Fungal Genetics and Biology 55 (2013) 32–41

Contents lists available at SciVerse ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/ locate/yfgbi

Agaricus bisporus and related Agaricus species on lignocellulose:Production of manganese peroxidase and multicopper oxidases

1087-1845/$ - see front matter � 2013 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.fgb.2013.02.002

⇑ Corresponding author. Address: Department of Food and EnvironmentalSciences, Biocenter 1, P.O. Box 56, FI-00014 University of Helsinki, Finland.

E-mail address: kristiina.s.hilden@helsinki.fi (K. Hildén).1 These authors contributed equally to this work.

Kristiina Hildén ⇑,1, Miia R. Mäkelä 1, Pauliina Lankinen, Taina LundellDepartment of Food and Environmental Sciences, University of Helsinki, Finland

a r t i c l e i n f o a b s t r a c t

Article history:Available online 21 February 2013

Keywords:BasidiomycotaLitter-decomposing fungiLignocellulose degradationWhite-rotLaccaseTyrosinase

Biotechnological, microbiological, and genetic studies of Agaricus species other than A. bisporus, the whitebutton mushroom, have been limited so far. To expand the knowledge in the genus Agaricus, six novelwild-type isolates of Agaricus spp. were studied on their nutritional demands for enzyme productionand mycelial growth. All the selected Agaricus species produced extracellular manganese peroxidase(MnP) and laccase activities in semi-solid rye bran cultures. Moderate MnP activities were measuredfor A. bisporus, A. bernardii and A. campestris. The highest laccase activities were obtained for A. bisporusand A. campestris. On soy medium, the highest mycelial tyrosinase activity was determined for A. bernar-dii. For A. bisporus, addition of copper caused no increase in laccase or tyrosinase activities on soy or maltextract media. Hyphal growth rate of the isolates was studied on lignocellulose amended agar plates.Fastest growth was obtained for A. bisporus on wheat bran and birch leaf litter agar. Except for A. bernar-dii, hyphal growth rates correlated well with MnP and laccase production levels between Agaricus species.Molecular taxonomy of the novel Agaricus spp. positioned them to distinct phylogenetic clusters withspecies-level identity. In conclusion, our data point to the importance of both MnP and multicopperenzymes in Agaricus spp. while growing on lignocelluloses.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

Litter-decomposing fungi, such as the button mushroom Agari-cus bisporus, are mainly mushroom-forming basidiomycetes of thesubphylum Agaricomycotina, class Agaricomycetes, order Agarica-les, and the primary common decomposers of residual plant mate-rial in forests and grasslands (Kirk et al., 2008). Agaric litter-decomposing fungi are able to efficiently degrade all componentsof the lignocellulose complex including cellulose, hemicellulosesand lignin (Steffen et al., 2000; Valášková et al., 2007). For activa-tion and decomposition of the aromatic lignin heteropolymers,fungal oxidative enzymes, such as heme-including peroxidases(manganese, lignin and versatile peroxidases; novel heme-thiolateperoxidases and dye-decolorizing peroxidases) and laccase-typemulticopper oxidases play important roles (Hofrichter et al.,2010; Lundell et al., 2010; Hatakka and Hammel, 2010; Martínezet al., 2009).

Manganese peroxidases (MnP, EC 1.11.1.13) catalyze the oxida-tion of Mn(II) to Mn(III) in the presence of H2O2. Mn(III) ions arestabilized in chelated form by organic acids, e.g. oxalic acid, and

are capable to oxidize various aromatic compounds, lignin-likemolecules and xenobiotics (Hatakka et al., 2003). Multicopper oxi-dases include mononuclear copper enzymes (e.g. amine oxidase,Cu-radical enzymes), coupled binuclear two-copper enzymes (e.g.tyrosinase) and four-copper enzymes containing trinuclear copperclusters (e.g. laccase) (Solomon et al., 2001; Nakamura and Go,2005). Laccases (benzenediol:oxygen oxidoreductases, EC1.10.3.2) occur in fungi, plants, insects, bacteria and archea (Hoeg-ger et al., 2006; Baldrian, 2006; Lundell et al., 2010; Uthandi et al.,2010). Laccases oxidize phenolic compounds to phenoxy radicals,and in the presence of charge-transfer mediator molecules, lac-cases are also capable of oxidation of nonphenolic and higher-re-dox potential compounds such as polymeric dyes (Morozovaet al. 2007).

Similarly to laccases, tyrosinases (monophenol monooxygena-ses, EC 1.14.18.1) are widely distributed in nature existing in bac-teria, fungi, plants, mammals and invertebrates (Mayer, 2006;Halaouli et al., 2006). Tyrosinases catalyze sequential oxidationand hydroxylation steps with various phenolic substrates. Tyrosi-nase is a key enzyme in the melanin biosynthesis pathway, andthese enzymes are responsible for the undesirable post-harvestbrowning of mushrooms, fruits and vegetables. Fungal tyrosinasesare generally considered as non-secreted, cytoplasmic enzymesalthough their location inside the cell is not entirely clear. A fewexamples for secreted fungal tyrosinases are from Ascomycota,

K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41 33

e.g. from Trichoderma reesei (Selinheimo et al., 2006). Laccases andtyrosinases have overlapping phenolic substrate specificities, alsowith catechol oxidases (EC 1.10.3.1). In fungal cultures and myce-lial or fruit-body extracts, these three enzymes may co-occur mak-ing activity determination and enzyme identification difficult(Ratcliffe et al., 1994; Gasparetti et al., 2010). In accordance, thecurrent genome project on A. bisporus and transcriptome studypinpoint a variety of peroxidases, multicopper oxidases and carbo-hydrate-acting enzymes being expressed when the fungus is grow-ing on humic-substance rich and lignocellulose-supplementedcompost substrate (Morin et al., 2012).

Species in the Agaricomycota genus Agaricus are litter-decom-posing saprotrophs which are widespread in a variety of habitats.The cultivation of the most studied litter-decomposing fungus, A.bisporus, is one of the world’s most profitable microbial technolo-gies for the conversion of low-cost lignocellulose wastes to hu-man-edible food (Wood, 1989; Morin et al. 2012). Lignindegradation in straw-based compost cultivation substrate takesplace during vegetative growth of A. bisporus and correlates withMnP and laccase activities (Waksman and Nissen, 1932; Wood,1980; Bonnen et al., 1994; Durrant et al., 1991; Lankinen et al.,2001). Extracellular MnP and laccase have been efficiently pro-duced in other rye bran type of lignocellulose-supplemented cul-tures of A. bisporus as well (Lankinen et al., 2005). However, MnPand laccase production by other litter-decomposing saprophyticfungal species has obtained little attention (Heinzkill et al., 1998;Steffen et al., 2002).

It is estimated that from 70 to 90 species of Agaricus occur inEurope, while the total number of species in this genus worldwidemay exceed 300 (Geml et al., 2004). However, only a few species ofAgaricus other than A. bisporus have been investigated, and thereby,the knowledge of the growth conditions, substrate utilization andenzyme production requirements is scarce within the genus andbetween the species. However, there is a growing interest to eval-uate the potential of alternative species of Agaricus for commercialuse and production of mushrooms (Calvo-Bado et al., 2000; Iwadeand Mizuno, 1997; Kerrigan et al., 1999; Martinez-Carrera et al.,1995; Mizuno, 1995; Noble et al., 1995). A better understandingof the species-level phylogenetic relationships in the genus Agari-cus is fundamental in order to enhance the selection and geneticproperties of the commercial lines and may aid to improve com-mercial cultivation of new species and breeding lines (Gemlet al., 2004).

