ARTICLE OPEN ACCESS

FLNC-Associated Myofibrillar MyopathyNew Clinical Functional and Proteomic Data

Rudolf Andre Kley MD Yvonne Leber PhD Bertold Schrank MD Heidi Zhuge BSc Zacharias Orfanos PhD

Julius Kostan PhD Adekunle Onipe PhD Dominik Sellung MD Anne Katrin Guttsches MD

Britta Eggers PhD Frank Jacobsen PhD Wolfram Kress PhD Katrin Marcus PhD

Kristina Djinovic-Carugo PhD Peter FM van der Ven PhD Dieter O Furst PhD and Matthias Vorgerd MD

Neurol Genet 20217e590 doi101212NXG0000000000000590

Correspondence

Dr Kley

rudolfkleyrubde

AbstractObjectiveTo determine whether a new indel mutation in the dimerization domain of filamin C (FLNc)causes a hereditary myopathy with protein aggregation in muscle fibers we clinically andmolecularly studied a German family with autosomal dominant myofibrillar myopathy (MFM)

MethodsWe performed mutational analysis in 3 generations muscle histopathology and proteomicstudies of IM protein aggregates Functional consequences of the FLNC mutation were in-vestigated with interaction and transfection studies and biophysics molecular analysis

ResultsEight patients revealed clinical features of slowly progressive proximal weakness associated witha heterozygous c8025_8030delCAAGACinsA (pK2676Pfs3) mutation in FLNC Two pa-tients exhibited a mild cardiomyopathy MRI of skeletal muscle revealed lipomatous changestypical for MFM with FLNC mutations Muscle biopsies showed characteristic MFM findingswith protein aggregation and lesion formation The proteomic profile of aggregates was specificfor MFM-filaminopathy and indicated activation of the ubiquitin-proteasome system (UPS)and autophagic pathways Functional studies revealed that mutant FLNc is misfolded unstableand incapable of forming homodimers and heterodimers with wild-type FLNc

ConclusionsThis new MFM-filaminopathy family confirms that expression of mutant FLNC leads to anadult-onset muscle phenotype with intracellular protein accumulation Mutant FLNc protein isbiochemically compromised and leads to dysregulation of protein quality control mechanismsProteomic analysis of MFM protein aggregates is a potent method to identify disease-relevantproteins differentiateMFM subtypes evaluate the relevance of gene variants and identify novelMFM candidate genes

RELATED ARTICLE

EditorialA Window Into theMyofibrillar MyopathyProteome

Page e587

From the Department of Neurology (RAK HZ DS AKG FJ MV) Heimer Institute for Muscle Research University Hospital Bergmannsheil Ruhr-University Bochum BochumGermany Department of Neurology and Clinical Neurophysiology (RAK) St Marien-Hospital Borken Borken Germany Department of Molecular Cell Biology (YL ZO PFMVDOF) Institute for Cell Biology University of Bonn Bonn Germany Department of Neurology (BS) DKD HELIOS Klinik Wiesbaden Wiesbaden Germany Department ofStructural and Computational Biology (JK AO KD-C) Max Perutz Laboratories University of Vienna Vienna Austria Medizinisches Proteom-Center (BE KM) Ruhr-UniversityBochum Bochum Germany Institute of Human Genetics (WK) University of Wurzburg Wurzburg Germany and Department of Biochemistry (KD-C) Faculty of Chemistry andChemical Technology University of Ljubljana Ljubljana Slovenia

Go to NeurologyorgNG for full disclosures Funding information is provided at the end of the article

RA Kley and Y Leber contributed equally to this work as condashfirst authors

The Article Processing Charge was funded by the authors

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 40 (CC BY-NC-ND) which permits downloadingand sharing the work provided it is properly cited The work cannot be changed in any way or used commercially without permission from the journal

Copyright copy 2021 The Author(s) Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology 1

Myofibrillar myopathies (MFMs) are hereditary neuromusculardisorders characterized by intramyoplasmic protein aggregationand focal dissolution of myofibrils1-3 A subtype of MFM causedby heterozygous mutations in the FLNC gene (MFM5 MIM609524) was discovered in 20054 and thereafter additionalfamilies with MFM-filaminopathy were described5-9 Main clin-ical features are progressive skeletal muscle weakness usuallymanifesting between the fourth and sixth decade of life andrespiratory insufficiency in advanced disease stages MRI revealsa typical pattern of lower limb muscle involvement helpful indifferential diagnostics610-12 Mutations in FLNC may also leadto a distal myopathy with histopathologic features distinct fromMFM1314 or may cause different types of cardiomyopathies15

The FLNC gene maps to human chromosome 7q32-q35and is predominantly expressed in striated muscles FLNccontains an N-terminal actin-binding domain followed by24 Ig-like domains that serve as versatile protein interactioninterfaces The carboxyterminal Ig-like domain 24 formshomodimers enabling filamins to cross-link actinfilaments1617 which is a crucial function of the filamins11

FLNc binds numerous Z-disc proteins including myopo-dinSYNPO218 FATZcalsarcinmyozenin19-21 aciculin

PGM522 and myotilin2324 whereas it interacts at the sar-colemma with components of the dystrophin-dystroglycancomplex25 and acts as scaffold for transmembrane receptorsand signaling and adapter proteins

We characterize the clinical and histopathologic phenotype ofa German family with MFM-filaminopathy caused by a novelFLNc mutation in Ig-like domain 24 analyze the molecularpathogenesis and provide new data about the composition ofintramyoplasmic protein aggregates in MFM-filaminopathy

PatientsA German family with 9 patients representing 3 generations wasincluded in this study (table e-1 linkslwwcomNXGA410figure 1A) Six patients underwent neurologic examinationsFrom patients I2 and II3 only medical information from hos-pital charts was available Relatives of patient III3 reported him tobe affected but he refused clinical examination Five patients hadmuscle MRI with a 15 T MR unit (MAGNETOM SymphonyQUANTUM Siemens) according to previously publishedprotocols5

