The PPAR-γ agonist troglitazone antagonizes survival pathways induced by STAT-3 in recombinant...

Biotechnology Advances 30 (2012) 169–184

Contents lists available at SciVerse ScienceDirect

Biotechnology Advances

j ourna l homepage: www.e lsev ie r.com/ locate /b iotechadv

The PPAR-γ agonist troglitazone antagonizes survival pathways induced by STAT-3 inrecombinant interferon-β treated pancreatic cancer cells

Giovanni Vitale a,b,⁎, Silvia Zappavigna c, Monica Marra c, Alessandra Dicitore b, Stefania Meschini d,Maria Condello d, Giuseppe Arancia d, Sara Castiglioni b, Paola Maroni e, Paola Bendinelli f,Roberta Piccoletti f, Peter M. van Koetsveld g, Francesco Cavagnini a,b, Alfredo Budillon h,Alberto Abbruzzese c, Leo J. Hofland g, Michele Caraglia c,⁎⁎a Dipartimento di Scienze Mediche, Universita` degli Studi di Milano, Milan, Italyb Istituto Auxologico Italiano IRCCS Milan, Italyc Department of Biochemistry and Biophysics, Second University of Naples, Via Costantinopoli, 16 80138 Naples, Italyd Department of Technology and Health, Italian National Institute of Health, Viale Regina Elena 299, 00161 Rome, Italye Galeazzi Orthopaedic Institute, IRCCS, Milan, Italyf Dipartimento di Morfologia Umana e Scienze Biomediche “Città Studi”, Universita` degli Studi di Milano, Milan, Italyg Department of Internal Medicine, Division of Endocrinology, Erasmus MC, Rotterdam, The Netherlandsh National Cancer Institute Fondazione “G. Pascale”, Experimental Oncology Dept., Experimental Pharmacology Unit, Naples, Italy

Abbreviations: IFN, Interferon; STAT, Signal TransducerI;MAPK,mitogen-activatedproteinkinase; PPAR-γ, peroxidose reduction index; PF, potentiation factor; PBS, phosphastimulated gene factor; TEM, transmission electron microcyclin dependent kinases;WT, wild type; DN, dominant neeukaryotic translation elongation factor 1; 15d-PGJ2, 15-D⁎ Correspondence to: G. Vitale, Istituto Auxologico Italia⁎⁎ Correspondence to: M Caraglia, Department of Biocfax: +39 0815665863.

E-mail addresses: [email protected] (G. Vitale

0734-9750/$ – see front matter © 2011 Elsevier Inc. Aldoi:10.1016/j.biotechadv.2011.08.001

a b s t r a c t
a r t i c l e i n f o
Available online 17 August 2011

Keywords:Type I interferonsRecombinant interferon betaPPAR gammaTroglitazoneSTATsCell cycleAutophagyMAPKAKTmTOR

We have previously shown that cancer cells can protect themselves from apoptosis induced by type Iinterferons (IFNs) through a ras→MAPK-mediated pathway. In addition, since IFN-mediated signallingcomponents STATs are controlled by PPAR gamma we studied the pharmacological interaction betweenrecombinant IFN-β and the PPAR-γ agonist troglitazone (TGZ). This combination induced a synergistic effecton the growth inhibition of BxPC-3, a pancreatic cancer cell line, through the counteraction of the IFN-β-induced activation of STAT-3, MAPK and AKT and the increase in the binding of both STAT-1 relatedcomplexes and PPAR-γ with specific DNA responsive elements. The synergism on cell growth inhibitioncorrelated with a cell cycle arrest in G0/G1 phase, secondary to a long-lasting increase of both p21 and p27expressions. Blockade of MAPK activation and the effect on p21 and p27 expressions, induced by IFN-β andTGZ combination, were due to the decreased activation of STAT-3 secondary to TGZ. IFN-β alone alsoincreased p21 and p27 expression through STAT-1 phosphorylation and this effect was attenuated by theconcomitant activation of IFNbeta-induced STAT-3-activation. The combination induced also an increase inautophagy and a decrease in anti-autophagic bcl-2/beclin-1 complex formation. This effect was mediated bythe inactivation of the AKT→mTOR-dependent pathway. To the best of our knowledge this is the firstevidence that PPAR-γ activation can counteract STAT-3-dependent escape pathways to IFN-β-inducedgrowth inhibition through cell cycle perturbation and increased autophagic death in pancreatic cancer cells.

andActivator of Transcription;PI3K, phosphatidylinositol 3someproliferator-activated receptorγ; TGZ, troglitazone; CIte buffered saline; eIF4E, eukaryotic translation initiation fascopy; AVOs, acidic vesicular organelles; ISRE, Interferon-sgative; mTOR, mammalian target of rapamycin; 4EBP1, eIFeoxy-Delta-12,14-prostaglandin J2; SOCS3, Suppressor of cno, Universita` degli Studi di Milano, Via Zucchi 18, Cusanohemistry and Biophysics, Second University of Naples, V

), [email protected] (M. Caraglia).

l rights reserved.

© 2011 Elsevier Inc. All rights reserved.

1. Introduction

Exocrine pancreatic adenocarcinoma is one of the most intrinsi-cally resistant tumors to chemo- and radiotherapy, with a 5-yearsurvival b4% and a median survival b6 months (Li et al., 2004).

Surgery remains the only curative therapy. Unfortunately, only 5% to15% of patients are surgical candidates at the time of diagnosis (Sohnet al., 2000). In this selected group of patients adjuvant chemotherapyhas a significant survival benefit, but the 5-year survival is only 21%(Neoptolemos et al., 2004). However, it has been described that

kinase; EGF, epidermal growth factor; IGF-I, insulin-like growth factor, combination index; IC50, halfmaximal inhibitory concentration;DRI,ctor 4E; EMSA, Electrophoretic mobility shift assay; ISGF, Interferon-timulated Response Element; GAS, IFN-gamma-activation site; CDK,4E-binding protein 1; MNK1, MAPK activated protein kinase; eEF-1A,ytokine signaling 3.Milanino (MI), 20095, Italy. Tel./fax: +39 02619112023.ia Costantinopoli 16, 80138, Naples, Italy. Tel.: +39 0815665871;

http://dx.doi.org/10.1016/j.biotechadv.2011.08.001

mailto:[email protected]

mailto:[email protected]

http://dx.doi.org/10.1016/j.biotechadv.2011.08.001

http://www.sciencedirect.com/science/journal/07349750

170 G. Vitale et al. / Biotechnology Advances 30 (2012) 169–184

interferon (IFN)-α in combination with adjuvant chemoradiotherapyimproved 5-year survival to 55% (Picozzi et al., 2003).

We recently showed that IFN-β, belonging to the family of type IIFNs together with IFN-α, has an in vitro antitumor activity strongerthan IFN-α in exocrine (Vitale et al., 2007) and endocrine (Vitale et al.,2006) tumors of the pancreas and in adrenal cancer (van Koetsveld etal., 2006). In these tumors, IFN-β induces amore potent and earlier cellcycle arrest and apoptosis activation compared to IFN-α. However, theclinical translation of type I IFNs is limited by the potential occurrenceof tumor resistance (Caraglia et al., 2009; Tagliaferri et al., 2005). Thealteration of type I IFNs signalling pathways and the activation ofsurvival pathways are commonmechanisms of tumor resistance to thegrowth inhibitory activity of IFNs. The interaction of type I IFNs withthe relative receptor activates two intracytoplasmic receptor-associ-ated kinases (Tyk-2 and JAK-1) able to induce the tyrosine phosphor-ylation of the receptor itself and of Signal Transducer and Activator ofTranscription (STAT) proteins. IFN receptor activation classically leadsto the phosphorylation of STAT-1 and STAT-2, inducing the apoptosisand cell cycle arrest in cancer cells (Caraglia et al., 2009; Tagliaferriet al., 2005). However, type I IFNs can also recruit and activate STAT-3protein. The phosphorylated STAT-3 acts as adapter for phosphatidy-linositol 3 kinase (PI3K) (Caraglia et al., 2009; Tagliaferri et al., 2005).One of the targets downstream to PI3K is the serine–threonine kinaseAkt, which is important for the generation of anti-apoptotic signals.Therefore, STAT-3 activation can prevent apoptosis and counteract theantitumor activity promoted by STAT-1 and STAT-2 activation(Caraglia et al., 2009; Tagliaferri et al., 2005). It is interesting toobserve that aberrant STAT-3 activation provides a relevant contribu-tion to the malignant phenotype of human pancreatic cancer (Qiuet al., 2007; Scholz et al., 2003). The autocrine/paracrine epidermalgrowth factor (EGF) and insulin-like growth factor I (IGF-I) systems,which are overexpressed in humanpancreatic cancer cells, particularlyin patientswith poor prognosis and inmetastatic lesions (Garcea et al.,2005; Xue et al., 2008), are important upstream stimulus of STAT-3activity (Chan et al., 2004; Colomiere et al., 2009; Novosyadlyy et al.,2008; Sriuranpong et al., 2003). We demonstrated that the increasedEGF receptor (EGF-R) expression and function represents anotherinducible survival responsewhich protects cancer cells from apoptosiscaused by IFN-α (Caraglia et al., 2003). The overactivation of EGFsystem stimulates Ras activation and the subsequent mitogen-activated protein kinase (MAPK) cascade. PI3K/Akt is another pathwayactivated by EGF-R and involved in cell growth, apoptosis resistance,invasion and migration. Moreover, in pancreatic cancer cells it wasrecently found the existence of a RAF/AKT/STAT-3 pathway, that doesnot involve MAPK, mediating the antitumor activity of sorafenib(a specific raf kinase inhibitor) (Ulivi et al., 2009). On the basis of theseobservations, we cannot exclude that the antitumor activity of type IIFNs may be counteracted by the overactivation of STAT-3 throughdirect and/or indirect (mediated by EGF/EGF-R or IGF-I/IGF-I receptor)survival mechanisms in pancreatic cancer cells.

