Ang II-AT2R increases mesenchymal stem cell migration by ......100 nM Ang II, and/or were pretreated...

RESEARCH Open Access

Ang II-AT2R increases mesenchymal stemcell migration by signaling through the FAKand RhoA/Cdc42 pathways in vitroXiu-ping Xu1, Hong-li He2, Shu-ling Hu1, Ji-bin Han1, Li-li Huang1, Jing-yuan Xu1, Jian-feng Xie1, Ai-ran Liu1,Yi Yang1 and Hai-bo Qiu1*

Abstract

Background: Mesenchymal stem cells (MSCs) migrate via the bloodstream to sites of injury and are possiblyattracted by inflammatory factors. As a proinflammatory mediator, angiotensin II (Ang II) reportedly enhances themigration of various cell types by signaling via the Ang II receptor in vitro. However, few studies have focused onthe effects of Ang II on MSC migration and the underlying mechanisms.

Methods: Human bone marrow MSCs migration was measured using wound healing and Boyden chamber migrationassays after treatments with different concentrations of Ang II, an AT1R antagonist (Losartan), and/or an AT2R antagonist(PD-123319). To exclude the effect of proliferation on MSC migration, we measured MSC proliferation after stimulationwith the same concentration of Ang II. Additionally, we employed the focal adhesion kinase (FAK) inhibitor PF-573228,RhoA inhibitor C3 transferase, Rac1 inhibitor NSC23766, or Cdc42 inhibitor ML141 to investigate the role of cell adhesionproteins and the Rho-GTPase protein family (RhoA, Rac1, and Cdc42) in Ang II-mediated MSC migration. Cell adhesionproteins (FAK, Talin, and Vinculin) were detected by western blot analysis. The Rho-GTPase family proteinactivities were assessed by G-LISA and F-actin levels, which reflect actin cytoskeletal organization, were detected byusing immunofluorescence.

Results: Human bone marrow MSCs constitutively expressed AT1R and AT2R. Additionally, Ang II increased MSCmigration in an AT2R-dependent manner. Notably, Ang II-enhanced migration was not mediated by Ang II-mediatedcell proliferation. Interestingly, Ang II-enhanced migration was mediated by FAK activation, which was critical for theformation of focal contacts, as evidenced by increased Talin and Vinculin expression. Moreover, RhoA and Cdc42 wereactivated by FAK to increase cytoskeletal organization, thus promoting cell contraction. Furthermore, FAK, Talin, andVinculin activation and F-actin reorganization in response to Ang II were prevented by PD-123319 but not Losartan,indicating that FAK activation and F-actin reorganization were downstream of AT2R.

Conclusions: These data indicate that Ang II-AT2R regulates human bone marrow MSC migration by signalingthrough the FAK and RhoA/Cdc42 pathways. This study provides insights into the mechanisms by which MSCs hometo injury sites and will enable the rational design of targeted therapies to improve MSC engraftment.

Keywords: Mesenchymal stem cells, Angiotensin II, AT1R, AT2R, Cell migration, Focal adhesion kinase, Rho GTPases,F-actin

* Correspondence: [email protected] of Critical Care Medicine, Nanjing Zhongda Hospital, School ofMedicine, Southeast University, Nanjing 210009, People’s Republic of ChinaFull list of author information is available at the end of the article

© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Xu et al. Stem Cell Research & Therapy (2017) 8:164 DOI 10.1186/s13287-017-0617-z

http://crossmark.crossref.org/dialog/?doi=10.1186/s13287-017-0617-z&domain=pdfmailto:[email protected]://creativecommons.org/licenses/by/4.0/http://creativecommons.org/publicdomain/zero/1.0/

BackgroundMesenchymal stem cells (MSCs) are stem cells for theconnective tissues, including bone, cartilage, adipose tis-sue, and the tendon, and like other adult stem cells,MSCs take part in the repair processes of many injuredtissues and organs [1]. A prerequisite for these cells toparticipate in tissue repair is migration of injected MSCsto the damaged tissues [2]. When injected intravenously,MSCs appear to preferentially home to sites of injury[3], which has been observed in tissue injuries that occurin the bone [4], liver [5], brain [6], and heart [7]. How-ever, mechanisms regarding how MSCs migrate into theinjured tissue remain unknown.Injured tissues and organs release various factors includ-

ing chemoattractants, growth factors, and inflammatoryfactors, which can recruit MSCs to the injured site [8]. Inaddition to being a physiological mediator that restorescirculatory integrity, angiotensin II (Ang II) has also beenreported to be involved in key events of the inflammatoryprocess and tissue damage [9]. Together with being a pro-inflammatory mediator, Ang II participates in numerouslife processes, including cell proliferation, apoptosis, andmigration. In particular, Ang II has been proved to be achemoattractant that directs the migration of smoothmuscle cells [10], human umbilical vein endothelial cells[11], cardiac fibroblasts [12], human breast cancer cells[13], and naive T cells [14]. Accordingly, it is assumed thatAng II might be a key inflammatory factor that mediatesMSC migration to sites of injury.Ang II transduces cell signaling upon binding to its re-

ceptors, namely angiotensin II type 1 receptor (AT1R)and angiotensin II type 2 receptor (AT2R). However, noconsensus has been reached on the subtype of Ang II re-ceptors that mediates the migration of different celltypes [10, 13]. Thus, there is a need to investigate the re-ceptor subtypes and associated signaling pathways inAng II-induced MSC migration. Moreover, previousstudies have shown that Ang II can lead to the formationof focal contacts and cell contraction [15], which are thekey steps in the process of cell migration [16]. Focal ad-hesion kinase (FAK) [17] functions as an adaptor proteinto recruit other focal contact proteins or their regulators,which affects the assembly or disassembly of focal con-tacts. Meanwhile, FAK influences the activity of Rho--family GTPases (RhoA, Rac, and Cdc42) [18], whichinvolves the dynamic remodeling of the actin cytoskel-eton that drives cell migration. Herein, we speculatedthat FAK and the Rho-family GTPases might be involvedin Ang II-increased MSC migration.In this study, we demonstrate that Ang II-AT2R pro-

motes MSC migration. Furthermore, we found that theFAK, RhoA, and Cdc42 signaling pathways were involvedin Ang II-increased migration. In brief, Ang II-AT2R signal-ing through activation of the FAK and RhoA/Cdc42

pathways plays a critical role in MSC migration and mayguide AT2R-targeted therapy to improve the efficiency ofMSC engraftment in clinical applications.

