Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...
Transcript of Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...
![Page 1: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/1.jpg)
c-Src-dependent Tyrosine Phosphorylation of IKKβ Is Involved in
TNF-α-induced Intercellular Adhesion Molecule-1 Expression
Wei-Chien Huang, Jun-Jie Chen, and Ching-Chow Chen
Department of Pharmacology, College of Medicine, National Taiwan University,
Taipei, 10018, Taiwan
Correspondence: Dr. Ching-Chow Chen
Department of Pharmacology
College of Medicine
National Taiwan University
No.1, Jen-Ai Road, 1st Section
Taipei 10018, Taiwan
Tel: +886-2-23123456 ext. 8321
Fax: +886-2-23947833
E-mail: [email protected]
The abbreviations used are: ICAM-1, intercellular adhesion molecule-1; IKK, IκB
kinase; NF-κB, nuclear factor κB; TNF, tumor necrosis factor; NIK, nuclear
factor-κB-inducing kinase; EMSA, electrophoretic mobility shift assay; GST,
glutathione S-transferase
1
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 2: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/2.jpg)
Abstract
The signaling pathway involved in tumor necrosis factor-α (TNF-α)-induced
intercellular adhesion molecule-1 (ICAM-1) expression was further studied in human
A549 epithelial cells. TNF-α- or TPA-induced ICAM-1 promoter activity was
inhibited by a protein kinase C (PKC) inhibitor (staurosporine), tyrosine kinase
inhibitors (genistein and herbimycin A), or a Src-specific tyrosine kinase inhibitor
(PP2). TNF-α− or TPA-induced IKK activation was also blocked by these inhibitors,
which slightly reversed TNF-α-induced, but completely reversed TPA-induced, IκBα
degradation. c-Src and Lyn, two members of the Src kinase family, were abundantly
expressed in A549 cells, and their activation by TNF-α or TPA was inhibited by the
same inhibitors. Furthermore, the dominant-negative c-Src (KM) mutant inhibited
induction of ICAM-1 promoter activity by TNF-α or TPA. Overexpression of the
constitutively active PKCα or wild-type c-Src plasmids induced ICAM-1 promoter
activity, this effect being inhibited by the dominant-negative c-Src (KM) or IKKβ
(KM) mutant, but not by the nuclear factor-κB-inducing kinase (NIK) (KM) mutant.
The c-Src (KM) mutant failed to block induction of ICAM-1 promoter activity caused
by overexpression of wild-type NIK. In co-immunoprecipitation and immunoblot
experiments, IKKβ was found to be associated with c-Src and to be phosphorylated
on tyrosine residues after TNF-α or TPA treatment. Two tyrosine residues, Tyr188
and Tyr199, near the activation loop of IKKβ were identified to be important for
NF-κB activation. Substitution of these residues with phenylalanines abolished
ICAM-1 promoter activity and c-Src-dependent phosphorylation of IKKβ
induced by TNF-α or TPA. These data suggest that, in addition to activating NIK,
TNF-α also activates PKC-dependent c-Src. These two pathways converge at IKKβ
and go on to activate NF-κB, via serine phosphorylation and degradation of IκB-α,
and, finally, to initiate ICAM-1 expression.
Running title: PKC-dependent c-Src activation in IKKβ activation
2
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 3: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/3.jpg)
Extravasation of leukocytes from the microvasculature at sites of inflammation
or injury is a critical event in inflammation-mediated diseases, such as rheumatoid
arthritis, psoriasis, bronchial asthma, atopic dermatitis, and allograft rejection (1–3).
The process of leukocyte migration includes several steps (4,5). The first of these is
adhesion of the leukocyte to the endothelial cell. The initial interaction between the
leukocyte and the endothelium is transient, resulting in the leukocyte rolling along the
vessel wall. The rolling leukocyte then become activated by local factors generated by
the endothelium, resulting in its arrest and firm adhesion to the vessel wall. Finally,
the leukocyte squeezes between the endothelial cells and migrates to the inflammation
site. These complex processes are regulated, in part, by specific adhesion molecules
and their counter ligands on both circulating leukocytes and vascular endothelial cells;
these include E-selectin (endothelial-leukocyte adhesion molecule-1, CD62E) and
immunoglobulin superfamily members, such as intercellular adhesion molecule-1
(ICAM-1, CD54) and vascular cell adhesion molecular-1 (VCAM) (6,7). As the
counter-receptor for leukocyte β2 integrin, LFA-1 and MAC-1, which promote the
adhesion and transendothelial migration of leukocytes, ICAM-1 plays a central role in
a number of inflammatory and immune responses (7-9). Similar processes govern the
adhesion of leukocytes to lung airway epithelial cells and contribute to the damage to
these cells seen in asthma (10).
Basal levels of ICAM-1 are low, but high expression can be induced in a number
of cell types by a wide range of ligands, including bacterial lipopolysaccharide (LPS),
phorbol esters, or inflammatory cytokines, such as tumor necrosis factor (TNF)-α,
interleukin (IL)-1β, and interferon (IFN)-γ (11-13). Induction of ICAM-1 expression
requires de novo mRNA and protein synthesis (8,14), indicating regulation at the
transcriptional level. The promoter region of the human ICAM-1 gene has been
cloned and sequenced, and shown to contain putative recognition sequences for a
variety of transcriptional factors, including nuclear factor-κB (NF-κB), activator
protein-1 (AP-1), AP-2, and the interferon-stimulated response element (ISRE) (15).
Of these, NF-κB family proteins are essential for the enhanced ICAM-1 gene
3
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 4: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/4.jpg)
expression seen in human alveolar epithelial cells on exposure to cytokines (16, 17).
The intracellular signaling pathways by which TNF-α and IL-1β cause ICAM-1
expression in A549 human alveolar epithelial cells have been explored and found to
involve the sequential activation of protein kinase Cα (PKCα), protein tyrosine kinase
(PTK), nuclear factor-κB-inducing kinase (NIK), and IκB kinaseβ (IKKβ) (16, 17).
The role of PTK has been further investigated in the present study. Using an
immunocomplex kinase assay and site-directed mutagenesis, we have demonstrated
that c-Src is involved in TNF-α-inducing NF-κB transcriptional activation and that, in
addition to serine phosphorylation of IKKβ by NIK, Tyr188 and Tyr199
phosphorylations by PKC-dependent c-Src activation also contribute to
TNF-α-induced ICAM-1 expression in human alveolar epithelial cells.
Experimental Procedures
Materials—Rabbit polyclonal antibodies specific for IκBα, IKKβ, c-Src, Lyn, Lck,
Fyn were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and rabbit
polyclonal anti-phosphotyrosine antibody was purchased from Upstate Biotechnology
(Lake Placid, NY). Human recombinant TNF-α was purchased from R&D Systems
(Minneapolis, MN). TPA was purchased from L.C. Service Corp (Worburn, MA).
Dulbecco’s modified Eagle medium (DMEM), fetal calf serum (FCS), penicillin, and
streptomycin were obtained from Life Technologies (Gaithersburg, MD).
Staurosporine, GST-agarose beads, and protein A-Sepharose were obtained from
Sigma (St. Louis, MO). Herbimycin A and PP2 were obtained from Calbiochem (San
Diego, CA). HRP-labeled donkey anti-rabbit second antibody and the enhanced
chemiluminescence (ECL) detecting reagent were obtained from Pharmacia Biotech
(Uppsala, Sweden). [γ-32P]ATP (3000 Ci/mmol) was obtained from DuPont-New
England Nuclear (Boston, MA). Tfx-50 and the luciferase assay kit were obtained
from Promega (Madison, MA). Plasmid purification and DNA recovery kits were
4
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 5: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/5.jpg)
obtained from Qiagen (Chatsworth, CA). The QuickchangeTM mutagenesis kit was
obtained from Strategene (La Jolla, CA). EcoRI, XboI, and SalI restriction enzymes
and T4 DNA ligase were obtained from NEB (Beverly, MA).