Previously, we isolated two MnP isoforms from A. bisporus (Lank-inen et al., 2005), and were able to demonstrate high MnP and lac-case activities in cereal bran cultures, and the respective proteinsin compost extracts (Lankinen et al., 2001). Based on those findings,our hypothesis was that lignocellulosic substrates are crucial forgrowth and activity of lignin-modifying enzymes in Agaricus species.Hyphal growth rate of six previously uninvestigated Agaricus spp.wild-type strains isolated from Northern and Eastern Europe andRussia, in comparison to the ATCC62459 type strain of A. bisporuswas followed. In addition, the enzyme activities of MnP, laccaseand mycelial tyrosinase were followed during growth on rye-bransupplemented lignocellulose medium. The phylogenetic relation-ships of the new isolates of Agaricus spp. are also presented.

2. Materials and methods

2.1. Fungal isolates

Agaricus spp. isolates used in this work were A. bisporus var.bisporus ATCC62459, A. abruptibulbus FBCC1001 (isolated fromBohemia, Czech Republic), A. arvensis FBCC1002 (isolated fromSaint Petersburg area, North-West Russia), A. balchaschensis

FBCC1003 (isolated from Lake Baikal district, South Siberia, Russia),A. bernardii FBCC1014 (isolated from Helsinki, South Finland), A.campestris FBCC1005 (isolated from Ai-Petri Mountain, Crimea, Uk-raine) and A. macrocarpus FBCC1006 (isolated from Penza area,South-West Russia). The fruiting-body isolated fungal cultureswere maintained on 2% (wt/vol) malt extract (Biokar Diagnostics)agar (MEA) and deposited into the Fungal Biotechnology CultureCollection, University of Helsinki, Helsinki, Finland (fbcc@hel-sinki.fi). For all fungal isolates, their identity and species-level tax-onomy was confirmed by ITS-PCR and sequencing.

2.2. Hyphal growth on lignocellulose agar plates

All fungal isolates were pre-cultivated on 2% malt-extract agar(MEA) plates in the dark for 1–3 weeks at +28 �C. For the determi-nation of hyphal growth rates on nine different types of lignocellu-lose solid media, one mycelium agar plug (7 mm in diameter) wasinoculated in the center of each 1.5% (wt/vol) agar agar (BiokarDiagnostics) plate and cultivated either 35 or 38 d at +28 �C inthe dark. The solid agar media used were 2% MEA, 2% malt concen-trate agar (MCA), malt-peptone agar (MPA), basal medium agar(BA), rye bran agar (RA), wheat bran agar (WA), birch leaf litteragar (LA), grass agar (GA), and tomato juice agar (TA). MCA con-tained 2% (wt/vol) malt concentrate (Laihian mallas), and MPAcontained 2% (wt/vol) malt extract (Biokar Diagnostics) and 0.5%peptone (Biokar Diagnostics). BA agar basal medium contained1% glucose (Riedel-de Haën), 0.2% KH2PO4 (Riedel-de Haën),0.05% MgSO4�7H2O (Merck), 0.01% CaCl2 (Riedel-de Haën), 0.05%ammonium tartrate (Sigma), 0.18% succinic acid (Fluka) and0.02% yeast extract (Biokar Diagnostics). The pH of BA was adjustedto 5.0 before autoclaving. For RA, WA, LA and GA plates, the basalmedium was supplemented with 4% (dry weight/vol) rye bran(Raisio), wheat bran (Raisio), birch leaf litter, or grass, respectively.TA contained 25% tomato juice (Rainbow, pH 4.2) and 1.5% agar indeionized water. Each fungal isolate was cultivated on three paral-lel plates on all the agar media.

2.3. Cultivation of the fungal isolates in liquid cultures

The fungi were cultivated in 75 ml of 2% (wt/vol) malt extract(ME) liquid and in soy broth medium (SM) in 250 ml conical flasks.For SM cultivation medium, 1.5% (wt/vol) of ground soybean meal(1–2 mm in diameter; Mildola) was added into deionized water.Three parallel flasks were used for ME and SM cultivations, whichwere incubated for 25 d in the dark at +28 �C. For the copper induc-tion experiments, CuSO4 (Sigma–Aldrich) was added into the MEand SM liquid cultures of A. bisporus after 3 d of growth to a finalconcentration of 25 lM.

A. abruptibulbus, A. arvensis, A. balchaschensis, A. bernardii, A.bisporus and A. campestris were cultivated in semi-solid rye branmedium (RL). For RL, 100 ml of basal liquid medium (pH 5.0) wasprepared as described above and supplemented with 4% (wt/vol)of rye bran. Due to an exceptionally slow growth, A. macrocarpuswas omitted from RL cultivation. Three parallel flasks were usedfor all fungal isolates, and cultivated for 46–53 d. All the liquid cul-tures were inoculated with four mycelium agar plugs (7 mm indiameter) from 2% MEA plates and incubated as stationary culturesat +28 �C in the dark.

2.4. Laccase and MnP assays

Laccase and MnP activities were determined spectrophotomet-rically at 476 nm (e = 14,800 M�1 cm�1) with Shimadzu Pharma-Spec UV-1700 spectrophotometer from samples taken from theliquid and semi-solid media culture fluids. Laccase was assayedby following the oxidation of 0.1 mM 2,6-dimethoxyphenol

Fig. 1. Radial growth of Agaricus spp. on nine different types of agar media. (A) A. bisporus, (B) A. bernardii, (C) A. balchaschensis, (D) A. arvensis, (E) A. abruptibulbus, (F) A.campestris, and (G) A. macrocarpus. Mean values from the measurement of the hyphal radial growth front from three parallel plates were calculated and the standarddeviations were under 5%. Malt extract agar (MEA, �); malt concentrate agar (MCA, j); malt-peptone agar (MPA, N); basal medium agar (BA, �); rye bran agar (RA, d); wheatbran agar (WA, ); birch leaf litter agar (LA, e); grass agar (GA, h); tomato agar (TA, D).

34 K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41

(2,6-DMP; Aldrich) at pH 3.0 and 4.5, in 50 mM sodium malonatebuffer. For the determination of MnP activity 1 mM 2,6-DMP wasused as a substrate together with 0.5 mM MnSO4 and 0.1 mMH2O2 according to Wariishi et al. (1992). MnP was corrected for lac-case activity. Laccase and MnP activities were followed at +25 �Cand are expressed as lkat l�1 (10�6 mol s�1 l�1).

2.5. Tyrosinase assay

For determination of tyrosinase activity, fungal mycelia werecollected from the culture fluids, frozen to �20 �C and lyophilized.

Lyophilized mycelia were disrupted with sterile glass bead tubes in0.1 M potassium phosphate buffer (pH 7.4) containing 0.2 mMphenylmethanesulfonyl fluoride (PMSF, Sigma–Aldrich) using aFastPrep Instrument (MP Biomedicals). Cell debris was removedby centrifuging (20 min, 16 100 rcf at +4 �C) and the supernatantwas used for tyrosinase assay.