MethodsHuman MSC culture and stimulationHuman bone marrow MSCs were purchased from Cya-gen Biosciences Inc. (Guangzhou, China). The cells wereidentified by detecting cell surface markers and the MSCmultipotent potential for differentiation toward theadipogenic, osteogenic, and chondrogenic lineages; cells weremaintained as described previously [19]. Cells were passagedevery 3–4 days using 0.25% trypsin–EDTA (Gibco) when theyreached approximately 80% confluence and were used for theexperimental protocols between passages 5 and 10 [20].For the Ang II treatments, MSCs were serum starved

for 6–8 h, and different concentrations of Ang II wereadded for 24 h or as indicated in the figures. To inhibitthe activities of AT1R, AT2R, FAK, RhoA, Rac1, andCdc42, cells were pretreated with AT1R antagonistLosartan (5 μM; Sigma-Aldrich, St. Louis, MO, USA),AT2R antagonist PD-123319 (5 μM; Tocris Biosciences,Bristol, UK), FAK inhibitor PF-573228 (5 μg/ml; TocrisBiosciences), RhoA inhibitor C3 transferase (5 μg/ml; Cyto-skeleton, Denver, CO, USA), Rac1 inhibitor NSC23766(50 μM; Tocris Biosciences) [21], or Cdc42 inhibitorML141 (5 μg/ml; Tocris Biosciences) for 30 min.

RNA isolation and quantitative real-time RT-PCRCells were collected, and total RNA was extracted fromcells using Trizol and quantified. Reverse transcriptionwas performed using the HiScript Q RT SuperMix(Vazyme, Piscataway , NJ, USA) for qPCR with 500 ng ofRNA according to the manufacturer’s instructions (25 °Cfor 10 min followed by 30 min at 42 °C and an add-itional 5 min at 85 °C). The qRT-PCR reactions wereperformed using the AceQ qPCR SYBR Green MasterMix (Vazyme, Piscataway, NJ, USA) and the StepOnePlus Real Time PCR System (Life Technologies) usingthe cDNA produced earlier. Relative changes in gene ex-pression were normalized to the expression levels ofGAPDH and calculated using the 2(–△△Ct) method. Theprimer sequences used for PCR amplification in our

Table 1 Primer sequences used for PCR amplification

Gene Primer sequence (5′–3′)

AGTR1(122 bp, NM_032049.3)

Forward: GGAAACAGCTTGGTGGTGAT

Reverse: GCCCATAGTGGCAAAGTCA

AGTR2(100 bp, NM_000686.4)

Forward: ACATCTTCAACCTCGCTGTG

Reverse: ACAGGTCCAAAGAGCCAGTC

GAPDH(138 bp, NM_002046)

Forward: CAGGAGGCATTGCTGATGAT

Reverse: GAAGGCTGGGGCTCATTT

Xu et al. Stem Cell Research & Therapy (2017) 8:164 Page 2 of 13

study were designed based on the sequences of the gen-omic clones and are presented in Table 1.The cDNA was amplified with initial incubation at 95 °C

for 5 min followed by 40 cycles of 10 s at 95 °C and 30 s at60 °C, and an additional extension step at the end of thelast cycle (60 s at 60 °C and 15 s at 95 °C). The PCR-amplified products were analyzed on 2.0% agarose gels,visualized by staining with ethidium bromide, and photo-graphed under a UV light.

Wound-healing assay (scratch assay)MSCs were grown on six-well plates until the cells were70–80% confluent. After 24 h, the cells reached 100%confluence, were serum starved for 6 h and treated with100 nM Ang II, and/or were pretreated with AT1R,AT2R, FAK, RhoA, Rac1, or Cdc42 antagonists. Awound was generated by scraping the cell monolayerswith a pipette tip. A nearby reference point was gener-ated using a needle as described previously [22]. At leastfive randomly chosen areas were quantified using ImageJsoftware (NIH, Bethesda, MD, USA). Experiments wererepeated three times, and an individual photograph waschosen as a representation.

Transwell migration assayModified Boyden chamber assays were conducted usingTranswell polyester membrane filter inserts with 8-μmpores (Corning Inc., Corning, NY, USA) at a density of500,000 cells/ml per Transwell (upper chamber) as de-scribed previously [22]. Different coculture conditionswere used in the bottom chambers of the Transwells as in-dicated in the figures. After culturing for 12 h, the cellsfrom the upper chambers of the Transwells were removed,and the migrated cells on the undersides of the mem-branes were stained with crystal violet (Beyotime, Haimen,China). Migratory cells were imaged and counted under alight microscope (Olympus, Tokyo, Japan).

Cell proliferationThe proliferation of human bone marrow MSCswas analyzed by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium (MTT; Sigma, St. Louis, MO) assay.Briefly, 3×103 human BM-MSCs in 200µl DMEM/F12supplemented with 10% FBS were plated in 96-well cul-ture plates. Grown overnight and then replaced withserum-free DMEM/F12 for an additional 6 h, then thecells were treated with different concentration of Ang II(10-8, 10-7, 10-6, 10-5, 3×10-5M)for another 24h. 20µl ofMTT (5 mg/ml) was added to the cells, and the plateswere incubated in the CO2 incubator for 4 h. The result-ing formazan was then solubilized in 150 µl of dimethylsulfoxide (DMSO; Sigma) and quantified by measuringthe absorbance value (OD, optical density) of each well

at 565 nm. There were six duplicate wells in each group,and the experiment was repeated at least three times.

Western blot analysisTotal protein from cells was extracted using RIPA lysisbuffer with 1 mmol/L phenylmethylsulfonyl fluoride(PMSF) (Beyotime, Haimen, China). The protein contentof the cell lysates was determined using the BCA method,and approximately 20 μg of total protein was used foreach sample. Protein samples were resolved by SDS-PAGE and electrophoretically transferred onto PVDFmembranes (Millipore, Bedford, MA, USA). After beingblocked in 5% milk or BSA for 2 h, the membranes wereincubated with FAK, Talin, Vinculin, and β-actin primaryantibodies (Cell Signaling Technology, Danvers, MA,USA) at 4 °C overnight. The primary antibodies were de-tected with their corresponding horseradish peroxidase-conjugated secondary antibodies (HuaAn Biotechnology,Hangzhou, China). Immunoreactive bands were obtainedusing a chemiluminescence imaging system (ChemiQ4800 mini; Ouxiang, Shanghai, China).

F-actin staining by fluorescence microscopyCells were grown on glass coverslips until they were ap-proximately 50% confluent and washed with PBS at 37 °C,followed by fixation with 4% paraformaldehyde in PBS for10 min at room temperature. Cells were then washed andpermeabilized with 0.5% Triton-X in PBS for 5 min. Afterwashing, phalloidin-conjugated rhodamine (Cytoskeleton)was added at 100 nM in 200 μl of PBS. After 30-min incu-bation in the dark, slides were washed and stained with 4',6-diamidino-2-phenylindole (DAPI, Beyotime, Haimen,China). After mounting with anti-fade mounting media,samples were examined with a microscope (Olympus)equipped with fluorescent illumination and a digitalcharge-coupled-device (CCD) camera.

