Quantitative Trait Locus Analysis of Neointimal...

Quantitative Trait Locus Analysis of Neointimal Formationin an Intercross Between C57BL/6 and C3H/HeJ

Apolipoprotein E–Deficient MiceZuobiao Yuan, MD, PhD; Hong Pei, MD; Drew J. Roberts, BS; Zhimin Zhang, MD;

Jessica S. Rowlan, BS; Alan H. Matsumoto, MD; Weibin Shi, MD, PhD

Background—Inbred mouse strains C57BL/6J (B6) and C3H/HeJ (C3H) exhibit marked differences in neointimalformation after arterial injury when deficient in apolipoprotein E (apoE�/�) and fed a Western diet. Quantitative traitlocus analysis was performed on an intercross between B6.apoE�/� and C3H.apoE�/� mice to determine genetic factorscontributing to the phenotype.

Methods and Results—Female B6.apoE�/� mice were crossed with male C3H.apoE�/� mice to generate F1s, which wereintercrossed to generate 204 male F2 progeny. At 10 weeks of age, F2s underwent endothelium denudation injury to the leftcommon carotid artery. Mice were fed a Western diet for 1 week before and 4 weeks after injury and analyzed for neointimallesion size, plasma lipid, and membrane cofactor protein (MCP)-1 levels. One significant quantitative trait locus, named Nih1(61 cM; LOD score, 5.02), on chromosome 12 and a suggestive locus on chromosome 13 (35 cM; LOD score, 2.67) wereidentified to influence lesion size. One significant quantitative trait locus on distal chromosome 1 accounted for majorvariations in plasma non–high-density lipoprotein cholesterol and triglyceride levels. Four suggestive quantitative trait locison chromosomes 1, 2, and 3 were detected for circulating MCP-1 levels. No correlations were observed between neointimallesion size and plasma lipid levels or between lesion size and plasma MCP-1 levels.

Conclusions—Neointimal formation is controlled by genetic factors independent of those affecting plasma lipid levels andcirculating MCP-1 levels in the B6 and C3H mouse model. (Circ Cardiovasc Genet. 2009;2:220-228.)

Key Words: atherosclerosis � hypercholesterolemia � neointimal hyperplasia � quantitative trait locus� restenosis � mice

Restenosis remains the most significant challenge limitingthe success of angioplasty treatment to atherosclerotic

cardiovascular disease. The incidence of restenosis afterarterial interventions varies from 10% to 80% within 6months, depending on the location of treatment and the typeof intervention.1 The placement of intravascular stents hasproven effective in reducing postinterventional restenosis, buta fraction of patients receiving stents develop late in-stentrestenosis. Neointimal hyperplasia is the primary cause forin-stent restenosis.2

Clinical Perspective on p 228

Accumulating evidence indicates that restenosis is not arandom phenomenon but a multifactorial disorder with astrong heritable component.3–6 Association studies have re-vealed an array of genes to be potentially involved in therestenotic process.5,7–9 However, the results should be inter-preted with caution because of small sample sizes and theheterogeneity of the patients. The difficulties inherent in

human genetic studies strongly suggest that parallel ap-proaches should be undertaken to identify genes for neointi-mal formation by using animal models.

The availability of numerous inbred mouse strains thatdiffer in injury-induced neointimal thickening provides anexperimental tool for identifying genetic factors involved inthe restenostic process. C57BL/6 (B6) and C3H mice are 2inbred strains that exhibit dramatic differences in neointimalformation when deficient in apolipoprotein E (apoE�/�) andfed a Western diet.10 B6.apoE�/� mice readily developneointimal lesions following carotid arterial endotheliumdenudation injury, whereas C3H.apoE�/� mice are almosttotally resistant to lesion formation. The dramatic differencebetween the 2 apoE�/� strains in neointimal formation isideal for conducting linkage analysis to dissect genetic factorscontributing to the phenotype. In this study, we performedquantitative trait locus (QTL) analysis of neointimal lesionsand associated traits using an intercross between B6.apoE�/�

and C3H.apoE�/� mouse strains.

Received May 15, 2008; accepted April 16, 2009.From the Departments of Radiology and of Biochemistry and Molecular Genetics, University of Virginia, Charlottesville, Va.The online-only Data Supplement is available at http://circgenetics.ahajournals.org/cgi/content/full/CIRCGENETICS.108.792499/DC1.Correspondence to Weibin Shi, MD, PhD, University of Virginia, Box 801339, Snyder 266, 480 Ray Hunt Dr, Charlottesville, VA 22908. E-mail

[email protected]© 2009 American Heart Association, Inc.

Circ Cardiovasc Genet is available at http://circgenetics.ahajournals.org DOI: 10.1161/CIRCGENETICS.108.792499

220

by guest on May 14, 2018

http://circgenetics.ahajournals.org/D

ownloaded from

by guest on M

ay 14, 2018http://circgenetics.ahajournals.org/

Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

http://circgenetics.ahajournals.org/







MethodsMiceFemale B6.apoE�/� mice were purchased from Jackson Laboratory(Bar Harbor, Me). C3H.apoE�/� mice at the N12 generation weregenerated in our laboratory. Female B6.apoE�/� mice were crossedwith male C3H.apoE�/� mice to generate F1s, which were inter-crossed by brother-sister mating to generate 204 male F2s. Mice wereweaned onto a rodent chow diet and at 9 weeks of age and wereswitched onto a Western diet containing 21% fat, 0.2% cholesterol, and19.5% casein (TD 88137; Teklad, Madison, Wis) and maintained on thediet throughout the entire experiment. All procedures were carried out inaccordance with the National Institutes of Health guidelines andapproved by the Institutional Animal Care and Use Committee.

Endothelium DenudationThe procedure for removing the endothelium of the left commoncarotid artery was performed as previously described.10,11 Briefly,mice were anesthetized by intramuscular injection of ketamine (80mg/kg; Aveco Inc) and xylazine (8 mg/kg; Lloyd Laboratories,Shenandoah, Iowa). Under a dissecting microscope, the left externalcarotid artery was ligated distally with a 6-0 silk suture and additional6-0 sutures were looped around the common and internal carotidarteries. A transverse arteriotomy was made in the left external carotidartery, and an epon-resin probe was introduced and advanced �1 cmtoward the aortic arch. Endothelial denudation of the artery wasachieved by repeated withdrawal for 3 passes. After removal of theprobe, the left external carotid artery was ligated and the skin incisionwas closed with surgical glue (Ethicon Inc, Somerville, NJ).

Plasma Lipid MeasurementsMice were fasted overnight before blood was collected throughretro-orbital puncture under ketamine and xylazine anesthesia.Plasma total cholesterol, non–high-density lipoprotein (non-HDL)cholesterol, and triglyceride levels were measured with enzymaticassays as we previously described.11

Measurements of Circulating MCP-1The same plasma samples used for lipid analysis were assessed forcirculating membrane cofactor protein (MCP)-1 levels. MCP-1 wasquantified with a sandwich ELISA technique according to themanufacturer’s instructions (R&D Systems, Minneapolis, MN).