Cell culture—A549, a human alveolar epithelial cell carcinoma, were obtained from
the American Type Culture Collection (Manassas, VA) and cultured in DMEM
supplemented with 10% FCS, 100 U/ml of penicillin, and 100 µg/ml of streptomycin
in six-well plates for transfection experiments, in 6 cm dishes for IKK, c-Src, or Lyn
kinase activity measurements and Western blot analysis, or in 10 cm dishes for EMSA
and co-immunoprecipitation tests.
Plasmids—The ICAM-1 promoter construct (pIC339) was a gift from Dr. van der
Saag (Hubrecht Laboratory, Utrecht, Netherlands). The κB-luc plasmid was from
Stratagene. The PKC-α constitutively active (PKC-α/AE) or dominant negative
mutant (PKCα/KR) were provided by Dr. A. Altman (La Jolla Institute for Allergy
and Immunology, San Diego, CA). The wild-type (wt) and dominant-negative
mutants of NIK and IKKβ (NIK wt and mutant KA; IKKβ wt and mutant KM) were
gifts from Signal Pharmaceuticals (San Diego, CA). The dominant negative mutant of
IKKβ (AA) was from Dr. Karin (UCSD, CA). pGEX-IκBα (1-100) was a gift from Dr.
Nakano (University of Juntendo, Tokyo). pGEX-IKKβ (132-206) was a gift from Dr.
Nakanishi (University of Nagoya, Nagoya).
Immunoprecipitation and kinase activity assay—Following treatment with TNF-α or
TPA, with or without 30 min pretreatment with PKC, tyrosine kinase, or Src kinase
inhibitors, the cells were rapidly washed with PBS and lysed with ice-cold lysis buffer
(50 mM Tris-HCl, pH 7.4, 1 mM EGTA, 150 mM NaCl, 1% Triton X-100, 1 mM
PMSF, 5 µg/ml of leupeptin, 20 µg/ml of aprotinin, 1 mM NaF, and 1 mM Na3VO4),
then IKK, c-Src, or Lyn was immunoprecipitated. For the in vitro kinase assay, 100
µg of total cell extract was incubated for 1 h at 4°C with 0.5 µg of rabbit anti-IKKβ,
5
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 6: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/6.jpg)
anti-c-Src, or anti-Lyn Ab, then protein A-Sepharose CL-4B beads (Sigma) were
added to the mixture and incubation continued for 4 h at 4°C. The immunoprecipitates
were collected by centrifugation, washed three times with lysis buffer without Triton
X-100, then incubated for 30 m 30°C in 20 µl of kinase reaction mixture (20 mM
HEPES, pH 7.4, 5 mM MgCl2, 5 mM MnCl2, 0.1 mM Na3VO4, 1 mM DTT)
containing 10 µM [γ-32P]ATP and either 1 µg of bacterially expressed GST-IκBα
(1-100) as IKK substrate, 1 µg of acidic denatured enolase as c-Src or Lyn substrate
or 6 ug of bacterially expressed GST-IKKβ(132-206), GST-IKKβ(132-206) (Y188F),
GST-IKKβ(132-206) (Y199F) or GST-IKKβ(132-206) (Y188F; Y199F) as c-Src
substrate. The reaction was stopped by addition of an equal volume of Laemmli buffer,
the proteins separated by electrophoresis on 10% SDS polyacrylamide gels, and
phosphorylated-GST-IκBα (1-100), phosphorylated-GST-IΚΚβ (132-206) or
phosphorylated-enolase visualized by autoradiography. Quantitative data were
obtained using a computing densitometer and ImageQuant software (Molecular
Dynamics, Sunnyvale, CA).
Western blot analysis—Following treatment with TNF-α or TPA, total or
immunoprecipitated cell lysates were prepared and subjected to SDS-PAGE using
7.5% running gels, as described previously (17). The proteins were transferred to a
nitrocellulose membrane, which was then incubated successively at room temperature
for 1 h with 0.1% milk in TTBS (50 mM Tris-HCl, pH 7.5, 0.15 M NaCl, and 0.05%
Tween-20), for 1 h with rabbit antibody specific for IKKβ, IκBα, c-Src, Lyn, Lck, or
Fyn, and for 30 min with HRP-labeled anti-rabbit antibody. After each incubation, the
membrane was washed extensively with TTBS. The immunoreactive bands were
detected using ECL detection reagent and Hyperfilm-ECL (Amersham International).
Preparation of nuclear extracts and the electrophoretic mobility shift assay
(EMSA)—Control cells or cells pretreated with various inhibitors for 30 min were
treated with TNF-α for 10 min or with TPA for 30 min, then nuclear extracts were
6
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 7: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/7.jpg)
isolated as described previously (17). Briefly, cells were washed with ice-cold PBS
and pelleted, then the cell pellet was resuspended in a hypotonic buffer (10 mM
HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM
PMSF, 1 mM NaF, and 1 mM Na3VO4) and incubated for 15 min on ice, then lysed by
the addition of 0.5% NP-40 followed by vigorous vortexing for 10 s. The nuclei were
pelleted and resuspended in extraction buffer (20 mM HEPES, pH 7.9, 400 mM NaCl,
1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 1 mM NaF, and 1 mM
Na3VO4), and the tube vigorously shaken at 4°C for 15 min on a shaking platform.
The nuclear extracts were then centrifuged and the supernatants aliquotted and stored
at -80°C.
Oligonucleotides corresponding to the downstream NF-κB consensus sequence
(5'-AGCTTGGAAATTCCGGA-3') in the human ICAM-1 promoter were
synthesized, annealed, and end-labeled with [γ-32P]ATP using T4 polynucleotide
kinase. The nuclear extract (6-10 µg) was incubated at 30°C for 20 min with 1 ng of 32P-labeled NF-κB probe (40,000-60,000 cpm) in 10 µl of binding buffer containing
1 µg of poly(dI-dc), 15 mM HEPES, pH 7.6, 80 mM NaCl, 1 mM EGTA, 1 mM DTT,
and 10% glycerol as described previously (17). DNA/nuclear protein complexes were
separated from the DNA probe by electrophoresis on a native 6% polyacrylamide gel,
then the gel was vacuum-dried and subjected to autoradiography using an intensifying
screen at -80°C.
Site-directed mutagenesis—Using a QuickchageTM site-directed mutagenesis kit
according to the manufacturer's manual, lysine (K) 295 in the mouse c-Src cloned in
the pBluescript vector was substituted with methionine (M) by changing the triplets
from AAG to ATG. Tyrosine (Y)199, tyrosine 188 or both sites in the human IKKβ
cloned in the pcDNA3.1 vector, or in the human GST-IKKβ(132-206) cloned in the
pGEX vector was substituted with phenylalanine (F) by change the triplet from TAC
to TTC. The mutated primers used were primer 1
(5'-CGAGGGTTGCCATCATGACTCTGAAGCCAGGCA-3') and primer 2
7
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 8: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/8.jpg)
(3'-GCTCCCAACGGTAGTACTGAGACTTCGGTCCGT-5') for c-Src (K295M)
mutation, primer 3 (5’−GGGGACCCTGCAGTTCCTGGCCCCAGAGC−3’) and
primer 4 (3’−CCCCTGGGACGTCAAGGACCGGGGTCTCG−5’) for IKKβ
(Y188F) mutation, and primer 5 (5’−GGAGCAGCAGAAGTTCACAGTGAC
-CGTCG−3’) and primer 6 (3’−CCTCGTCGTCTTCAAGTGTCACTGGCAGC−5’)
for IKKβ (Y199F) mutation. DNA prepared from overnight cultures of picked
colonies using Miniprep (Qiagen) was subjected to restriction digest analysis and the
nucleotide changes confirmed by DNA sequencing. The mutated c-Src plasmid
containing the point mutation was digested with EcoRI and XhoI and inserted into the
pcDNA3(+) vector.