Rho GTPase activity assayGTP-bound RhoA, Rac1, and Cdc42 were measuredusing corresponding G-LISA Activation Assay Kits(Cytoskeleton). After stimulation, cells were washedtwice with cold PBS and lysed using the lysis buffer pro-vided by the kits for 15 min on ice, and the lysates werecentrifuged at 10,000 × g for 1 min at 4 °C. Supernatantswere aliquoted, snap-frozen in liquid nitrogen, andstored at –80 °C, as indicated by the manufacturer’sprotocol. Protein concentrations were determined, andRho GTPase activity was assessed according to themanufacturer’s instructions.

Statistical analysisAll statistical analyses were performed using SPSS, ver-sion 20.0 (SPSS Inc., Chicago, IL, USA). Experimentswere statistically analyzed by one-way analysis of


variance (ANOVA) followed by Bonferroni’s post-hoctest. Statistical significance was determined at p < 0.05.Data are presented as the mean ± standard deviation(SD).

ResultsHuman bone marrow MSCs constitutively express AT1Rand AT2RCells were harvested at confluence under normal condi-tions for expression analyses of AT1R and AT2R mRNA,measured by RT-PCR. Determinations were made fromtwo identical groups of human bone marrow MSCs. Theresults demonstrated that cultured human bone marrowMSCs in vitro expressed both AT1R and AT2R mRNA.Moreover, the AT2R mRNA expression levels werehigher than that of the AT1R mRNA (Fig. 1).

Ang II promotes the migration of human bone marrowMSCs via AT2RTo determine the dose-dependent effects of Ang II oncell migration, MSCs were treated with concentrationsof 10–8, 10–7, 10–6, 10–5, and 3 × 10–5 M Ang II inscratch assays and Transwell assays. Ang II-induced cellmigration occurred in a dose-dependent manner, with amaximal response obtained at 10–7 M (100 nM) Ang II(Fig. 2). To define the roles of AT1R and AT2R in AngII-mediated MSC migration, AT1R antagonist Losartan(5 μM) and/or AT2R antagonist PD123319 (5 μM) wereadded 30 min prior to the Ang II treatment. PD123319

significantly inhibited Ang II-induced migration, whileLosartan had no effect (Fig. 3). The results showed thatthe MSC migration induced by Ang II was mainlymediated by AT2R.To determine whether different concentrations of Ang

II could influence the level of receptor expression, wemeasured the expression levels of AT1R and AT2RmRNA. The results showed that the AT1R and AT2RmRNA levels were increased in proportion with theconcentration of Ang II. However, the AT1R mRNAlevel induced by Ang II was maximal at the concentra-tion of 10–5 M, whereas the AT2R mRNA level wasmaximal at the concentration of 10–7 M. Thereafter,both diminished progressively to the baseline (Fig. 4).These data confirmed that Ang II-AT2R increased

MSC migration, which was consistent with the AT2Rexpression levels.

Ang II-induced MSC migration is not mediated throughcell proliferationTo verify whether Ang II-induced MSC migration re-sulted from the proliferative effects of Ang II, we per-formed MTT assays to measure MSC proliferation afterstimulations with different concentrations of Ang II.Fig. 5 shows that Ang II had no effect on MSC prolifera-tion, which further suggests that the Ang II-increasedMSC migration was not mediated by proliferation.

Involvement of FAK, RhoA, and Cdc42 in Ang II-enhancedmigration of MSCsGiven that the activation of FAK can affect cell adhesion[17] and the activities of Rho-family GTPases (RhoA,Rac1, and Cdc42) [18] that are essential for cell migra-tion, we investigated the effect of FAK and the Rho-fam-ily GTPases on Ang II-induced MSC migration.Migration was assessed after pretreatments with an FAKinhibitor (PF-573228), RhoA inhibitor (C3 transferase),Rac1 inhibitor (NSC23766), or Cdc42 inhibitor (ML141)in the presence of Ang II. The results showed that theFAK, RhoA, and Cdc42 inhibitors prevented Ang II-enhanced MSC migration, whereas the Rac1 inhibitorhad no effect (Fig. 6).These results demonstrated that FAK, RhoA, and

Cdc42 were involved in the Ang II-enhanced MSCmigration.

FAK is critical for the formation of focal contacts by MSCsafter Ang II stimulationStudies have suggested that FAK is important for theformation of focal contacts, which mediate cell adhe-sion [17]; we therefore assessed the expression of thekey adhesion proteins, namely Talin and Vinculin, bywestern blot analysis after Ang II stimulation follow-ing pretreatments with or without FAK inhibitor

Fig. 1 Expression of AT1R and AT2R mRNA in human bone marrowMSCs. Representative examples of phosphor images show AT1R andAT2R receptor analysis by RT-PCR using total RNA isolated from humanbone marrow MSCs. Lanes 1 and 2, AT1R expression in human bonemarrow MSCs. Lanes 5 and 6, AT2R expression in human bone marrowMSCs. GAPDH gene used as the internal loading control (lanes 3 and 4).AT1R angiotensin II type 1 receptor, AT2R angiotensin II type 2 receptor


PF-573228. We found that Ang II increased the ex-pression of FAK, Talin, and Vinculin, which are im-portant proteins that form structural focal contracts(Fig. 7). However, when stimulated with Ang II andPF-573228, MSCs showed significant decreases in theexpression of FAK (Fig. 7a, b), Talin (Fig. 7a, c), andVinculin (Fig. 7a, d) compared with the Ang II group.These data suggested that FAK was critical for theformation of focal contacts in the Ang II-increasedmigration of MSCs.

RhoA and Cdc42 activation by FAK induces F-actinorganization in MSCs after stimulation with Ang IIFAK also influences the activities of Rho-familyGTPases, which participate in the dynamic remodelingof the actin cytoskeleton that drives cell migration [18].F-actin cytoskeleton networks can regulate cellular shapechanges and force the migration of MSCs [23]. There-fore, we observed the actin structure by staining cellswith rhodamine phalloidin as a probe for filamentousactin after treatments with the FAK or Rho-familyGTPase inhibitors. We observed that MSCs stimulatedby Ang II displayed more noticeable stress fibers.

Meanwhile, the FAK, RhoA, or Cdc42 inhibitor pretreat-ments decreased F-actin organization successfully, whilethe Rac1 inhibitor pretreatment did not (Fig. 8a).To further validate the effect of FAK on the activ-

ities of the Rho-family GTPases, we detected the ac-tivities of RhoA, Rac1, and Cdc42 after PF-573228treatment. The results indicated that FAK inhibitioncould significantly inhibit the activation of RhoA andCdc42, which was consistent with actin organization(Fig. 8b).These results suggested that the Ang II-increased mi-

gration required FAK to activate RhoA and Cdc42,which control F-actin organization in MSCs.