Tissue Preparation and Lesion QuantificationThe procedure was performed as previously described.10,11 Briefly,the carotid arteries were perfusion-fixed via the left ventricle with10% formalin. After fixation in 10% formalin for more than 24hours, the front soft tissues of the neck were dissected out, andprocessed by using the standard histological technique. Serial 10-�m-thick sections were collected, starting from the disappearance ofthe left common carotid artery bifurcation, and mounted on poly-D-lysine-coated slides. On average, 400 sections were collected foreach mouse. All sections were subjected to van Gieson staining forelastic laminas. Morphometric measurements of the injured commoncarotid artery were made in every 10 sections using Image ProPlus3.0 software (Media Cybernetics, Bethesda, MD). Luminal, internal,and external elastic areas were measured, as previously described.12

GenotypingDNA was isolated from the tails of mice by using the standardphenol/chloroform extraction and ethanol precipitation method. Atotal of 125 microsatellite markers distinguishing B6 from C3H miceand covering all 19 autosomes and the X chromosome at an averageinterval of 13 cM were typed by polymerase chain reaction (PCR).The parental and F1 DNA served as controls for each marker.

Statistical AnalysisLinkage analyses of neointimal lesions, plasma lipid, and MCP-1levels were performed by using MapManager QTXb20 (http://mapmgr.roswellpark.org) and J/qtl (http://research.jax.org/faculty/churchill/software/Jqtl/index.html) software. The distributions of

trait values in F2 mice were assessed for normality with the SPSSprogram (SPSS, Chicago, Ill) by examining skewness, kurtosis,Kolmogorov-Smirnov test, and Q-Q plots. Neointimal lesion sizeswere square root transformed before QTL analysis was performed asthey were not normally distributed. Non-HDL cholesterol, triglycer-ide, and MCP-1 levels were directly used for QTL analysis. Onethousand permutations of the trait values were used to define thegenome-wide log-odds (LOD) score threshold required to be signif-icant or suggestive for each specific trait. The support interval foreach QTL was determined by using a 1-LOD drop from the QTLpeak. Variance and mode of inheritance of the traits were determinedwith MapManager and further confirmation was made with linearregression analysis. ANOVA was used to determine whether themean phenotype values of progeny with different genotypes at aspecific marker were significantly different. Differences were con-sidered statistically significant at P�0.05.

Candidate Gene AnalysisSequence comparison was made to ascertain which genes within theconfidence interval of Nih1 were polymorphic between B6 and C3Hmice by querying the National Center for Biotechnology InformationDatabase (http://www.ncbi.nlm.nih.gov/SNP/MouseSNP.cgi) andMouse Phenome Database (http://www.informatics.jax.org/javawi2/servlet/WIFetch?page�snpQF). The genes containing sequencevariations in coding regions leading to amino acid substitutions or inregulatory regions were further examined for their expression in thearterial wall of 2 parental strains by real-time PCR. Total RNA wasexacted from the aorta and carotid arteries of 6 to 10-week-oldB6.apoE�/� and C3H.apoE�/� mice fed a chow diet using Trizol,digested by DNase I, and then reverse transcribed into cDNA usingthe ThermoScript RT-PCR kit (Invitrogen, Carlsbad, CA). cDNAwas mixed with SYBR Green supermix reagent (Bio-Rad, Boston,MA) and gene-specific primers (see online-only Data Supplement).Real-time PCR on each sample was run in triplicate on an iCycler iQ5machine (Bio-Rad) under the condition of 50°C for 2 minutes, 95°C for2 minutes, then 95°C 30 seconds, 60°C 30 seconds, and 72°C 30seconds for 40 cycles. The expression of each gene was determined in3 or 4 biologically independent samples for each strain and wasnormalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Immunohistochemical AnalysisParaffin-embedded sections were stained with the following primaryantibodies: H-196, rabbit anti-human �-smooth muscle actin IgG(Santa Cruz); MCA519, rat antimouse macrophage/monocyte IgG(Serotec); H-414, rabbit antihuman Yy1 IgG (Santa Cruz); and rabbitantihuman Pacs2 IgG (provided by Dr. Gary Thomas at Vollum

Figure 1. Representative cross-sections of the injured commoncarotid artery of B6.apoE�/� and C3H.apoE�/� mice fed aWestern diet. Paraffin-embedded tissues were stained with vanGieson stain or specific antibodies against smooth muscle cellsand macrophages. Note the distinct difference between the 2strains in neointimal lesion size, the strong-actin positive arterialwall and neointimal lesions, and the focal accumulation of mac-rophages (arrow). Insets display magnified views of representa-tive areas (magnification �10 or �20).

Yuan et al Neointima QTL 221



ownloaded from


Institute, Portland, Ore). Sections were deparaffinized with xylene,followed by incubation with the primary antibodies. After a thoroughwash, the slides were incubated with a biotinylated secondaryantibody (Vector Laboratories). The reactions were visualized with aperoxidase chromogen kit (Vector Laboratories).

Sequence AnalysisThe promoter region of the Yy1 gene of B6 and C3H mice wasPCR-amplified using primers 5�-ACCTGGTCTATCGAAAGG-

AAGCAC-3�/5�-TTGCCTTTACTCGTTACTCGGG-3� and 5�-TAACGGACACACTTCCAACGGTGA-3�/5�-TCCGCGGTGCAAC-AGTGACAAA-3� and purified PCR products sequenced on a 3730DNA Analyzer (Applied Biosystems).

ResultsB6.apoE�/� mice developed prominent neointimal lesions inthe common carotid artery 4 weeks after endothelial denuda-

Figure 2. Distributions of square root–transformed neointimal lesion size, untransformed non-HDL cholesterol, triglyceride, and MCP-1levels in 204 male F2 mice derived from B6.apoE�/� and C3H.apoE�/� mice. Mice were subject to endothelium denudation injury tothe left common carotid artery and fed a Western diet for 1 week before and 4 weeks after injury.

Figure 3. A genome-wide scan with F2mice to search for loci influencing neointi-mal lesion size. Chromosomes 1 throughX are represented numerically on thex-axis. The relative width of the spaceallotted for each chromosome reflects therelative length of each chromosome. They-axis represents LOD score. Three dashlines on the plot represent LOD scorethresholds for “suggestive (P�0.63),” “sig-nificant (P�0.05),” or “highly significant(P�0.01)” QTLs as calculated by permu-tation tests.