Some nuclear receptors modulate the transcriptional activities ofSTATs through direct or coregulator-mediated protein–protein in-teractions. The peroxisome proliferator-activated receptor γ (PPAR-γ)is a prototypical member of the nuclear receptor superfamily andintegrates the control of energy, lipid, and glucose homeostasis.PPAR-γ is the main target of the thiazolidenedione class of insulin-sensitizing drugs (troglitazone, rosiglitazone, pioglitazone and cigli-tazone), which are currently a mainstay of therapy for type 2 diabetes.Apart from established metabolic actions, PPAR-γ agonists displayantineoplastic effects in several tumors, including pancreatic cancer(Motomura et al., 2004). Several mechanisms appear to contribute tothe antitumor activity of these compounds. It has been described thatPPAR-γ agonists can function as negative modulators of STAT-3through direct and/or indirect mechanisms (Wang et al., 2005, 2009).

On the basis of these data, the aim of the present study was toevaluate the antitumor activity and pharmacological interaction

between recombinant IFN-β and troglitazone (TGZ) in pancreaticcancer.

2. Materials and methods

2.1. Cell cultures

The human pancreatic cancer cell line, BxPC-3, was purchasedfrom the American Type Culture Collection. Cells were cultured in ahumidified incubator containing 5% CO2 at 37 °C. The culture mediumconsisted of RPMI 1640 supplemented with 10% FCS, penicillin (105U/L) and L-glutamine (2 mmol/l). Periodically, the cells were confirmedas Mycoplasma-free. Cells were harvested with trypsin (0.05%), EDTA(0.02%), and resuspended in medium. Before plating, the cells werecounted microscopically using a standard hemocytometer. TrypanBlue staining was used to assess cell viability and always exceeded95%.

2.2. Cell proliferation assay

Analysis of cell proliferation was performed in the presence ofIFN-β and TGZ by theMTT assay. Briefly, cells (5×103) were seeded in96-well plates in serum-containing media and allowed to attach for24 h. The mediumwas then removed and replaced with newmediumcontaining drugs at different concentrations. Cells were incubatedunder these conditions for a time course spanning 72 h. Then cellviability was assessed with MTT method as previously described(Caraglia et al., 2003).

2.3. Drug combination studies

For the study of the synergism between IFN-β and TGZ on cellgrowth inhibition of BxPC-3, the cells were seeded in 96-multiwellplates at the density of 5×103cells/well. After 24 h incubation at 37 °Cthe cells were treated with different concentrations of IFN-β and TGZ.Drug combination studies were based on concentration–effect curvesgenerated as a plot of the fraction of unaffected (surviving) cellsversus drug concentration (Chou and Talalay, 1984) after 72 h oftreatment. To explore the relative contribution of each agent to thesynergism, three combinations with different IFN-β/TGZ molar ratioswere tested for each schedule: equiactive doses of the two agents(IC50), higher relative doses of IFN-β (IC75 of IFN-β/IC25 of TGZ) andhigher relative doses of TGZ (IC25 of IFN-β/IC75 of TGZ). Assessment ofsynergy was performed quantitating drug interaction by Calcusyncomputer program (Biosoft, Ferguson, MO). Combination index (CI)values of b1, 1, and N1 indicate synergy, additivity, and antagonism,respectively (Chou et al., 1994). The dose reduction index (DRI)represents the measure of how much the dose of each drug in asynergistic combination may be reduced at a given effect levelcompared with the doses of each drug alone. Furthermore, weanalyzed the specific contribution of both IFN-β and TGZ on thecytotoxic effect of the combination of drugs by calculating thepotentiation factor (PF), defined as the ratio of the IC50 of eitherIFN-β or TGZ alone to the IC50 of IFN-β and TGZ in combination; ahigher PF indicates a greater cytotoxicity.

2.4. Western blotting

BxPC-3 cells were scraped, washed twice in cold phosphatebuffered saline (PBS) and resuspended in 20 μl of lysis buffer(1% Triton, 0.5% sodium deoxycholate, 0.1 NaCl, 1 mM EDTA, pH 7.5,10 mM Na2HPO4, pH 7.4, 10 mM PMSF, 25 mM benzamidin, 1 mMleupeptin, 0.025 units/ml aprotinin) for 30 min on ice and centrifugedat 14,000×g for 20 min at 4 °C. Protein concentration was determinedby Lowrymethod and comparedwith bovine serum albumin standardcurve. Equal amounts of cell proteins were separated by SDS-PAGE,

171G. Vitale et al. / Biotechnology Advances 30 (2012) 169–184

electrotransferred to nitrocellulose and reacted with the differentantibodies: anti-STAT-1C terminus (BD Transduction Laboratories),anti-STAT-3 (BD Transduction Laboratories), anti-p-STAT-1 (CellSignaling Tecnology Inc, Beverly, MA, USA), anti-p-STAT-3 (BDTransduction Laboratories), anti-Kip/p27 (BD transduction Laborato-ries), anti-Waf1/p21 (Calbiochem), anti-p-MAPK p42/44 (Cell Signal-ing Tecnology Inc, Beverly, MA, USA), anti-pAKT (Cell SignalingTecnology Inc, Beverly, MA, USA), anti-beclin1 (Cell SignalingTecnology Inc, Beverly, MA, USA), anti bcl2 (Santa Cruz Biotechnology,inc.), anti-eIF4E-binding protein 1 (4EBP1) (Cell Signaling TecnologyInc, Beverly, MA, USA), anti-p-4EBP1 (Cell Signaling Tecnology Inc,Beverly, MA, USA), anti-eukaryotic translation initiation factor 4E(eIF4E) (Cell Signaling Tecnology Inc, Beverly, MA, USA), anti-p-eIF4E(Cell Signaling Tecnology Inc, Beverly, MA, USA), anti-MAPK activatedprotein kinase (MNK1) (Cell Signaling Tecnology Inc, Beverly, MA,USA), anti-p-MNK1(Cell Signaling Tecnology Inc, Beverly, MA, USA),anti-α-tubulin (Calbiochem), and anti-ubiquitin (Santa Cruz Biotech-nology, inc.). Blots were then developed using enhanced chemo-luminescence detection reagents (SuperSignal West Pico, Pierce) andexposed to X-ray film. The bands derived from western blottingwere scanned with a laser scanner (Epson 1260) and their intensitieswere quantified with Image J software (NIH). The error bars shownin the histograms represent the standard deviation from the meanof different densitometric scanning in at least three differentexperiments.

2.5. Immunoprecipitation

Total protein extracts were subjected to immunoprecipitationwith 2 μg of anti-beclin1, anti-bcl2, anti p27 or anti-p21 for 2 h at 4 °C.Immune complexes were collected with 20 μl of protein A-agarose for16 h at 4 °C. The protein A-agarose/immune complex was washedtwice with cold PBS, resuspended in 20 μl of SDS-loading buffer,heated to 95 °C for 5 min and used for Western blotting analysis usinganti-bcl2, anti-beclin 1 or anti-ubiquitin.

2.6. Preparation of nuclear extracts

After treatment, the cells were scraped off in ice-cold PBS andhomogenised in a buffer containing 10 mM Hepes pH 7.9, 10 mM KCl,1.5 mM MgCl2, 0.2 mM EDTA pH 7.9, 0.5 mM dithiothreitol, 0.5 mMPMSF, 10 μg/ml leupeptin, 10 μg/ml aprotinin, and 1 mM Na3VO4. Thenuclei were collected by centrifugation at 5000 rpm at 4 °C inEppendorf microfuge, washed with the same buffer, and resuspendedin a homogenisation buffer containing 0.4 M NaCl and 25% glycerol,after which the nuclear proteins were extracted for 30 min at 4 °Cunder constant shaking. The samples were then centrifuged at16,000 g for 30 min at 4 °C for supernatant collection, and theirprotein concentration was determined using Bradford's method. Thesamples were then frozen and kept at −80 °C.