Figure 1 Pedigree and pK2676Pfs3 FLNC Mutation Analysis

(A) Pedigree of the German family with LGMD-like MFMidentified in this study associated with a mutation of FLNCexon 48 The index patient III8 is indicated by an arrowIndividuals with proven mutation and deceased familymembers who had muscle weakness are represented byfilled symbols (B)Mutation detection via Sanger sequencingwith subsequent translation to amino acids in silico

GlossaryCK = Creatine kinase HGMD = Human Gene Mutation Database MFMs = Myofibrillar myopathies NMD = nonsense-mediated decay NADH = Nicotinamide adenine dinucleotide dehydrogenase SEC-MALS = size exclusion chromatographycombined with multiangle light scatt

2 Neurology Genetics | Volume 7 Number 3 | June 2021 NeurologyorgNG

MethodsStandard Protocol Approvals Registrationsand Patient ConsentsInformed consent was obtained from all patients (approval ofRuhr-University Bochum ethics committee [4078ndash11])

FLNC Mutation DetectionFLNC gene analysis by Sanger sequencing used an establishedprotocol avoiding amplification of the FLNC pseudogene26

Variant detection was accomplished by aligning the obtainedsequence with the NCBI Reference Sequence NM_0014584using the software Gensearch (Phenosystems Braine leChateau Belgium)

Muscle Biopsy StudiesSkeletal muscle biopsies from patients III4 and III7 wereused for evaluating histopathologic changes and for immu-nolocalization studies using established procedures56

Analysis of Mutant Allele Expression by RT-PCRTotal RNA was purified from muscle samples using theRNeasy fibrous tissue mini kit (Qiagen Hilden Germany)Primer pairs used were as follows (1) ctccagctacagctccatccand gaggcacttttgggattcaa or (2) catcgtgaacaccctgaatg andgacactttcgtcaccccact Amplicons were purified digested withAleI run on agarose gels and were analyzed with a gel doc-umentation system (BioRad GelDoc XR) and band densi-tometry (QuantityOne software)

Cloning of Truncated and Full-LengthFLNC ConstructsA FLNC d23ndash24 construct containing the c8025_8030del-CAAGACinsA mutation was obtained by PCR using primerstttacgcgtGGGGAGCAGAGCCAGGCTGGGGACCCAG(forward) and tttgtcgacCAGGGGTGGGCCGTGCACGCC-CACCATCATC (reverse without stop codon) or tttgtcgacT-CACAGGGGTGGGCCGTGCACGCCCACCATC (reverseincluding stop codon) and the wild-type variant as a templateAmplicons were cloned into the prokaryotic expression vectorspET23-EEF pET23-T7 or pGEX-6P3 for expression of fusionproteins carrying a C-terminal His-tag and either a C-terminalEEF- or N-terminal T7-immunotag or an N-terminal GST-tagrespectively Integrity of all constructs was verified by sequencing(LGC Genomics Berlin Germany)

Full-length FLNC cDNA clones in pEGFP-C2 (ClontechTakara Holdings Kyoto Japan) were obtained as described13

The mutation was introduced into full-length FLNC by ex-changing the cDNA encoding the wild-type Ig-like domains23ndash24 with the truncated variant using a unique BspEI re-striction site within the cDNA encoding Ig-like domain 23

Details of expression and purification of recombinant pro-teins biophysical characterization cross-linking of FLNcpolypeptides and proteolytic susceptibility studies are pro-vided in table e-2 linkslwwcomNXGA411

Transfection StudiesC2C12 cells were cultured in 6-well plates (TPP Trasadin-gen Switzerland) in Dulbeccorsquos modified Eagle mediumsupplemented with 15 fetal calf serum 4 mM L-glutamine1 nonessential amino acids and 2 mM sodium pyruvate(Invitrogen) and transfected with full-length wild-type ormutant FLNC constructs (see above) using LipofectamineLTX and Plus Reagent according to the manufacturerrsquos in-structions (Invitrogen) Twenty-four hours after transfectionaggregate formation was evaluated in at least 2000 transfectedcells for each construct by live cell imaging (IX83 microscopeOlympus Tokyo Japan) Unpaired t tests were used for sta-tistical analysis

Proteomic AnalysisDifferential proteomic analysis was performed with samples of2 patients carrying the pK2676Pfs3 mutation (III4 and III7) and 5 patients with distinct FLNC mutations (3 withpW2710X and 2 with pV930_T933del mutation) The latterpatients were also included in our previous proteomic study27

but were reanalyzed with an optimized method

Combined laser microdissection label-free mass spectrometrywas applied as described1528 250000 μm2 of protein aggre-gates and control samples were excised from immunostained10 μm cryosections by laser microdissection (LMD 6500Leica Microsystems Wetzlar Germany) and transferred toreaction tubes containing 40 μL formic acid (FA 98ndash100)Samples were incubated at room temperature for 30 minutesin the sonication bath (35 kHz) and centrifuged for 10 min-utes (12000g 4degC) and supernatant proteins were furtherprocessed by tryptic digestion15 or stored at minus80degC until use

Samples were analyzed by nanoHPLC-ESI-MSMS on anUltiMate 3000 RSLC nanoLC system coupled to a LTQOrbitrap Elite mass spectrometer (Thermo Fisher ScientificBremen Germany) Protein quantification was performed byspectral counting Nano LC-MSMS and subsequent dataanalysis parameters were as described28 Overrepresentationof proteins in aggregate samples was calculated and a 2-tailedunpaired t test (equal variances assumed) was used for eachprotein A protein was considered as significantly increasedwith a fold change gt15 and p value le005

Data AvailabilityAnonymized data not published within this article will beshared by request from any qualified investigator

ResultsIdentification of a Novel FLNC MutationWe describe a 3-generation family with MFM-filaminopathywith 9 affected patients (figure 1A) Sanger sequencing of theFLNC gene of the index patient revealed a novel indel mutationc8025_8030delCAAGACinsA segregating in this family withthe disease (figure 1B) This combination of deletion and

NeurologyorgNG Neurology Genetics | Volume 7 Number 3 | June 2021 3

simultaneous insertion results in a frameshift producing apremature stop codon at position 2679 (pK2676Pfs3)