Ang II induces the expression of focal adhesion proteinsand the alignment of F-actin via AT2R in MSCsTo explore whether the increased expression of focal ad-hesion proteins and alignment of F-actin induced byAng II was mediated through AT2R, we measured focaladhesion protein expression after the Ang II receptorwas blocked. We found that when stimulated with AngII and PD123319, MSCs showed significant decreases inthe expression of FAK (Fig. 9a, b), Talin (Fig. 9a, c), and

Fig. 2 Effect of different concentrations of Ang II on migration of human bone marrow MSCs. a Nondirectional migration ability of human bonemarrow MSCs after stimulations with different concentrations of Ang II (10–8, 10–7, 10–6, 10–5, and 3 × 10–5 M) examined using the scratch assay.Wound sites (areas cleared of cells in the center of the scratched area) were observed and photographed at 0 and 24 h (200×). b Quantitativeresults of wound healing. c Directional migration ability of human bone marrow MSCs after stimulations with the different concentrations of AngII indicated examined using the Transwell migration assay. Migrated cells on the bottom surfaces of the Transwell inserts were stained withcrystal violet and observed under a microscope (200×). d Quantitative results of cell migration. n = 3; *p < 0.05 vs normal. Ang II angiotensin II


Fig. 3 Effect of AT1R and AT2R antagonists on Ang II-mediated migration of MSCs. a Nondirectional migration ability of MSCs after stimulationwith 100 nM Ang II following pretreatment with Losartan (5 μM) and/or PD-123319 (5 μM) examined with the scratch assay. Wound sites (areas cleared ofcells in the center of the scratched area) were observed and photographed at 0 and 24 h (200×). b Quantitative results of wound healing. c Directionalmigration ability of MSCs after stimulation with 100 nM Ang II following pretreatment with Losartan (5 μM) and/or PD-123319 (5 μM) examined using theTranswell migration assay. Migrated cells on the bottom surfaces of the Transwell inserts were stained with crystal violet and observed under a microscope(200×). d Quantitative results of cell migration. Significant differences were found compared with the normal group (n= 3; *p< 0.05) and compared withthe control group (n= 3; #p< 0.05). Ang II angiotensin II

Fig. 4 Effect of different concentrations of Ang II on AT1R and AT2R mRNA expression in human bone marrow MSCs. AT1R mRNA (a) and AT2RmRNA (b) expression determined by quantitative PCR after stimulations with different concentrations of Ang II (10–8, 10–7, 10–6, 10–5, and 3 × 10–5

M) for 12 h. Ang II angiotensin II, AT1R angiotensin II type 1 receptor, AT2R angiotensin II type 2 receptor


Vinculin (Fig. 9a, d) and in the alignment of F-actin(Fig. 10) compared with the Ang II group, while Losar-tan had no effect. This result was consistent with thecorresponding migration results, suggesting that theFAK and RhoA/Cdc42 pathways were downstream ofAT2R.

DiscussionIn this study, we showed that Ang II can promote themigration of MSCs in an AT2R-dependent manner.Moreover, we proved that Ang II-enhanced migration ismediated by FAK activation. On the one hand, FAK acti-vation forms the focal contacts that enhance cell adhe-sion. On the other hand, RhoA and Cdc42 are activatedby FAK to increase the cytoskeletal organization, thuspromoting cell contraction. In addition, the formation offocal contacts and organization of the cytoskeleton aremediated through AT2R. Taken together, Ang II-AT2Rmediates MSC migration through the FAK and RhoA/Cdc42 pathways in vitro ( Fig. 11).

Fig. 6 Roles of FAK and Rho GTPases in the migration of MSCs. a Nondirectional migration ability of MSCs after stimulation with Ang II and/orinhibitors of FAK and the Rho GTPases examined using the scratch assay. Wound sites (areas cleared of cells in the center of the scratched area)were observed and photographed at 0 and 24 h (200×). b Quantitative results of wound healing. c Directional migration ability of MSCs afterstimulation with Ang II and/or inhibitors of FAK and the Rho GTPases examined using the Transwell migration assay. Migrated cells on thebottom surfaces of the Transwell inserts were stained with crystal violet and observed under a microscope (200×). d Quantitative results of cellmigration. n = 3; *p < 0.05 vs normal, #p < 0.05 vs the control group. Ang II angiotensin II

Fig. 5 Effect of Ang II on the proliferation of MSCs. MSCs were stimulatedwith different concentrations of Ang II (10–8, 10–7, 10–6, 10–5, and 3 × 10–5

M) for 24 h. Cells cultured under normal conditions served as the baseline.The proliferation rate of MSCs following stimulation was evaluated usingthe MTT assay. Significant differences were found compared with thenormal group (n= 3; *p< 0.05 vs normal). Ang II angiotensin II, ODoptical density


The utilization of MSC transplantation to enhancetherapeutic effects has been reported previously [8].However, the invasive character of local transplantationmight be not feasible for widespread clinical application.Thus, a successful systemic transplantation and the mi-gratory ability of MSCs toward sites of injury are essen-tial for enhancing the healing process [24]. Mostimportantly, this process is controlled by several inflam-matory factors that are released at the injured site, whichpromote the recruitment of MSCs [25, 26]. Undoubt-edly, Ang II is involved in key events of the inflamma-tory process and contributes to the recruitment ofinflammatory cells into the injured tissue [9]; thismotivated our investigation of whether Ang II couldpromote the migration of MSCs. Our result demon-strated that Ang II significantly enhanced the migrationof MSCs in a dose-dependent manner. This is the firsttime we have demonstrated that Ang II can promote themigration of human bone marrow MSCs.Only a few studies have shown that human MSCs

express Ang II receptors. It is known that these two re-ceptors are expressed in the monkey and human HS-5stromal cell line at the protein level [27]. Nevertheless,AT2R mRNA was not detected in human MSCs [27].