The tyrosinases di-phenolase activity (activity on o-diphenolsand catechols) was followed as oxidation of 3,4-dihydroxy-L-phen-ylalanine (L-dopa) to the respective o-diquinone (dopachrome)product at 480 nm using a Tecan Infinite M200 microplate reader(Tecan, USA). The reactions were performed in citrate–phosphate

K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41 35

buffer (pH 7.0). 1.25 mM 3-methyl-2-benzothiazolinone hydra-zone (MBTH; Sigma–Aldrich) was added into the reaction mixturein order to obtain a stable colored product complex with the o-diq-uinones (Rodríguez-López et al., 1994). 0.1 mM sodium dodecylsulfate (SDS; Sigma–Aldrich) was added to activate also the poten-tially inactive tyrosinases (Espín and Wichers, 1999). Enzyme reac-tions were initiated by addition of 1 mM L-dopa (Sigma–Aldrich).The reactions were carried out at +30 �C and are expressed aslkat l�1. Molar extinction for the dopachrome complex productwas 3600 mM�1 cm�1 (Neeley et al., 2009). Commercially availabletyrosinase from A. bisporus (Sigma–Aldrich) was used as a positivecontrol in all measurements.

Protein concentrations were measured at 540 nm by BCA Pro-tein Assay Kit (Pierce) using bovine serum albumin as standardprotein to determine specific activities of the enzymes.

2.6. Isoelectric focusing

Analytical isoelectric focusing (IEF) was used to determine theisoelectric profile of extracellular laccases produced by differentspecies of Agaricus during their growth in the rye bran supple-mented liquid cultures. The extracellular fluids were harvestedfrom three parallel culture flasks and concentrated in an Amiconultrafiltration unit with 10 kDa cut-off membrane filter (Millipore)at +4 �C. IEF was performed in 7.5% polyacrylamide gels with aMultiphor II apparatus (Pharmacia Amersham). The 0.4 mm thickgels were casted on GelBond PAG films (GE Healthcare), and apH gradient from 3 to 10 was obtained with ampholytes (Pharma-lyte, GE Healthcare). The pH-gradient on the gel was measuredusing a surface pH electrode (Orion ROSS8135SCU, Thermo Elec-tron Corporation). Laccases were visualized by activity stainingwith 5 mM guaiacol in 50 mM Na-malonate buffer (pH 4.5).

2.7. Characterization of A. bisporus laccases

Proteins in concentrated extracellular culture fluid of A. bisporuswere dialyzed to 20 mM sodium acetate buffer (pH 5.5) containing1 M (NH4)2SO4 and fractionated chromatographically using ÄKTAExplorer apparatus (GE Healthcare). The extracellular proteinswere separated by hydrophobic interaction chromatography in aHiTrap Butyl FF column (GE Healthcare) with a linear (NH4)2SO4

gradient from 1 to 0 M in the sodium acetate buffer (20 mM, pH5.5). The fractions which contained the main activity were col-lected, dialyzed into H2O and run in 12% SDS–PAGE (Bio-Rad) fortrypsin ‘‘in-gel’’ digestion. LC-MS/MS analysis was performed bythe Protein Chemistry Research Laboratory and Core Facility, theInstitute of Biotechnology, University of Helsinki, Finland. AcquiredMS scans were searched against UniProt protein data-base andannotated laccase genes of A. bisporus at http://jgi.doe.gov/Abisporus_var_bisporus.

2.8. DNA extraction, ITS PCR and sequencing

Mycelia from 2% ME liquid cultures were filtered through Mir-acloth (Calbiochem), frozen to �80 �C and ground with a mortarand pestle in liquid N2. DNA was extracted using GenElute™ PlantGenomic DNA Miniprep Kit (Sigma–Aldrich) according to theinstructions of the manufacturer.

Complete internal transcribed spacer (ITS) region comprisingITS1, 5.8S rRNA gene and ITS2 regions of ribosomal RNA encodingDNA was amplified from the fungal genomic DNA samples with theprimers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4(TCCTCCGCTTATTGATATGC) (White et al., 1990). The 25 ll PCRmixture contained 5 ll DNA template, 0.8 lM 50 and 30 primersand 1 � GoTaq� Green Master Mix (Promega). PCR was performedwith initial denaturation at 95 �C for 2 min; then 35 cycles of (1)

denaturation at 95 �C for 60 s, (2) annealing at 55 �C for 60 s, (3)elongation at 72 �C for 60 s; and final extension at 72 �C for5 min. The PCR amplification products were run on 1% agarose(Fermentas) gels, then visualized with ethidium bromide underUV light and recorded by Bio-Rad Image analyzer. The PCR prod-ucts of correct size (600–700 bp) were cut out of the gels, purifiedwith Geneclean Turbo Kit (MP Biomedicals) according to theinstructions of the manufacturer, and sequenced from both direc-tions (Macrogen Ltd., Republic of Korea).

2.9. Sequence alignment and phylogenetic analysis

Obtained nucleotide sequences were manually inspected andtrimmed to contiguous ITS1 + 5.8S rRNA + ITS2 rDNA sequencesby using Chromas 2.33 and MEGA 5.03 (Tamura et al., 2011) soft-ware. The ITS contigs were submitted to EBI EMBL nucleotide se-quence database. Similar sequences were retrieved by using NCBIBLASTN 2.2.27+ searches against nr/nt database (megablast anddiscontinous megablast algorithms in use) (http://blast.ncbi.nlm.-nih.gov/). Minimum evolution neighbor-joining (ME-NJ) methodwas adopted for the phylogenetic analyses of rDNA ITS sequencesof the Agaricus spp. using the MEGA 5.03 software. The most sim-ilar ITS sequences retrieved for Agaricus spp. were included in themultiple alignment. For A. bisporus isolates, over 60 ITS sequenceswith 97–99% sequence identity with the A. bisporus var. bisporusATCC62459 of this study were obtained (SupplementaryTable S1). In order to avoid distortion in the phylogenetic tree, onlythe ATCC62459 ITS sequence was thereby included in the mini-mum evolution analysis. Corresponding ITS sequence of the sapro-bic, litter-decomposing Agaricomycota species Agrocybe praecoxfrom the same order (Agaricales) but different family (Stropharia-ceae) was used as an outgroup. Bootstrapping of 1000 replicateswas conducted to test branching of the ME-NJ tree, which was ob-tained with the close-neighbor-interchange algorithm and pair-wise comparison for all nucleotide positions. Alignment capswere treated as information. ITS sequence accessions and fungaltaxons at species and isolate levels are indicated in the ME-NJ tree.

2.10. Accession numbers of ITS sequences

EMBL accession numbers for the rDNA ITS1 + 5.8S + ITS2 se-quences of the Agaricus spp. isolates determined in this study areAM930981 for A. bisporus var. bisporus ATCC62459, AM930987for A. abruptibulbus FBCC1001, AM930985 for A. arvensis FBCC1002,AM930983 for A. balchaschensis FBCC1003, AM930982 for A. ber-nardii FBCC1014, AM930984 for A. campestris FBCC1005, andAM930986 for A. macrocarpus FBCC1006.

3. Results

3.1. Hyphal growth of Agaricus spp. strains on solid lignocellulosemedia

Hyphal radial growth was weekly measured from three parallelplates of the various lignocellulose agar media. The average growthrates for the fungal isolates are shown in Fig. 1.

For A. bisporus, three distinct growth patterns were detected onthe solid lignocellulose media tested (Fig. 1A). The fastest hyphalgrowth rate was measured on wheat bran agar (WA; 5 mm d�1)and birch leaf litter agar (LA; 3 mm d�1), and the hyphal frontreached the edge of the 8 cm diameter plate within 3 weeks at+28 �C. A. bisporus developed hyphal mat with uneven but well-developed front edge. The mycelium partially penetrated agarwhen white rhizomorph formation was observed on top, in theaerial hyphae layer. Hyphal extension proceeded similarly on rye

36 K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41

bran (RA), grass (GA) and malt concentrate (MCA) agar media withaverage growth rate of 1.4 mm d�1. The less efficient hyphal exten-sion was measured on malt extract agar (MEA), malt-peptone agar(MPA) and basal medium agar (BA) (approx. 1.0 mm d�1). Theslowest growth was observed on tomato agar (TA) with hyphalfront extension at the rate of 0.8 mm d�1.

