Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research...

23
Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects

Transcript of Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research...

Page 1: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Welcome toIntroduction to Bioinformatics

Monday, 28 February 2005

Introduction to Research Projects

Page 2: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Prochlorococcus MED4

Prochlorococcus SS120

CO2

Fixed C

N2

Fixed N

Trichodesmium erythraeum

Crocosphaera watsonii

Wolfgang Hess, U. Freiburg

Brian Palenik, Scripps

Eric Webb, Woods Hole

Rakefet Schwarz, Bar Ilan U Jon Zehr, UC Santa Cruz

Oceanic Cyanobacteria

Page 3: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Differentiation by N2-Fixing Cyanobacteria

Peter Wolk, Michigan StJim Golden, Texas A&MTerry Thiel, U. Missouri-St.LouisMike Summers, Cal State-NorthridgeJack Meeks, U California-Davis

Page 4: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Cyanobacterial Genomes

You Chen, Texas A&MJames Godde, MonmouthPeter Wolk, Michigan StJack Meeks, U California-Davis

AATAAAGCTTTACAAACCAAACTCTGGCTTCAATTGTGTAACCCAAGCTTTGATTCTTTCCTCTGTTAAATCGGATTGATTATCTTCATCAAGGGCAAGACCTACAAATTTACCATCACGAACAGCTTTAGACTCACTGAATTCATAACCTTCTGTAGGCCAATAGCCAACTGTTTCACCACCATTTTCTGAAATTTTTTCCTCTAGAATACCGCAACACTATCACCACCAAACTCCTTCTGAATTATTTCTGATTCAGTTTGGGTATTGCCTGTTTGAGTACCAAAAAATAAACCAATATTAGACAATAAAGCTTTACAAACCAAACTCTGGCTTCAATTGTGTAACCCAAGCTTTGATTCTTTCCTCTGTTAAATCGGATTGATTATCTTCATCAAGGGCAAGACCTACAAATTTACCATCACGAACAGCTTTAGACTCACTGAATTCATAACCTTCTGTAGGCCAATAGCCAACTGTTTCACCACCATTTTCTGAAATTTTTTCCTCTAGAATACCGCAACACTATCACCACCAAACTCCTTCTGAATTATTTCTGAT

Page 5: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

RNA-mediated Gene Regulation in Synechococcus PCC 7942

Circadian rhythmYou ChenTexas A&M

C

Crp

5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

lacZ

RNA Polymerase

Page 6: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

RNA-mediated Gene Regulation in Synechococcus PCC 7942

Circadian rhythmYou ChenTexas A&M

???

5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

photosynthesis

RNA Polymerase

Page 7: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

RNA-mediated Gene Regulation in Synechococcus PCC 7942

You ChenTexas A&M

???

5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

photosynthesis

RNA Polymerase

Genomic search for potential regulatory RNA molecules

Page 8: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

RNA-mediated Gene Regulation in Anabaena PCC 7120

Peter WolkMichigan State U Heterocyst differentiation

- N

Page 9: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

RNA-mediated Gene Regulation in Anabaena PCC 7120

Peter WolkMichigan State U

- N

Genomic search for potential regulatory RNA molecules

Page 10: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Factors mediating patterned differentiation by Anabaena PCC 7120

Jim GoldenTexas A&M Heterocyst differentiation

Page 11: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Motifs regulating akinete expression in Nostoc punctiforme

Mike SummersCal State-Northridge

Dark+

fructose

heterocyst akinetes

Page 12: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Motifs regulating akinete expression in Nostoc punctiforme

Mike SummersCal State-Northridge

Dark+

fructose

Search for sequence patterns upstream from akinete-specific genes

Page 13: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Generalized motif discovery in small marine cyanobacteria

Wolfgang HessU Freiburg

Dark+

fructose

Page 14: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Generalized motif discovery in small marine cyanobacteria

Wolfgang HessU Freiburg

Prochlorococcus MED4Prochlorococcus SS120Prochlorococcus MIT9313Synechococcus WH8302

Page 15: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Function prediction by conserved gene position in marine cyanobacteria

Jon ZehrU California-Santa Clara

Why not more?

CO2 N2

sugar

NH3

- Limitation by iron- Limitation by nitrogen

Fe-related??

Page 16: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Motifs governing expression of iron-related genes in marine cyanobacteria

Eric WebbWoods Hole

Why not more?

CO2 N2

sugar

NH3

- Limitation by iron- Limitation by nitrogen

Fe-related

Page 17: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Genome families of Nostoc punctiforme compared to smaller cyanobacteria

Jack MeeksU California-Davis

?heterocyst Symbiosis

with plants

9.1 Mb

Prochlorococcus

1.7 Mb

Why is the Nostoc genome so large?

Page 18: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Characterization of nitrogenase complexes in Anabaena variabilis

Terry ThielU Missouri-St. Louis

heterocyst

N2

NH3nitrogenase

Molybdenum

Vanadium

Page 19: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Characterization of nitrogenase complexes in Anabaena variabilis

Terry ThielU Missouri-St. Louis

Vanadium

What genes encode each machine?Where did they come from?

Page 20: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Protein quorum sensing signals between marine cyanobacteria

Rakefet Schwarz Bar Ilan U

?

Vs

Page 21: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Protein quorum sensing signals between marine cyanobacteria

Rakefet Schwarz Bar Ilan U

?

Vs

What proteins mediate communication between

cyanobacteria?

Page 22: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Protein quorum sensing signals between marine cyanobacteria

Brian PalenikScripps Ocean. Inst.

What signals determine protein transport through

membranes?

Page 23: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects.

Unusual repeated sequences in genomic DNA

James GoddeMonmouth College

• Tandem repeats

• Dispersed repeats• CRISPRs

What is the mechanism by which CRISPRs propagate?