However, our study detected not only AT1R mRNA butalso AT2R mRNA in cultured human bone marrowMSCs. In accordance with our findings, human MSCsexpress both Ang II receptors at the mRNA level [28,29]. We did not analyze the protein expression ofAT1R and AT2R because the commercially availableAT1R [30, 31] and AT2R [32] antibodies are nonspe-cific. Thus, the determination of mRNA expressionremains the only reliable approach to date for exam-ining AT1R and AT2R expression. However, thedifferent AT2R gene expression patterns in humanMSCs can be attributed to the different sources ofthe cells or cell lineages. Furthermore, after stimula-tion using different concentrations of Ang II, the ex-pression of both receptors was increased to differentlevels, which suggests that the expression level corre-lates with receptor function.Previous studies have demonstrated that Ang II stimu-

lates cellular proliferation of different types of cells, in-cluding smooth muscle cells [33], hepatic stellate cells[34], and cardiac fibroblasts [35]. Additionally, Ang II isknown to promote the proliferation of hematopoieticstem cells (HSCs) [36]. To exclude the effect of Ang II-mediated stimulation of proliferation on the migration

Fig. 7 FAK contributed to the formation of focal contacts in Ang II-mediated migration of MSCs. a–d Immunoblot analysis of the total cell lysatesperformed using antibodies against FAK, Talin, and Vinculin in MSCs pretreated with Ang II (100 nM) and/or FAK inhibitor PF-573228 (5 μg/ml). Statisticallysignificant differences are indicated (n= 3; *p< 0.05 vs normal, #p< 0.05 vs the Ang II group). Ang II angiotensin II, FAK focal adhesion kinase


of human bone marrow MSCs, we investigated MSCproliferation using the same concentration of Ang II andfound that Ang II had no effect on cell proliferation.However, Zhang et al. [37] reported that exogenous ap-plications of Ang II could increase mouse MSC prolifer-ation. This discrepancy might be explained by thedifferent species origins of the MSCs. Based on thesefindings, we conclude that Ang II-induced human bonemarrow MSC migration is not mediated through the ef-fects of Ang II on proliferation.The role of the Ang II receptors in cell migration is

less clear. We found that PD123319 inhibits Ang II-induced migration of MSCs in both the scratch andTranswell culture assays. Meanwhile, the migrationenhanced by Ang II is consistent with the AT2R ex-pression. In accordance with our findings, a recentstudy showed that PD123319 inhibits the angiotensin-induced migration of porcine vascular smooth musclecells [10]. In contrast, PD123319 has been shown to

enhance the Ang II-induced migration of keratino-cytes, suggesting an inhibitory action of AT2R in cellmigration [38]. There are also several studies showingthat AT2R does not contribute to the effect of Ang IIon the migration of vascular smooth muscle cells [39]or monocytes [40]. Intriguingly, Zhao et al. [13]showed that Ang II plays an important role in pro-moting human breast cancer cell migration via AT1R.These apparent discrepancies concerning the role ofAng II receptors on migration could be attributed tocell line differences.We next investigated potential pathways that partici-

pate in Ang II-enhanced migration. In this study, wefound that Ang II enhanced the expression of FAK inhuman bone marrow MSCs. Moreover, blocking FAK[41] using a small molecule inhibitor, PF-573228, effect-ively reduced Ang II-induced MSC migration to baselinelevels, thus indicating that FAK plays an important rolein Ang II-induced MSC migration.

Fig. 8 Role of FAK and Rho GTPases on F-actin organization after Ang II stimulation. a Immunofluorescence analysis of F-actin polymerization performedusing rhodamine phalloidin (F-actin; red–orange). Nuclei were stained with DAPI (blue). An overlay of the two fluorescent signals is shown (scale bars= 20 μm).b–d A colorimetric ELISA-based assay was used to estimate the Rho GTPase activity levels in cell lysates. Statistically significant differences are indicated (n= 3;*p< 0.05 vs normal, #p< 0.05 vs the control group). Ang II angiotensin II, OD optical density, DAPI 4', 6-diamidino-2-phenylindole


Cell adhesion and cell contraction are crucial steps incell migration and have been reviewed recently in detailby Nitzsche et al. [24] for the mechanisms of MSCmigration. FAK not only affects the assembly or disas-sembly of focal contacts but also influences the activityof Rho-family GTPases. The regulation of the Rho familyof small GTPases, which includes RhoA, Rac1, and

Cdc42, is essential for controlling the dynamics of theactin cytoskeleton and actin-associated adhesions dur-ing polarized cell migration [42]. Therefore, anotherimportant finding in our study showed that PF-573228 not only inhibits the expression of focal adhe-sion proteins which decrease cell adhesion but alsoinhibits the activity of RhoA and Cdc42, which

Fig. 9 Role of Ang II receptors on the activation of focal adhesion proteins. a–d Immunoblot analysis of the total cell lysates performed withantibodies against FAK, Talin, and Vinculin in MSCs pretreated with Ang II (100 nM) and/or Losartan (5 μM) and PD-123319 (5 μM). Statisticallysignificant differences are indicated (n = 3; *p < 0.05 vs normal, #p < 0.05 vs control). Ang II angiotensin II, FAK focal adhesion kinase

Fig. 10 Role of Ang II receptors on F-actin polymerization. MSCs were stimulated with 100 nM Ang II after pretreatment with Losartan and/or PD-123319. Immunofluorescence analysis was performed using rhodamine phalloidin (F-actin; red–orange). Nuclei were stained with DAPI (blue). An overlayof the two fluorescent signals is shown (scale bars= 20 μm). Ang II angiotensin II, DAPI 4', 6-diamidino-2-phenylindole


decreases formation of the F-actin network. Further-more, the RhoA and Cdc42 inhibitors can individuallyreverse the enhanced migration of MSCs that is in-duced by Ang II. These results suggest that Ang IIenhances MSC migration by signaling through theFAK and RhoA/Cdc42 pathways. It has been shownthat high targeted migration of human MSCs is asso-ciated with enhanced activation of RhoA [43], whichis consistent with our results. Similarly, Cdc42 activa-tion has also been demonstrated to enhance cellmigration in human corneal endothelial cells [44].One unanticipated finding was that Rac1 had no rolein Ang II-mediated migration. The reason for this isunclear, but may have something to do withdifferences in cell type.Perhaps the most significant idea in this study is the

suggestion by these findings of a novel and unique rolefor AT2R in mediating MSC migration in response toAng II and the establishment of FAK and RhoA/Cdc42as a downstream target of AT2R. However, we will needto verify the function of AT2R in MSCs using animalmodels in future studies. It should be noted that Ang IIwas shown to play a role in the osteogenesis of MSCs[29] and to enhance the paracrine production of VEGFin rat MSCs [45]. Therefore, the effect of Ang II at thesame concentration on the differentiating ability andparacrine action of MSCs warrants future studies.

ConclusionsIn summary, our experiments demonstrate that Ang II-AT2R activates FAK, leading to the formation of focalcontacts and RhoA/Cdc42 mediating organization of thecytoskeleton, which together increase the migration ofMSCs. These findings advance our understanding of themechanisms underlying MSC homing to injury sites andenable investigators and clinicians to directly modulatethe functions of these cells with the ultimate goal of

generating more potent MSCs for therapeutic applica-tions toward human diseases.