Similar to the previously reported cG8130A (pW2710X)mutation found in several unrelated filaminopathy families themutation found in the German family reported here truncatesthe dimer-forming FLNc Ig-like domain 24 Although in thepW2710X mutation the carboxyterminal 16 amino acids aredeleted the c8025_8030delCAAGACinsA pK2676Pfs3mutation leads to replacement of the carboxyterminal 50 aminoacids by proline and leucine (figure 1B) The mutation there-fore results in the deletion of β-strands D E F F9 and G fromthe Ig-like domain 24 (d24) (figure 2 A and B)

For premature stop codonndashcausing mutations it is crucial tocheck for mutant mRNA degradation via nonsense-mediateddecay (NMD) We therefore performed RT-PCR with cDNAfrommRNA purified from control and patient skeletal musclesAt the cDNA level the mutation leads to the generation of anAleI restriction site enabling us to use different primer pairs toamplify patient and control cDNAs and a subsequent AleIdigestion Patient cDNA exhibited both wild-type and mutantcDNAs at a ratio of approximately 43 (figure 2C) indicatingthat mutant mRNA is not degraded via NMD and that bothwild-type and mutant RNAs are expressed in patients

Clinical FeaturesIn the 8 affected patients whose data were available diseaseonset was diagnosed between 35 to 45 years (mean age 374 plusmn30 years table e-1 linkslwwcomNXGA410) In all patientsthe initial symptom was proximal leg muscle weakness The

disease course was slowly progressive with additional distal legand upper limb weakness At an advanced stage 3 patients useda wheelchair Cardiomyopathy occurred in 28 patients andrespiratory insufficiency in 48 patients Creatine kinase (CK)elevation was moderate and lt7-fold of the upper normal limitMuscle MRI of patient III4 showed severe symmetrical lipo-matous alterations in most posterior thigh muscles (semi-membranosus adductor magnus and longus semitendinosusand biceps femoris) in vastus intermedius and in the soleus(figure 3) In lower legs a reticular pattern of hyperintensity onT1-weighted images was observed in the medial head of gas-trocnemius and in tibialis anterior extensor hallucis longus andextensor digitorum longus muscles The pattern of muscle in-volvement was similar in patient III5 but ventral thighmusclestibialis anterior and the medial head of gastrocnemius weremore severely affected than in patient III4 MRI detected noalterations in the gracilis and in the lateral head of gastrocne-mius In patients with a shorter disease duration reticular changesoccurred either in the anterior tibialis and semimembranosus (III6)or in the soleus (III7 III8) muscle (figure 3) as early degenerativechanges

Histopathologic StudiesMuscle biopsies of patients III4 and III7 showed dystrophic-like features with fiber size variation with scattered atrophicand hypertrophic fibers fiber splitting increased numbers ofcentrally located nuclei augmented fibrosis and fatty infil-trations These features were more pronounced in patient III4 (figure 4A) compared with those in III7 (figure 4B) Ad-ditional structural changes with rimmed vacuoles appeared insome muscle fibers Trichrome staining (TC) showed muscle

Figure 2 Effect of pK2676Pfs3 FLNC Mutation

(A and B) Sketch illustrating the effect ofthe mutation Topology of filamin C do-main 24 as derived from its crystalstructure17 aligned to the amino acid se-quence (A) and in a 2-dimensional view(B)β-strands (C andD) form the interfacebetween dimerized domains Strand Gdirectly interacts with strand (A) which isimportant for the coherence of the 2β-sheets that comprise an Ig-like domainThe position of the pK2676Pfs3 muta-tion is marked with a red asterisk It re-sults in the loss of β-strands (DndashG)rendering a correct folding of the domainimpossible The gray asterisk marks theposition of the pW2710X mutation (C)RT-PCR of control and patient cDNAdigested with AleI cDNA reverse tran-scribed from control and patient skeletalmuscle mRNA amplified with 2 differentprimer pairs and digested with AleI Be-cause control cDNA does not contain anAleI restriction site only mutant cDNAwas digested into 160 and 170 bp frag-ments (primer pair 1) and 450 and 138 bpfragments (primer pair 2) respectively Inpatient skeletal muscle wild-type andmutant mRNA are expressed in an ap-proximate ratio of 43

4 Neurology Genetics | Volume 7 Number 3 | June 2021 NeurologyorgNG

fibers with a combination of vacuolar changes and blue-colored amorphous deposits (figure 4 Ab and Bb) Nico-tinamide adenine dinucleotide dehydrogenase (NADH)staining demonstrated areas devoid of oxidative enzyme ac-tivities in many fibers and areas of increased NADH in-tensities outside these lesions and beneath the sarcolemma(figure 4 Ac and Bc) Immunolocalization studies revealedaccumulation of FLNc and desmin in protein aggregateswithin abnormal muscle fibers (figure 4 C and Dc)

Because muscle fibers of patients with MFM caused by otherFLNcmutations and of pW2711X knock-inmice contain largenumbers of myofibrillar lesions we also stained longitudinalsections of our patients for lesion markers desmin FLNc(figure 4 Ea-c) myotilin and Xin (not shown) This revealedthat also in patients with pK2676Pfs3 mutation these pro-teins were not only localized in the typical aggregates but also infrequently occurring microlesions and macrolesions (myofi-brillar lesions spanning up to 5 sarcomeres or more than 5sarcomeres and across multiple myofibrils respectively)

Proteomic Analysis of Protein AggregatesMass spectrometric analysis detected 1045 proteins with 88being significantly overrepresented in aggregate samples

compared with intraindividual control samples from musclefibers without aggregates (table e-3 linkslwwcomNXGA412) From these 88 proteins the disease-causing FLNcshowed the highest mean proportion in aggregates with a valuenearly 7-fold higher than in control samples In relation toproportion Z-disc and Z-discndashassociated proteins representedthe most important group of accumulated aggregate proteinsfollowed by quality control and protein degradation proteins(figure 5) Subgroup analysis of different FLNC mutationsrevealed high similarity of proteomic aggregate profiles in allpatients with MFM-filaminopathy (figure 5) Comparison ofthis MFM-filaminopathy cohort with proteomic findings in 96otherMFMpatients including patients withmutations in otherknown MFM genes and genetically unresolved cases revealedthat an FLNc ratio (value in aggregate sample divided by thevalue in intraindividual control sample) above 5 is a highlysensitive (100) and specific (99) diagnostic marker forMFM-filaminopathy (data not shown)