For A. bernardii, the hyphal growth was less efficient with lack ofdistinct aerial hyphae on all types of agar media. This was also seenin the ca 50% slower radial growth rates when compared to A. bisp-orus (Fig. 1B). Two radial growth patterns were observed for A. ber-nardii. The fastest hyphal growth rate (1.8–2.0 mm d�1) wasachieved on three of the four lignocellulose-containing solid media(RA, LA, GA). However, this faster, secondary phase of radial growthwas preceded by a much slower (0.5–1.0 mm d�1), 2-week longprimary hyphal growth period, which was not observed for A. bisp-orus. A. balchaschensis showed similar type of two-phase hyphalgrowth on GA. Similarly to A. bernardii, the fastest hyphal radialgrowth was detected on LA and GA media, 1.9 mm d�1 and1.2 mm d�1, respectively (Fig. 1C). Accordingly, the TA mediumwas the least preferred also for this species.

Two distinct patterns of radial growth were as well observed forA. arvensis and A. abruptibulbus. In contrast to A. bisporus, A. bal-chaschensis and A. bernardii (Fig. 1A–C), A. arvensis and A. abrupti-bulbus demonstrated the lowest growth rates on the cereal-based(RA, WA) solid media whereas the litter- and grass-containing(LA, GA) media promoted hyphal growth (Fig. 1D and E). Similarhyphal extension of ca 1.5 mm d�1 was also achieved on theMCA medium. Surprisingly, A. abruptibulbus as well reached thisspeed on the basal, glucose-containing BA medium, which wasnot observed for the other fungal strains studied.

A. campestrisachieved good growth rates (1.5–2.0 mm d�1) onmalt (MEA, MCA, MPA), lignocellulose-containing (LA, GA, RA,WA) and on solid basal agar (BA) media during the first 2 weeks(Fig. 1F). However, after this phase, hyphal extension ceased onthe peptone-containing MPA as well as on litter, grass and rye branmedia (LA, GA, RA). A very distinctive growth was seen on tomatoagar (TA): following the slower period of 3 weeks, a rapid hyphalextension (4.0 mm d�1) within the last 10 d was detected. Amongthe Agaricus spp. studied, only A. macrocarpus demonstrated extre-mely low hyphal extension rates (0.1–0.3 mm d�1) (Fig. 1G). Noneof the supplements tested resulted with promotion on growthwithin the 5 weeks of cultivation and was therefore omitted fromthe further enzyme activity studies.

Fig. 2. Effect of 25 lM copper supplement on extracellular laccase activity duringthe growth of A. bisporus in (A) 2% ME liquid and in (B) 1.5% soy medium. Laccaseactivity was determined as oxidation of 2,6-DMP in buffer pH 3.0 (j) and 4.5 (d).(C) pH of the culture media: ME (r), ME with addition of 25 lM CuSO4 (.) and soywith addition of 25 lM CuSO4 (�). Each data point represents the mean values ofthree parallel cultivations and the standard deviations did not exceed 5%.

3.2. Laccase and tyrosinase activities and the effect of coppersupplementation

The effect of copper supplementation on the extracellular lac-case activity of A. bisporus was tested in liquid malt extract (ME)and soy (SM) media. With supplementation of 25 lM CuSO4 inthe ME cultures, 14- and 8-fold increase in laccase activities wasobserved, as measured by oxidation of 2,6-DMP at pH 4.5 and3.0, respectively (Fig. 2A). A. bisporus, A. arvensis, A. balchaschensis,A. bernardii and A. campestris demonstrated lower than 0.5 lkat l�1

extracellular laccase activities without copper supplementationduring the 25 d of cultivation in the ME medium, assayed eitherat pH 3.0 or 4.5 (data not shown). However, for A. bisporus, the cop-per-supplemented SM cultures promoted the highest laccase activ-ities of 7–10 lkat l�1, which were approximately three timeshigher than detected in the ME cultures (Fig. 2A and B). On both li-quid media, the A. bisporus laccase activity values were higherwhen determined at pH 4.5 than at pH 3.0. After 25 d of cultivation,the acidity in the ME cultures slightly decreased, which is seen inincrease in pH values; from 5.9 to 6.6, and from pH 5.6 to 6.9 in cul-tures with and without copper amendment, respectively (Fig. 2C).

The growth of A. abruptibulbus was very low in all liquid mediastudied and all measured enzyme activities were negligible.

The five other species of Agaricus studied produced low levels ofmycelium-retained tyrosinase activity (below 1.4 lkat l�1), duringtheir growth in the soy medium (data not shown). The highest

Fig. 3. Extracellular (A) laccase pH 4.5 (B) laccase pH 3.0 and (C) MnP activities inrye-bran supplemented liquid medium (RL). A. bisporus (j), A. arvensis (d), A.balchaschensis (N), A. bernardii (�) and A. campestris ( ). For laccase activities,standard deviation lines represent variation of the mean activity value from threeparallel cultivations. For MnP activities, the standard deviations varied between 5%and 15%. However, in some cases the variation was even 50%.

K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41 37

tyrosinase activity was detected in the mycelial extracts of A. ber-nardii after 18 d of growth (1.39 lkat l�1). A higher tyrosinaseactivity (0.9 lkat l�1) was measured from the mycelial extracts ofA. bisporus from the cultures without copper supplementation. A.balchaschensis showed low tyrosinase activity levels, and slight in-crease (0.75 lkat l�1) in tyrosinases activity was detected onlyafter 25 d of cultivation. A. campestris, however, showed only neg-ligible mycelial tyrosinase activities that remained below the levelof 0.2 lkat l�1.

3.3. Laccase and MnP in lignocellulose semi-solid cultures

Extracellular laccase activity started to accumulate in the RLcultures of A. bisporus after 7 d of cultivation, and the highest activ-ity of 85 lkat l�1 was detected after 24 d of cultivation (Fig. 3A).Compared to the other species of Agaricus, laccase activity was inthe A. bisporus RL cultures nine times (A. balchaschensis, A. bernardiiand A. campestris) to 24 times (A. arvensis) higher. The extracellularlaccase activity in the A. arvensis RL cultures started to accumulateonly after 21 d and peaked at 50 lkat l�1 at the end of the cultiva-tion. In the RL cultures of A. balchaschensis, A. bernardii and A. cam-pestris, notably lower maximum laccase activities (from 3 to10 lkat l�1) were detected.

In order to describe the biochemical characteristics of the lac-cases of different Agaricus species the activities were assayed atpH 3.0 and 4.5 by using 2,6-DMP as a substrate. The latter condi-tion is more near to usual optimal pH values of fungal laccases (be-tween pH 4.5–5) for oxidation of phenols. Accordingly, laccaseactivity values for all the species and time points were higher atpH 4.5 (Fig. 3A and B). Except for A. bisporus and A. arvensis, the restof the Agaricus spp. isolates showed negligible laccase activities atboth pH values.

The highest MnP activity, 14 lkat l�1, was measured from theRL cultures of A. bisporus after 38 d of cultivation (Fig. 3C). In addi-tion, a clear cyclic pattern of the production of MnP by A. bisporuswas observed. The MnP activity in the RL cultures of A. bernardii, A.balchaschensis and A. campestris peaked at 9–10 lkat l�1 after 28,42 and 42 d, respectively. The lowest extracellular MnP activitieswere detected in the RL cultures of A. arvensis but peaking at5 lkat l�1 after 24 d of cultivation. Enzyme activity measurementsfrom brown-colored semi-solid culture media are challenging andtherefore in some cases high standard deviation values were de-tected in RL cultures.