Transient transfection and luciferase assay—A549 cells, grown to 50% confluent in
six-well plates, were transfected with the human ICAM-1(pIC-339/0)/firely luciferase
(Luc) or κB-luc plasmid using Tfx-50 (Promega) according to the manufacturer's
recommendations. Briefly, reporter DNA (0.4 µg) and β-galactosidase DNA (0.2 µg;
plasmid pRK containing the β-galactosidase gene driven by the constitutively active
SV40 promoter, used to normalize the transfection efficiency were mixed with 0.6 µl
of Tfx-50 in 1 ml of serum-free DMEM. After 10-15 min incubation at room
temperature, the mixture was applied to the cells, then, 1 h later, 1 ml of complete
growth medium was added. On the following day, the medium was replaced with
fresh medium. Forty-eight hours after transfection, the cells were treated with
inhibitors (as indicated) for 30 min, then TNF-α or TPA was added for 6 h. Cell
extracts were then prepared and luciferase and β-galactosidase activities measured,
the luciferase activity being normalized to the β-galactosidase activity. In experiments
using dominant-negative mutants, cells were co-transfected with reporter (0.2 µg) and
β-galactosidase (0.1 µg) and either the dominant-negative NIK, IKKβ, or c-Src
mutant or the respective empty vector (0.4 µg).
In experiments using wt plasmids, cells were co-transfected with 0.2 µg of
reporter plasmid, 0.1 µg of β-galactosidase plasmid, 0.4 µg of the constitutively active
8
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 9: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/9.jpg)
PKCα (A/E) plasmid, wt c-Src or NIK plasmid, or the respective empty vector, and
0.4 µg of the dominant-negative NIK, IKKβ, or c-Src mutant or the respective empty
vector.
Co-immunoprecipitation assay—Cell lysates containing 1 mg of protein were
incubated for 1 h at 4°C with 2 µg of anti-IKKβ or anti-c-Src Ab or with 4 µg of
anti-phosphotyrosine Ab, then 50 µl of 50% protein A-agarose beads were added and
mixed for 16 h at 4°C. The immunoprecipitates were collected and washed three times
with lysis buffer without Triton X-100, then Laemmli buffer was added and the
samples subjected to electrophoresis on 10% SDS polyacrylamide gels. Western blot
analysis was performed as described above using antibodies against phosphotyrosine,
IKKβ, or c-Src.
RESULTS
Effect of inhibitors of PKC, tyrosine kinase, or Src kinase on the induction of ICAM-1
promoter activity by TNF-α or TPA in A549 Cells—In our previous study (17), we
found that PKC and tyrosine kinase were involved in TNF-α–induced ICAM-1
expression. Transient transfection using the ICAM-1 promoter-luciferase construct,
pIC-339 (-339/0) was performed to elucidate the signaling pathway mediated by these
kinases. The pIC-339 construct contains the downstream NF-κB site (-189/-174)
responsible for mediating the induction of ICAM-1 promoter activity by TNF-α or
TPA (17). As shown in Figure 1, TNF-α led to a 2.9-fold increase in ICAM-1
promoter activity. When cells were pretreated with inhibitors of PKC (staurosporine),
tyrosine kinases (genistein or herbimycin A), or Src kinases (PP2), the
TNF-α-induced increase was inhibited by 69%, 84%, 65%, or 66%, respectively. TPA,
a direct PKC activator, resulted in a 3.5-fold increase in ICAM-1 promoter activity,
and this effect was inhibited by genistein, herbimycin A, or PP2 by 74%, 60% or 87%,
respectively. None of these inhibitors alone affected the basal luciferase activity (data
9
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 10: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/10.jpg)
not shown).
Induction of IKK activation, IκBα degradation, and NF-κB-specific DNA-protein
complex formation by TNF-α and TPA, and the inhibitory effect of inhibitors of PKC,
tyrosine kinase, or Src kinase—Since TNF-α- and TPA-induced ICAM-1 promoter
activity in A549 cells is inhibited by the dominant-negative IKKβ mutant (17),
endogenous IKK activity was measured by immunoprecipitation with anti-IKKβ
antibody. When cells were treated with 10 ng/ml of TNF-α for 5, 10, 30, or 60 min,
maximal IKK activity was seen after 5 min (Fig. 2A), while maximal degradation of
IκB-α was seen after 10 min, IκB-α levels being restored to the resting level after 1 h
of treatment (Fig. 2B). In TPA-treated cells, maximal IKK activity was seen after 30
min of treatment (Fig 2A), whereas maximal IκB-α degradation was seen after 60
min (Fig 2B). The TNF-α-induced IKK activation was inhibited by a PKC, tyrosine
kinase, or Src kinase inhibitor by 56%, 49%, or 50%, respectively, while these same
inhibitors suppressed TPA-induced IKK activation by 71%, 91%, or 90%,
respectively (Fig. 3A). The IκBα degradation induced by TPA was reversed by PKC,
tyrosine kinase, and Src kinase inhibitors, but that induced by TNF-α was only
slightly affected by these inhibitors (Fig 3B). The effect of these inhibitors on TNF-α-
or TPA-induced NF-κB specific DNA-protein binding was examined. As shown in
Fig 3C, when cells were treated with TNF-α for 10 min, increased NF-κB-specific
DNA-protein binding was seen, and this effect was inhibited by PKC, tyrosine kinase,
and Src kinase inhibitors by 20%, 51%, and 48%, respectively. TPA treatment for 30
min also increased NF-κB specific DNA-protein binding and this was more
effectively suppressed by these inhibitors (75%, 74%, and 87%, respectively; Fig.
3C).
Induction of c-Src and Lyn activation by TNF-α and TPA, and the inhibitory effect of
inhibitors of PKC, tyrosine kinase, or Src kinase—TNF-α- or TPA-induced IKK
activation was inhibited by PKC, tyrosine kinase, and Src kinase inhibitors, indicating
10
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 11: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/11.jpg)
the involvement of tyrosine kinase, or at least the Src family, downstream of PKC in
the induction of IKK activation. To further characterize the tyrosine kinase involved,
Western blot analysis using antibodies against the Src family members, c-Src, Lck,
Lyn, and Fyn, was performed. Since c-Src is reported to be expressed in platelets and
neuronal tissues, Lck in T lymphocytes, Lyn at high levels in platelets, and Fyn in the
brain and T lymphocytes, we used the Jurkat T cell line, the HL-60 promyelocytic cell
line, and brain as positive controls. As shown in Fig. 4A, c-Src was abundantly
expressed in brain, in Jurkat and HL-60 cells, and in the human alveolar epithelial cell
lines, NCI-H292 and A549. Lck was abundantly expressed in brain and Jurkat cells,
but only weakly expressed in NCI-H292 and A549 cells. Lyn was abundantly
expressed in brain and in Jurkat, HL-60, NCI-H292, and A549 cells, while Fyn was
only expressed in brain and in Jurkat and HL-60 cells. c-Src and Lyn in A549 cells
were therefore isolated by immunoprecipitation using anti-c-Src or anti-Lyn antibody
and their in vitro kinase activity measured using enolase as substrate. As shown in Fig.