Biophysical and Biochemical Studies ofMutantpK2676Pfs3 FLNc ProteinWe examined effects of the pK2676Pfs3 mutation on foldintegrity and stability Circular dichroism spectroscopy wasused to assess secondary structure content of the mutant

Figure 3 Muscle Imaging Findings in Lower Extremities

T1-weighted muscle MRI revealed severe fatty de-generative changes in patients III4 and III5 with a diseaseduration of more than 10 years The gracilis and the lat-eral head of the gastrocnemius were relatively spared inboth patients as indicated by arrowheads Mild earlychanges (arrows) were seen either in the tibialis anteriorand semimembranosus (patient III6) or in the soleusmuscle (patients III7 and III8)

NeurologyorgNG Neurology Genetics | Volume 7 Number 3 | June 2021 5

constructs comprising Ig-like domains 23ndash24 (d23ndash24)Whereas analysis of the wild-type domains resulted in thetypical szlig-strand secondary structure previously reported forthese domains1617 the truncatedmutant construct resulted inlower signals (figure 6B) for szlig-strand structure with a con-comitant increase of signal for random coil suggesting im-proper folding Structure stability was analyzed bythermolysin digestion of d23ndash24 constructs The mutantpK2676Pfs3 protein was already partially digested after 1minute and completely digested after 20 minutes whereas aportion of the pW2710X mutant and almost all of the wild-type variant was still intact after this time (figure 6C)

indicating a notably less stable fold of especially thepK2676Pfs3 mutant protein with exposed unfolded regionshighly susceptible to proteolysis We next inspected di-merization of mutant FLNc by chemical cross-linking exper-iments Whereas the cross-linking of the wild-type variantyielded a strong signal for dimer and the spontaneous aggre-gation of the pW2710X mutant was reproduced cross-linking of the pK2676Pfs3 mutant d23ndash24 did not yielddimeric cross-links indicating impaired dimer formation(figure 6D) To assess the hydrodynamic properties andmeasure the molecular mass of the pK2676Pfs3 d23ndash24protein in solution we used size exclusion chromatography

Figure 4 Histochemical Findings and Immunolocalization Studies

Analysis of muscle biopsy samples from patients III4 (A and C) and III7 (B D and E) (Aa and Bc) Cryosections stained with HampE TC and NADH showed fiberdiameter variability fiber splitting adipose replacement endomysial fibrosis increase in central nuclei and marked irregularities of the intermyofibrillarnetwork with many fibers showing multiple areas devoid of oxidative enzyme activity These findings were more pronounced in III4 (CandashDc) Cryosectionsdouble stained with antibodies recognizing desmin (DES) and FLNc to localize protein aggregations Bar 50 μm (EandashEc) Longitudinal cryosections weredouble stained for DES and FLNc Both proteins colocalized in aggregates (arrows) but also in microlesions (arrowheads) Bar 10 μm

6 Neurology Genetics | Volume 7 Number 3 | June 2021 NeurologyorgNG

combined with multiangle light scattering (SEC-MALS)Whereas the wild-type construct d23ndash24 eluted at a volumeexpected for a dimer and displayed a molecular mass of 489kDa as assessed by MALS the pK2676Pfs3 mutantd23ndash24 clearly displayed a monomeric state with a non-symmetric elution profile suggesting a folding defect andstructural disorder (figure e-1A linkslwwcomNXGA409) Taken together our data reveal that the deletionmutant is impaired in dimerization due to an incompleteunfolded domain 24

Transfection StudiesTo analyze effects of expression of mutant FLNc in C2C12myoblasts we transiently transfected these cells with con-structs encoding full-length wild-type or mutant FLNc Im-aging of more than 5000 successfully transfected cellsrevealed that spontaneous aggregate formation was signifi-cantly more frequent in cells expressing mutant FLNc

compared with wild-type controls (24 vs 12 p lt 00001figure e-1B linkslwwcomNXGA409)

DiscussionMutations in FLNC may lead to MFM distal myopathy or avariety of familial and isolated cardiac phenotypes7 MFM-filaminopathy is associated with mutations in the roddomain of FLNc causing truncation of the dimerization do-main or other protein alterations leading to misfolding andaggregation4829 The few reported examples of distal myop-athies either result from mutations in the ABD of FLNc13 orare caused by haploinsufficiency due to NMD of the mutanttranscript14 We here describe an MFM-filaminopathy familywith a novel indel mutation in one of the exons encoding thedimerization domain of FLNc and characterize its pathogenicconsequences

Figure 5 Proteomic Analysis of Skeletal Muscle Samples From Patients With MFM-Filaminopathy

Aggregate and intraindividual control samples were collected by laser microdissection The bar chart in (A) shows the proportion of proteins identified asoverrepresented in aggregate samples (compared with controls) grouped by function Z-disc and Z-discndashassociated proteins were the most abundantcomponents followed by proteins involved in protein quality control and degradation (B) Proteomic profiles of overrepresented aggregate proteins inpatients with filaminopathy caused by different FLNC mutations Pie charts illustrate that the pattern in patients with pK2676Pfs3 mutation was highlysimilar to that in patient with pW2710X or pV930_T933del mutation FLNc was always themost abundant protein followed by desmin and the FLNc bindingpartners Xin actin-binding repeat-containing protein 2 (XIRP2) and nebulin-related-anchoring protein (N-RAP) Proportions of αB crystallin Xin actin-bindingrepeat-containing protein 1 (Xin) obscurin and nestin were also similar