2.7. Analysis of the mobility of DNA–protein complexes by gelelectrophoresis (EMSA)

EMSA was performed as previously described (Bendinelli et al,2000). Oligonucleotides, 5 GATCCTCGGGAAAGGGAAACCGAAACT-GAAGCC3 ISRE (IFN-stimulated response element) (Hua et al, 2002);5 AGCTTCAGCCTGATTTCCCCGAAATGACGGA3 IRF1 GAS (IFN-γ acti-vation site) (Lehtonen et al., 1997); 5 TCTCTCTGGGTGAAATGTGC-3ARE6, containing the PPAR response element of (aP2 adipocyte lipid-binding protein (Juge-Aubry et al., 1997), were synthesized by Primm(Milan, Italy). One strand was end-labelled with T4 polynucleotidekinase and [γ-32P]ATP and annealed to the complementary strand. Thedouble-stranded sequence was purified by means of native PAGE.Aliquots of nuclear extracts (5 μg proteins) were incubated in 25 μl of abinding reaction mixture containing: 10 mM Tris, pH 7.9, 5% glycerol,

50 mMNaCl, 1 mMEDTA, 0.5 mMdithiotreithol, and 0.5 μg of poly [dI–dC] in the presence of 0.5 ng of the labelled double-stranded sequence.For the competition experiments, an excess of specific unlabelleddouble-stranded sequences (25 to 50 ng) was added to the bindingmixture. After 20 min at 25 °C, 5 μl of dye solution (0.01% bromophenolblue, 0.05% xylene cyanol, 5% Ficoll) was added to samples. DNA–protein complexes were loaded onto a 5% native PAGE in 0.5×TBE or1× TBE for ARE6 probe (1× TBE: 90 mMTris borate, 2 mMEDTA, pH 8).The gel was run at 280 V for 2 h at 5 °C, then dried and subjected toautoradiography at−80 °Cwith Kodak X-Omat AR film. The antibody-mediated supershift analyses were performed by preincubatingnuclear extract proteins (5 μg) with appropriate antibodies (2 μg foranti-STAT-1 and anti-STAT-3, 1 μg for anti-interferon-stimulated genefactor (ISGF)-3γ p48, 1,5 μg for anti-PPAR-γ antibodies) for 1 h on icefollowed by incubation with labelled oligonucleotide for 20 min. Thesamples were then resolved by PAGE as described above. Quantitativemeasurement of radioactive bands was performed by densitometricanalysis using Image Master Software (Pharmacia, Milwaukee, WI).

2.8. Cell cycle analysis

Cells were plated in 100 mm dishes. After 1 day, cells were treatedwith IFN-β and TGZ. After 1 day of incubation (with a confluence of60–70%), cells were harvested by gentle trypsinization and preparedfor cell cycle determination using propidium iodide for DNA staining,as previously described (Vitale et al., 2006). The stained cells wereanalyzed by FACS-calibur flow cytometer (Becton Dickinson, Erem-bodegem, Belgium) and CellQuest Pro Software. Cell cycle progressionwas measured with corresponding absorbances for. Cell cycledistribution, expressed as percentage of cells in G0/G1, S and G2/Mphases, was determined as previously described (Vitale et al., 2006).

2.9. Quantitative PCR

Total RNA was isolated using a commercially available kit (highpure RNA isolation kit; Roche, Almere, The Netherlands). cDNAsynthesis and quantitative PCR using Taqman Gold Nuclease assayand the ABI PRISM 7900 sequence detection system (Perkin ElmerApplied Biosystems, Groningen, The Netherlands) were performedas described in detail previously (Hofland et al., 2005). The primersand probes sequences were obtained from Sigma-Aldrich (St. Louis,USA). The primer sequences were as follows for p27, forward: 5 -GGAGCAATGCGCAGGAAT-3 , reverse: 5 -TGGCTCTTTTGTTTTGAG-TAGAAGAA-3 , probe 5 -FAM-AGGAAGCGACCTGCAACCGACG-TAMRA-3 and for p21, forward: 5 -TGGAGACTCTCAGGGTCGAAA-3 , reverse: 5 -CGGCGTTTGGAGTGGTAGAA-3 , probe: 5 -FAM-CGGCGGCAGACCAGCATGAC-TAMRA-3 . The estimated copy num-bers were calculated using the comparative threshold method withefficiency correction (Livak and Schmittgen, 2001). The detection ofhypoxanthine-phosphoribosyl-transferase (hprt) mRNA served asa control and was used for normalization of the p27 and p21 mRNAlevels. Primers and probes to detect hprt have been describedpreviously (Hofland et al., 2004). To exclude contamination of thePCR mixtures, the reactions were also performed in the absence ofcDNA template, in parallel with cDNA samples.

2.10. Plasmids and transfections

STAT-1 dominant-negative (DN) mutant (Y701F) and STAT-3 DNmutant (Y705F) plasmids have been described previously (Asao andFu, 2000; Zhang et al., 2004). Specifically, pEFneoStat1 was con-structed by inserting human Stat1 cDNA to BamHI and EcoRV sites ofpEFneo. pEFneoStat1-Y701F is a mutant human Stat1 in which aphenylalanine was substituted for tyrosine 701. Wild-type STAT3cDNA3 was cloned into a mammalian expression vector containingthe ampicillin resistance gene, pcDNA3.1/Amp(+). The cDNA for DN

B

C

0 0.2 0.4 0.6 0.8 1.00

1.0

2.0

3.0

4.0

5.0

Fractional Effect

CI

0 0.2 0.4 0.6 0.8 1.0

0

0.5

1.0

1.5

2.0

2.5

Fractional Effect

CI

0 0.2 0.4 0.6 0.8 1.00

1.0

2.0

3.0

Fractional Effect

CI

A

Fig. 1. IFN-β and troglitazone (TGZ) have a synergistic effect on BxPC-3 cell growthinhibition. We have evaluated the growth inhibition induced by different concentra-tions of IFN-β and TGZ at 72 h on BxPC-3 cells. We have performed these experimentswith MTT assay and the resulting data were elaborated with the dedicated softwareCalcusyn (by Chou and Talalay) as described in “Materials and methods”. In the figurethe isobologram analysis of the effects of IFN-β and TGZ combinations, at equitoxicconcentrations (A), at overwhelming concentrations of IFN-β (B) and at overwhelmingconcentrations of TGZ (C) is shown. CI: combination index. Each point is the mean of atleast three different experiments performed in quadruplicates.


STAT3 (Phe substitution at Tyr705, STAT3-YF) was made by PCR-mediated mutagenesis and cloned into pcDNA3.1/Amp(+). Thetransfection of DNA plasmid encoding for DN or wild type (WT)STAT-1 or STAT-3 (15 μg) was performed with Lipofectamine 2000(LF2000) according to the manufacturer's instructions (Invitrogen)and transfection efficiency was determined using the β-GalactosidaseEnzyme Assay System (Promega, Madison WI). The transfectionefficiency for β-galactosidase activity was more than 85% after 24 hfrom the transfection. After transfection, cells were incubated at 37 °Cfor 24 h and treated with IFN-β and/or TGZ for 6 h. Then, the cellswere processed for western blotting assay.

2.11. Transmission electron microscopy (TEM)

After 48 h of incubation with INF-β (25 UI/ml) and/or TGZ(25 μM), detached and adherent BxPC-3 cells were collected. BxPC-3cells growing for the same time in drug free medium were used ascontrol. After centrifugation, the pellet was fixed with 2.5% glutaral-dehyde in 0.1 M cacodylate buffer (pH 7.3) at room temperature for20 min. After postfixationwith 1% OsO4 in 0.2 M cacodylate buffer (pH7.3) at room temperature for 1 h, cells were dehydrated withascending concentrations of ethanol, and embedded in epoxy resin(TAAB Laboratories Equipment Limited, Aldermarton, UK). Ultrathinsections, obtained with an LKB Ultratome Nova ultramicrotome (LKB,Bromma, Sweden), were stained with uranyl acetate and lead citrateand thenwere examinedwith a Philips EM208S transmission electronmicroscope (FEI Company, Eindhoven, The Netherland).

2.12. Detection and quantification of acidic vesicular organelles withacridine orange

To detect and quantify the acidic vesicular organelles (AVOs) incontrol and treated cells, the vital staining with acridine orange wascarried out according to Traganos and Darzinkiewich(1994). Inacridine orange-stained cells, the cytoplasm and nucleolus fluorescebright green and dim red, whereas acidic compartments fluorescebright red. The intensity of the red fluorescence is proportional to thedegree of acidity and/or the amount of the cellular acidic compart-ments. After 48 h of incubation with or without INF-β (25 UI/ml) and/or TGZ (25 μM), cells were detached and stained with acridine orangeat a final concentration of 1 μg/ml for 15 min. After washing in PBSsolution, cells were analyzed by FACScan flow cytometer (BectonDickinson, Mountain View, CA) equipped with a 15-mW, 488 nm, andan air-cooled argon ion laser. The fluorescent emission was collectedthrough a 670 nm band-pass filter and acquired in log mode.At least 10,000 events were analyzed. The analysis was carried outon living cells selected on FSC/SSC plot (area selection) in order toeliminate cellular debris. Monoparametric analysis quantified theintensity of the red fluorescence and was expressed as arbitrary unitthat was calculated by the formula MFCtreated/MFCuntreated. MFCtreatedis the mean fluorescence channel, calculated by CellQuest software,of the drug treated cells and the MFCuntreated is the fluorescenceintensity of the untreated cells. The values reported in the figureare the mean±standard deviations from three independentexperiments.

2.13. Statistical analysis

All experiments were carried out at least 3 times and gavecomparable results. For statistical analysis GraphPad Prism 3.0(GraphPad Software, San Diego, CA) was used. The comparativestatistical evaluation among groups was first performed by theANOVA test. When significant differences were found, a comparisonbetween groups was made using the Newman–Keuls test. In allanalyses, values of Pb0.05 were considered statistically significant.The values reported in the figures are the mean±standard deviations(SD) from at least three independent experiments.

3. Results

3.1. Pharmacological combination between IFN-β and TGZ

In order to investigate the potential interaction between IFN-βand TGZ in pancreatic cancer, we evaluated the growth inhibitioninduced by different concentrations of IFN-β in combination with TGZat 72 h on BxPC-3 cells. We performed these experiments with MTTassay and the resulting data were elaborated by the dedicatedsoftware Calcusyn, as described in “Materials and methods”. Using

Table 1Combination index (CI)a, dose reduction index (DRI)b according to the different cytotoxic ratio of IFN-β/TGZ combination and potentiation factor (PF)c values of IFN-β and TGZ inBxPC-3.