4B, when A549 cells were treated with 10 ng/ml of TNF-α for 10, 30, or 60 min,
maximal c-Src and Lyn activity (enolase phosphorylation) was seen after 10 min and
was maintained to 60 min. In addition, marked autophosphorylation of c-Src and Lyn
was seen over the same time period. TPA (1 µM) also induced c-Src and Lyn
activation after 30 min treatment of A549 cells (Fig. 5). The TNF-α- and
TPA-induced activation of c-Src and Lyn was inhibited by staurosporine, herbimycin
A, and PP2 (Fig. 5).
Induction of ICAM-1 promoter activity by overexpression of PKCα or c-Src and the
inhibitory effect of dominant-negative mutants of c-Src or IKKβ —Since the TNF-α-
or TPA-induced activation of c-Src and Lyn was inhibited by PKC, tyrosine kinase, or
Src kinase inhibitors, this indicated that PKC-dependent c-Src and Lyn activation was
required to induce IKK and NF-κB activation in A549 cells. To further examine the
involvement of c-Src, a dominant-negative mutant was generated by site-directed
mutagenesis of mouse c-Src lysine (K) 295 to methionine (M). Overexpression of
11
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 12: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/12.jpg)
c-Src (KM) attenuated the TNF-α- or TPA-induced ICAM-1 promoter activity (Fig.
6). The TNF-α-induced ICAM-1 promoter activity was also inhibited by the
dominant-negative NIK (KA) and IKKβ (KM) mutants, as previously reported (17).
In order to characterize the relationship between PKC, c-Src, NIK, and IKKβ,
overexpression of the constitutively active form of PKCα (A/E) or of wt c-Src, NIK,
or IKKβ was performed. Overexpression of PKCα (A/E) or wt c-Src, NIK, or IKKβ
significantly increased ICAM-1 promoter activity by 2-, 2.7-, 3.4-, or 2.5-fold,
respectively (Fig. 7A). The ICAM-1 promoter activity induced by overexpression of
PKCα (A/E) or c-Src wt was inhibited by the dominant-negative c-Src (KM) or IKKβ
(KM) mutant, but not by the NIK (KA) mutant. In contrast, the dominant-negative
IKKβ (KM) mutant, but not the c-Src (KM) mutant attenuated the promoter activity
induced by overexpression of NIK wt (Fig. 7B). These results indicate the
involvement of both the PKC/c-Src/IKKβ and NIK/IKKβ pathways in
TNF-α-induced ICAM-1 expression in A549 cells.
Induction by TNF-α or TPA of tyrosine phosphorylation of IKKβ and of the c-Src and
IKKβ association, and the inhibitory effect of PP2—Since c-Src-dependent IKK
activation was shown to be involved, co-immunoprecipitation of c-Src and IKKβ was
performed to examine whether c-Src directly regulates IKK activity through
phosphorylation of tyrosine residues. When cells were treated with TNF-α for 5, 10,
or 15 min, IKKβ was tyrosine-phosphorylated in a time-dependent manner, the
maximal effect being seen at 10 min; a similar effect was seen after 30 min treatment
with TPA (Fig. 8A). Both effects were inhibited by PP2 (Fig 8A). To demonstrate that
c-Src associated with IKKβ and phosphorylated its tyrosine residues, cell lysates
were immunoprecipitated with anti-IKKβ antibodies, then the immunoprecipitates
were separated by SDS-PAGE, transferred to membranes, and blotted with
anti-phosphotyrosine antibodies. As shown in Fig. 8B, tyrosine phosphorylation of
IKKβ was seen after TNF-α or TPA treatment, the effect being maximal at 10 or 30
min, respectively, and inhibited by PP2. When cell lysates were immunoprecipitated
12
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 13: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/13.jpg)
with anti-phosphotyrosine antibody and immunoblotted with anti-IKKβ or
anti-c-Src antibody, both IKKβ and c-Src were shown to be tyrosine-phosphorylated
after TNF-α or TPA treatment, and these effects were again inhibited by PP2 (Fig.
8C). These results indicate that c-Src can associate with IKKβ and phosphorylate its
tyrosine residues after TNF-α or TPA stimulation. The association between c-Src and
IKK was further examined. Anti-IKKβ antibody was used to precipitate IKK from
A549 cells, then the immunoprecipitated proteins were subjected to Western blotting
using anti-c-Src antibody. As shown in Fig. 9A, an increased amount of c-Src
co-precipitated with IKKβ after TNF-α or TPA stimulation. In the converse
experiment in which c-Src was precipitated using anti-c-Src antibody, IKKβ was
shown to be associated with c-Src in a time-dependent manner after TNF-α or TPA
treatment (Fig. 9B). These results show an association between c-Src and IKKβ and
that IKKβ tyrosine residues were phosphorylated.
Inhibitory effect of the dominant-negative mutants, IKKβ (Y188F), IKKβ (Y199F) or
IKKβ (FF), on TNF-α- and TPA-induced ICAM-1 promoter activity and on the
PKCα- and c-Src-induced, but not the NIK-induced, increase in NF-κB activity—The
above experiments demonstrated that c-Src could directly interact with IKKβ and
phosphorylate its tyrosine residues after TNF-α or TPA stimulation. When the amino
sequences of subdomain VII and VIII in the kinase domain of PKCδ, AKT1 and
IKKα/β were aligned, the tyrosine residues were found to be conserved (Fig. 9C).
Hypothesizing that Tyr188 and/or Tyr199 of IKKβ were the targets for c-Src
phosphorylation after TNF-α or TPA stimulation, we used site-directed mutagenesis
to generate the dominant-negative tyrosine mutants, IKKβ (Y188F), IKKβ (Y199F)
and IKKβ (Y188F, Y199F). Overexpression of these mutants attenuated the TNF-α-
or TPA-induced ICAM-1 promoter activity, the double mutant having a greater
inhibitory effect than either of the single mutants (Fig. 10A). The dominant-negative
IKKβ (KM) mutant, with Lys44 mutated to methionine, had a similar inhibitory effects
to IKKβ (Y188F) or IKKβ (Y199F) on TNF-α- and TPA-induced ICAM-1 promoter
13
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 14: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/14.jpg)
activity, while IKKβ (AA), with Ser177 and Ser181 mutated to alanine, was as effective
as IKKβ (Y188F) or IKKβ (Y199F) in inhibiting TNF-α-induced ICMA-1 promoter
activity, but had no effect on TPA-induced ICAM-1 promoter activity (Fig. 10A).
To further confirm the involvement of tyrosine phosphorylation in
PKCα/c-Src/IKKβ pathway and serine phosphorylation in NIK/IKKβ pathway, the
dominant-negative IKKβ mutants with either a tyrosine or serine mutation were
co-transfected with PKCα (A/E), wt c-Src or wt NIK to examine their inhibitory
effects on the constitutively active or wt plasmid-induced NF-κB activity. As shown
in Fig. 10B, PKCα (A/E)- or wt c-Src-induced NF-κB activity was inhibited by all
three tyrosine mutants, but not by the double serine mutant, whereas the converse was
true for NIK-induced NF-κB activity.