NeurologyorgNG Neurology Genetics | Volume 7 Number 3 | June 2021 7

In this family clinical disease manifestation with proximal lowerlimb weakness started in the fourth or fifth decade of life In laterdisease stages distal lower limb upper limb and respiratorymuscles were also involved A fraction of patients showed cardiacabnormalities and the CK level was moderately elevated co-inciding with descriptions of MFM-filaminopathy families fromdifferent countries and with distinct FLNC mutations29 Thisunderlines that this type of FLNC-associated myopathy which isassociated with the expression of a toxic protein and formation ofprotein aggregates in muscle fibers is characterized by a largelyhomogeneous clinical phenotype differing from the phenotypescaused by mutations in the ABD of FLNC30 mutations resultingin reduced expression of FLNc protein14 or MFM subtypes dueto mutations in other genes31

Muscle imaging findings at more advanced disease (III4 and III5) were also typical of MFM-filaminopathy with a pattern ofmuscle involvement that met the criteria defined to differentiate

between this disease and other MFM subtypes1012 As in otherfamilies with MFM-filaminopathy the gracilis sartorius and thelateral head of the gastrocnemius muscle were relatively sparedalthough neighboring muscles already showed marked lipoma-tous changes Imaging in younger patients with shorter diseaseduration (III6 III7 and III8) revealed only slight muscle al-terations that were not sufficient for a clear distinction againstother myopathies demonstrating the sometimes limited differ-ential diagnostic value of muscle imaging in early disease stages

The most impressive histopathologic feature in our patientswas massive protein aggregation with increased immunore-activity for FLNc and other MFM marker proteins in theirmuscle fibers To further decipher the composition of proteinaggregates in MFM-filaminopathy we extended our previousproteomic studies by analyzing material from these patients andoptimizing our approach From the 88 proteins significantlyoverrepresented in aggregates FLNc contributed the highest

Figure 6 Functional Studies of the pK2676Pfs3 Mutation

(A) Ribbon representation of the human FLNc domain 24 structure (PDB code 1V05) The d24 dimer is shown in blue with regionsmissing in the pK2676Pfs3mutant variant shown in light orange β-strands as well as N and C termini are indicated Asterisks distinguish β-strands of individual subunits Themutationleads to loss of β-strands involved in the formation of 2 extended antiparallel β-sheets (B-E-D-D-E-B and C-F-G-GF-C) which stabilize domain foldintegrity as well as the dimer leading to severely impaired dimerization (B) Circular dichroism spectroscopy performed with purified bacterially expressedwild-type and pK2676Pfs3 mutant FLNc d23ndash24 constructs The mean residue ellipticity (DeMR) of wild-type andmutant FLNc shows a minimum at 218 nmcharacteristic of a β-structure However the deletion mutant displays a lower amplitude at this wavelength indicating loss of β-structure andor folding (C)Thermolysin digestion of wild-type andmutant FLNc d23ndash24 for 1ndash20minutes Themutant protein was completely digested after 20min whereas almost allthe wild-type variant was still intact and the pW2710X was only partially digested indicating less stable folding of the pK2676Pfs3 mutant protein (D)Chemical cross-linking experiments using wild-type (WT) andmutant filamin d23ndash24 constructs Without EGS onlymonomers of all constructs were detected(approximately 20ndash25 kDa) After cross-linkingwith EGS thewild-type variant appears as dimers (50 kDa) themutant pW2710X construct wasmainly foundin high-molecular-mass aggregates and pK2676Pfs3 was only found as monomers In a mixture of differentially tagged wild-type and both mutantconstructs (WT + pW2710X andWT + pK2676Pfs3) thewild-type construct dimerizes normally Note that samples were in part run on different gels that areseparated by a white line

8 Neurology Genetics | Volume 7 Number 3 | June 2021 NeurologyorgNG

quantity of peptides in aggregate samples followed by furtherZ-disc and Z-discndashassociated proteins Our previous proteomicstudies only identified 28 of these proteins27 Several of thesenewly identified less abundantly overrepresented proteinsare involved in protein degradation and protein qualitycontrol eg SQSTM1 (p62) HSPA8 and BAG3 The latterare components of chaperone-assisted selective autophagy(CASA) a tension-induced autophagy pathway essential formyofibril integrity maintenance by degradation of damagedFLNc and simultaneous stimulation of FLNC transcrip-tion32 These findings are consistent with our previoushypothesis-driven immunolocalization studies in MFM-fil-aminopathy29 and with results of proteomic analyses inMFM-myotilinopathy28 We succeeded in identifying fur-ther chaperones and proteins involved in different cellularpathways as aggregate components This increases our un-derstanding of the disease pathogenesis and might help todevelop new therapeutic strategies eg by influencingCASA activity Additional interesting proteins over-represented in aggregate samples are the FLNc bindingpartners phosphoglucomutase-like protein 5 (PGM5 aci-culin) and HSPB7 both being essential for assemblyremodeling and maintenance of myofibrils2233 Further-more HSPB7 protein expression levels were highly reducedin muscle fibers of homozygous pW2711X knock-in miceTogether with the finding that proteins associated with otherMFM subtypes (desmin myotilin alphaB-crystallin andBAG3) also accumulate in MFM-filaminopathy aggregatesthese data render PGM5 and HSPB7 promising candidategenes for new MFM subtypes Therefore we recommendtesting genetically unresolved patients with MFM for mu-tations in both genes It is also noteworthy that similarstrategies to identify disease genes by combination of lasermicrodissection and proteomic analysis were already suc-cessful in other protein aggregate myopathies (Refs 34 and35 and our unpublished data)

Another clinically relevant point is that proteomic analysis canbe helpful in differential diagnostic workup of patients withMFM Our analyses revealed that proteomic aggregate pro-files in 7 patients with MFM-filaminopathy with 3 distinctFLNC mutations were highly similar Moreover we couldvalidate in a large MFM cohort that the FLNc ratio ie theproportion of FLNc in aggregate samples divided by theproportion of FLNc in intraindividual control samples is ahighly sensitive and specific diagnostic biomarker All patientswith MFM-filaminopathy but only 1 of 96 patients with dif-ferent MFM subtypes had an FLNc ratio above 5 Togetherwith clinical and muscle imaging findings this biomarker isuseful to assess FLNC variants of uncertain significance inpatients with MFM