222 Circ Cardiovasc Genet June 2009



ownloaded from


tion injury when fed the Western diet (Figure 1). In contrast,neointimal lesions were barely detectable in C3H.apoE�/�

mice. Immunohistochemical analysis with specific antibodiesagainst smooth muscle cells and macrophages revealed thatsmooth muscle cells were the primary cellular component ofneointimal lesions and a few focally accumulated macro-phages were present in the peripheral region of the lesions. Todetermine genetic factors contributing to variation in neoin-timal lesion size, we performed QTL analysis using an

intercross between the 2 apoE�/� strains. Two hundred fourmale F2 mice were analyzed for such phenotypes as neointi-mal lesion size, plasma lipid and MCP-1 levels 4 weeks afterarterial injury and were genotyped for microsatellite markersspanning the entire genome. As shown in Figure 2, the valuesof plasma non-HDL cholesterol, triglyceride, and MCP-1levels in F2 mice are approximately normally distributed. Thenormal distribution parameters obtained by examining skew-ness, kurtosis, Kolmogorov-Smirnov test, and Q-Q plot

Figure 4. Likelihood plots for neointimallesion size on chromosome 12 and chro-mosome 13. Plots were generated usingthe interval mapping function of MapManager QTX, including a bootstrap testshown as a histogram estimating the con-fidence interval of a QTL. Vertical greenlines on the plot represent significancethresholds for the likelihood-ratio statistic,indicating “suggestive (P�0.63),” “signifi-cant (P�0.05),” or “highly significant(P�0.01)” peaks as calculated by permu-tation analysis for the genome-wide sig-nificance thresholds. Black plots reflectthe likelihood-ratio statistic calculated at1-cM intervals. The red plot representsthe additive regression coefficient, andthe blue plot represents the dominantregression coefficient, indicating effect ofthe B6 allele.

Table 1. Significant and Suggestive QTLs for Neointimal Lesion Size, Plasma Non-HDL Cholesterol,Triglyceride, and MCP-1 Levels Identified in an Intercross Between B6.apoE�/� and C3H.apoE�/� Mice

Chromosome Marker, cM Trait LOD* SI, cM† Variance, %‡ Model of Inheritance§

D12mit144 (61) Lesion size 5.02 51.0 to 61.0 15 B6 dominant

D13mit250 (35) Lesion size 2.67 27 to 42.5 8 B6 dominant

D1mit270 (92.3) Non-HDL 3.31 83.0 to 104.0 7 Additive

D12mit97 (47) Non-HDL 4.00 27.0 to 59.0 9 B6 dominant



D15mit161 (69.2) Non-HDL 2.08 47.9 to 65.2 4 B6 dominant

D1mit270 (92.3) Triglyceride 4.92 82.0 to 103.5 11 Additive

D16mit165 (10.3) Triglyceride 2.70 10.3 to 15.8 6 Additive

D1mit102 (73) MCP-1 2.59 63.0 to 83.5 5 C3H dominant

D2mit263 (92.0) MCP-1 2.06 57.9 to 101.8 4 Heterosis

D3mit21 (19.2) MCP-1 2.21 11.2 to 26.4 4 B6 dominant

D3mit230 (38.3) MCP-1 2.17 31.7 to 56.46 4 B6 dominant

SI indicates support interval.*LOD scores were generated with J/qtl software. “Suggestive” or “significant” QTLs were calculated by 1000 permutation tests,

and the corresponding genome-wide significance thresholds were P�0.63 and P�0.05, respectively. The significant loci are italicizedto easily distinguish them from suggestive loci.

†SIs were defined by a 1-unit decrease in LOD score on either side of the peak.‡Variance (%), which indicates the percentage of the phenotypic variance detected in the F2 cohort under the peak marker, was

generated with MapManager QTX program.§Model of inheritance was determined by using the MapManager QTX program and further confirmation was made for loci at which

heterozygotes exhibited significantly higher or lower trait values than both homozygotes by performing linear regression using theadditive and dominant/recessive models.




ownloaded from


indicated that the values of square root-transformed lesionsizes of F2 mice approached a normal distribution.

A genome-wide scan with F2 mice revealed that a signif-icant QTL on chromosome 12 and a suggestive QTL onchromosome 13 influenced neointimal lesion size (Figure 3).Details of the QTL detected, including peak marker locus,LOD score, support interval, variance, and mode of inheri-tance, are presented in Table 1. The chromosome 12 locuspeaked near marker D12Mit144 (61 cM, LOD: 5.02) andexplained 15% of the variance in lesion size of the cross(Figure 4). We designated this QTL as Nih1 to represent thefirst QTL detected that affects neointimal lesion size in themouse. This locus exhibited a dominant inheritance pattern inthat F2s with the heterozygous BC genotype at peak markerD12Mit144 had a lesion size comparable with F2s with thehomozygous BB genotype but larger than those homozygousin the CC genotype (P�1.27�10�5; Table 2). The chromo-

some 13 locus peaked near D13Mit250 (35 cM) and had asuggestive LOD score of 2.67 (Figure 4, Table 1). This locusexplained 8% of the variance in lesion size and exhibited adominant effect from the B6 allele on the trait (Table 2).

As shown in Figure 5 and Table 1, plasma non-HDLcholesterol and triglyceride levels were each influenced by 2or more QTL. A QTL on distal chromosome 1 near D1Mit270(92.3 cM) had significant LOD scores of 3.31 for non-HDLand 4.92 for triglyceride and explained 9% and 11% of thevariance in the traits, respectively. A significant QTL onchromosome 12 near D12Mit97 (47 cM) had a significantLOD of 4.0 and accounted for 9% of the variance in non-HDLcholesterol levels. This QTL overlapped with Nhdlq12, recentlymapped in a female BXH F2 cross.13 A suggestive QTL fornon-HDL near D4Mit192 (6.3 cM; LOD: 2.18) corresponded toChol8, identified in a 129S1/SvImJXCAST/Ei intercross,14 anda QTL near D7Mit330 (57.5 cM, LOD: 2.13) corresponded to

Table 2. Effects of B6 (B) and C3H (C) alleles in Different QTLs on Neointimal Lesion Size, Plasma Lipid, and MCP-1Levels in the B6.apoE�/� and C3H.apoE�/� Intercross

Trait Peak Marker BB BC CC P

Lesion size* D12mit144 58134.0�3888.8 63368.0�7330.8 28399.0�9647.2 1.27�10�5

Lesion size D13mit250 27707.0�6085.8 36030.0�4129.0 19292.2�4964.4 0.002

Non-HDL* D1mit270 735.7�353.9 894.3�373.3 990.5�338.1 0.001

Non-HDL* D12mit97 966.9�304.1 934.6�371.0 712.7�327.6 0.0002

Non-HDL D4mit192 960.9�380.4 909.7�363.5 759.1�344.1 0.008

Non-HDL D7mit330 783.2�334.0 851.0�362.6 1007.8�377.0 0.007

Non-HDL D15mit161 859.5�340.3 819.5�367.6 1005.6�369.4 0.012

Triglyceride* D1mit270 108.2�26.1 130.8�40.1 144.3�48.5 2�10�5

Triglyceride* D16mit165 126.3�48.9 139.6�42.3 114.3�29.6 0.002

MCP-1 D1mit250 79.3�32.5 98.1�38.2 93.9�30.1 0.006

MCP-1 D2mit263 100.8�40.6 85.0�28.3 94.8�38.5 0.02

MCP-1 D3mit21 89.5�34.9 85.9�31.9 104.2�41.6 0.009

MCP-1 Demit230 86.5�40.5 87.8�27.4 103.0�39.3 0.01

Measurements are mean�SD. ANOVA was used to determine P values. The units of measurements are as follows: lesion size, �m2/section;non-HDL cholesterol and triglyceride, mg/dL; MCP-1, pg/mL. BB indicates homozygous for B6 alleles at a linked marker; CC, homozygous for C3Halleles; BC, heterozygous for B6 and C3H alleles.