50:50 IFN-β/TGZ cytotoxic ratio 25:75 IFN-β/TGZ cytotoxic ratio 75:25 IFN-β/TGZ cytotoxic ratio

CI50 DRI50IFN-β

DRI50 TGZ PFIFN-β

PF TGZ CI50 DRI50IFN-β

DRI50 TGZ PFIFN-β

PF TGZ CI50 DRI50IFN-β

DRI50 TGZ PFIFN-β

PF TGZ

0.495(0.19)

23.8(3.2)

2.2(0.9)

4.4(0.4)

2.2(0.22)

1.15(0.2)

3.9(0.8)

1.1(0.08)

2.5(0.4)

1.2(0.3)

0.541(0.1)

1.9(0.2)

51.3(3.2)

1.6(0.3)

13.3(1.2)

50:50 cytotoxic ratio, evaluation at equipotent doses of the two agents [IFN-β (IC50)/TGZ(IC50)]; 25:75 cytotoxic ratio, evaluation at higher relative doses of TGZ [IFN-β (IC25)/TGZ(IC75)]; 75:25 cytotoxic ratio, evaluation at higher relative doses of IFN-β [IFN-β(IC75)/TGZ(IC25)].Data are expressed as mean (standard deviation) from at least three separate experiments performed in quadruplicates.

a CI represents the assessment of synergy induced by drug interaction. Combination index (CI) values of b1, 1, and N1 indicate synergy, additivity, and antagonism, respectively.b DRI represents the order of magnitude (fold) of dose reduction obtained for IC50 (DRI50) in combination setting compared with each drug alone.c PF values define the specific contribute of IFN-β or TGZ evaluated as the ratio of the IC50 of IFN-β or TGZ to the IC50 of IFN-β/TGZ. The Friedman non-parametric rank test was used

to analyze the impact of the different cytotoxic ratio on the whole cell line panel, P=0.02.


this mathematical model synergistic conditions occur when the CI isbelow 1.0. When CI is less than 0.5 the combination is highlysynergistic. We have found that the combination of IFN-β and TGZwas highly synergistic when the two drugs were used at equitoxicconcentrations (Fig. 1A and Table 1), while a less synergistic effectwas recorded with overwhelming concentrations of IFN-β (IC75

IFN-β:IC25 TGZ) (Fig. 1B and Table 1). Antagonistic effects wereobtained when relative lower doses of IFN-β (IC25 IFN-β:IC75 TGZ)were used (Fig. 1C and Table 1). In synergistic drug combination theCI50s (the CI calculated for 50% cell survival by isobologram analysis)were 0.49 and 0.54 for equitoxic concentrations of the two drugs orfor relative higher doses of IFN-β, respectively (Table 1).

IFN-ββ - + - + - + -TGZ - - + + - - +

3h 6h A

B

3h 6h 24h0

100

200

300

400

500

CTRIFN-β

TGZIFN-β+TGZ

Arb

itrar

y un

its (

%)

pSTAT-1

*** *** §§§***

***

*** ***

Fig. 2. Effects of IFN-β and troglitazone (TGZ) on STAT protein expression and activation. (ASTAT-3 protein was evaluated byWestern blot assay with specific antibodies as described inSTAT-3 (C) activity. The intensities of the bands were expressed as % arbitrary units. Error ba*: Pb0.05, ***: Pb0.001 versus control; §§§: Pb0.001 versus IFN-β+TGZ. IFN-β: BxPC-3IFN-β+TGZ: BxPC-3 cells treated with 25 IU/ml of IFN-β and 25 μM of TGZ.

The DRI50 (DRI calculated for 50% cell survival) was 23.8 for IFN-βand 2.2 for TGZ, when both drugs were used at equitoxic concentra-tions, 1.9 for IFN-β and 51.3 for TGZ, when relative lower doses of TGZwere used (Table 1).

Moreover, values of PF reported in Table 1 demonstrated thatIFN-β had an important contribution to the cytotoxic effect of thecombination in BxPC-3 cells. Interestingly, the optimal results (lowestCI values with the best PF) were obtained when two drugs were usedat equitoxic concentrations (Table 1). Therefore, for all subsequentexperiments we have selected 25 IU/ml of IFN-β and/or 25 μM of TGZ,that were the CI50s of the two drugs at 72 h in synergism evaluationexperiments.

+ - + - ++ - - + +

24h

- pSTAT-1α- pSTAT-1β

- STAT-1α- STAT-1β

- pSTAT-3

- STAT-3

pSTAT-1

STAT-1

C CTRIFN-β

TGZIFN-β+TGZ

3h 6h 24h0

100

200

300

400

pSTAT-3

§§§*** §§§

***

*Arb

itrar

y un

its (

%)

) Determination of the expression of the phosphorylated and total forms of STAT-1 and“Materials and methods”. (B–C) Laser scanner of the bands associated to STAT-1 (B) andrs showed standard deviation from the mean in at least three independent experiments.cells treated with 25 IU/ml of IFN-β; TGZ: BxPC-3 cells treated with 25 μM of TGZ;

IFN-ββTGZ

3hA C

+ - - + + ++ - + - + +

50X

3h 6h

+ - + - + - + - + + ++ - - + + - - + + + -

TGZ

- ISGF3

- Ss p4850X

250

300- p48 D ***

Arb

itrar

y U

nits

100

150

200

B

***

**

***

0

50

150

200ISGF3p48

- + - + - + - + + + - - + + - - + + + -

TGZ***

***

Arb

itrar

y U

nits

50

100

- PPAR-γ

- PPAR-γ

3h 6hIFN-β

IFN-β

IFN-β

Ab-PPARγ

E

0 - γ-tubulin

- - + +- + - +

TGZIFN-βTGZ

3h

- - + + +- + - + +

Fig. 3. Effects of IFN-β and troglitazone (TGZ) on the DNA-binding activity of STATs and PPAR-γ. EMSA analysis of nuclear extracts from BxPC-3 cells incubated with or without IFN-βand/or troglitazone (TGZ), using ISRE (A, B) and ARE6 (C, D) probes. Nuclear extracts, incubated with [γ-32P]ATP-labelled double-stranded ISRE/ARE6 consensus probe, underwentelectrophoresis followed by autoradiography. Binding specificity was assessed by means of competition studies with a 50-fold molar excess of unlabelled ISRE/ARE6 oligonucleotide(50×). Antibodies against STAT-1, STAT-2, p48 and PPAR-γ were included in the binding reactions when indicated. Densitometric analyses of the bands associated to STAT andPPAR-γ binding activity are showed in panels B and D. The intensities of the bands were expressed as arbitrary units. Error bars showed standard deviation from the mean in at leastthree independent experiments. Under the same experimental conditions, PPAR-γ (E) expressionwas also evaluated throughWestern blotting using specific antibody. Expression ofthe house-keeping protein γ-tubulin has been used as loading control. Ss: supershifted complex. **: Pb0.01; ***: Pb0.001 versus control.


3.2. Effects of IFN-β and TGZ on STAT protein expression and activation

In order to evaluate molecular and biochemical mechanismsinvolved in the synergistic antitumor activity of IFN-β and PPAR-γagonists, we studied the effects of IFN-β (25 IU/ml) and TGZ (25 μM),alone or in combination, on phosphorylation of STAT-1 and STAT-3after 3, 6 and 24 h of treatment by Western blot analysis in BxPC-3cells (Fig. 2A–C).

STAT-1 phosphorylation (Fig. 2A and B) significantly increasedfrom 3- to 4-fold after incubation with IFN-β alone or together withTGZ compared to control (pb0.001), while PPAR-γ agonist aloneinduced no change in STAT-1 activation. After 6 h of incubation withcombined treatment, STAT-1 activation resulted to be significantlyhigher (pb0.001) than that induced by IFN-β alone. IFN-β induced aslight increase also of STAT-1 protein expression that, however, didnot account for the increase of its activity caused by the cytokine. TGZdid not induce any modification in the expression of STAT-1 proteinsand did not appear to significantly affect the modifications of STAT-1expression induced by IFN-β (Fig. 2A).

On the other hand, IFN-β alone significantly (pb0.001) increasedSTAT-3 phosphorylation after 6 and 24 h of incubation (Fig. 2A and C).TGZ alone mildly inhibited the phosphorylation of STAT-3, but theeffect did not result significantly different compared to the control,while the activation of STAT-3 was significantly (pb0.05) suppressedby the combined treatment after 24 h (Fig. 2A and C). Either IFN-β orTGZ alone did not affect the expression of STAT-3 protein at allassessed time points, while the combination increased the expressionof STAT-3 protein after 24 h (Fig. 2A). This confirmed even more thestrong inhibitory effect of IFN-β and TGZ combination on STAT-3activity.