AbbreviationsAng II: Angiotensin II; AT1R: Angiotensin II type 1 receptor; AT2R: Angiotensin IItype 2 receptor; DMEM/F12: Dulbecco’s modified Eagle’s medium/nutrient mixtureF-12; FAK: Focal adhesion kinase; FBS: Fetal bovine serum; HSC: Hematopoieticstem cell; MSC: Mesenchymal stem cell; MTT: Methyl-thiazolyl-tetrazolium;PMSF: Phenylmethylsulfonyl fluoride; RT-PCR: Reverse-transcriptase polymerasechain reaction

AcknowledgementsNot applicable.

FundingThis study was supported by the National Natural Science Foundation ofChina (81372093, 81501705, and 81571874), the Fundamental ResearchFunds for the Central Universities, and the Graduate Innovation Project inJiangsu Province of China (KYLX15_0181). The funding body had no role inthe design of the study and collection, analysis, and interpretation of dataand in writing the manuscript.

Availability of data and materialsAll data generated or analyzed during this study are included in this publishedarticle.

Authors’ contributionsX-pX and H-lH conceived and designed the study. X-pX, S-lH, J-bH, and L-lHperformed the experiments and assembled and interpreted the data. X-pX,H-lH, J-yX, J-fX, and A-rL analyzed and interpreted the data and wrote themanuscript. YY and H-bQ analyzed and interpreted the data and reviewedthe manuscript critically. All authors read and approved the final manuscript.

Ethics approval and consent to participateNot applicable.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.

Fig. 11 Schematic of Ang II-AT2R-increased MSC migration by signaling through the FAK and RhoA/Cdc42 pathways. Ang II-AT2R activates FAK,leading to the formation of focal contacts and organization of the cytoskeleton, which is mediated by RhoA and Cdc42, and increases the migration ofMSCs. Ang II angiotensin II, AT1R angiotensin II type 1 receptor, AT2R angiotensin II type 2 receptor, FAK focal adhesion kinase


Author details1Department of Critical Care Medicine, Nanjing Zhongda Hospital, School ofMedicine, Southeast University, Nanjing 210009, People’s Republic of China.2Department of Critical Care Medicine, Affiliated Hospital of University ofElectronic Science and Technology of China & Sichuan Provincial People’sHospital, Chengdu 610072, People’s Republic of China.

Received: 11 April 2017 Revised: 6 June 2017Accepted: 20 June 2017

References1. Li L, Jiang J. Regulatory factors of mesenchymal stem cell migration into

injured tissues and their signal transduction mechanisms. Front Med.2011;5(1):33–9. doi:10.1007/s11684-011-0114-1.

2. Kholodenko IV, Konieva AA, Kholodenko RV, Yarygin KN. Molecularmechanisms of migration and homing of intravenously transplantedmesenchymal stem cells. J Regen Med Tissue Eng. 2013;2(1):2. doi:10.7243/2050-1218-2-4.

3. Ortiz LA, Gambelli F, McBride C, Gaupp D, Baddoo M, Kaminski N, et al.Mesenchymal stem cell engraftment in lung is enhanced in response tobleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci US A. 2003;100(14):8407–11. doi:10.1073/pnas.1432929100.

4. Dimitriou R, Tsiridis E, Giannoudis PV. Current concepts of molecular aspects ofbone healing. Injury. 2005;36(12):1392–404. doi:10.1016/j.injury.2005.07.019.

5. Sotnikova NV, Stavrova LA, Gur'antseva LA, Khrichkova TY, Fomina TI,Vetoshkina NV, et al. Mechanisms of the effects of granulocytic CSF ontissue reparation during chronic CCl4-induced damage to the liver. Bull ExpBiol Med. 2005;140(5):644–7. doi:10.1007/s10517-006-0044-0.

6. Hellmann MA, Panet H, Barhum Y, Melamed E, Offen D. Increased survivaland migration of engrafted mesenchymal bone marrow stem cells in 6-hydroxydopamine-lesioned rodents. Neurosci Lett. 2006;395(2):124–8. doi:10.1016/j.neulet.2005.10.097.

7. Wu GD, Bowdish ME, Jin YS, Zhu H, Mitsuhashi N, Barsky LW, et al.Contribution of mesenchymal progenitor cells to tissue repair in rat cardiacallografts undergoing chronic rejection. J Heart Lung Transplant. 2005;24(12):2160–9. doi:10.1016/j.healun.2005.05.017.

8. Sohni A, Verfaillie CM. Mesenchymal stem cells migration homing andtracking. Stem Cells Int. 2013;2013:130763. doi:10.1155/2013/130763.

9. Suzuki Y, Ruiz-Ortega M, Lorenzo O, Ruperez M, Esteban V, Egido J.Inflammation and angiotensin II. Int J Biochem Cell Biol. 2003;35(6):881–900.doi:10.1016/s1357-2725(02)00271-6.

10. Louis S, Saward L, Zahradka P. Both AT(1) and AT(2) receptors mediateproliferation and migration of porcine vascular smooth muscle cells. Am J PhysiolHeart Circ Physiol. 2011;301(3):H746–56. doi:10.1152/ajpheart.00431.2010.

11. Martini A, Bruno R, Mazzulla S, Nocita A, Martino G. Angiotensin II regulatesendothelial cell migration through calcium influx via T-type calcium channelin human umbilical vein endothelial cells. Acta Physiol (Oxf). 2010;198(4):449–55. doi:10.1111/j.1748-1716.2009.02070.x.

12. Siddesha JM, Valente AJ, Sakamuri SS, Yoshida T, Gardner JD, Somanna N, et al.Angiotensin II stimulates cardiac fibroblast migration via the differentialregulation of matrixins and RECK. J Mol Cell Cardiol. 2013;65:9–18. doi:10.1016/j.yjmcc.2013.09.015.

13. Zhao Y, Wang H, Li X, Cao M, Lu H, Meng Q, et al. Ang II-AT1R increases cellmigration through PI3K/AKT and NF-kappaB pathways in breast cancer. JCell Physiol. 2014;229(11):1855–62. doi:10.1002/jcp.24639.

14. Silva-Filho JL, Souza MC, Henriques MG, Morrot A, Savino W, Caruso-Neves C, et al. Renin-angiotensin system contributes to naive T-cellmigration in vivo. Arch Biochem Biophys. 2015;573:1–13. doi:10.1016/j.abb.2015.02.035.

15. Mehta PK, Griendling KK. Angiotensin II cell signaling: physiological andpathological effects in the cardiovascular system. Am J Physiol Cell Physiol.2007;292(1):C82–97. doi:10.1152/ajpcell.00287.2006.