The indel mutation we describe here causes a frameshiftintroducing a stop codon in the mutant mRNA In theHuman Gene Mutation Database (HGMD hgmdcfacukacindexphp) only 14 of the total number of humanmutations identified are indel mutations making this type

of mutation very rare36 Indeed in a recent article reporting325 different variants of the FLNC gene only 4 of those(12) were indel mutations7 The region directly flankingthe pK2676Pfs3 mutation detected in our family(GGTGGGCGTGCACGGCCCCAAGACCCCCTGTGAGGAGGTG deleted nucleotides are underlined) is very GC-rich(725) and stretches of 4 or 5 guanines or cytosines oftenflanked by an adenine or thymine were identified as hotspots forhuman mutations37 It is interesting to note that also 2 differentMFM-causingmutations in Ig-like domain24of FLNc are localizedin a stretch of 4 guanines flanked on both sides by a thymine(NM_0014584(FLNC)c8130GgtA and c8129GgtA49) Bothmutations result in the same mutation at the protein level(pW2710X) indicating that this specific stretch of guaninesindeed is a mutation hotspot Because the introduced stopcodon occurs in the last exon NMD does not occur as con-firmed by our RT-PCR experiments indicating that a mis-folded and unstable FLNc variant is indeed expressed whichnot only leads to protein aggregation but also results inthe formation of numerous myofibrillar lesions NotablypK2676Pfs3 FLNc was even more susceptible to proteolysisthan pW2710X FLNc Because muscle fibers of pW2711Xknock-in mice with the latter human FLNc mutation containmyofibrillar lesions but no aggregates we proposed that lesionsare precursors of aggregates and contribute to muscle weak-ness38 Thus myofibrillar lesions and protein aggregates arehallmarks of MFM-filaminopathy

Loss of β-strands F9 and G (figure 2 A and B) caused by thepW2710X mutation is sufficient for the inability of Ig-likedomain 24 to dimerize439 Instead multimeric complexesare formed indicating spontaneous aggregation Deletionof β-strands D-G in the patients described here also hassevere effects the ability to dimerize is entirely lost andspontaneous aggregation is displayed in vitro Indeed full-length mutant FLNc formed significantly more aggregatesin transfected myoblasts than wild-type protein in line withobserved increased levels of proteins involved in degrada-tion and protein quality control in aggregates Togetherwith our previous data on a mutation in Ig-like domain72938 and the presence of other MFM-filaminopathycausing mutations in other Ig-like domains15 this mightindicate that the mere misfolding of any single Ig-like do-main of FLNc is sufficient to cause a phenotype with lesionand aggregate formation

ConclusionIn conclusion we have identified a rare indel mutation in apotential mutation hotspot in FLNC that is associated withMFM-filaminopathy in a German family of 3 subsequentgenerations Here we characterized the disease phenotypeand the mutated protein at different levels and found that thismutation causes a pattern typical for various types of proteinaggregate-forming MFM-filaminopathies In addition wedemonstrate a highly similar composition of protein

NeurologyorgNG Neurology Genetics | Volume 7 Number 3 | June 2021 9

aggregates in all MFM-filaminopathy subtypes independentof the individual FLNC mutation causative for this diseaseTherefore we suggest this tool as a sensitive and specificdiagnostic biomarker in patients with MFM and FLNC vari-ants of unknown significance We also identified promisingcandidate genes for new MFM subtypes

AcknowledgmentThe authors thank the patients for participation in this studyand Aileen Balkow Karin Bois and Anja Schreiner fortechnical support

Study FundingThis research was supported by the German ResearchFoundation (DFG Research Unit 1228 and DFG Re-search Unit 2743) the Heimer foundation ITN-MUZIC(Ndeg238423) FWF Projects I525 I1593 P22276 P19060and W1221 ldquoLaura Bassi Centre of Optimized StructuralStudiesrdquo (Ndeg253275) Welcome Trust CollaborativeAward (201543Z16Z) COST action BM1405 WWTFChemical Biology project LS17-008 Christian DopplerLaboratory for High-Content Structural Biology and Bio-technology the Welcome Trust Collaborative Award theCentre of Optimized Structural Studies the Austrian-Slovak Interreg Project StruBioMol (B301) and by theDoctoral Program Plus Structure and Interaction ofBiological Macromolecules (W1221)

DisclosureRA Kley was funded by DFG Research Unit 1228 andreceived research support from the Heimer foundationY Leber B Schrank H Zhuge and Z Orfanos report nodisclosures J Kostan was funded by the Welcome TrustCollaborative Award by Centre of Optimized StructuralStudies and by Austrian-Slovak Interreg Project StruBio-Mol (B301) A Onipe was funded by Doctoral ProgramPlus Structure and Interaction of Biological Macromole-cules (W1221) D Sellung A-K Guttsches B EggersF Jacobsen and W Kress report no disclosures K Marcuswas funded by DFG Research Unit 1228 K Djinovic-Carugo was funded by ITN-MUZIC (Ndeg238423) FWFProjects I525 I1593 P22276 P19060 and W1221 ldquoLauraBassi Centre of Optimized Structural Studiesrdquo (Ndeg253275)Welcome Trust Collaborative Award (201543Z16Z)COST action BM1405 WWTF Chemical Biology projectLS17-008 and Christian Doppler Laboratory for High-Content Structural Biology and Biotechnology PFM vander Ven reports no disclosures DO Furst was funded byDFG Research Units 1228 and 2743 M Vorgerd receivedresearch support from the Heimer Foundation Go toNeurologyorgNG for full disclosures

Publication HistoryReceived by Neurology Genetics July 23 2020 Accepted in final formDecember 28 2020

Appendix Authors

Name Location Contribution

RudolfAndreKley MD

Ruhr-University BochumBochumGermany and StMarien-Hospital BorkenGermany

Designed and conceptualizedthe study major role in theacquisition and interpretation ofdataanddraftedthemanuscriptfor intellectual content

YvonneLeber PhD

University of Bonn BonnGermany

Acquisition andinterpretation of data anddrafted the manuscript forintellectual content