3.3. Effects of IFN-β and TGZ on DNA-binding activity of STAT proteins

To better understand STAT-1, STAT-2 and STAT-3 behavioursunder our experimental conditions we studied their DNA-bindingcapacity by EMSA (Fig. 3A and B). To this purpose we selected ISREand GAS probes which bind different complexes of STAT proteins aftertheir activation. It is well known that after treatment with IFN-β,

- pMAPK

- MAPK

- pAKT

-

- AKT

B

A

C

3h 6h 24h0

100

200

300

400

CTR TGZ

pMAPK

Arb

itrar

y un

its (

%)

§§§

***

§§§***

§§§***

**

§

§§§

***§§**

*

3h 6h 24h0

50

100

150

CTR TGZ

pAKT

Arb

itrar

y un

its (

%)

§§§***

§§§***

§§§***

§§

**

- + - + - + - + - + - +TGZ - - + + - - + + - - + +

3h 6h 24h

Fig. 4. Effects of IFN-β and troglitazone (TGZ) onMAPK (Erk1/2) and AKT expression and activation. A) BxPC-3 cells were processed for the determination of the phosphorylated andtotal form ofMAPK evaluated byWestern blotting with specific anti-pMAPK and anti-MAPKmonoclonal antibodies, respectively, as described in “Material andmethods”. In the sameexperimental conditions the expression and activity of AKT was also analyzed with a western blotting. Expression of the house-keeping protein γ-tubulin was used as loadingcontrol. B–C) The intensity of each band, associated to MAPK (B) and AKT (C) activity, was expressed as % arbitrary units compared to that of the untreated cells. Error bars showedstandard deviation from the mean in at least three independent experiments. *: Pb0.05, **: Pb0.01; ***: Pb0.001 versus control; §: Pb0.05, §§: Pb0.01; §§§: Pb0.001 versusIFN-β+TGZ.


activated STAT-2, STAT-1 and p48 proteins form the ISGF3 DNA-binding complex, that migrates to the nucleus and binds to the ISRE(Kotenko et al., 1999). Therefore, we evaluated whether nuclearextracts from BxPC-3 cells, upon IFN-β and TGZ treatment, were ableto activate the ISGF3 DNA-binding complexes.

We found a constitutive ability to form complexes that bind ISRE; infact, we detected different complexes (Fig. 3A) whose specificity hasbeen assessed by incubation with an excess of unlabelled probe (50×).IFN-β treatment modified the ISRE binding activity of the nuclearextracts of BxPC-3 cells. Three hours of treatment with IFN-β inducedthe appearance of a slower migrating complex, and the combinationbetween IFN-β and TGZ determined about 1.5-fold increase of theDNA-binding activity of the complex (Fig. 3A and B). The combinationincreased both the slower migrating complex corresponding to ISGF3and the band corresponding to p48. We confirmed that this interferon-induced complexas STAT1–STAT2–p48was ISGF3by supershift analysiswith specific antibodies (Fig. 3A). Similar resultswere observed after 6 hof incubation (data not shown).

By EMSA experiments using GAS probe the nuclear extracts ofuntreated BxPC-3 cells displayed essentially three complexes whosespecificity has been assessed with an excess of unlabelled probe. Bysupershift experiments with anti-STAT-1, anti-STAT-2, and anti-STAT-3 antibodies we identified the complexes as STAT-3/3, STAT-1/3 andSTAT-1/1 dimers (data not shown). Neither IFN-β nor TGZ norcombined treatment significantly modified these complexes after 3 hof treatment. Six hours of combined treatment caused a decrease ofSTAT-3/3 binding activity which, however, did not appear signifi-cantly different from control (data not shown).

3.4. Effects of IFN-β and TGZ on the DNA-binding activity of PPAR-γ

In order to study DNA-binding activity of PPAR-γ, we performedEMSA experiments using an ARE6 probe that contains the PPARresponse element identified in the promoter of aP2 adipocyte lipid-binding protein, which can only be significantly bound by PPAR-γ(Bendinelli et al., 2005; Juge-Aubry et al., 1997). In nuclear extractsfrom BxPC-3 cells, we observed the presence of a complex whosespecificity has been assessed by incubations with an excess ofunlabelled probe (50×) (Fig. 3C). As expected, TGZ induced an increasein ARE6 binding of about 80% and 40% compared to control after 3 and6 h, respectively (Fig. 3C, D). The combination of drugs potentiatedPPAR-γDNA-binding of about 3 and 2-fold after 3 and 6 h, respectively(Fig. 3C, D). The DNA–protein complexes observed after TGZ co-migratedwith those induced by IFN-β alone or plus TGZ treatment. Theinvolvement of PPAR-γ in the DNA-binding to ARE6 probewas verifiedby supershift analysis with anti-PPAR-γ antibodies (Fig. 3C).

On the other hand, the levels of PPAR-γ proteins in nuclearextracts did not change during the different treatments (Fig. 3E).

3.5. Effects of IFN-β and TGZ on MAPK and AKT expression and activation

We have studied the effects of the drug combination on two keymolecules involved in the regulation of both cell proliferation andsurvival, MAPK (Erk-1 and Erk-2) and AKT (Fig. 4A–C).

In BxPC-3 cells, IFN-β alone increased both MAPK and AKT activity(both pb0.001) after 3, 6 and 24 h of incubation, while TGZ mildlystimulated only MAPK activity at 3 and 24 h compared to the

3h 6h 24h

A B

C D G0/G1 S G2/M

0

50

100

150

CTR

IFN-βTGZ

IFN-β+TGZ

§*

**

§§

§§§***

Cel

ls (

% v

s co

ntro

l) §§§**

***§

****** ***

3h 6h 24h0

100

200

300

400

CTR

IFN-βTGZ

IFN-β+TGZ

p21

§********* §§§

***

§§***

***

§§§*

§§§*

***

Arb

itrar

y un

its (

%)

- p21

- p27

3h 6h 24h0

100

200

300

CTR

IFN-βTGZ

IFN-β+TGZ

p27

Arb

itrar

y un

its (

%)

********* *********

§§§***

***

§§§***

IFN-β - + - + - + - + - + - + TGZ - - + + - - + + - - + +

Fig. 5. Effects of IFN-β and troglitazone (TGZ) on cell cycle and p21 and p27 expression. A) Cell cycle distribution after 1 day of incubation with or without IFN-β (25 IU/ml) and/orTGZ (25 μM) in BxPC-3 cells, evaluated by FACS, as described in Materials andmethods. Data are expressed asmean±SEM of the percentage of cells in the different phases of the cellcycle, as compared with untreated control cells. Control values have been set to 100%. Effects of IFN-β and TGZ on p21 and p27 expression (B) in BxPC-3 cells. The intensity of eachband, associated to p21 (C) and p27 (D), was expressed as % arbitrary units compared to that of the untreated cells. Error bars showed standard deviation from the mean in at leastthree independent experiments. *: Pb0.05, **: Pb0.01; ***: Pb0.001 versus control; §: Pb0.05, §§: Pb0.01; §§§: Pb0.001 versus IFN-β+TGZ.


untreated cells (Fig. 4A–C). On the other hand, the combinationbetween IFN-β and TGZ at synergistic experimental conditionsdecreased MAPK phosphorylation already after 6 h of treatment andAKT phosphorylation after 24 h. Interestingly, MAPK activity wasalmost completely restored after 24 h of treatment with thecombination. This increase was likely due to the enhancement oftotal MAPK proteins expression induced by either TGZ alone or by thecombination, while at earlier time points the different treatments didnot affect the expression of total MAPK (Fig. 4A). On the other hand,the two drugs alone and, more potently, the combined treatmentinduced an increase of the total AKT protein expression and this effectmade stronger the inhibition of AKT activity (Fig. 4A). Also in this caseall the treatments did not induce any changes in AKT expression atearlier time points.

These data suggest that single agents could induce survivalpathways, but these effects were antagonized by the combinedtreatment.

3.6. Effects of IFN-β and TGZ on cell cycle and p21 and p27 expression

We evaluated whether the mechanisms of the antitumorsynergistic interaction between IFN-β and PPAR-γ agonists in-volved cell cycle kinetics (Fig. 5A–D). Cell cycle phase distributionwas evaluated by FACS analysis on BxPC-3 cells treated with IFN-βand/or TGZ for 24 h and labelled with propidium iodide. TGZ aloneinduced a slight significant increase of G0/G1 phase, while IFN-βalone and in combination with TGZ significantly increased thepercentage of BxPC-3 cells in G0/G1 phase (about +19% and +34%compared to the untreated cells, respectively) (Fig. 5A). In the sameexperimental conditions, TGZ alone induced a mild increase(+13%) of cell population in S phase, while IFN-β induced an

about −20% decrease of cells in S phase; the combinationpotentiated this effect inducing an about −41% decrease comparedto control cells. All treatments induced a significant decrease in theproportion of cells in G2/M phase. These data suggested that BxPC-3cells failed to transit efficiently from G0/G1 into S phase after 24 h ofincubation with IFN-β. This effect is highly potentiated by thecombination with TGZ.

On the bases of these results we studied the effects of biologicaltreatments on two cyclin dependent kinases (CDK) inhibitor p21 andp27, negative check-point regulators of the cell cycle, involved in thetransition from G0/G1 to S phase. After 3 and 6 h of treatment IFN-βand TGZ alone or in combination induced a significant increase in p21expression (about 2-fold, pb0.001 versus control), as evaluated by awestern blotting assay (Fig. 5B and C). After 24 h IFN-β and TGZ aloneinduced only a slight increase of p21, while the combination caused anabout 3-fold increase of p21 as compared to the control. After 3 and6 h all the treatments induced an about 1.5-fold increase of p27expression (Fig. 5B and D). After 24 h IFN-β and TGZ alone inducedonly a slight increase of p27, while the combination induced a 2-foldincrease of p27 compared to untreated cells.