16. Ridley AJ, Schwartz MA, Burridge K, Firtel RA, Ginsberg MH, Borisy G, et al.Cell migration: integrating signals from front to back. Science. 2003;302(5651):1704–9. doi:10.1126/science.1092053.

17. Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in commandand control of cell motility. Nat Rev Mol Cell Biol. 2005;6(1):56–68.doi:10.1038/nrm1549.

18. Jaffe AB, Hall A. Rho GTPases: biochemistry and biology. Annu Rev Cell DevBiol. 2005;21:247–69. doi:10.1146/annurev.cellbio.21.020604.150721.

19. Chen QH, Liu AR, Qiu HB, Yang Y. Interaction between mesenchymal stemcells and endothelial cells restores endothelial permeability via paracrinehepatocyte growth factor in vitro. Stem Cell Res Ther. 2015;6:44. doi:10.1186/s13287-015-0025-1.

20. Lee JW, Krasnodembskaya A, McKenna DH, Song Y, Abbott J, Matthay MA.Therapeutic effects of human mesenchymal stem cells in ex vivo humanlungs injured with live bacteria. Am J Respir Crit Care Med. 2013;187(7):751–60.doi:10.1164/rccm.201206-0990OC.

21. Liu L, He H, Liu A, Xu J, Han J, Chen Q, et al. Therapeutic effects of bonemarrow-derived mesenchymal stem cells in models of pulmonary andextrapulmonary acute lung injury. Cell Transplant. 2015;24(12):2629–42. doi:10.3727/096368915X687499.

22. Cai SX, Liu AR, He HL, Chen QH, Yang Y, Guo FM, et al. Stable geneticalterations of beta-catenin and ROR2 regulate the Wnt pathway, affect thefate of MSCs. J Cell Physiol. 2014;229(6):791–800. doi:10.1002/jcp.24500.

23. Lee SK, Kim Y, Kim SS, Lee JH, Cho K, Lee SS, et al. Differential expression ofcell surface proteins in human bone marrow mesenchymal stem cellscultured with or without basic fibroblast growth factor containing medium.Proteomics. 2009;9(18):4389–405. doi:10.1002/pmic.200900165.

24. Nitzsche F, Muller C, Lukomska B, Jolkkonen J, Deten A, Boltze J. ConciseReview: MSC adhesion cascade-insights into homing and transendothelialmigration. Stem Cells. 2017;35(6):1446–60. doi:10.1002/stem.2614.

25. Fu X, Han B, Cai S, Lei Y, Sun T, Sheng Z. Migration of bone marrow-derivedmesenchymal stem cells induced by tumor necrosis factor-alpha and itspossible role in wound healing. Wound Repair Regen. 2009;17(2):185–91.doi:10.1111/j.1524-475X.2009.00454.x.

26. Meng E, Guo Z, Wang H, Jin J, Wang J, Wang H, et al. High mobility groupbox 1 protein inhibits the proliferation of human mesenchymal stem cellsand promotes their migration and differentiation along osteoblasticpathway. Stem Cells Dev. 2008;17(4):805–13. doi:10.1089/scd.2008.0276.

27. Richmond RS, Tallant EA, Gallagher PE, Ferrario CM, Strawn WB. Angiotensin IIstimulates arachidonic acid release from bone marrow stromal cells. J ReninAngiotensin Aldosterone Syst. 2004;5(4):176–82. doi:10.3317/jraas.2004.037.

28. Matsushita K, Wu Y, Okamoto Y, Pratt RE, Dzau VJ. Local renin angiotensinexpression regulates human mesenchymal stem cell differentiation toadipocytes. Hypertension. 2006;48(6):1095–102. doi:10.1161/01.HYP.0000248211.82232.a7.

29. Matsushita K, Wu Y, Pratt RE, Dzau VJ. Blockade of angiotensin II type 2receptor by PD123319 inhibits osteogenic differentiation of humanmesenchymal stem cells via inhibition of extracellular signal-regulated kinasesignaling. J Am Soc Hypertens. 2015;9(7):517–25. doi:10.1016/j.jash.2015.06.006.

30. Benicky J, Hafko R, Sanchez-Lemus E, Aguilera G, Saavedra JM. Sixcommercially available angiotensin II AT1 receptor antibodies are non-specific.Cell Mol Neurobiol. 2012;32(8):1353–65. doi:10.1007/s10571-012-9862-y.

31. Herrera M, Sparks MA, Alfonso-Pecchio AR, Harrison-Bernard LM, CoffmanTM. Lack of specificity of commercial antibodies leads to misidentification ofangiotensin type 1 receptor protein. Hypertension. 2013;61(1):253–8. doi:10.1161/HYPERTENSIONAHA.112.203679.

32. Hafko R, Villapol S, Nostramo R, Symes A, Sabban EL, Inagami T, et al.Commercially available angiotensin II At(2) receptor antibodies arenonspecific. PLoS One. 2013;8(7):e69234. doi:10.1371/journal.pone.0069234.

33. Marchesi C, Rehman A, Rautureau Y, Kasal DA, Briet M, Leibowitz A, et al.Protective role of vascular smooth muscle cell PPARgamma in angiotensinII-induced vascular disease. Cardiovasc Res. 2013;97(3):562–70. doi:10.1093/cvr/cvs362.

34. Koh SL, Ager E, Malcontenti-Wilson C, Muralidharan V, Christophi C.Blockade of the renin-angiotensin system improves the early stages of liverregeneration and liver function. J Surg Res. 2013;179(1):66–71. doi:10.1016/j.jss.2012.09.007.

35. Vlahakos DV, Marathias KP, Madias NE. The role of the renin-angiotensinsystem in the regulation of erythropoiesis. Am J Kidney Dis. 2010;56(3):558–65. doi:10.1053/j.ajkd.2009.12.042.

36. Rodgers KE, Xiong S, Steer R, diZerega GS. Effect of angiotensin II onhematopoietic progenitor cell proliferation. Stem Cells. 2000;18(4):287–94.doi:10.1634/stemcells.18-4-287.

37. Zhang Y, Lv J, Guo H, Wei X, Li W, Xu Z. Hypoxia-induced proliferation inmesenchymal stem cells and angiotensin II-mediated PI3K/AKT pathway.Cell Biochem Funct. 2015;33(2):51–8. doi:10.1002/cbf.3080.