*Traits with significant linkage.

Figure 5. Genome-wide scans with F2 mice to search for loci affecting plasma levels of non-HDL cholesterol and triglyceride. Chromo-somes 1 through X are numerically represented on the x-axis and the LOD scores represented on the y-axis. The LOD score thresholdsare shown on the figure.




ownloaded from


Chldq4, mapped in a MRL/MpJXSJL/J intercross.15 The QTLnear D15Mit161 for non-HDL (69.2 cM, LOD: 2.08) and theQTL near D16Mit165 (10.3 cM, LOD: 2.7) for triglyceride arenovel.

Four suggestive loci, located on chromosomes 1, 2, and 3,were detected to affect plasma MCP-1 levels of F2 mice (Table1). The chromosome 1 locus near D1Mit102 (73 cM) had asuggestive LOD score of 2.59 and explained 5% of the variancein MCP-1 levels. The chromosome 2 locus near D2Mit263 (92cM) had a LOD score of 2.06 and explained 4% of the variance.The chromosome 3 loci, peaked near D3Mit21 (19.2 cM, LOD:2.21) and D3Mit230 (38.3 cM, LOD: 2.17), respectively, eachaccounted for 4% of the variance in MCP-1 levels.

The NCBI and the Mouse Phenome databases were queriedto identify sequence differences underlying Nih1 that lead tochanges in either the structure or quantity of a gene productbetween B6 and C3H mice. Twenty-two nonsynonymoussingle-nucleotide polymorphisms (SNPs) were detected in 10and 4 gene sequences (RIKEN cDNA or expressed se-quences) and 41 SNPs were detected in the regulatory regionsof 12 genes and 7 gene sequences. The genes containingnonsynonymous SNP or/and SNP in regulatory regions werefurther examined for their expression in the arterial wall ofthe 2 strains. Three functional candidates, including Tnfaip2,Crip2, and Itgb8, were also evaluated by real-time PCR,

although their sequence information was unavailable forC3H. As shown in Table 3, Yy1 was highly expressed in C3H,Pacs2 highly expressed in B6, Traf3, Cdc42bp, Tnfaip2,Klc1, Kif26a, Inf2, Pld4, Akt1, Gpr132, Jag2, Mta1, Crip2,and Itgb8 similarly expressed in both strains, and severalother genes, including Chga, Bdkrb2, Adam6, Ptprn2, andCdca7l, were barely detectable. Bag5 and Siva1 were alsodifferentially expressed in the 2 strains when the original �ctvalues (target gene-Gapdh cycle threshold) were analyzed(supplemental Table I). Yy1, Bag5, Siva1, and Pacs2 werefurther evaluated by real-time PCR using RNA extractedfrom the uninjured carotid arteries (Table 4). The trend ofdifferences between the 2 strains in gene expression levelswas comparable in the aorta and carotid arteries. A search ofthe NCBI Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/) reveals that Yy1, Bag5, Siva1, andPacs2 are expressed in the aortic wall of C57BL/6 and C3Hmice (accession No. GDS735, GSE14854, GSE1560). Inter-estingly, a microarray study using RNA extracted from theaorta of B6.apoE�/� and C3H.apoE�/� mice also showshigher Yy1 and Bag5 expression in C3H (GSE14854).

Immunohistochemical analysis confirmed the expressionof Yy1 and Pacs2 in the arterial wall and neointimal lesions(Figure 6). For Yy1, the uninjured carotid artery was moreintensely stained in C3H than in B6, whereas the inner layer

Table 3. Real-time PCR Assessment of Expression of Candidate Genes for Nih1 in the Aortic Wall of B6.apoE�/� and C3H.apoE�/� Mice

Gene Symbol Gene Name Location (Mb) B6 C3H P SNP Type

Chga Chromogranin A 103.79 NQ NQ Reg

Bdkrb2 Bradykinin receptor, �2 106.80 NQ NQ ?

Yy1 YY1 transcription factor 110.03 26.36�9.12 78.38�34.14 0.03 Reg

Traf3 Tnf receptor-associated factor 3 112.49 6.38�2.10 10.71�6.43 0.33 Reg

Cdc42bp Cdc42 binding protein kinase beta 112.56 36.37�11.81 34.01�17.22 0.83 CN

Tnfaip2 Tumor necrosis factor, �-induced protein 2 112.68 32.08�21.08 50.28�57.56 0.86 ?

Bag5 BCL2-associated athanogene 5 112.95 12.40�3.92 34.29�21.44 0.09 CN

Klc1 Kinesin light chain 1 113.03 42.04�6.01 47.31�14.38 0.52 Reg

Kif26a Kinesin family member 26A 113.41 0.91�0.38 0.89�0.72 0.97 CN, Reg

Inf2 Inverted formin, FH2 and WH2 domaincontaining

113.85 33.59�13.08 51.10�21.46 0.21 CN, Reg

Siva1 SIVA1, apoptosis-inducing factor 113.87 8.25�2.66 23.91�14.78 0.08 CN

Akt1 Thymoma viral proto-oncogene 1 113.89 29.14�4.90 56.28�24.12 0.073 Reg

Pld4 Phospholipase D family, member 4 114.01 2.09�0.34 1.47�0.89 0.24 Reg

Gpr132 G protein-coupled receptor 132 114.10 NQ NQ Reg

Jag2 Jagged 2 114.15 5.39�3.17 5.84�2.41 0.83 CN

Pacs2 Phosphofurin acidic cluster sorting protein 2 114.31 8.11�3.36 2.61�1.36 0.02 CN, Reg

Mta1 Metastasis associated 1 114.37 30.79�2.60 29.21�9.48 0.76 CN

Crip2 Cysteine rich protein 2 114.38 71.76�29.90 89.21�54.86 0.6 ?

Adam6 A disintegrin and metallopeptidase domain 6 115.24 NQ NQ Reg

Ptprn2 Protein tyrosine phosphatase, receptor type, Npolypeptide 2

118.09 NQ NQ CN

Cdca7l Cell division cycle associated 7 like 119.11 NQ NQ CN, Reg

Itgb8 Integrin beta 8 120.47 6.91�3.53 7.44�3.54 0.86 ?