Therefore, the delay of G0/G1-S phase progression occurredtogether with an increase in p21 and p27 protein expression thatwas more evident after 24 h of treatment with the pharmacologicalcombination.

This increase was mainly related to a decrease in the proteasome-dependent degradation of both proteins. In fact, we observed adecrease of p21 and p27 ubiquitination (Fig. 6A), in particular after 6 hof treatment with IFN-β plus TGZ. In order to investigate also upontranscriptional modulation of combined treatment, we evaluated theeffects of treatment with IFN-β and/or TGZ on p21 and p27 mRNAexpression (Fig. 6B and C). A mild increase in p21 and p27 mRNA

B C

A

1h 3h 6h 24h0

50

100

150

CTR

IFN-β

TGZ

IFN-β+TGZ

CTR

IFN-β

TGZ

IFN-β+TGZ

p21/

hprt

mR

NA

exp

ress

ion

(% o

f co

ntro

l)

** * *

1h 3h 6h 24h0

100

200

p27/

hprt

mR

NA

exp

ress

ion

(% o

f co

ntro

l)* * *

***

§§§§

% A

rbitr

ary

units

0

20

40

60

80

100

120

140

160

Ub p21Ub p27

TGZ IFN-β

3h

- + - + - + - ++ +- - - - + +

- + - +- - + +

24h6h

Fig. 6. Effects of IFNβ and troglitazone (TGZ) on the ubiquitination andmRNA expression of p21 and p27. (A) Ubiquitination of p21 and p27was determined by immunoprecipitatingp21 and p27 with anti-p21 and p27 mAbs, respectively, and subsequent probing with anti-ubiquitin polyclonal antibody. The intensity of each band, associated to ubiquitinated p21and p27 proteins, was expressed as % arbitrary units compared to that of the untreated cells. Expression of p21 (B) and p27 (C) mRNA has been evaluated by quantitative RT PCR.BxPC-3 cells were treated with or without IFN-β (25 IU/ml) and/or TGZ (25 μM) after 1, 3, 6 and 24 h of incubation. Data are mean±standard deviation and are expressed as %control. All the experiments were performed at least three times and gave always similar results. *: Pb0.05, **: Pb0.01; ***: Pb0.001 versus control; §: Pb0.05, §§: Pb0.01; §§§:Pb0.001 versus IFN-β+TGZ.


expression has been observed similarly after single agents andcombined treatment. Only after 24 h of incubation, IFN-β and TGZ incombination induced a moderate increase in p27 mRNA expression(about 1.5 fold) that was significantly higher than single agents(Fig. 6C).

Therefore, the effects of the combination on p21 and p27 occurredat least in part at post-transcriptional level.

3.7. Role of STAT-1 and STAT-3 proteins in the modulation of MAPK, p21and p27 induced by TGZ and IFN-β

In order to evaluate the role of either STAT-1 or STAT-3 in themodulation of both MAPK activity and p21/p27 expression induced byIFN-β and/or TGZ we have transfected BxPC3 cells with an eukaryoticplasmid vectors encoding for a WT or a DN isoform of STAT-1 or STAT-3that cannot be phosphorylated in Tyrosine. Both the mutant forms ofSTAT-1 (STAT-1-Y701F) and STAT-3 (STAT-3-Y705F) act in a DN fashion.The transfection of WT STAT-1 was functionally active increasing theSTAT-1 phosphorylation induced by both IFN-β and the combination. Onthe other hand, the transfection with the DN STAT-1 made ineffective allthe treatments in inducing changes in its phosphorylation (Fig. 7A). Thetransfection of the cells with the WT STAT-1 plasmid attenuated theincrease of pMAPK induced by IFN-β and increased the counteractingeffects of TGZ. On the other hand, the transfection with DN STAT-1

enhanced the increase of pMAPK induced by both IFN-β and TGZ andmade ineffective the abrogating effect induced by the concomitanttreatment with both IFN-β and TGZ (Fig. 7A). The transfections with WTSTAT-1 potentiated the effects induced by IFN-β on both p21 and p27expression but had no consequences on the modulation of the sameproteins causedbyTGZalone.On theother hand, the transfectionwithDNSTAT-1antagonized theeffects inducedby IFN-βon theexpressionofbothcell cycle inhibitors but had again no consequences on the changesinduced by TGZ alone. Interestingly, a synergistic antitumor activity ofIFN-β andTGZwasconfirmed inBxPC-3 cells transfectedwithWTSTAT-1.This effect was not detected in DN STAT-1 transfected pancreatic cancercells (Fig. 7B).

Also the transfection of WT STAT-3 was functionally active since itsphosphorylation was increased by IFN-β and was almost unchanged byTGZ, while the combination partially antagonized the effects induced byIFN-β alone (Fig. 8A). On the other hand, the transfection with the DNisoform made the cells insensitive to the modulation of STAT-3phosphorylation induced by the different agents used alone or incombination (Fig. 8A). Similarly, WT STAT-3 transfection abrogated theantagonistic effects of the combination on the activation ofMAPK inducedby the single agents, while the DN STAT-3 transfection made cellsinsensitive to MAPK activity modulation induced by the different agentsalone or in combination (Fig. 8A). On the other hand, p21 and p27expression increasedduring TGZ and TGZ/IFN-β treatment in BxPC-3 cells

% G

row

th in

hibi

tion

0

20

40

60

80

100

120

140

- pSTAT1

IFN-β

TGZ

Empty vector STAT-1 WT STAT-1 DN

- STAT1

- MAPK

- p21

- p27

- pMAPK

- γ-tubulin

IFN-βTGZ


B

A

** **

***

* * *

- + - +

- - + +

- + - +

- - + +

- + - +

- - + +

- + - + - + - +- - + + - - + +

- + - +- - + +

Fig. 7. Effects of IFN-β and troglitazone (TGZ) on STAT-1 and MAPK protein expression and activation and p21/p27 expression in BxPC-3 cells transfected with WT or DN STAT-1.BxPC-3 cells were transfected with empty vector, DN STAT-1 or WT STAT-1 plasmids and treated for 6 h with or without IFN-β (25 IU/ml) and/or TGZ (25 μM) after 24 h from thetransfection. (A) Determination of the phosphorylated and total forms of STAT-1 and MAPK and of p21 and p27 proteins byWestern blot assay with specific antibodies, as describedin “Materials and methods”. The expression of γ-tubulin was used as loading control. The experiments were performed at least three different times and the results were alwayssimilar. (B) Evaluation of growth inhibition of transfected BxPC-3 cells. Error bars showed standard deviation from themean in at least three independent experiments. *: Pb0.05, **:Pb0.01; ***: Pb0.001 versus control.


transfected with both WT or DN STAT-3. This suggests that p21 and p27regulation by TGZ was completely independent from STAT-3 activationstatus. These biochemical effects were paralleled by a more potentantiproliferative effects after incubation with both agents compared tosingle treatments in DN STAT-3 (Fig. 8B).

These data suggest that the modulation of p21 and p27 expressioninduced by the combination occurred independently from both STAT-1 and STAT-3, while the decrease of MAPK activity occurred throughthe inhibition of STAT-3 activity induced by the combination and, indetails, by TGZ. Moreover, the modulation of p21 and p27 expressioninduced by IFN-β was attenuated by STAT-3.

3.8. IFN-β and/or PPAR-γ agonists induced autophagy death in BxPC-3cells

The combination between IFN-β and TGZ was not able to induceapoptosis, as evaluated by either Annexin V and propide iodidelabelling at FACS analysis or to mediate caspases and PARP activation(data not shown).

On these bases, we have studied the alternative autophagy cell deathmechanism. Untreated control BxPC-3 cells examined by TEM afterultrathin sectioning showed their typical morphology characterized by a

compact cytoplasm with well preserved organelles and no sign of celldamage (Fig. 9A). After treatment with INF-β alone, cells did not exhibitsignificant changes when compared to the untreated control, the onlydifference was the higher number of mitochondria in treated cells(Fig. 9B). In TGZ-treated samples,many cells showed thepresence of largevesicular bodies containing organelles and material of variable structureinside a well preserved cytoplasmic matrix (Fig. 9C). Such vesiclesappeared to be very similar to autophagosomes, typical structures presentin autophagic cells, suggesting the induction of autophagy by TGZ. Suchphenomenon appeared to be extremely potentiated when the treatmentwith TGZwas carried out in associationwith INF-β (Fig. 9D). In fact, mostcells treated with the combination INF-β+TGZ displayed large areas ofthe cytoplasm occupied by complex vacuolar structures surrounded by awell defined membrane and containing cellular components, probablyunder digestion by lysosomal enzymes (autophagolysosomes) (Fig. 9D).