3.4. Isoelectric focusing

The extracellular laccase isozyme patterns in the rye bran sup-plemented (RL) semi-solid cultures from of A. bisporus, A. arvensis,A. balchaschensis, A. bernardii and A. campestris were studied usinganalytical isoelectric focusing (IEF) (Fig. 4). Laccase-specific guaia-col staining was used to visualize the active isozymes in the gel.

As can be observed in Fig. 4, A. bisporus produced only oneextracellular laccase isozyme or isoform with acidic pI value of4.0 during the 6 weeks of cultivation in the rye bran medium.One less acidic laccase isozyme was produced by A. arvensis (pI va-lue 4.5) and A. bernardii (pI value of 5.0) on the same semi-solidmedium. Two distinct laccase isozymes with pI values of 4.5 and4.9, and pI values of 4.6 and 5.0, were detected in the culture fluidsof A. balchaschensis and A. campestris, respectively.

3.5. Characterization of A. bisporus laccases

The MS/MS-based peptide analysis demonstrated that mainextracellular laccase activity of A. bisporus was due to laccase iso-zyme encoded by lcc12 (Fig. 5). The peptide coverage for Lcc12was 57% and the number of peptide-spectrum matches (PSMs)

was about 10 times higher than for the second discovered laccaseisozyme Lcc2. Up to seven laccases of the twelve annotated genemodels were discovered according to the peptide data matches(Supplementary Table S2).

Fig. 4. Isoelectric focusing of the extracellular laccase isozymes in the culture fluidconcentrates of A. bisporus (lane 1), A. arvensis (lane 2), A. balchaschensis (lane 3), A.bernardii (lane 4) and A. campestris (lane 5) cultivated in rye-bran supplementedliquid medium (RL) for 6 weeks. Laccases were visualized with guaiacol activitystaining.

38 K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41

3.6. Phylogenetic ITS analysis

Minimum evolution (ME) Neighbor-joining (NJ) method wasused to evaluate the evolutionary relationships of the fungal rDNAITS sequence regions. Most identical ITS sequences were takenwithin the analysis according to BLAST searches. As presented inFig. 6, it can be interpreted from the phylogenetic tree that withingenus Agaricus the various species branch into several potentialsub-groups. The grouping of the new isolates A. arvensis FBCC1002and A. campestris FBCC1005 within A. arvensis and A. campestrisspecies level branches, respectively, is well supported (Fig. 6). Inaddition, A. abruptibulpus FBCC1001 and A. macrocarpus FBCC1006seem to be closely related to the species A. arvensis. The ITS tree re-veals the nearest positioning of A. balchaschensis FBCC1003 with A.vaporarius strain RWK1710 in close proximity to the A. bitorquisbranch.

4. Discussion

Except for A. bisporus, the edible button mushroom, and A. cam-pestris, the edible field mushroom, other Agaricus species have ob-tained less attention for biotechnological, microbiological, andgenetic studies. In order to utilize new isolates of the genus Agar-icus (Kirk et al., 2008), good colonization, growth on laboratory cul-tivation media, and efficient substrate utilization are necessaryqualities for further applications, e.g. mushroom cultivation andenzyme production. To expand such research in the genus Agaricus,we chose novel wild-type isolates of Agaricus spp. for laboratorycultivations to investigate and compare their nutritional demandsfor mycelial growth and enzyme production.

MnPs are among the key enzymes in wood and lignocellulose-decaying basidiomycetous fungi for oxidation and modification oflignin and lignocelluloses (Hatakka et al., 2003; Hofrichter et al.,

Fig. 5. Predicted protein sequence of A. bisporus lcc12 laccase and the internal peptide seqpeptide is underlined.

2010; Floudas et al., 2012). We previously studied the productionof MnPs and laccases by A. bisporus, and expression of the novelAbis-MnP1 encoding gene on various lignocellulosic substrates,such as agricultural waste compost (Lankinen et al., 2001; Lanki-nen et al., 2005). In this study, six other species of Agaricus (A. arv-ensis, A. abruptibulbus, A. balchaschensis, A. bernardii, A. campestris,A. macrocarpus) were cultivated on lignocellulose substrates to-gether with A. bisporus.

Five species of Agaricus secreted MnP in the rye-bran supple-mented liquid medium. In line with this, elevated MnP activitiesof A. bisporus were previously obtained in wheat and rye bransemi-solid cultures (Lankinen et al., 2005). In addition, a typicalcyclic pattern of the production of MnP was observed in A. bisporus,A. arvensis and A. campestris similar to the cyclic production of MnPand LiP in the semi-solid lignocellulose-containing cultures of thewhite-rot fungus Phlebia radiata (Mäkelä et al., 2012).

On semi-solid lignocellulose and liquid media, the highest lac-case activities were detected in rye bran supplemented culturesof A. bisporus and A. arvensis. For A. bisporus, two cycles of high lac-case production were observed within 6 weeks, whereas A. arvensisdemonstrated elevated laccase activities in very late phase ofgrowth starting after 30 d of cultivation. Previously, laccase pro-duction has been strongly supported by cereal bran media (Pickardet al., 1999). Rye bran is complex lignocellulose in composition anda nutrient rich growth substrate, which evidently promotes fungalgrowth in A. bisporus and A. arvensis. The other four species of Agar-icus, however, showed only moderate laccase activities in the ryebran cultures, which may also be due to lower amount of mycelialbiomass as regarding to their lower hyphal growth rates on the lig-nocellulose-amended agar media. One exception was the species A.bernardii, which demonstrated laccase production in semi-solid ryebran cultures although hyphal extension rates were very low onthe lignocellulose amended agar plates. Apart from growth sub-strate, the amount of laccase production may be due to gene dosesince the common white button mushroom A. bisporus is a poly-ploid fungal strain (Sonnenberg et al., 1996) whereas the ploidy le-vel of the other studied wild-type species of Agaricus is not known.

To our surprise, for A. bisporus, the extracellular laccase activi-ties were over 20 times higher in the rye bran cultures than inthe copper-supplemented malt extract and soy broth cultures.For many basidiomycete white rot species, elevated levels of cop-per have resulted with highly induced laccase activity levels, aswell as up-regulation of expression of certain laccase isozymeencoding genes (Palmieri et al., 2000; Soden and Dobson, 2001).However, another compost growing Agaricomycetes speciesCoprinopsis cinerea has shown relatively low laccase activities incopper supplemented cultures (Navarro-Gonzáles 2008). It wassuggested that laccase production in C. cinerea is more related todevelopmental stage than substrate utilization. Fungal laccase pro-duction is substantially affected by the composition of the culturemedium (Thurston, 1994; Baldrian, 2006; Mäkelä et al., 2006).However, tolerance for copper varies in great extent in basidiomy-cetes, and over 100� differences in concentration are evident

uences. The peptides detected by LS-MS/MS are shaded in gray. The deduced signal

Fig. 6. Minimum evolution neighbor-joining phylogenetic tree of the ITS1 + 5.8S + ITS2 rDNA sequences of selected Agaricus spp. and the isolates used in this work. Sequenceaccessions are followed by systematic species names and isolate culture collection identifiers. The six novel isolates of this study are indicated in bold. Bootstrap values (1000replications) higher than 50% are shown for the nodes. The scale bar corresponds to 0.05 nucleotide substitutions per position.