Gene expression levels are expressed as copy number of candidate gene mRNA relative to 1000 copies of GAPDH mRNA. Results are mean�SD of 3 to 4 biologicallyindependent samples for each strain. Total RNA was prepared from the aorta of 6- to 10-week-old mice fed a chow diet.

NQ indicates expression level too low to accurately quantify; CN, coding nonsynonymous polymorphism resulting in amino acid substitution; Reg, regulatory region;?, sequence information unavailable.




ownloaded from


of neointimal lesions was more intensely stained in B6than in C3H. Pacs2 showed endothelial staining in theuninjured artery but diffuse staining of the medial layerand neointimal lesions in the injured artery. We sequencedthe promoter region of the Yy1 gene for B6 and C3H miceand found 5 SNPs (�A1445G, �A1443C, �C1435A,�A1354C, and �G1304T) and a 10-bp deletion (�1351 to�1342: TTTTTAAATA) in C3H (Figure 7).

DiscussionB6.apoE�/� and C3H.apoE�/� mice exhibit marked differ-ences in neointimal formation following the carotid endothe-lium denudation injury when fed a Western diet. In this study,we performed QTL analysis using an intercross derived fromthe 2 apoE�/� strains to search for genetic factors contribut-ing to neointimal formation and associated traits. We identi-fied one significant QTL on chromosome 12 and one sugges-tive QTL on chromosome 13 for neointimal lesions,replicated 7 QTLs for plasma lipids, and detected 4 sugges-tive QTLs for circulating MCP-1.

Inbred strains B6 and C3H are prototype mouse models forgenetic studies of atherosclerosis. B6 mice readily developatherosclerosis whereas C3H mice are resistant when fed anatherogenic diet or deficient in apoE.16,17 Using intercrossesderived from the 2 strains, we and others have identifiedseveral QTLs contributing to the development of atheroscle-rosis.12,18–20 However, the study of various mouse strains has

shown that genetic susceptibility to injury-induced neointimalhyperplasia is distinct from susceptibility to atherosclerosis asstrains susceptible to atherosclerosis are resistant to neointi-mal hyperplasia and vice versa.21 Thus, genetic factorsidentified for atherosclerosis might not reflect genetic controlof neointimal hyperplasia. ApoE�/� mice represent an animalmodel in which spontaneous hyperlipidemia and atheroscle-rosis occur on a low fat, low cholesterol diet. Because mostrestenosis patients have a history of hyperlipidemia andatherosclerosis, apoE�/� mice are obviously a more suitablemodel for the study of restenosis than wild-type mice. In thisstudy, using a F2 cross derived from the 2 apoE�/� strains, weidentified a significant QTL, named Nih1, on distal chromo-some 12 and a suggestive QTL on chromosome 13 thataffected neointimal lesion size. The chromosome 12 QTLmapped to the distal region (61 cM), and the B6 alleleconferred the increased neointimal lesion formation at thelocus. This locus did not overlap with any atherosclerosisQTLs mapped in genetic crosses derived from B6 and C3Hmice,12,13,18–20 suggesting that neointimal hyperplasia andatherosclerosis are controlled by separate genetic factors.Indeed, the pathology of these 2 vascular disorders is quitedifferent: the neointimal lesion consists largely of vascularsmooth muscle cells, although macrophages are also present(Figure 1), whereas macrophages are the major cellularcomponent of atherosclerotic lesions at all stages and smoothmuscle cells only become prominent in the advanced stage.22

B6 and C3H are among the inbred mouse strains whosewhole genome sequences and genetic variants have been wellcharacterized. Thus, we perused all genes within the confi-dence interval of Nih1 to detect sequence variants that maycontribute to the quantitative trait. Flint et al23 have analyzed20 cloned QTL genes in rodents and found that all of themhave sequence variations in coding or regulatory regionsleading to changes in structure, quantity, or both of a geneproduct. One probable candidate for Nih1 is Yy1, a ubiquitousand zinc finger transcription factor. Expression of this generesults in inhibition of neointima growth in human, rabbit,and rat blood vessels.24 We found that Yy1 expression levelsin uninjured arterial walls were higher in C3H than in B6 byreal-time PCR and immunohistochemistry. A higher expres-sion of Yy1 by arterial wall cells would lead to a greaterinhibition of neointimal formation in C3H. The strong ex-

Table 4. Real-time PCR Assessment of 4 Potential CandidateGenes for Nih1 in the Carotid Arteries of B6.apoE�/� andC3H.apoE�/� Mice

Gene Symbol B6 C3H P

Yy1 15.50�1.53 30.45�4.57 0.0008

Bag5 10.74�1.70 25.42�16.22 0.12

Siva1 5.14�1.84 14.37�2.77 0.0015

Pacs2 11.61�2.92 5.19�1.89 0.01

Yy1, Bag5, Siva1, and Pacs2 were differentially expressed in the aorta of 2parental strains when the original Dct values (target gene-Gapdh cyclethreshold) were analyzed (supplementary TABLE). These 4 genes were furtherevaluated by real-time PCR using RNA extracted from the uninjured carotid arteriesof 6- to 10-week-old mice fed a chow diet. Gene expression levels are expressedas copy number of candidate gene mRNA relative to 1000 copies of GAPDH mRNA.Results are mean�SD of 4 biologically independent samples for each strain.

Figure 6. Representative light photo-graphs of immunohistochemical analysisof Yy1 and Pacs2 expression in thecarotid arteries with or without endotheli-um denudation injury. Sections werestained with rabbit polyclonal antibodiesagainst Yy1 and Pacs2. Insets displaymagnified views of representative areas(magnification �20).




ownloaded from


pression of Yy1 by proliferating neointima might also regulateits growth. We identified a 10-bp deletion and 5 SNPs in thepromoter region of Yy1, which could be responsible for thehigher baseline expression in C3H. Other probable candidates inthe region are 3 apoptosis-related genes, including Bag5, Siva1,and Pacs2. Apoptosis or programmed cell death of vascularsmooth muscle cells plays a critical role in injury-inducedneointimal hyperplasia.25 These 3 genes exhibited nonsynony-mous polymorphisms between B6 and C3H and were differen-tially expressed in the arterial wall of the 2 strains.

In this study, we found that QTL on distal chromosome 1contributed to variations in plasma non-HDL cholesterol andtriglyceride levels in the F2 cross. This finding is consistentwith previous observations made with female F2 crossesbetween B6.apoE�/� and C3H.apoE�/� mice.12,13 Hyperlip-idemia has been considered responsible for aggravated neo-intimal formation of apoE�/� or LDLR�/� mice on a West-ern diet.10,11 However, the present study of F2 mice hasdemonstrated that neointimal formation is independent ofplasma lipid levels in that the size of neointimal lesions wasnot correlated with plasma non-HDL cholesterol or triglyc-eride levels (data not shown). A previous observation thatB6.apoE�/� mice developed 5-fold larger neointimal lesionsthan C3H.apoE�/� mice despite their comparable levels ofplasma low-density lipoprotein, or low-density lipoproteinand HDL cholesterol on a chow diet10 also suggests thatfactors other than plasma lipids contribute to differentialneointimal formation of the B6 and C3H strains.