38. Takeda H, Katagata Y, Hozumi Y, Kondo S. Effects of angiotensin II receptorsignaling during skin wound healing. Am J Pathol. 2004;165(5):1653–62. doi:10.1016/S0002-9440(10)63422-0.


http://dx.doi.org/10.1007/s11684-011-0114-1http://dx.doi.org/10.7243/2050-1218-2-4http://dx.doi.org/10.7243/2050-1218-2-4http://dx.doi.org/10.1073/pnas.1432929100http://dx.doi.org/10.1016/j.injury.2005.07.019http://dx.doi.org/10.1007/s10517-006-0044-0http://dx.doi.org/10.1016/j.neulet.2005.10.097http://dx.doi.org/10.1016/j.neulet.2005.10.097http://dx.doi.org/10.1016/j.healun.2005.05.017http://dx.doi.org/10.1155/2013/130763http://dx.doi.org/10.1016/s1357-2725(02)00271-6http://dx.doi.org/10.1152/ajpheart.00431.2010http://dx.doi.org/10.1111/j.1748-1716.2009.02070.xhttp://dx.doi.org/10.1016/j.yjmcc.2013.09.015http://dx.doi.org/10.1016/j.yjmcc.2013.09.015http://dx.doi.org/10.1002/jcp.24639http://dx.doi.org/10.1016/j.abb.2015.02.035http://dx.doi.org/10.1016/j.abb.2015.02.035http://dx.doi.org/10.1152/ajpcell.00287.2006http://dx.doi.org/10.1126/science.1092053http://dx.doi.org/10.1038/nrm1549http://dx.doi.org/10.1146/annurev.cellbio.21.020604.150721http://dx.doi.org/10.1186/s13287-015-0025-1http://dx.doi.org/10.1186/s13287-015-0025-1http://dx.doi.org/10.1164/rccm.201206-0990OChttp://dx.doi.org/10.3727/096368915X687499http://dx.doi.org/10.1002/jcp.24500http://dx.doi.org/10.1002/pmic.200900165http://dx.doi.org/10.1002/stem.2614http://dx.doi.org/10.1111/j.1524-475X.2009.00454.xhttp://dx.doi.org/10.1089/scd.2008.0276http://dx.doi.org/10.3317/jraas.2004.037http://dx.doi.org/10.1161/01.HYP.0000248211.82232.a7http://dx.doi.org/10.1161/01.HYP.0000248211.82232.a7http://dx.doi.org/10.1016/j.jash.2015.06.006http://dx.doi.org/10.1007/s10571-012-9862-yhttp://dx.doi.org/10.1161/HYPERTENSIONAHA.112.203679http://dx.doi.org/10.1161/HYPERTENSIONAHA.112.203679http://dx.doi.org/10.1371/journal.pone.0069234http://dx.doi.org/10.1093/cvr/cvs362http://dx.doi.org/10.1093/cvr/cvs362http://dx.doi.org/10.1016/j.jss.2012.09.007http://dx.doi.org/10.1016/j.jss.2012.09.007http://dx.doi.org/10.1053/j.ajkd.2009.12.042http://dx.doi.org/10.1634/stemcells.18-4-287http://dx.doi.org/10.1002/cbf.3080http://dx.doi.org/10.1016/S0002-9440(10)63422-0

39. Dubey RK, Flammer J, Luscher TF. Angiotensin II and insulin induce growthof ciliary artery smooth muscle: effects of AT1/AT2 antagonists. InvestOphthalmol Vis Sci. 1998;39(11):2067–75.

40. Kintscher U, Wakino S, Kim S, Fleck E, Hsueh WA, Law RE. Angiotensin IIinduces migration and Pyk2/paxillin phosphorylation of human monocytes.Hypertension. 2001;37(2 Pt 2):587–93. doi:10.1161/01.HYP.37.2.587.

41. Meng F, Rui Y, Xu L, Wan C, Jiang X, Li G. Aqp1 enhances migration ofbone marrow mesenchymal stem cells through regulation of FAK and beta-catenin. Stem Cells Dev. 2014;23(1):66–75. doi:10.1089/scd.2013.0185.

42. Raftopoulou M, Hall A. Cell migration: Rho GTPases lead the way. Dev Biol.2004;265(1):23–32.

43. Vertelov G, Kharazi L, Muralidhar MG, Sanati G, Tankovich T, Kharazi A. Hightargeted migration of human mesenchymal stem cells grown in hypoxia isassociated with enhanced activation of RhoA. Stem Cell Res Ther. 2013;4(1):5. doi:10.1186/scrt153.

44. Lee JG, Heur M. Interleukin-1beta-induced Wnt5a enhances human cornealendothelial cell migration through regulation of Cdc42 and RhoA. Mol CellBiol. 2014;34(18):3535–45. doi:10.1128/MCB.01572-13.

45. Liu C, Fan Y, Zhou L, Zhu HY, Song YC, Hu L, et al. Pretreatment ofmesenchymal stem cells with angiotensin II enhances paracrine effects,angiogenesis, gap junction formation and therapeutic efficacy for myocardialinfarction. Int J Cardiol. 2015;188:22–32. doi:10.1016/j.ijcard.2015.03.425.

• We accept pre-submission inquiries • Our selector tool helps you to find the most relevant journal• We provide round the clock customer support • Convenient online submission• Thorough peer review• Inclusion in PubMed and all major indexing services • Maximum visibility for your research

Submit your manuscript atwww.biomedcentral.com/submit

Submit your next manuscript to BioMed Central and we will help you at every step:


http://dx.doi.org/10.1161/01.HYP.37.2.587http://dx.doi.org/10.1089/scd.2013.0185http://dx.doi.org/10.1186/scrt153http://dx.doi.org/10.1128/MCB.01572-13http://dx.doi.org/10.1016/j.ijcard.2015.03.425

AbstractBackgroundMethodsResultsConclusions

BackgroundMethodsHuman MSC culture and stimulationRNA isolation and quantitative real-time RT-PCRWound-healing assay (scratch assay)Transwell migration assayCell proliferationWestern blot analysisF-actin staining by fluorescence microscopyRho GTPase activity assayStatistical analysis

ResultsHuman bone marrow MSCs constitutively express AT1R and AT2RAng II promotes the migration of human bone marrow MSCs via AT2RAng II-induced MSC migration is not mediated through cell proliferationInvolvement of FAK, RhoA, and Cdc42 in Ang II-enhanced migration of MSCsFAK is critical for the formation of focal contacts by MSCs after Ang II stimulationRhoA and Cdc42 activation by FAK induces F-actin organization in MSCs after stimulation with Ang IIAng II induces the expression of focal adhesion proteins and the alignment of F-actin via AT2R in MSCs

DiscussionConclusionsAbbreviationsFundingAvailability of data and materialsAuthors’ contributionsEthics approval and consent to participateConsent for publicationCompeting interestsPublisher’s NoteAuthor detailsReferences

Ang II-AT2R increases mesenchymal stem cell migration by ......100 nM Ang II, and/or were pretreated...

Documents

Transcript of Ang II-AT2R increases mesenchymal stem cell migration by ......100 nM Ang II, and/or were pretreated...