K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41 39

(10 lM to over 1 mM) for optimal concentration of Cu2+ to pro-mote laccase expression and enzyme production (Baldrian, 2003;Mäkelä et al., 2012). It may well be the case that the copper con-centration used was not optimal in the less supportive malt extractand soy broth media for higher production of laccase by A. bisporus.

In the two genome sequenced variants of A. bisporus (var. bisp-orus and var. burnettii), two MnP encoding genes (MnP1 and MnP2)together with 12 genes annotated as laccases (lcc, of which lcc6 isan expressed pseudogene) are found. The expression of one mnp,several other heme-containing peroxidase, and multicopper oxi-dase genes (laccase gene models JGI ID#146228 (lcc1) and JGIID#139148 (lcc2) and tyrosinase gene model JGI ID#191507(PPO4)) are recognized when A. bisporus is growing in compost cul-

ture (Morin et al., 2012). Accordingly, two laccase isozymes (Lcc1and Lcc2) and one manganese peroxidase (MnP1) have been iso-lated from hyphal solid-state compost cultures of the fungus (Bon-nen et al., 1994; Lankinen et al., 2001). However, in the currentstudy the main secreted laccase of A. bisporus was previously unde-tected isozyme Lcc12 which has only been described as a genemodel so far (JGI ID#184993). On the semi-solid rye bran supple-mented liquid cultures, Lcc2 was the second most abundant lac-case isozyme secreted by A. bisporus.

Only one distinct extracellular laccase isoform was detected inthe rye-bran supplemented culture liquids of A. bisporus, A. arvensisand A. bernardii by isoelectric focusing. However, according to thepeptide analysis of extracellular proteins of A. bisporus additional

40 K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41

laccase isozymes are simultaneously produced in minor amounts.This is in contrast with laccase production of Agaricus blazei whereonly one laccase isozyme is found (Ullrich et al., 2005). On theother hand, two distinct main laccase isozymes were secreted byA. balcanschensis and A. campestris. In white rot basidiomycetes,multiple secreted laccase isoforms are typical when the fungi arecultivated on nutrient-rich media (Vares et al., 1995; Hildénet al., 2007).

For all the here studied species of Agaricus, higher laccase activ-ity values were assayed at pH 4.5 than at pH 3.0 for oxidation of2,6-dimethoxyphenol. Optimal pH for oxidation of substitutedphenols is typically at pH 4.5–5 for basidiomycetous laccases (Bal-drian, 2006). Notably, samples from the cultures of A. bisporus andA. arvensis showed considerable laccase activity at pH 3.0, too,which suggests that their laccases are more suited for action inacidic conditions.

The structurally and functionally best characterized fungal tyr-osinases are from A. bisporus and the ascomycete Neurospora crassa(Chang, 2009). In our study, mycelial tyrosinase activities were fol-lowed in the similar fungal cultures where both laccase and MnPactivities were determined. Interestingly, the maximal intracellulartyrosinase activity levels were detected for A. bernardii instead of A.bisporus, and moreover, the copper supplement caused no increasein tyrosinase activities in A. bisporus. Accordingly with our results,Matsubara and Iwasaki (1972) detected tyrosinase activity in thefruiting bodies of the species A. arvensis and A. campestris, althoughin our study only slight tyrosinase activities were assayed from themycelial extracts of A. campestris. It is noteworthy that our study isthe first case when mycelial tyrosinase activities are reported forthe species A. balchaschensis and A. bernardii.

In the genus Agaricus, one of the major problems limiting spe-cies domestication and breeding is the low hyphal growth rate,which complicates development of cultivation methods and thus,commercialization of the species. In our study, various lignocellu-loses favored mycelial growth in most of the seven Agaricus spe-cies. Interestingly, A. arvensis, A. campestris and A. abruptibulbuspreferred litter- and grass-containing solid media to cereal–basedsubstrates for growth. According to Gramss (2010), the fairy-ring-forming field mushroom A. arvensis and the root-associatedA. campestris are dependent on grass plants for their nutritionand survival in the soil environment. The hyphal extension rateof A. macrocarpus was extremely low on all the media tested. Thismay be due to the lack of proper growth conditions since anotherstrain of A. macrocarpus has been reported to colonize non-sterilesoil very well (Gramss and Bergmann, 2007).

Extracellular enzyme production enables the soil-inhabiting andlitter-decomposing saprobic fungi like Agaricus spp. to utilize nutri-ents from humic-associated substrates. Results from our compara-tive study of extracellular and tyrosinase enzyme activitiesproduced by the five wild-type Agaricus species during cultivationon lignocellulose-rich substrates may therefore be used in subse-quent studies on their ecology and physiology, and for biotechnolog-ical purposes to optimize their cultivation conditions for moreefficient utilization of the various lignocellulosic substrates forgrowth.

In the genus Agaricus, classic species-level identification accord-ing to e.g. fruiting body and basidiospore morphology is compli-cated, which explains the versatility of the taxon names, currentlyexpanding to over 200 species names for Agaricus spp. (Kirk et al.,2008; Vellinga et al., 2011). For these reasons, molecular phyloge-netic analysis based on ITS sequences was conducted to confirmthe species identity of the Agaricus isolates used in this study. Inour phylogenetic analysis, the isolates A. arvensis FBCC1002 and A.campestris FBCC1005 group within the clades of Arvenses and Cam-pestres, as was previously described by Geml and Royse (2002), andA. abruptibulpus FBCC1001 and A. macrocarpus FBCC1006 are closely

related to A. arvensis, as well in consistency with the previous results(Geml et al., 2008). A. bernardii FBCC1014 is branching with A. ber-nardii strain ARP173 (Fig 5). A. balchaschensis FBCC1003 groups withA. vaporarius strain RWK1710 and close to A. bitorquis branch. How-ever, it is obvious that additional isolates of A. balchaschensis areneeded for molecular systematic studies until the taxonomic posi-tion of this species can be confirmed.

Acknowledgments

Funding from the Academy of Finland research project GrantsNos. 138331 and 1133022, and the EC Marie Curie actionPERG08-GA-2010-276794 Grant (to K.H.) are acknowledged. Dr.Nadezhda Psurtseva (Komarov Botanical Institute RAS, SaintPetersburg, Russia) is thanked for providing fungal isolates. ReettaHuttunen and Petri Kajasniemi are acknowledged for their assis-tance in the laboratory work.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.fgb.2013.02.002.

References

Baldrian, P., 2003. Interactions of heavy metals with white-rot fungi. EnzymeMicrob. Technol. 32, 78–91.

Baldrian, P., 2006. Fungal laccases – occurence and properties. FEMS Microbiol. Rev.30, 215–242.

Bonnen, A.M., Anton, L.H., Orth, A.B., 1994. Lignin-degrading enzymes of thecommercial button mushroom, Agaricus bisporus. Appl. Environ. Microbiol. 60,960–965.

Calvo-Bado, L., Noble, R., Challen, M., Dobrovin-Pennington, A., Elliott, T., 2000.Sexuality and genetic identity in the Agaricus section Arvenses. Appl. Environ.Microbiol. 66, 728–734.

Chang, T.-S., 2009. An updated review of tyrosinase inhibitors. Int. J. Mol. Sci. 10,2440–2475.

Durrant, A.J., Wood, D.A., Cain, R.B., 1991. Lignocellulose biodegradation by Agaricusbisporus during solid substrate fermentation. J. Gen. Microbiol. 137, 751–755.