Since Tyr188 and Tyr199 in IKKβ were found to be critical for the
PKCα/c-Src/IKKβ pathway to elicit NF-κB activation, leading to induction of TNF-α-
or TPA-stimulated ICAM-1 promoter activity (Fig. 10), endogenous c-Src
phosphorylation of Tyr188 and Tyr199 in IKKβ was further examined. c-Src was
immunoprecipitated using anti-c-Src antibody and its ability to phosphorylate IKKβ
measured using GST-IKKβ (132-206) as an in vitro substrate. When cells were
treated with TNF-α or TPA, IKKβ was phosphorylated by c-Src in a time-dependent
manner. The maximal effect was seen at 10 min treatment with TNF-α or 30 min
treatment with TPA (Fig. 11A), and both effects were inhibited by PP2 (Fig. 11B).
The c-Src-dependent IKKβ phosphorylation was specific for Tyr188/Tyr199, as it was
not seen when either or both tyrosine residues were substituted with phenylalanines
(Fig 11C).
DISCUSSION
The PKC-dependent tyrosine kinase activation pathway is involved in
TNF-α-induced NF-κB activation and ICAM-1 expression in A549 alveolar epithelial
cells and in causing monocytes to adhere to these cells (17). The role and molecular
identity of the tyrosine kinase involved have been further characterized in the present
14
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 15: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/15.jpg)
study. TNF-α- and TPA-induced ICAM-1 promoter activity were both inhibited by
PKC, tyrosine kinase, and Src kinase inhibitors, indicating the possible involvement
of the Src tyrosine kinase family downstream of PKC activation in the induction of
ICAM-1 expression. IKKβ, but not IKKα, is involved in the TNF-α- and TPA-induced
ICAM-1 promoter activity (17), and TNF-α- or TPA-induced stimulation of IKK
activity and parallel degradation of IκB-α was seen in the present study. The TNF-α-
and TPA-induced IKK activity and NF-κB specific DNA-protein binding were
attenuated by PKC, tyrosine kinase, and Src kinase inhibitors, indicating that the Src
tyrosine kinase family is involved downstream of PKC in the induction of IKKβ
activation leading to NF-κB activation and ICAM-1 expression in A549 cells.
Western blot analysis showed that c-Src and Lyn were abundantly expressed in A549
cells and that TNF-α and TPA induced activation of these two Src tyrosine kinases.
The c-Src and Lyn activation induced by either stimulus was also inhibited by PKC,
tyrosine kinase, and Src kinase inhibitors. Taken together, these results demonstrate
that the tyrosine kinase involved downstream of PKC is c-Src or Lyn. The
involvement of PKC/c-Src/IKKβ activation in TNF-α-induced ICAM-1 expression
was confirmed by the finding that the dominant-negative c-Src (KM) mutant
attenuated the TNF-α- and TPA-induced ICAM-1 promoter activity.
In nonstimulated cells, NF-κB dimers are present as cytoplasmic latent
complexes due to the binding of specific inhibitors, the IκBs, which mask their
nuclear localization signal. Following stimulation by proinflammatory cytokines, the
IκBs are rapidly phosphorylated at two conserved NH2-terminal serine residues and
this posttranslational modification is rapidly followed by their polyubiquitination and
proteasomal degradation (18, 19). This results in the unmasking of the nuclear
localization signal in NF-κB dimers, followed by their translocation to the nucleus,
binding to specific DNA sites (κB sites), and targeting of gene activation. The protein
kinase that phosphorylates IκBs in response to proinflammatory stimuli has been
15
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 16: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/16.jpg)
identified biochemically and molecularly (20-24). Named IKK, it exists as a complex,
termed the IKK signalsome, which is composed of at least three subunits, IKKα
(IKK1), IKKβ (IKK2), and IKKγ (25). IKKα and IKKβ are very similar protein
kinases that act as the catalytic subunits of the complex (20-24). In mammalian cells,
IKKα and IKKβ form a stable heterodimer that is tightly associated with IKKγ, a
regulatory subunit (26). The IKKs bind NIK (22, 23), a member of the MAPK kinase
kinase family, that interacts with the TRAF6-associated IL-1 receptor complex or
TRAF2-associated TNF receptor complex, thereby linking IκB degradation and
NF-κB activation to IL-1β or TNF-α stimulation (27). The activities of both IKKα
and IKKβ are reported to be regulated by NIK (28). Our results showed that the
TNF-α-induced increase in ICAM-1 promoter activity was inhibited by the
dominant-negative NIK (KA) and IKKβ (KM), but not IKKα (KM) mutants (Fig. 6;
17). The dominant-negative IKKβ (KM) mutant attenuated wt NIK-induced ICAM-1
promoter activity, indicating the involvement of NIK/IKKβ pathway in
TNF-α-induced ICAM-1 expression.
To elucidate the relationship between the PKC/c-Src/IKKβ and NIK/IKKβ
pathways in TNF-α-induced ICAM-1 expression, overexpression of a constitutively
active PKCα plasmid and the wt c-Src, NIK, and IKKβ plasmids was used. These
plasmids all induced increase in ICAM-1 promoter activity, and their effects were
blocked by the dominant-negative IKKβ (KM) mutant. The effect of the constitutively
active PKCα (A/E) was blocked by the dominant-negative c-Src (KM) mutant, but
not by the NIK (KA) mutant. The effect of the wt c-Src plasmid on ICAM-1 promoter
activity was not affected by the dominant-negative NIK (KA) mutant, neither that of
the wt NIK plasmid was affected by the dominant-negative c-Src (KM) mutant (Fig.
7B). These results show that the PKC/c-Src/IKKβ and NIK/IKKβ pathways function
in parallel in the TNF-α-mediated induction of ICAM-1 expression in A549 cells. The
16
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 17: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/17.jpg)
existence of these two pathways explains why inhibitors of PKC, tyrosine kinases, or
Src kinase could reverse TPA-, but not TNF-α-, induced IκB-α degradation, since
TNF-α could still act via the NIK/IKKβ pathway in the presence of these inhibitors.
c-Src is involved in NF-κB activation in bone marrow macrophages, U937 cells,
and B cells (29-31). In bone marrow macrophages, TNF-α induces activation of c-Src,
which associates with IκB-α and phosphorylates Tyr42 of IκB-α, leading to NF-κB
activation and IL-6 release (29). In contrast to the rapid degradation of
serine-phosphorylated IκB-α (32), tyrosine-phosphorylated IκB-α is not subject to
rapid proteolysis (29, 33). In the present study of TNF-α-induced ICAM-1 expression,
the downstream target of c-Src was IKKβ and rapid degradation of IκB-α was seen
(Fig. 2B). Involvement of a tyrosine kinase upstream of IKK activation has also been
reported in CD23 signaling in U937 cells (30) and in B cell antigen receptor
stimulation (31). A similar PKC-dependent c-Src activation pathway has been found
in human osteoblasts, in which FGF-2 increases N-cadherin expression, in A7r5
vascular smooth muscle cells, in which TPA induces Rho-dependent actin
reorganization, and in SH-SY5Y neuroblastoma cells, in which TPA induces Cas-Crk
complex formation (34-36). Furthermore, the PKC/c-Src/IKK pathway, here shown to
be involved in induction of ICAM-1 expression, might be a common signaling
pathway for inducible gene expression, as TNF-α-, IL-1β-, or IFN-γ-induced COX-2
or ICAM-1 expression in human alveolar epithelial cells also involves
PKC-dependent activation of c-Src or Lyn (16, 37, 38 and our unpublished data).