BertoldSchrankMD

DKD HELIOS MedicalCenter WiesbadenWiesbaden Germany

Acquisition andinterpretation of clinical dataand drafted the manuscriptfor intellectual content

HeidiZhuge BSc

Ruhr-University BochumBochum Germany

Interpretation of data andrevised the manuscript forintellectual content

ZachariasOrfanosPhD

University of Bonn BonnGermany

Acquisition andinterpretation of data

JuliusKostanPhD

University of ViennaVienna Austria

Acquisition andinterpretation of data

AdekunleOnipe PhD

University of ViennaVienna Austria

Acquisition andinterpretation of data

DominikSellungMD

Ruhr-University BochumBochum Germany

Interpretation of data andrevised the manuscript forintellectual content

AnneKatrinGuttschesMD

Ruhr-University BochumBochum Germany

Interpretation of data andrevised the manuscript forintellectual content

BrittaEggersPhD

Ruhr-University BochumBochum Germany

Interpretation of proteomicdata

FrankJacobsenPhD

Ruhr-University BochumBochum Germany

Interpretation of data andrevised the manuscript forintellectual content

WolframKress PhD

University of WurzburgWurzburg Germany

Interpretation of data andrevised the manuscript forintellectual content

KatrinMarcusPhD

Ruhr-University BochumBochum Germany

Interpretation of proteomicdata

KristinaDjinovic-CarugoPhD

University of ViennaVienna Austria andUniversity of LjubljanaLjubljana Slovenia

Acquisition andinterpretation of data andrevised the manuscript forintellectual content

Peter FMvan derVen PhD

University of Bonn BonnGermany

Acquisition andinterpretation of data andrevised the manuscript forintellectual content

Dieter OFurst PhD

University of Bonn BonnGermany

Acquisition andinterpretation of data anddrafted the manuscript forintellectual content

MatthiasVorgerdMD

Ruhr-University BochumBochum Germany

Major role in the acquisitionand analysis of data anddrafted the manuscript forintellectual content

10 Neurology Genetics | Volume 7 Number 3 | June 2021 NeurologyorgNG

References1 Kley RA Olive M Schroder R New aspects of myofibrillar myopathies Curr Opin

Neurol 201629628-6342 Schroder R Schoser B Myofibrillar myopathies a clinical and myopathological guide

Brain Pathol 200919483-4923 Selcen D Engel AG Myofibrillar myopathies Handb Clin Neurol 2011101143-1544 Vorgerd M van der Ven PFM Bruchertseifer V et al A mutation in the dimerization

domain of filamin c causes a novel type of autosomal dominant myofibrillar myopathyAm J Hum Genet 200577297-304

5 Kley RA Hellenbroich Y van der Ven PFM et al Clinical andmorphological phenotype ofthe filamin myopathy a study of 31 German patients Brain 20071303250-3264

6 Kley RA van der Ven PFM Olive M et al Impairment of protein degradation in myofi-brillar myopathy caused by FLNCfilamin C mutations Autophagy 20139422-423

7 Verdonschot JAJ Vanhoutte EK Claes GRF et al A mutation update for the FLNCgene in myopathies and cardiomyopathies Hum Mutat 2020411091-1111

8 Shatunov A Olive M Odgerel Z et al In-frame deletion in the seventhimmunoglobulin-like repeat of filamin C in a family with myofibrillar myopathy Eur JHum Genet 200917656-663

9 Lee HH Wong S Sheng B et al Clinical and pathological characterization of FLNC-related myofibrillar myopathy caused by founder variant c8129GgtA in Hong KongChinese Clin Genet 202097747-757

10 Fischer D Kley RA Strach K et al Distinct muscle imaging patterns in myofibrillarmyopathies Neurology 200871758-765

11 Furst DO Goldfarb LG Kley RA Vorgerd M Olive M van der Ven PFM FilaminC-related myopathies pathology and mechanisms Acta Neuropathol 201312533-46

12 Wattjes MP Kley RA Fischer D Neuromuscular imaging in inherited muscle dis-eases Eur Radiol 2010202447-2460

13 Duff RM Tay V Hackman P et al Mutations in the N-terminal actin-binding domainof filamin C cause a distal myopathy Am J Hum Genet 201188729-740

14 Guergueltcheva V Peeters K Baets J et al Distal myopathy with upper limb pre-dominance caused by filamin C haploinsufficiency Neurology 2011772105-2114

15 Maerkens A Kley RA Olive M et al Differential proteomic analysis of abnormalintramyoplasmic aggregates in desminopathy J Proteomics 20139014-27

16 Himmel M van der Ven PFM Stocklein W Furst DO The limits of promiscuityisoform-specific dimerization of filamins Biochemistry 200342430-439

17 Pudas R Kiema TR Butler PJ Stewart M Ylanne J Structural basis for vertebratefilamin dimerization Structure 200513111-119

18 Linnemann A van der Ven PFM Vakeel P et al The sarcomeric Z-disc componentmyopodin is a multiadapter protein that interacts with filamin and alpha-actinin Eur JCell Biol 201089681-692

19 Faulkner G Pallavicini A Comelli A et al FATZ a filamin- actinin- andtelethonin-binding protein of the Z-disc of skeletal muscle J Biol Chem 200027541234-41242

20 Frey N Olson EN Calsarcin-3 a novel skeletal muscle-specific member of the calsarcinfamily interacts with multiple Z-disc proteins J Biol Chem 200227713998-14004

21 Takada F Vander Woude DL Tong HQ et al Myozenin an alpha-actinin- andgamma-filamin-binding protein of skeletal muscle Z lines Proc Natl Acad Sci U S A2001981595-1600

22 Molt S Buhrdel JB Yakovlev S et al Aciculin interacts with filaminC andXin and is essentialfor myofibril assembly remodeling and maintenance J Cell Sci 20141273578-3592

23 Gontier Y Taivainen A Fontao L et al The Z-disc proteins myotilin and FATZ-1interact with each other and are connected to the sarcolemma via muscle-specificfilamins J Cell Sci 20051183739-3749