In this study, we detected 4 suggestive QTLs that influ-enced plasma levels of MCP-1 in apoE�/� mice, althoughnone of them overlapped with neointimal lesion QTLs.MCP-1 is the prototypical CC chemokine that is induced bynoxious stimuli such as oxidized low-density lipoprotein,endotoxin, and mechanical forces in a variety of cells,including smooth muscle cells, endothelial cells, macro-phages, and fibroblasts. We previously observed a distinctdifference between B6 and C3H mice in the induction of MCP-1by oxidized low-density lipoprotein in arterial wall cells.17,26

Because MCP-1 functions in the recruitment of monocytes, the

expression of this proinflammatory molecule by vascular wallcells is expected to lead to monocyte recruitment to injuredarterial walls and promote neointimal formation. However, thepresent study of F2 mice has suggested a less significant role forthis chemokine in differential neointimal growth of the B6 andC3H strains because the size of neointimal lesions was notcorrelated with MCP-1 levels.

In summary, this study has identified the first significantQTL for neointimal hyperplasia, which does not overlap withloci for atherosclerotic lesions identified from previouscrosses derived from the same parental strains. Moreover, wefound no correlations between neointimal lesion size and plasmalipid levels or between lesion size and plasma MCP-1 levels.Thus, our findings indicate that neointimal formation is con-trolled by genetic factors independent of those affecting plasmalipid levels and circulating MCP-1 levels in hyperlipidemicmice.

Sources of FundingThis work was supported by National Institutes of Health grantHL082881.

DisclosuresNone.

References1. Duda SH, Poerner TC, Wiesinger B, Rundback JH, Tepe G, Wiskirchen

J, Haase KK. Drug-eluting stents: potential applications for peripheralarterial occlusive disease. J Vasc Interv Radiol. 2003;14:291–301.

2. Fattori R, Piva T. Drug-eluting stents in vascular intervention. Lancet.2003;361:247–249.

3. Monraats PS, Pires NM, Agema WR, Zwinderman AH, Schepers A, de MaatMP, Doevendans PA, de Winter RJ, Tio RA, Waltenberger J, Frants RR,Quax PH, van Vlijmen BJ, Atsma DE, van der Laarse A, van der Wall EE,Jukema JW. Genetic inflammatory factors predict restenosis after percuta-neous coronary interventions. Circulation. 2005;112:2417–2425.

4. Petrovic D, Peterlin B. Genetic markers of restenosis after coronaryangioplasty and after stent implantation. Med Sci Monit. 2005;11:RA127–RA135.

5. Monraats PS, Kurreeman FA, Pons D, Sewgobind VD, de Vries FR,Zwinderman AH, de Maat MP, Doevendans PA, de Winter RJ, Tio RA,Waltenberger J, Huizinga TW, Eefting D, Quax PH, Frants RR, van derLaarse A, van der Wall EE, Jukema JW. Interleukin 10: a new risk marker

Figure 7. Selected sequence traces of the pro-moter region of the Yy1 gene for B6 and C3Hmice. Differences between the 2 strains in nu-cleotides are highlighted. Partial sequences ofthe Yy1 promoter region are not presentedbecause no sequence difference has beenfound between the 2 strains.




ownloaded from


for the development of restenosis after percutaneous coronary inter-vention. Genes Immun. 2007;8:44–50.

6. Pons D, Monraats PS, de Maat MP, Pires NM, Quax PH, van Vlijmen BJ,Rosendaal FR, Zwinderman AH, Doevendans PA, Waltenberger J, deWinter RJ, Tio RA, Frants RR, van der Laarse A, van der Wall EE,Jukema JW. The influence of established genetic variation in the haemo-static system on clinical restenosis after percutaneous coronary inter-ventions. Thromb Haemost. 2007;98:1323–1328.

7. Agema WR, Jukema JW, Zwinderman AH, van der Wall EE. A meta-analysis of the angiotensin-converting enzyme gene polymorphism andrestenosis after percutaneous transluminal coronary revascularization:evidence for publication bias. Am Heart J. 2002;144:760–768.

8. Kastrati A, Koch W, Berger PB, Mehilli J, Stephenson K, Neumann FJ,von Beckerath N, Bottiger C, Duff GW, Schomig A. Protective roleagainst restenosis from an interleukin-1 receptor antagonist gene poly-morphism in patients treated with coronary stenting. J Am Coll Cardiol.2000;36:2168–2173.

9. Monraats PS, Rana JS, Nierman MC, Pires NM, Zwinderman AH,Kastelein JJ, Kuivenhoven JA, de Maat MP, Rittersma SZ, Schepers A,Doevendans PA, de Winter RJ, Tio RA, Frants RR, Quax PH, van derLaarse A, van der Wall EE, Jukema JW. Lipoprotein lipase gene poly-morphisms and the risk of target vessel revascularization after percuta-neous coronary intervention. J Am Coll Cardiol. 2005;46:1093–1100.

10. Shi W, Pei H, Fischer JJ, James JC, Angle JF, Matsumoto AH, Helm GA,Sarembock IJ. Neointimal formation in two apolipoprotein E-deficientmouse strains with different atherosclerosis susceptibility. J Lipid Res.2004;45:2008–2014.

11. Tian J, Pei H, Sanders JM, Angle JF, Sarembock IJ, Matsumoto AH,Helm GA, Shi W. Hyperlipidemia is a major determinant of neointimalformation in LDL receptor-deficient mice. Biochem Biophys ResCommun. 2006;345:1004–1009.

12. Su Z, Li Y, James JC, McDuffie M, Matsumoto AH, Helm GA, WeberJL, Lusis AJ, Shi W. Quantitative trait locus analysis of atherosclerosis inan intercross between C57BL/6 and C3H mice carrying the mutantapolipoprotein E gene. Genetics. 2006;172:1799–1807.

13. Li Q, Li Y, Zhang Z, Gilbert TR, Matsumoto AH, Dobrin SE, Shi W. Quanti-tative trait locus analysis of carotid atherosclerosis in an intercross betweenC57BL/6 and C3H apolipoprotein E-deficient mice. Stroke. 2008;39:166–173.

14. Lyons MA, Wittenburg H, Li R, Walsh KA, Korstanje R, Churchill GA,Carey MC, Paigen B. Quantitative trait loci that determine lipoproteincholesterol levels in an intercross of 129S1/SvImJ and CAST/Ei inbredmice. Physiol Genomics. 2004;17:60–68.

15. Srivastava AK, Mohan S, Masinde GL, Yu H, Baylink DJ. Identificationof quantitative trait loci that regulate obesity and serum lipid levels inMRL/MpJ x SJL/J inbred mice. J Lipid Res. 2006;47:123–133.