Since involvement of the PKC/c-Src/IKKβ pathway had been demonstrated,
tyrosine phosphorylation of IKKβ by c-Src was further examined. Several lines of
evidence show that this occurred. Firstly, in both crude cell lysates and
immunoprecipitates formed using anti-IKKβ antibody, IKKβ was found to be
tyrosine-phosphorylated after TNF-α or TPA stimulation. Secondly, in
immunoprecipitates formed using anti-phosphotyrosine antibody, both IKKβ and
17
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 18: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/18.jpg)
c-Src were tyrosine-phosphorylated after treatment with TNF-α or TPA. Thirdly, all
these effects were inhibited by PP2. Fourthly, using either immunoprecipitation with
anti-IKKβ antibody followed by blotting with anti-c-Src antibody or
immunoprecipitation with anti-c-Src antibody followed by blotting with anti-IKKβ
antibody, an association between c-Src and IKKβ was demonstrated and shown to be
increased after TNF-α or TPA treatment. Fifthly, an in vitro kinase assay
demonstrated that c-Src directly phosphorylated IKKβ at Tyr188 and Tyr199. IKKβ is a
Thr/Ser kinase and phosphorylation of Ser177 and Ser181 in the kinase domain is
necessary for its activation, since substitution of these two residues with alanines
reduces IKKβ activity and leads to reduced Rel A nuclear translocation and
NF-κB-dependent gene expression (21, 39). MEKK1 and NIK are reported to
phosphorylate these two serine residues (40). The present experiments further
demonstrated Tyr188 and Tyr199 phosphorylation by c-Src via a PKC-dependent
activation pathway. This tyrosine phosphorylation of IKKβ was essential for
TNF-α-induced ICAM-1 expression in A549 cells, since the dominant-negative
mutants, IKKβ (Y188F), IKKβ (Y199F) or IKKβ (FF), abrogated the effects of both
TNF-α and TPA. Tyrosine phosphorylation of Thr/Ser kinases, such as PKCs and Akt,
has also been reported to be important for their activation (41, 42). Akt activation by
extracellular stimuli is a multistep process involving translocation and
phosphorylation. Two phosphorylation sites, Thr308 and Ser473, have been shown to be
critical for growth factor-induced activation of Akt (43-45). In addition to the
phosphorylation of these two sites, tyrosine phosphorylation plays an important role
in regulation of Akt activity. Both the EGF-induced tyrosine phosphorylation and
kinase activity of Akt are blocked by PP2, and Src phosphorylates Tyr315 and Tyr326 of
Akt both in vivo and in vitro (41). It is noteworthy that these tyrosine residues are
conserved in about 50% of Ser/Thr kinases and that phosphorylation of the
corresponding residues, Tyr512 and Tyr523, in PKCδ is also critical for PKCδ activation
in response to H2O2 (42). Phosphorylation of the two conserved tyrosine residues in
the kinase domains of Ser/Thr kinases may therefore be a general mechanism by
18
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 19: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/19.jpg)
which Akt, PKCδ, and IKKβ are regulated (41, 42, and present study; Fig. 9C). The
Src tyrosine kinase family therefore directly regulates IKKβ activity via
phosphorylation at Tyr188 and Tyr199, rather than solely by NIK-mediated
phosphorylation at Ser177 and Ser181, as previously suggested (27). Three findings
further support the notion that PKC/c-Src/IKKβ pathway induces tyrosine
phosphorylation, while the NIK/IKKβ pathway induces serine phosphorylation.
Firstly, NF-κB activity induced by PKCα (A/E) or wt c-Src was inhibited by the
tyrosine mutants, IKKβ (Y188F), IKKβ (Y199F), or IKKβ (FF), but not by IKKβ
(AA), in which Ser177 and Ser181 are mutated. Secondly, wt NIK-induced NF-κB
activity was inhibited by IKKβ (AA), but not by IKKβ (Y188F), IKKβ (Y199F), or
IKKβ (FF) (Fig. 10B). Thirdly, TPA-induced ICAM-1 promoter activity was not
affected by IKKβ (AA) (Fig. 10A). Our data demonstrate, for the first time, that, in
addition to phosphorylation of Ser177 and Ser181, Tyr188 and Tyr199 phosphorylation of
IKKβ is required for its full activation and biological functions.
In summary, the signaling pathways involved in TNF-α-induced ICAM-1
expression in A549 cells have been further explored. In addition to activating the
NIK/IKKβ pathway, TNF-α activates the PKC-dependent c-Src pathway. These two
pathways converge at IKKβ, and are, respectively, responsible for phosphorylation of
Ser177/Ser181 and Tyr188/Tyr199 of IKKβ, then go on to activate NF-κB, via serine
phosphorylation and degradation of IκB-α, then, finally, initiate of ICAM-1
expression. A schematic diagram showing the involvement of these two pathways in
TNF-α –induced ICAM-1 expression in A549 epithelial cells is shown in Fig. 12.
Acknowledgement: This work was supported by a research grant from the National
Science Council of Taiwan.
REFERENCES
1. Springer, T.A. (1990) Nature 346, 425–434.
2. Wegner, C.D., Gundel, R.H., Reilly, P., Haynes, N., Letts, L.G., and Rothlein, R.
19
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 20: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/20.jpg)
(1990) Science 247, 456–459.
3. Isobe, M., Yagita, H., Okmura, A.K., and Ihara, A. (1992) Science 255,
1125–1127.
4. Springer, T.A. (1994) Cell 76, 301–314.
5. Carlos, T., Kovach, N., Rosa, M., Newman, B., Wayner, E., Benjamin, C.,
Osborn, L., Lobb, R., and Harlan, J. (1991) Blood 77, 2266–2271.
6. Osborn, L., Hession, C., Tizard, R., et al. (1989) Cell 59, 1203-1211.
7. Dustin, M.L., and Springer, T.A. (1988) J. Cell Biol. 107, 321-331.
8. Smith, C.W., Marlin, S.D., Rothlein, R., Toman, C., and Anderson, D.C. (1989) J.
Clin. Invest. 83, 2008-2017.
9. Staunton, D.E., Marlin, S.D., Stratowa, C., Dustin, M.L., and Springer, T.A.
(1988) Cell 52, 925-933.
10. Bloemen, P.G., Van Den Tweel, M.C., Henricks, P.A. J., Engel, F., Wagenaar,
S.E., Rutten A.A.J.J.L., and Nijkamp, F.P. (1993) Am. J. Respir. Cell Mol. Biol.
9, 586–593
11. Tosi, M.F., Stark, J.M., Smith, C.W., Hamedani, A., Gruenert, D.C., and Infeid,
M.D. (1992) Am. J. Respir. Cell. Mol. Biol. 7, 214-221.
12. Pobers, J.S., Gimbrone, M.A., Lapierre, L.A., Mendrick, D.L., Fiers, W.,
Rothelein, R., and Springer, T.A. (1986) J. Immunol. 137, 1893-1896.
13. Lane, T.A., Lamkin, G.E., and Wancewicz, E. (1989) Biochem. Biophys. Res.
Commun. 161, 945-952.
14. Wertheimer, S.J., Myers, C.L., Wallace, R.W. and Park, T.P. (1992) J. Biol. Chem.
267, 12030-12035.
15. Voraberger, G., Shafer, R. and Stratowa, C. (1991) J. Immunol. 147, 2777-2786.
16. Chen, C.C., Chen, J.J., and Chou, C.Y. (2000) Mol. Pharmacol. 58, 1479-1489.
17. Chen, C.C., Chou, C.Y., Sun, YT and Huang, W.C. (2001) Cell. Signal. 13,
543-553.