24 van der Ven PFM Wiesner S Salmikangas P et al Indications for a novel musculardystrophy pathway gamma-filamin the muscle-specific filamin isoform interacts withmyotilin J Cell Biol 2000151235-248

25 Thompson TG Chan YM Hack AA et al Filamin 2 (FLN2) a muscle-specificsarcoglycan interacting protein J Cell Biol 2000148115-126

26 Odgerel Z van der Ven PFM Furst DO Goldfarb LG DNA sequencing errors inmolecular diagnostics of filamin myopathy Clin Chem Lab Med 2010481409-1414

27 Kley RA Maerkens A Leber Y et al A combined laser microdissection and massspectrometry approach reveals new disease relevant proteins accumulating in aggre-gates of filaminopathy patients Mol Cell Proteomics 201312215-227

28 Maerkens A Olive M Schreiner A et al New insights into the protein aggregationpathology in myotilinopathy by combined proteomic and immunolocalization anal-yses Acta Neuropathol Commun 201648

29 Kley RA Serdaroglu-Oflazer P Leber Y et al Pathophysiology of protein aggregationand extended phenotyping in filaminopathy Brain 20121352642-2660

30 van den Bogaart FJ Claeys KG Kley RA et al Widening the spectrum of filamin-Cmyopathy predominantly proximal myopathy due to the pA193T mutation in theactin-binding domain of FLNC Neuromuscul Disord 20172773-77

31 Walter MC Reilich P Huebner A et al Scapuloperoneal syndrome type Kaeser and awide phenotypic spectrum of adult-onset dominant myopathies are associated withthe desmin mutation R350P Brain 20071301485-1496

32 Ulbricht A Eppler FJ Tapia VE et al Cellular mechanotransduction relies on tension-induced and chaperone-assisted autophagy Curr Biol 201323430-435

33 Juo LY LiaoWC Shih YL Yang BY Liu AB Yan YT HSPB7 interacts with dimerizedFLNC and its absence results in progressive myopathy in skeletal muscles J Cell Sci20161291661-1670

34 Greenberg SA Salajegheh M Judge DP et al Etiology of limb girdle musculardystrophy 1D1E determined by laser capture microdissection proteomics AnnNeurol 201271141-145

35 Schessl J Zou Y McGrath MJ et al Proteomic identification of FHL1 as the proteinmutated in human reducing body myopathy J Clin Invest 2008118904-912

36 Stenson PD Mort M Ball EV et al The Human Gene Mutation Database towards acomprehensive repository of inherited mutation data for medical research geneticdiagnosis and next-generation sequencing studies Hum Genet 2017136665-677

37 Ball EV Stenson PD Abeysinghe SS Krawczak M Cooper DN Chuzhanova NAMicrodeletions and microinsertions causing human genetic disease commonmechanisms of mutagenesis and the role of local DNA sequence complexity HumMutat 200526205-213

38 Chevessier F Schuld J Orfanos Z et al Myofibrillar instability exacerbated by acuteexercise in filaminopathy Hum Mol Genet 2015247207-7220

39 Lowe T Kley RA van der Ven PFM et al The pathomechanism of filaminopathyaltered biochemical properties explain the cellular phenotype of a protein aggregationmyopathy Hum Mol Genet 2007161351-1358

NeurologyorgNG Neurology Genetics | Volume 7 Number 3 | June 2021 11

DOI 101212NXG000000000000059020217 Neurol Genet

Rudolf Andre Kley Yvonne Leber Bertold Schrank et al Data

FLNC-Associated Myofibrillar Myopathy New Clinical Functional and Proteomic

This information is current as of June 1 2021

reserved Online ISSN 2376-7839Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology All rightsan open-access online-only continuous publication journal Copyright Copyright copy 2021 The Author(s)

is an official journal of the American Academy of Neurology Published since April 2015 it isNeurol Genet

ServicesUpdated Information amp

httpngneurologyorgcontent73e590fullhtmlincluding high resolution figures can be found at

References httpngneurologyorgcontent73e590fullhtmlref-list-1

This article cites 38 articles 9 of which you can access for free at

Citations httpngneurologyorgcontent73e590fullhtmlotherarticles

This article has been cited by 1 HighWire-hosted articles

Subspecialty Collections

httpngneurologyorgcgicollectionmuscle_diseaseMuscle disease

httpngneurologyorgcgicollectionmriMRI

httpngneurologyorgcgicollectionemgEMG

httpngneurologyorgcgicollectionclinical_neurology_examinationClinical neurology examination

httpngneurologyorgcgicollectionall_geneticsAll Geneticsfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpngneurologyorgmiscaboutxhtmlpermissionsits entirety can be found online atInformation about reproducing this article in parts (figurestables) or in

Reprints

httpngneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

reserved Online ISSN 2376-7839Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology All rightsan open-access online-only continuous publication journal Copyright Copyright copy 2021 The Author(s)

is an official journal of the American Academy of Neurology Published since April 2015 it isNeurol Genet

ServicesUpdated Information amp

httpngneurologyorgcontent73e590fullhtmlincluding high resolution figures can be found at

References httpngneurologyorgcontent73e590fullhtmlref-list-1

This article cites 38 articles 9 of which you can access for free at

Citations httpngneurologyorgcontent73e590fullhtmlotherarticles

This article has been cited by 1 HighWire-hosted articles

Subspecialty Collections

httpngneurologyorgcgicollectionmuscle_diseaseMuscle disease

httpngneurologyorgcgicollectionmriMRI

httpngneurologyorgcgicollectionemgEMG

httpngneurologyorgcgicollectionclinical_neurology_examinationClinical neurology examination

httpngneurologyorgcgicollectionall_geneticsAll Geneticsfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpngneurologyorgmiscaboutxhtmlpermissionsits entirety can be found online atInformation about reproducing this article in parts (figurestables) or in

Reprints

httpngneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

reserved Online ISSN 2376-7839Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology All rightsan open-access online-only continuous publication journal Copyright Copyright copy 2021 The Author(s)

is an official journal of the American Academy of Neurology Published since April 2015 it isNeurol Genet