16. Paigen B, Morrow A, Brandon C, Mitchell D, Holmes P. Variation insusceptibility to atherosclerosis among inbred strains of mice.Atherosclerosis. 1985;57:65–73.

17. Shi W, Wang NJ, Shih DM, Sun VZ, Wang X, Lusis AJ. Determinants ofatherosclerosis susceptibility in the C3H and C57BL/6 mouse model:evidence for involvement of endothelial cells but not blood cells orcholesterol metabolism. Circ Res. 2000;86:1078–1084.

18. Wang X, Ria M, Kelmenson PM, Eriksson P, Higgins DC, Samnegård A,Petros C, Rollins J, Bennet AM, Wiman B, de Faire U, Wennberg C, OlssonPG, Ishii N, Sugamura K, Hamsten A, Forsman-Semb K, Lagercrantz J,Paigen B. Positional identification of TNFSF4, encoding OX40 ligand, as agene that influences atherosclerosis susceptibility. Nat Genet. 2005;37:365–372.

19. Wang SS, Shi W, Wang X, Velky L, Greenlee S, Wang MT, Drake TA,Lusis AJ. Mapping, genetic isolation, and characterization of genetic locithat determine resistance to atherosclerosis in C3H mice. ArteriosclerThromb Vasc Biol. 2007;27:2671–2676.

20. Wang SS, Schadt EE, Wang H, Wang X, Ingram-Drake L, Shi W, DrakeTA, Lusis AJ. Identification of pathways for atherosclerosis in mice:integration of quantitative trait locus analysis and global gene expressiondata. Circ Res. 2007;101:e11–e30.

21. Kuhel DG, Zhu B, Witte DP, Hui DY. Distinction in genetic determinantsfor injury-induced neointimal hyperplasia and diet-induced atherosclero-sis in inbred mice. Arterioscler Thromb Vasc Biol. 2002;22:955–960.

22. Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughoutthe arterial tree. Arterioscler Thromb. 1994;14:133–140.

23. Flint J, Valdar W, Shifman S, Mott R. Strategies for mapping and cloningquantitative trait genes in rodents. Nat Rev Genet. 2005;6:271–286.

24. Santiago FS, Ishii H, Shafi S, Khurana R, Kanellakis P, Bhindi R,Ramirez MJ, Bobik A, Martin JF, Chesterman CN, Zachary IC,Khachigian LM. Yin Yang-1 inhibits vascular smooth muscle cell growthand intimal thickening by repressing p21WAF1/Cip1 transcription andp21WAF1/Cip1-Cdk4-cyclin D1 assembly. Circ Res. 2007;101:146–155.

25. Mnjoyan ZH, Doan D, Brandon JL, Felix K, Sitter CL, Rege AA, BrockTA, Fujise K. The critical role of the intrinsic VSMC proliferation anddeath programs in injury-induced neointimal hyperplasia. Am J Physiol.2008;294:H2276–H2284.

26. Miyoshi T, Tian J, Matsumoto AH, Shi W. Differential response of vascularsmooth muscle cells to oxidized LDL in mouse strains with different atheroscle-rosis susceptibility. Atherosclerosis. 2006;189:99–105.

CLINICAL PERSPECTIVEOne common and effective treatment for atherosclerotic vascular disease is angioplasty/stenting. One major problem encounteredafter such treatment is in-stent stenosis caused primarily by neointimal hyperplasia. Identification of genes contributing toneointimal hyperplasia may lead to the development of novel therapeutic approaches for limiting restenosis after angioplasty/stening. Inbred mouse strains C57BL/6J (B6) and C3H/HeJ (C3H) exhibit marked differences in neointimal formation whendeficient in apolipoprotein E (apoE�/�) and fed a Western diet. An intercross between B6.apoE�/� and C3H.apoE�/� mice wasconstructed to map chromosomal regions affecting neointimal formation. We identified one statistically significant quantitativetrait locus, named Nih1, on chromosome 12 and a suggestive locus on chromosome 13 that contributed to neointimal lesion size.Of note, we found no correlation between neointimal lesion size and plasma lipid levels or between lesion size and plasmaMCP-1 concentrations. Thus, our findings indicate that neointimal formation in hyperlipidemic mice is controlled by geneticfactors that are likely independent of those affecting plasma lipid and circulating MCP-1 concentrations.




ownloaded from


Matsumoto and Weibin ShiZuobiao Yuan, Hong Pei, Drew J. Roberts, Zhimin Zhang, Jessica S. Rowlan, Alan H.

Deficient Mice−C57BL/6 and C3H/HeJ Apolipoprotein E Quantitative Trait Locus Analysis of Neointimal Formation in an Intercross Between

Print ISSN: 1942-325X. Online ISSN: 1942-3268 Copyright © 2009 American Heart Association, Inc. All rights reserved.

Dallas, TX 75231is published by the American Heart Association, 7272 Greenville Avenue,Circulation: Cardiovascular Genetics

doi: 10.1161/CIRCGENETICS.108.7924992009;2:220-228; originally published online April 21, 2009;Circ Cardiovasc Genet.

http://circgenetics.ahajournals.org/content/2/3/220World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circgenetics.ahajournals.org/content/suppl/2009/04/22/CIRCGENETICS.108.792499.DC2Data Supplement (unedited) at:

http://circgenetics.ahajournals.org//subscriptions/

is online at: Circulation: Cardiovascular Genetics Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer information about this process is available in the

requested is located, click Request Permissions in the middle column of the Web page under Services. FurtherCenter, not the Editorial Office. Once the online version of the published article for which permission is being

can be obtained via RightsLink, a service of the Copyright ClearanceCirculation: Cardiovascular Geneticsin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:



ownloaded from

http://circgenetics.ahajournals.org/content/2/3/220

http://circgenetics.ahajournals.org/content/suppl/2009/04/22/CIRCGENETICS.108.792499.DC2

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circgenetics.ahajournals.org//subscriptions/


SUPPLEMENTAL MATERIALS

Supplementary Table 1. Real-time PCR assessment of expression of candidate genes for Nih1 in the aortic wall of B6.apoE-/-

and C3H.apoE-/-

mice.