18. Thanos, D., and Maniatis, T. (1995) Cell 80, 529-531.
19. Chen, Z.J., Parent, L., and Maniatis, T. (1996) Cell 84, 853-862.
20
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 21: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/21.jpg)
20. DiDonato, J.A., Hayakawa, M., Rothwarf, D.M., Zandi, E., and Karin, M. (1997)
Nature 388, 548-554.
21. Mercurio, F., Zhu, H., Murry, B.W., Shevchenko, A., Bennett, B.L., Li, J.W.,
Young, D.M., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997) Science
278, 860-866.
22. Regnier, C.H., Song, H.Y., Gao, X., Goeddel, D.V., Cao, Z., and Rothe, M.,
(1997) Cell 90, 373-383.
23. Woronicz, J.D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D.V. (1997) Science
278, 866-869.
24. Zandi, E., Rothwarf, D.M., Delhase, M., Hayakawa, M., and Karin, M. (1997)
Cell 91, 243-252.
25. Zandi, E., and Karin, M. (1999) Mol. Cell. Biol. 19, 4547-4551.
26. Rothwarf, D.M., Zandi, E., Natoli, G., and Karin, M. (1998) Nature 395,
297-300.
27. Malinin, N.L., Boldin, M.P., Rovalenko, A.V., and Wallach, D. (1997) Nature
385, 540-544.
28. Nakano, H., Shindo, M., Sakon, S., Nishinaka, S., Mihara, M., Yagita, H., and
Okumura, K. (1998) Proc. Natl. Acad. Sci. 95, 3537-3542.
29. Abu-Amer, Y., Ross, F.P., McHugh, K.P., Livolsi, A., Peyron, J.F., and
Teitelbaum, S.L. (1998) J. Biol. Chem. 273, 29417-29423.
30. Ten, R.M., McKinstry, M.J., Trushin, S.A., Asin, S., and Paya, C.V. (1999) J.
Immunol. 163, 3851-3857.
31. Petro, J.B., Rahman, S.M., Ballard, D.W., and Khan, W.N. (2000) J. Exp. Med.
191, 1745-1754.
32. Baldwin AS. (1996) Annun. Rev. Immunol. 14, 649-683.
33. Imbert, V., Rupec, R. A., Livolsi, A., Pahl, H. L., Traenckner, E. B.-M.,
Mueller-Dieckmann, C., Farahifar, D., Rossi, B., Auberger, P., Baeuerle, P. A.,
and Peyron, J.F. (1996) . Cell 86, 787-798.
34. Debiais, F., Lemonnier, J., Hay, E., Delannoy, P., Caverzasio, J., and Marie, P.J.
21
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 22: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/22.jpg)
(2001) J. Cell. Biochem. 81, 68-81
35. Brandt, D., Gimona, M., Hillmann, M., Haller, H., and Mischak, H. (2002) J.
Biol. Chem. 277, 20903-20910.
36. Bruce-Staskal, P.J., and Bouton, A.H. (2001) Exp.Cell Res. 264, 296-306.
37. Chang, Y.C., Holtzman, M.J., and Chen, C.C. (2002) J. Biol. Chem. 277,
7118-7126
38. Chen, C.C., Sun, Y.T., Chen, J.J., and Chiu, K.T. (2001) J. Immunol. 165,
2719-2728.
39. Delhase, M., Hayakawa, M., Chen, Y., and Karin, M. (1999) Science 284,
309-313.
40. Nemoto, S., Didonato, J.A., and Lin, A. (1998) Mol. Cell. Biol. 18, 7336–7343.
41. Chen, R., Kim, O., Yang, J., Sato, K., Eisenmann, K.M., McCarthy, J., Chen, H.,
and Qiu, Y. (2001) J. Biol. Chem. 276, 31858-31862.
42. Konishi, H., Tanaka, M., Takemura, Y., Matsuzaki, H., Ono, Y., Kikkawa, U.,
and Nishizuka, Y. (1997) Proc. Natl. Acad. Sci. U.S.A. 94, 11233-11237.
43. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P.,
and Hemmings, B. A. (1996) EMBO J. 15, 6541-6551.
44. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter,
G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Science 277,
567-570.
45. Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F.,
Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P.,
Coadwell, J., and Hawkins, P. T. (1998) Science 279, 710-714.
22
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 23: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/23.jpg)
Figure legends:
Fig. 1. Effect of various inhibitors on TNF-α- or TPA-induced ICAM-1 promoter
activity in epithelial cells. A549 cells were transfected with the pIC339
luciferase expression vector as described under “Experimental Procedures”,
then pretreated for 30 min with vehicle, 300 nM staurosporine, 30 µM
genistein, 1 µM herbimycin A, or 10 µM PP2 before incubation for 6 h
with 10 ng/ml of TNF-α or 1 µM TPA. Luciferase activity was then
measured as described under “Experimental Procedures”, normalized to
the β-galactosidase activity and expressed as the mean±S.E.M. for three
independent experiments performed in triplicate. *: P < 0.05, compared
to TNF-α or TPA alone.
Fig. 2. Kinetics of TNF-α-induced IKK activation and IκB-α degradation. A549
cells were treated with 10 ng/ml of TNF-α or 1 µM TPA for 5, 10, 30, or
60 min, then cell lysates were prepared. In (A), cell lysates were
immunoprecipitated with anti-IKKβ antibody, then the kinase assay (KA)
and autoradiography for phosphorylated GST-IκBα (1-100) were
performed on the precipitates as described under “Experimental
Procedures”. Levels of immunoprecipitated IKKβ protein were estimated
by Western blotting (WB) using anti-IKKβ antibody. In (B), cytosolic
levels of IκB-α were measured using anti-IκB-α antibody as described
under “Experimental Procedures”.
23
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 24: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/24.jpg)
Fig. 3. Effect of various inhibitors on TNF-α- or TPA-induced IKK activity, IκBα
degradation, and NF-κB-specific DNA-protein complex formation in
epithelial cells. A549 cells were pretreated for 30 min with 300 nM
staurosporine, 1 µM herbimycin A, or 10 µM PP2 before incubation with
10 ng/ml of TNF-α for 10 min or 1 µM TPA for 30 min, then whole cell
lysates or nuclear extracts were prepared. In (A), whole cell lysates were
immunoprecipitated with anti-IKKβ antibody and the kinase assay (KA)
and autoradiography for phosphorylated GST-IκBα (1-100) performed on
the precipitates as described under “Experimental Procedures”. Levels of
immunoprecipitated IKKβ were estimated by Western blotting (WB) using
anti-IKKβ antibody. In (B), cytosolic levels of IκB-α were measured by
Western blotting using anti-IκB-α antibody as described under
“Experimental Procedures”. In (C), the NF-κB specific DNA-protein
activity in nuclear extracts was determined by EMSA as described under
“Experimental Procedures”.
Fig. 4. Src family expression and time-dependent activation of c-Src or Lyn by
TNF-α in A549 cells. In (A), Jurkat, HL-60, NCI-H292, or A549 cells and
brain lysates were prepared and subjected to Western blotting using
antibodies against c-Src, Lck, Lyn, or Fyn as described in the Methods. In
(B), A549 cells were treated with 10 ng/ml of TNF-α for 10, 30, or 60 min,
then whole cell lysates were prepared and immunoprecipitated with
anti-c-Src or anti-Lyn antibody. The kinase assay (KA) and
autoradiography for phosphorylated enolase were performed on the
precipitates as described under “Experimental Procedures”. Levels of
immunoprecipitated c-Src or Lyn were estimated by Western blotting (WB)
using anti-c-Src or anti-Lyn antibody, respectively.