To identify andquantify thedevelopment of acidic vesicular organelles(AVOs),which is characteristic of autophagy,we performed FACS analysisusing the lysosomotropic agent acridine orange that moves freely acrossbiological membranes when uncharged. Its protonated form accumulatesinside acidic compartments, where it forms aggregates that fluorescebright red. As shown in Fig. 9E, INF-β treatment alone did not increase theintensity of the red fluorescence signal in comparison with the control

% G

row

th in

hibi

tion

0

20

40

60

80

100

120

140



B

A

*** ***

***

* *

*

§§ §§

§

- pSTAT3

- STAT3

- MAPK

- p21

- p27

- pMAPK

- γ-tubulin

IFN-β

TGZ

- + - +

- - + +

- + - +

- - + +

- + - +

- - + +

IFN-βTGZ

- + - + - + - +- - + + - - + +

- + - +- - + +

Fig. 8. Effects of IFN-β and troglitazone (TGZ) on STAT-3 and MAPK protein expression and activation and p21/p27 expression in BxPC-3 cells transfected with WT or DN STAT-3.BxPC-3 cells were transfected with empty vector, DN STAT-3 or WT STAT-3 plasmids and treated for 6 h with or without IFN-β (25 IU/ml) and/or TGZ (25 μM) after 24 h from thetransfection. (A) Determination of the phosphorylated and total forms of STAT-3 and MAPK and of p21 and p27 proteins byWestern blot assay with specific antibodies, as describedin “Materials and methods”. The expression of γ-tubulin was used as loading control. The experiments were performed at least three different times and the results were alwayssimilar. (B) Evaluation of growth inhibition of transfected BxPC-3 cells. Error bars showed standard deviation from the mean in at least three independent experiments. *: Pb0.05,***: Pb0.001 versus control. §: Pb0.05, §§: Pb0.01 versus IFN-β+TGZ.


cells, whereas TGZ treatment alone slightly increased it (pb0.01). Aftertreatmentwith the combination INF-β+TGZa significant increase (about80%, pb0.001) of the intensity of the redfluorescence, expressionofAVO'sinduction, confirmed TEM observations. The histograms related to onerepresentative experiment are shown in Supplementary Fig. 1A and B.

3.9. Molecular mechanisms of autophagy induction

We have investigated the molecular mechanisms of autophagystudying the interaction between two molecules involved in thisprocess: Beclin-1 and Bcl-2. It is known that Bcl-2, interacting withBeclin-1, inhibits beclin-1-dependent autophagy (Pattingre andLevine, 2006).

We have performed co-immunoprecipitations of these proteins andwe have found that combined treatment suppressed Beclin-1/Bcl-2complex formation at both 3 and, more significantly, at 6 h from thebeginningof the treatment (Fig. 10AandB). Theexpressionof total Beclin-1 increased in all the treatments at 3 h, while at 6 h remained unchangedin the single treatments. On the other hand, Bcl-2 was not subjected tosignificantmodulationbyboth agents aloneor in combinationat 3 and6 h(Fig. 10A).

Another key component that regulates the balance between cellgrowthandautophagy in response tocellularphysiological conditionsandenvironmental stress is mammalian target of rapamycin (mTOR).

The activation of mTOR leads to the phosphorylation of its two majordownstream components, p70S6K and eIF4E-binding protein 1 (4EBP1).4EBP1 is believed to primarily control cap-dependent translation bybinding and inactivating eIF4E, an initiation factor, which binds to themRNA cap structure, thereby mediating the initiation of translation.Phosphorylation of 4EBP1 results in the release of eIF4E and subsequentactivation of the eIF4G scaffolding protein. Both PI3 kinase/AKT pathwayand mTOR kinase regulate 4EBP1 activity (Smolewski, 2006).

We have found that the combination between IFN-β and TGZdecreased 4EBP1 phosphorylation already after 6 h and,more significant-ly, after 24 h (Fig. 11A). 4EBP1 phosphorylationwas significantly reducedalsoby single agents at 24 h.However, this inhibition resulted tobehigherin the combined treatment (Fig. 11A).No significant change in total 4EBP1expression was observed during all treatments (Fig. 11B).

On the other hand, while single agents did not induce anysignificant changes in eIF4E phosphorylation, IFN-β plus TGZ reducedeIF4E phosphorylation after 3 and 6 h, while it increased at 24 h(Fig. 11C). The inhibition of eIF4E phosphorylation, occurring atearlier time points, seemed to be independent from the interaction

E

A

C

B

D

Arb

itrar

y U

nits

0

50

100

150

200

IFN-β -

TGZ

***

*

+-+

- +- +

Fig. 9. Effects of IFN-β and troglitazone (TGZ) on autophagosome formation in BxPC-3 cells. A–D) Transmission electron microscopy (TEM) showing the typical morphology ofuntreated cells (A), cells treated with INF-β (B) or TGZ (C) alone and cells treated with the combination INF-β plus TGZ (D). (E) Intensity of the red fluorescence signal obtained byFACS analysis using the lysosomotropic agent acridine orange to detect and quantify the acidic vesicular organelles. Error bars showed standard deviation from the mean in at leastthree independent experiments. *: Pb0.05, ***: Pb0.001 versus control.


with 4EBP1. No significant change in total eIF4E expression (Fig. 11D)was observed during all the treatments. eIF4E is phosphorylated bythe MAPK activated protein kinase MNK1 that, in turn, is activated byErk-1 and 2. Therefore, in order to explain the modulation of eIF4Ephosphorylation induced by the different treatments, we haveevaluated MNK1 expression and phosphorylation, which, uponactivation by mitogenic and/or stress stimuli mediated by MAPKand p38MAPK, phosphorylates eIF4E (Raught and Gingras, 1999). Wehave found that the combination determined an about 60% reductionof MNK1 phosphorylation at both 3 h and 6 h, while its phosphory-lation increased of about 60% at 24 h. On the other hand, single agentshad poor effects on the phosphorylation of MNK1 (Fig. 11E). All thetreatments did not induce any significant changes in total MNK1expression (Fig. 11F).

Therefore, the combination IFN-β plus TGZ probably decreasedeIF4E phosphorylation by inhibiting MNK1 activation.

4. Discussion

Type I IFNs in humans, are grouped into five major classes: IFN-α,IFN-β, IFN-ε, IFN-κ and IFN-ω. We recently showed that IFN-β issignificantly more effective than IFN-α in inducing cell growth

inhibition in exocrine (Vitale et al., 2007) and endocrine (Vitaleet al., 2006) tumors of the pancreas and in adrenal cancer (vanKoetsveld et al., 2006). IFN-α is used in the therapy of few neoplasms(Borden et al., 2007; Gray et al., 2002; Kirkwood, 2002). However, thepotential anti-tumor activity of IFN-α is limited by the activation oftumor resistance mechanisms (Caraglia et al., 2009).

An interesting and well studied survival pathway activated incancer cells after IFN-α treatment includes the EGF-R and itsdownstream targets. We have shown that IFN-α, at growth inhibitoryconcentrations, enhances the expression and signaling activity of EGF-R in epidermoid cancer cell lines (Caraglia et al., 1994, 2003).Therefore, the enhanced expression and function of EGF-R in tumorcells could represent a stress response that is activated to provide anescape mechanism to the growth inhibition induced by IFN-α. In fact,we have demonstrated that the ras→Erk-dependent pathwayactivated by EGF in IFN-α-treated cancer cells is essential to providesurvival to cancer cells (Caraglia et al., 2003; Tagliaferri et al., 1994).Another important anti-apoptotic pathway regulated by EGF and Rasis the signaling via AKT/PKB, an important survival pathway, aspreviously reported (von Gise et al., 2001; Zhou et al., 2000). Inaddition, we recently showed that in human epidermoid lung cancerH1355 cell line, IFN-α increases the expression of the eukaryotic

Bec

lin a

nd B

cl2

com

plex

(% o

f co

ntro

l)

0

50

100

150

200

250

300Beclin-1Bcl-2

CTR+

Beclin-1

Bcl-2

IP

Bcl-2

Beclin-1

Bcl-2 Beclin-1

IFN-βTGZ

3h

A

B

IFN-βTGZ

3h 6h

***

*** ***

***

- + - + - + -

- - + +

+

++- -

6h

- + - +

- - + +

- + - +

- - + +WB

Fig. 10. Interaction between Beclin-1 and Bcl-2 in BxPC-3 cells. BxPC-3 cells were treated with INF-β and/or troglitazone (TGZ) and thereafter proteins were extracted. A) Westernblot assay for the expression of the total Beclin-1 and Bcl2 proteins and immunoprecipitation of Beclin-1 and Bcl-2 blotted with Bcl-2 and Beclin-1, respectively for the evaluation ofBeclin-1/Bcl-2 and Bcl-2/Beclin-1 complexes as described in “Material and methods”. In the last lanes cells were run as positive controls. B) Representation of the Beclin-1 and Bcl2complexes expressed as the ratio between the relative intensities of the bands associated with the Beclin-1/Bcl-2 and Bcl-2/Beclin-1 complexes versus the bands associatedwith totalBeclin-1 and Bcl-2, respectively. The intensities of the bands were expressed as arbitrary units when compared to that of the untreated cells. Error bars showed standard deviationfrom the mean in at least three independent experiments. ***: Pb0.001 versus control.


translation elongation factor 1A (eEF-1A) through its phosphorylationmediated by C-Raf and that the latter effect has a role in the protectionof cancer cells from IFN-α-induced apoptosis (Lamberti et al., 2007).Another survival pathway activated by type I IFNs is mediated bySTAT-3. In fact, the activated JAK-1 can stimulate STAT-3 that acts asadapter to couple the PI3K-dependent pathway (Caraglia et al., 2004,

IFN-β - + - + - + -TGZ - - + + - - +

3h

A

B

D

C

E

F

G

6h

Fig. 11. Effects of IFN-β and troglitazone (TGZ) on mTOR-dependent pathway. BxPC-3 celexpression (B, D, F) of 4EBP1 (A, B), eIF4E (C, D) and MNK1 (E, F) were evaluated after blottthe house-keeping protein γ-tubulin, used as loading control. The experiments were perfor

2005). The p85 regulatory subunit of PI3K, which activates a series ofserine kinases, binds to phosphorylated STAT-3 and subsequentlyundergoes tyrosine phosphorylation. Consequently, PI3K is activatedand can transduce its signals through AKT activation. Therefore, type IIFN-induced phosphorylation of STAT-3 can prevent apoptosis andcounteracts the antitumor activity promoted by STAT-1 and STAT-2

- peIF4E

- p4EBP1

- 4EBP1

- eIF4E

- γγ - tubulin

+ - + - + + - - + +

24h

- pMNK1

- MNK1

ls were treated with INF-β and/or TGZ. Thereafter, both the activity (A, C, E) and theing with specific antibodies, as described in “Materials and methods”. (G) Expression ofmed at least three different times and the results were always similar.