Gene symbol Gene name Location (Mb)

Gene number per 1000 copies of Gapdh

Ct value (Fold change) difference with Gapdh

SNP type

B6 C3H P value B6 C3H

P value

Chga Chromogranin A 103.79 NQ NQ NQ NQ Reg Bdkrb2 Bradykinin receptor, β2 106.8 NQ NQ NQ NQ ? Yy1 YY1 transcription factor 110.03 26.36±9.12 78.38±34.14 0.03 5.31±0.49 3.78±0.69 0.02 Reg Traf3 Tnf receptor-associated factor 3 112.49 6.38±2.10 10.71±6.43 0.33 7.35±0.51 6.75±0.51 0.4 Reg Cdc42bp Cdc42 binding protein kinase beta 112.56 36.37±11.81 34.01±17.22 0.83 4.84±0.49 4.99±0.63 0.72 CN Tnfaip2 Tumor necrosis factor, α-induced protein 2 112.68 32.08±21.08 50.28±57.56 0.86 5.33±1.44 4.97±1.64 0.79 ? Bag5 BCL2-associated athanogene 5 112.95 12.40±3.92 34.29±21.44 0.09 6.38±0.43 5.04±0.76 0.02 CN Klc1 Kinesin light chain 1 113.03 42.04±6.01 47.31±14.38 0.52 4.58±0.20 4.47±0.52 0.69 Reg

Kif26a Kinesin family member 26A 113.41 0.91±0.38 0.89±0.72 0.97 10.22±0.68 10.52±1.25 0.69CN, Reg

Inf2 Inverted formin, FH2 and WH2 domain containing 113.85 33.59±13.08 51.10±21.46 0.21 4.98±0,55 4.39±0.63 0.21CN, Reg

Siva1 SIVA1, apoptosis-inducing factor 113.87 8.25±2.66 23.91±14.78 0.08 7.00±0.57 5.61±0.94 0.05 CN Akt1 Thymoma viral proto-oncogene 1 113.89 29.14±4.90 56.28±24.12 0.07 5.12±0.25 4.27±0.75 0.08 Reg Pld4 Phospholipase D family, member 4 114.01 2.09±0.34 1.47±0.89 0.24 8.92±0.23 9.63±0.91 0.18 Reg Gpr132 G protein-coupled receptor 132 114.1 NQ NQ NQ NQ Reg Jag2 Jagged 2 114.15 5.39±3.17 5.84±2.41 0.83 7.69±0.73 7.51±0.58 0.68 CN

Pacs2 Phosphofurin acidic cluster sorting protein 2 114.31 8.11±3.36 2.61±1.36 0.02 7.04±0.61 8.75±0.83 0.02CN, Reg

Mta1 Metastasis associated 1 114.37 30.79±2.60 29.21±9.48 0.76 5.03±0.12 5.17±0.54 0.63 CN Crip2 Cysteine rich protein 2 114.38 71.76±29.90 89.21±54.86 0.6 3.92±0.70 3.70±0.92 0.72 ? Adam6 A disintegrin and metallopeptidase domain 6 115.24 NQ NQ NQ NQ Reg

Ptprn2 Protein tyrosine phosphatase, receptor type, N polypeptide 2 118.09 NQ NQ NQ NQ CN

Cdca7l Cell division cycle associated 7 like 119.11 NQ NQ NQ NQ CN, Reg

Itgb8 Integrin beta 8 120.47 6.91±3.53 7.44±3.54 0.86 7.34±0.89 7.22±0.85 0.87 ? Gene expression levels are expressed as minus cycle threshold (-ΔCt, or fold change) relative to Gapdh. Results are means ± SD of 3~4 biologically independent samples for each strain. Total RNA was prepared from the aorta of 6~10 week-old mice fed a chow diet. NQ: expression level too low to accurately quantify; CN: Coding nonsynonymous polymorphism resulting in amino acid substitution; Reg: regulatory region; ?: sequence information unavailable.

Supplementary Table 2. Real-time PCR assessment of four candidate genes for Nih1 in the carotid arteries of B6.apoE-/-

and C3H.apoE-/-

mice.

Gene symbol Gene number per 1000 copies of Gapdh Ct value (Fold change) difference with Gapdh B6 C3H P Value B6 C3H P value Yy1 15.50±1.53 30.45±4.57 0.0008 6.02±0.14 5.05±0.22 0.0003Bag5 10.74±1.70 25.42±16.22 0.12 6.55±0.22 5.48±0.77 0.04Siva1 5.14±1.84 14.37±2.77 0.0015 7.70±0.65 6.14±0.28 0.005Pacs2 11.61±2.92 5.19±1.89 0.01 6.47±0.39 7.68±0.60 0.01Gene expression levels are expressed as minus cycle threshold (-ΔCt, or fold change) relative to Gapdh. Results are means ± SD of 4 biologically independent samples for each strain.

Primers used for real-time PCR: Gene Forward primer (5'-3') Reverse primer (5'-3') Akt1 TATTGGCTACAAGGAACGGCCTCA TGTCTTCATCAGCTGGCATTGTGC Crip2 TGTCCCAAGTGTGACAAGACCGTA CTTTGGGTCCAAACAGTGTGGCAT Yy1 CTTGCCCTCATAAAGGCTGCACAA TTGAGCTCTCAACGAACGCTTTGC Traf3 CAAGAGCATCCAAAGCCTGCACAA TGGACTCGTTGTTTCGGAGCATCT Tnfaip2 TGCAGATAAAGCAGTTGCTGCTGG ATTTCTGCTCCACGGAAGTCCAGA Chga ACAACAGGATGGCTTTGAGGCAAC ATTGGGTATTGGTGGCTGTGTCCT Cdca7l AGTTTCGGTCTTCGGGTAGCCTTT TTGGGCTGTCTGGAGCTCTTCTTT Bdkrb2 GGCCTCCTTTGGCATCGAAATGTT ACACGCTGAGGACAAAGAGGTTCT Klc1 AGGCAGAAACGCTGTACAAGGAGA AGGCTTTATACCAGCCGCCATACT Kif26 TTTGACATTGGAGTTGCTGCCACC ACTCCATCCCACATTACGCTCACA Inf2 ACAGCAGGGCATCGAATACATCCT AGAGCAGCCAGCAATTCAAACACC Pld4 AGTATTTCCCTACCACGCGCTTCA AAAGCCTGCAGGGACCTCAGATAA Gpr132 TCGGCAAGAAGTGTCCAGAATCCA TAAACCTAGCTTCGCTGGCTGTGA Pacs TGCCAAGCAGATGTTGCTCTTGTG TCTGAGCAGCAGAAGCCTAAAGGT Cdc42bp AGCTGAGGAAGGTCAAAGACAGCA AAGTTTGAGCCCTGTATCCGCTCT Gag5 ATCTGCGCGGTACAGGAGGTTATT TGTTCACCTCGCACATGACAGAGT Sova1 ATGTTGATTGGACCTGATGGCCGA TCATGCACGATGAACAAGCGATGG Jag2 ACTACTACAGTGCCACCTGCAACA TTTGCATTCTTTGCCCATCCAGCC Mta1 ACCAAGTCGGAATCTCCTGCTCAA TGGTCTCTTCGGTGGCCATGTAAA Ptprn2 GAGCAGTTTGAGTTTGCGCTGACA TATCCTGTTGCGGTTCTGGAAGCA Adam6 ATGAATGCATGGAAGCACTGGAGC GAATGGGTTGCTTGAAAGTGGCCT

Quantitative Trait Locus Analysis of Neointimal...

Documents

Transcript of Quantitative Trait Locus Analysis of Neointimal...