Espín, J.C., Wichers, H.J., 1999. Activation of a latent mushroom (Agaricus bisporus)tyrosinase isoform by sodium dodecyl sulfate (SDS). Kinetic properties of theSDS-activated isoform. J. Agric. Food Chem. 47, 3518–3525.

Floudas, D., Binder, M., Riley, R., Barry, K., Blanchette, R.A., Henrissat, B., Martínez,A.T., Otillar, R., Spatafora, J.W., Yadav, J.S., Aerts, A., Benoit, I., Boyd, A., Carlson,A., Copeland, A., Coutinho, P.M., de Vries, R.P., Ferreira, P., Findley, K., Foster, B.,Gaskell, J., Glotzer, D., Górecki, P., Heitman, J., Hesse, C., Hori, C., Igarashi, K.,Jurgens, J.A., Kallen, N., Kersten, P., Kohler, A., Kües, U., Kumar, T.K., Kuo, A.,LaButti, K., Larrondo, L.F., Lindquist, E., Ling, A., Lombard, V., Lucas, S., Lundell, T.,Martin, R., McLaughlin, D.J., Morgenstern, I., Morin, E., Murat, C., Nagy, L.G.,Nolan, M., Ohm, R.A., Patyshakuliyeva, A., Rokas, A., Ruiz-Dueñas, F.J., Sabat, G.,Salamov, A., Samejima, M., Schmutz, J., Slot, J.C., St John, F., Stenlid, J., Sun, H.,Sun, S., Syed, K., Tsang, A., Wiebenga, A., Young, D., Pisabarro, A., Eastwood, D.C.,Martin, F., Cullen, D., Grigoriev, I.V., Hibbett, D.S., 2012. The Paleozoic origin ofenzymatic lignin decomposition reconstructed from 31 fungal genomes.Science 336, 1715–1719.

Gasparetti, C., Faccio, G., Arvas, M., Buchert, J., Saloheimo, M., Kruus, K., 2010.Discovery of a new tyrosinase-like enzyme family lacking a C-terminallyprocessed domain: production and characterization of an Aspergillus oryzaecatechol oxidase. Appl. Microbiol. Biotechnol. 86, 213–226.

Geml, J., Royse, D.J., 2002. Molecular phylogeny and cultivation of Agaricus species.In: Sánchez, J.E., Huerta, G., Montiel, E. (Eds.), Proceedings of the IV InternationalConference on Mushroom Biology and Mushroom Products, Cuernavaca,Mexico, pp. 111–120.

Geml, J., Geiser, D.M., Royse, D.J., 2004. Molecular evolution of Agaricus speciesbased on ITS and LSU rDNA sequences. Mycol. Prog. 3, 157–176.

Geml, J., Laursen, G.A., Taylor, D.L., 2008. Molecular diversity assessment of arcticand boreal Agaricus taxa. Mycologia 100, 193–208.

Gramss, G., 2010. The universe of basidiomycetous ground fungi. In: Méndez-Vilas,A. (Ed.), Current Research in Technology and Education: Topics in AppliedMicrobiology and Microbial Biotechnology, vol. 1. Formatex Research Center,pp. 218–229.

Gramss, G., Bergmann, H., 2007. Microbial competition, lack in macronutrients, andacidity as main obstacles to the transfer of basidiomycetous ground fungi into(organically or heavy-metal contaminated) soils. J. Basic Microbiol. 47, 309–316.

Halaouli, S., Asther, M., Sigoillot, J.C., Hamdi, M., Lomascolo, A., 2006. Fungaltyrosinases: new prospects in molecular characteristics, bioengineering andbiotechnological applications. J. Appl. Microbiol. 100, 219–232.

K. Hildén et al. / Fungal Genetics and Biology 55 (2013) 32–41 41

Hatakka, A., Hammel, K., 2010. Fungal biodegradation of lignocelluloses. In:Hofrichter, M., Ullrich, R. (Eds.), Mycota X. Industrial Applications, second ed.Springer-Verlag, Berlin, Heidelberg, pp. 319–340.

Hatakka, A., Lundell, T., Hofrichter, M., Maijala, P., 2003. Manganese peroxidase andits role in the degradation of wood lignin. In: Mansfield, S.D., Saddler, J.N. (Eds.),Applications of Enzymes to Lignocellulosics, ACS Symposium Series, AmericanChemical Society, Washington DC, pp. 230–243.

Heinzkill, M., Bech, L., Halkier, T., Schneider, P., Anke, T., 1998. Characterization oflaccases and peroxidases from wood-rotting fungi (family Coprinaceae). Appl.Environ. Microbiol. 64, 1601–1606.

Hildén, K., Hakala, T.K., Maijala, P., Lundell, T., Hatakka, A., 2007. Novelthermotolerant laccases produced by the white-rot fungus Physisporinusrivulosus. Appl. Microbiol. Biotechnol. 77, 301–309.

Hoegger, P.J., Kilaru, S., James, T.Y., Thacker, J.R., Kües, U., 2006. Phylogeneticcomparison and classification of laccase and related multicopper oxidaseprotein sequences. FEBS J. 273, 2308–2326.

Hofrichter, M., Ullrich, R., Pecyna, M., Liers, C., Lundell, T., 2010. New and classicfamilies of secreted fungal heme peroxidases. Appl. Microbiol. Biotechnol. 87,871–897.

Iwade, I., Mizuno, T., 1997. Cultivation of Kawariharatake (Agaricus blazei). Food Rev.Int. 13, 383–390.

Kerrigan, R.W., Callac, P., Xu, J., Noble, R., 1999. Population and phylogeneticstructure within the Agaricus subfloccosus complex. Mycol. Res. 103, 1515–1523.

Kirk, P.M., Cannon, P.F., Minter, D.W., Stalpers, J.A., 2008. Dictionary of the Fungi,10th ed. CABI, Wallingford.

Lankinen, P.V., Bonnen, A.M., Anton, L.H., Wood, D.A., Kalkkinen, N., Hatakka, A.,Thurston, C.F., 2001. Characteristics and N-terminal amino acid sequence ofmanganese peroxidase from solid substrate cultures of Agaricus bisporus. Appl.Microb. Biotechnol. 55, 170–176.

Lankinen, P., Hildén, K., Aro, N., Salkinoja-Salonen, M., Hatakka, A., 2005. Manganeseperoxidase of Agaricus bisporus: grain bran-promoted production and genecharacterization. Appl. Microbiol. Biotechnol. 66, 401–407.

Lundell, T., Mäkelä, M.R., Hildén, K., 2010. Lignin-modifying enzymes in filamentousbasidiomycetes – ecological, functional and phylogenetic review. J. BasicMicrobiol. 50, 5–20.

Mäkelä, M.R., Hildén, K.S., Hakala, T.K., Hatakka, A., Lundell, T.K., 2006. Expressionand molecular properties of a new laccase of the white rot fungus Phlebiaradiata grown on wood. Curr. Genet. 50, 323–333.

Mäkelä, M.R., Hatakka, A., Lundell, T., Hildén, K., 2012. Effect of copper, nutrientnitrogen and wood-supplement on the production of lignin-modifying enzymesby the white-rot fungus Phlebia radiata. Fungal Biol., http://dx.doi.org/10.1016/j.funbio.2012.11.006.

Martínez, A.T., Ruiz-Dueñas, F.J., Martínez, M.J., del Rio, J.C., Gutierrez, A., 2009.Enzymatic lignification of plant cell wall: from nature to mill. Curr. Opin.Biotechnol. 20, 348–357.

Martinez-Carrera, D., Smith, J.F., Challen, M.P., Elliott, T.J., 1995. Evolutionary trendsin the Agaricus bitorquis complex and their relevance for breeding. Mush. Sci. 14,29–35.