24
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 25: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/25.jpg)
Fig. 5. Effect of various inhibitors on TNF-α- or TPA-induced c-Src or Lyn
activation in epithelial cells. A549 cells were pretreated with 300 nM
staurosporine, 1 µM herbimycin A, or 10 µM PP2 for 30 min before
incubation with 10 ng/ml of TNF-α for 10 min or 1 µM TPA for 30 min.
Whole cell lysates were prepared and immunoprecipitated with anti-c-Src
or anti-Lyn antibody and the kinase assay (KA) and autoradiography for
phosphorylated enolase were performed on the precipitate as described
under “Experimental Procedures”. Levels of immunoprecipitated c-Src or
Lyn were estimated by Western blotting (WB) using anti-c-Src or anti-Lyn
antibody, respectively.
Fig. 6. Effect of various dominant-negative mutants on TNF-α- or TPA-induced
ICAM-1 promoter activity in A549 cells. A549 cells were co-transfected
with pIC339 and the dominant-negative c-Src (K295M), NIK (KA), or
IKKβ (KM) mutant, or the respective empty vector, then treated for 6 h
with 10 ng/ml of TNF-α or 1 µM TPA. Luciferase activity was then
measured as described under “Experimental Procedures” and the results
normalized to the β-galactosidase activity and expressed as the
mean±S.E.M. for three independent experiments performed in triplicate.
*: P < 0.05, **: P<0.01 compared to TNF-α or TPA alone.
Fig. 7. Effect of various dominant-negative mutants on wild-type
plasmid-induced ICAM-1 promoter activity. In (A), A549 cells were
co-transfected with pIC339 and the constitutively active form of
PKCα (A/E), wild-type c-Src, IKKβ, or NIK, or the respective empty
vector. In (B), A549 cells were co-transfected for 24 h with PKCα (A/E),
wild-type c-Src, or NIK and c-Src (K295M), IKKβ (KM), or NIK (KA).
Luciferase activity was then assayed as described under “Experimental
Procedures”, and the results normalized to the β-galactosidase activity and
expressed as the mean±S.E.M. for three independent experiments
performed in triplicate. *:P < 0.05 **: P<0.01 compared to the control
vector. 25
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 26: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/26.jpg)
Fig. 8. Tyrosine phosphorylation of IKKβ induced by TNF-α or TPA and the
inhibitory effect of PP2. Control cells or cells pretreated for 30 min with
10 µM PP2 were stimulated with TNF-α for 5, 10, or 15 min or with TPA
for 10 or 30 min. In (A), crude lysates were prepared. In (B) and (C), equal
amounts (1 mg) of cell lysate were immunoprecipitated (IP) with
anti-IKKβ (A) or anti-phosphotyrosine (PY) (B) antibodies. Crude lysates
and immunoprecipitated proteins were separated by SDS-PAGE on a 10%
gel and immunoblotted (WB) with anti-phosphotyrosine (PY) (A, B),
anti-IKKβ (C), or anti-c-Src (C) antibodies or reprobed with anti-IKKβ (A,
B) antibody.
Fig. 9. c-Src co-immunoprecipitates with IKKβ after TNF-α or TPA treatment.
A549 cells were treated with TNF-α for 5, 10, or 15 min or with TPA for
10 or 30 min. Equal amounts (1 mg) of cell lysate were
immunoprecipitated (IP) with anti-IKKβ (A) or anti-c-Src (B) antibodies.
Immunoprecipitated proteins were separated by SDS-PAGE on a 10% gel
and immunoblotted (WB) with anti-IKKβ or anti-c-Src antibodies. In (C),
alignment of subdomains VII and VIII of the kinase domains of PKCδ,
Akt1, and IKKα/β.
26
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 27: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/27.jpg)
Fig. 10. Effect of the dominant-negative tyrosine mutants, IKKβ (Y188F), IKKβ
(Y199F), and IKKβ (FF), on TNF-α- or TPA-induced ICAM-1 promoter
activity and on wild-type plasmid-induced NF-κB activity. In (A), A549
cells were co-transfected with pIC339 plus one of the dominant-negative
tyrosine mutants [IKKβ (188F), IKKβ (Y199F), or IKKβ (FF)],
dominant-negative mutant [IKKβ (KM)], or dominant-negative serine
mutant [IKKβ (AA)], or the respective empty vector, then treated with 10
ng/ml of TNF-α or 1 µM TPA for 6 h. In (B), A549 cells were
co-transfected with κB-luc and the constitutively active form of PKCα
(A/E), wild type c-Src, or wild-type NIK, plus the dominant-negative
mutants, IKKβ (Y188F), IKKβ (Y199F), IKKβ (FF), or IKKβ (AA), or the
respective empty vector. Luciferase activity was then measured as
described under “Experimental Procedures” and the results normalized to
the β-galactosidase activity and expressed as the mean±S.E.M. for three
independent experiments performed in triplicate. *: P < 0.05, **: P<0.01
compared to TNF-α or TPA alone (A) or wild type alone (B).
27
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 28: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/28.jpg)
Fig. 11. c-Src-dependent phosphorylation of IKKβ at Y188 and Y199 is induced by
TNF-α or TPA and inhibited by PP2. A549 cells were treated with 10
ng/ml of TNF-α or 1µM TPA for 5, 10, 30, or 60 min (A) or pretreated
with 10 µM PP2 for 30 min before stimulation with TNF-α for 10 min or
TPA for 30 min (B). Whole cell lysates were prepared and
immunoprecipitated with anti-c-Src antibody, then a kinase assay (KA)
and autoradiography for phosphorylated GST-IKKβ (132-206) were
performed as described under “Experimental Procedure”. The amount of
immunoprecipitated c-Src was detected by Western blotting (WB) using
anti-c-Src antibody. In (C), cells were treated with 10 ng/ml of TNF-α for
10 min or 1uM TPA for 30 min, the whole cell lysates were
immunoprecipitated with anti-c-Src antibody followed by kinase assay
(KA) and autoradiography for phosphorylated wt GST-IKKβ(132-206),
GST-IKKβ(132-206) (Y188F), GST-IKKβ (132-206) (Y199F), or
GST-IKKβ(132-206) (Y188F; Y199F). The amount of
immunoprecipitated c-Src was detected by Western blotting (WB) using
anti-c-Src antibody. Amount of GST-IKKβ (132-206) were detected by
Coomassie Brilliant blue staining.
Fig. 12. Schematic representation of the signaling pathways involved in
TNF-α-induced ICAM-1 expression in A549 epithelial cells. TNF-α binds
to TNFR1 and activates PC-PLC to induce PKCα and c-Src activation,
leading to tyrosine phosphorylation of IKKβ at Tyr188 and Tyr199. TNF-α
also activates TRAF2 to induce NIK activation, leading to serine
phosphorylation of IKKβ at Ser177 and Ser181. These two pathways
converge at IKKβ, resulting in phosphorylation and degradation of IκB-α,
stimulation of NF-κB in the ICAM-1 promoter, and, finally, initiation of
ICAM-1 expression.
28
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 41: Involvement of PKC-dependent c-Src and IKK Activation in TNF-a ...](https://reader033.fdocuments.net/reader033/viewer/2022051713/586e107c1a28abf0718b6d6c/html5/thumbnails/41.jpg)
Wei-Chien Huang, Jun-Jie Chen and Ching-Chow Chenintercellular adhesion molecule-1 expression
-inducedα is involved in TNF-βc-Src-dependent trosine phosphorylation of IKK
published online January 6, 2003J. Biol. Chem.
10.1074/jbc.M208521200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from