Matsubara, T., Iwasaki, H., 1972. Occurrence of laccase and tyrosinase in fungi ofAgaricales and comparative study of laccase from Russula delica and Russulapseudodelica. Shokubutsugaku Zasshi 85, 71–83.

Mayer, A.M., 2006. Polyphenol oxidases in plants and fungi: going places? A review.Phytochemistry 67, 2318–2331.

Mizuno, T., 1995. Kawariharatake, Agaricus blazei Murrill: medicinal and dietaryeffects. Food Rev. Intern. 11, 167–172.

Morin, E., Kohler, A., Baker, A.R., Foulogne-Oriol, M., Lombard, V., Nagy, L.G., Ohm,R.A., Patyshakuliyeva, A., Brun, A., Aerts, A.L., Bailey, A.M., Billette, C., Coutinho,P.M., Deakin, G., Doddapaneni, H., Floudas, D., Grimwood, J., Hildén, K., Kües, U.,LaButti, K.M., Lapidus, A., Lindquist, E.A., Lucas, S.M., Murat, C., Riley, R.W.,Salamov, A.A., Schmutz, J., Subramanian, V., Wösten, H.A.B., Xu, J., Eastwood,D.C., Foster, G.D., Sonnenberg, A.S.M., Cullen, D., de Vries, R.P., Lundell, T.,Hibbett, D.S., Henrissat, B., Burton, K.S., Kerrigan, R.W., Challen, M.P., Grigoriev,I.V., Martin, F., 2012. The genome sequence of the button mushroom Agaricusbisporus reveals mechanisms governing adaptation to a humic-rich ecologicalniche. Proc. Natl. Acad. Sci. USA 109, 17501–17506.

Morozova, O.V., Shumakovich, G.P., Shleev, S.V., Yaropolov, Y.I., 2007. Laccase-mediator systems and their applications: a review. Appl. Biochem. Microbiol.43, 523–535.

Nakamura, K., Go, N., 2005. Function and molecular evolution of multicopper blueproteins. Cell. Mol. Life Sci. 62, 2050–2066.

Navarro-Gonzáles, M., 2008. Growth, fruiting body development and laccaseproduction of selected coprini. PhD thesis, University of Goettingen,Goettingen, Germany.

Neeley, E., Fritch, G., Fuller, A., Wolfe, J., Wright, J., Flurkey, W., 2009. Variations inIC50 values with purity of mushroom tyrosinase. Int. J. Mol. Sci. 10, 3811–3823.

Noble, R., Grogan, H., Elliott, T., 1995. Variation in morphology, growth, andfructification of isolates in the Agaricus subfloccosus complex. Mycol. Res. 99,1453–1461.

Palmieri, G., Giardina, P., Bianco, C., Fontanella, B., Sannia, G., 2000. Copperinduction of laccase isoenzymes in the ligninolytic fungus Pleurotus ostreatus.Appl. Environ. Microbiol. 66, 920–924.

Pickard, M.A., Vandertol, H., Roman, R., Vazquez-Duhalt, R., 1999. High productionof ligninolytic enzymes from white rot fungi in cereal bran liquid medium. Can.J. Microbiol. 45, 627–631.

Ratcliffe, B., Flurkey, W.H., Kuglin, J., Dawley, R., 1994. Tyrosinase, laccase, andperoxidase in mushrooms Agaricus, Crimini, Oyster and Shiitake. J. Food Sci. 59,824–827.

Rodríguez-López, J.N., Escribano, J., García-Cánovas, F., 1994. A continuousspectrophotometric method for the determination of the determination ofmonophenolase activity of tyrosinase using 3-methyl-2-benzothiazolinonehydrazone. Anal. Biochem. 216, 205–212.

Selinheimo, E., Saloheimo, M., Ahola, E., Westerholm-Parvinen, A., Kalkkinen, N.,Buchert, J., Kruus, K., 2006. Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichodermareesei. FEBS J. 273, 4322–4335.

Soden, D.M., Dobson, A.D.W., 2001. Differential regulation of laccase geneexpression in Pleurotus sajor-caju. Microbiology 147, 1755–1763.

Solomon, E.I., Chen, P., Metz, M., Lee, S.-K., Palmer, A.E., 2001. Oxygen binding,activation, and reduction to water by copper proteins. Angew. Chem. Int. Ed. 40,4570–4590.

Sonnenberg, A.S., de Groot, P.W., Schaap, P.J., Baars, J.J., Visser, J., Van Griensven, L.J.,1996. Isolation of expressed sequence tags of Agaricus bisporus and theirassignment to chromosomes. Appl. Environ. Microbiol. 62, 4542–4547.

Steffen, K.T., Hofrichter, M., Hatakka, A., 2000. Mineralisation of 14C-labelledsynthetic lignin and ligninolytic enzyme activities of litter-decomposingbasidiomycetous fungi. Appl. Microbiol. Biotechnol. 54, 819–825.

Steffen, K.T., Hofrichter, M., Hatakka, A., 2002. Purification and characterization ofmanganese peroxidases from the litter-decomposing basidiomycetes Agrocybepraecox and Stropharia coronilla. Enzyme Microb. Technol. 30, 550–555.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:Molecular evolutionary genetics analysis using maximum likelihood,evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,2731–2739.

Thurston, C.F., 1994. The structure and function of fungal laccases. Microbiology140, 19–26.

Ullrich, R., Huong, L.M., Dung, N.L., Hofrichter, M., 2005. Laccase from the medicinalmushroom Agaricus blazei: production, purification and characterization. Appl.Microbiol. Biotechnol. 67, 357–363.

Uthandi, S., Saad, B., Humbard, M.A., Maupin-Furlow, J.A., 2010. LccA, an archaeallaccase secreted as a highly stable glycoprotein into the extracellular mediumby Haloferax volcanii. Appl. Environ. Microbiol. 76, 733–743.

Valášková, V., Šnajdr, J., Bittner, B., Cajthaml, T., Merhautová, V., Hofrichter, M.,Baldrian, P., 2007. Production of lignocellulose-degrading enzymes anddegradation of leaf litter by saprotrophic basidiomycetes isolated from aQuercus petraea forest. Soil Biol. Biochem. 39, 2651–2660.

Vares, T., Kalsi, M., Hatakka, A., 1995. Lignin peroxidases, manganese peroxidases,and other ligninolytic enzymes produced by Phlebia radiata during solid-statefermentation of wheat straw. Appl. Environ. Microbiol. 61, 3515–3520.

Vellinga, E.C., Sysouphanthong, P., Hyde, K.D., 2011. The family of Agaricaceae:phylogenies and two new white-spored genera. Mycologia 103, 494–509.

Waksman, S., Nissen, W., 1932. On the nutrition of the cultivated mushroomAgaricus campestris, and the chemical changes brought about by this organismin the manure compost. Am. J. Bot. 19, 514–537.

Wariishi, H., Valli, K., Gold, M.K., 1992. Manganese (II) oxidation by manganeseperoxidase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem.267, 23688–23695.

White, T.J., Bruns, T., Lee, S., Taylor, J.W., 1990. Amplification and direct sequencingof fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H.,Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: a Guide to Methods andApplications. Academic Press, Inc., New York, pp. 315–322.

Wood, D.A., 1980. Inactivation of extracellular laccase during fruiting of Agaricusbisporus. J. Gen. Microbiol. 117, 339–345.

Wood, D.A., 1989. Mushroom biotechnology. Int. Ind. Biotechnol. 9, 5–9.