AUTOPHAGY

STAT-1

MAPK

p21p27

MNK-1

eIF4E

AKT

mTOR

4EBP1

CELL CYCLE PERTURBATIONS

TGZ

STAT-3 PPAR-γ

Fig. 12. Schematic representationof theproposedmechanisms involved in the synergisticantitumor activity of IFN-β plus troglitazone (TGZ) through regulation of cell cycle andautophagy in pancreatic cancer cells. IFN-β activates both STAT-1 and STAT-3. STAT-1phosphorylation stimulates the expression of cell cycle inhibitory proteins p21 and p27(at least in part through the regulation of their degradation). On the other hand, STAT-3activation counteracts the effects of STAT-1 on p21 and p27 expression and activates asurvivalMAPK andAKT-dependent pathwaywhich inhibits the occurrence of autophagy.TGZ, through PPAR-γ activation, inhibits STAT-3 activation induced by IFN-β and directlyincreases the expression of both p21 and p27. These effects potentiate the stimulatoryactivity of IFN-β on both autophagy and cell cycle perturbations, inducing a devastatingantiproliferative effect in pancreatic cancer cells after the combination IFN-β plus TGZ,through the inactivation of the AKT→mTOR-dependent pathway. (→: stimulation;—|: inhibition; eIF4E: Eukaryotic translation initiation factor 4E; 4EBP1: eIF4E-bindingprotein 1; MNK1: MAPK activated protein kinase).


activation (Bromberg, 2000). In fact, STAT-3 is involved in celltransformation, cancer proliferation, protection from apoptosis andinvasion and the block of STAT-3 expression is a strategy to controlcancer cell proliferation (Aggarwal et al., 2009).

On the other hand, PPAR-γ has beenwidely reported to antagonizethe activation of STAT-3 in several normal and cancer models.In details, the natural PPAR-γ ligand, 15deoxy Delta12-14 PGJ(2)(15d-PGJ2) and TGZ, induce suppressor of cytokine signaling 3(SOCS3) expression and inhibit JAK2/STAT-3 signalling in pancreaticacinar cells (Yu et al., 2008). Moreover, PPAR-γ agonists decrease thephosphorylation of STAT-3 and Jak1 in embryonic stem cells(Mo et al., 2010; Rajasingh and Bright, 2006), while 15d-PGJ2inhibited the IL-6-mediated increase of PC-3 cell proliferation, aprostate cancer cell line, through the reduction of phosphorylated andunphosphorylated STAT-3 and the activation of Erk1/2 phosphoryla-tion, without affecting AKT phosphorylation (Pitulis et al., 2009).PPAR-γ agonists also induce cell cycle arrest and apoptosis inassociation with the inhibition of EGF/bFGF signalling, mediated bythe suppression of Tyk2-STAT-3 pathway, in brain tumor stem cells(Chearwae and Bright, 2008).

On these bases, we have evaluated the effects of the pharmaco-logical interaction between IFN-β and TGZ, a classical activator ofPPAR-γ, on pancreatic cancer BxPC-3 cells. A strong synergismbetween both agents has been observed. This effect was paralleledby a counteraction on IFN-β-induced MAPK, AKT and STAT-3activation and appeared to be mediated by a strong increase inPPAR-γ activation (Fig. 12). At the same experimental conditions anincrease of cell accumulation in G0/G1 phase and a decrease of the Sphase together with an increase of the expression of the CDKinhibitors p21 and p27 was recorded (Fig. 12). These effects are notsurprising if we consider that both IFN-β and PPAR-γ agonists caninduce cancer cell growth inhibition through upregulation of p21 and

p27 and consequent cell cycle perturbations (Aiello et al., 2006;Sangfelt et al., 2000). The stimulatory effect of the combination on thep21 and p27 expression appeared to be due, at least in part, todecrease of their proteasome-dependent degradation, that is one ofthe most important reported mechanisms of regulation of p21 andp27 expression in tumor cells (Kitagawa et al., 2009).

From the experiments with DN and WT STAT-1 and STAT-3transfection it appeared that IFN-β increased p21 and p27 expressionthrough STAT-1 activation, whereas the concomitant stimulation ofSTAT-3 counteracted this effect. On the other hand, the regulation ofp21 and p27 expression by TGZ appeared to be independent fromboth STAT-1 and STAT-3. MAPK increased phosphorylation was, inturn, dependent from STAT-3 activation by IFN-β. This effect seems tobe counteracted by TGZ through STAT-3 inhibition (Fig. 12).

We have also investigated the mechanisms of cell death in ourexperimental model and we have not found evidence of apoptosisoccurrence with single agents and/or the combination. The subse-quent analysis of BxPC-3 cells at the electron transmissionmicroscopydemonstrated a strong increase of autophagosome formation in cellstreated with the combination, while IFN-β and TGZ alone induced noor less effects, respectively. Similar results were obtained with thedetermination of acridine orange labelling at FACS analysis. Thesedata suggested that the combination had a synergistic effect onpancreatic cancer cell growth inhibition through the triggering ofautophagy (Fig. 12).

Recent reports suggested that thiazolidinediones can induce celldeath in cancer cells through the activation of autophagy (Yan et al.,2010; Zhou et al., 2009). In fact, thiazolidinediones seem to representa novel class of energy restriction-mimetic agents. It has beenreported that autophagy is a process regulated by the AKT-mTOR-dependent signalling (Jung et al., 2010); therefore, we have analyzedthe involvement of this signalling in our experimental model. Wehave studied the effects of single and combined treatments on thephosphorylation of eIF4E and of its inhibitor 4EBP1, since they aresubstrates of mTOR and thus indirect markers of mTOR activation. Wehave found that the combination IFN-β+TGZ decreased the phos-phorylation of 4EBP1 after 6 and 24 h whereas the inhibition of eIF4Ephosphorylation was present only when BxPC-3 cells were treatedwith the combination for 3 and 6 h, restoring completely at 24 h. Theeffect on eIF4E phosphorylation at 24 h was paralleled by therestoration of the MAPK phosphorylation. Since eIF4E is alsophosphorylated by the MAPK activated protein kinase MNK-1(Gelinas et al., 2007), we have evaluated its phosphorylation in ourexperimental model. We have found that the phosphorylation ofMNK-1 decreased in cells treated with the combination at 3 and 6 hand increased at 24 h suggesting that it was involved in thedifferential phosphorylation of eIF4E (Fig. 12). These data are inagreement with the recent report by Joshi et al. showing a role ofMNK-1 activation by type I IFNs in the generation of growth inhibitoryresponses in a leukemia model (Joshi et al., 2009).

5. Conclusions

We demonstrated, for the first time, that a PPAR-γ agonistpotentiates the anti-cancer effects of IFN-β through the induction ofcell cycle perturbations and the occurrence of autophagy cell death inpancreatic cancer cells. Moreover, these effects occurred through thecounteraction of a STAT-3-dependent survival pathway and throughthe increase of p21 and p27 expression directly induced by TGZ.

Supplementarymaterials related to this article can be found onlineat doi:10.1016/j.biotechadv.2011.08.001.

Acknowledgements

This work was partially supported by Associazione Italiana per laRicerca sul Cancro (AIRC-MFAG-5695). AD and SC are recipients of an


AIRC-MFAG fellowship. AB and MC received a grant by RegioneCampania for “Laboratori Pubblici” Hauteville. MC received a grant by“Progetto di rilevante interesse di Ateneo” for the year 2008. ABreceived a grant from “PRIN 2008” by Italian Ministry for Education,Research and University (MIUR).

We thank prof. Giuseppe Matarese for the critical reading of themanuscript and for his precious suggestions.

References

Aggarwal BB, Kunnumakkara AB, Harikumar KB, Gupta SR, Tharakan ST, Koca C, et al.Signal transducer and activator of transcription-3, inflammation, and cancer: howintimate is the relationship? Ann N Y Acad Sci 2009;1171:59–76.

Aiello A, Pandini G, Frasca F, Conte E, Murabito A, Sacco A, et al. Peroxisomalproliferator-activated receptor-gamma agonists induce partial reversion ofepithelial–mesenchymal transition in anaplastic thyroid cancer cells. Endocrinol-ogy 2006;147:4463–75.

Asao H, Fu XY. Interferon-gamma has dual potentials in inhibiting or promoting cellproliferation. J Biol Chem 2000;275:867–74.

Bendinelli P, Maroni P, Pecori Giraldi F, Piccoletti R. Leptin activates Stat3, Stat1 and AP-1 in mouse adipose tissue. Mol Cell Endocrinol 2000;168:11–20.

Bendinelli P, Piccoletti R, Maroni P. Leptin rapidly activates PPARs in C2C12muscle cells.Biochem Biophys Res Commun 2005;332:719–25.

Borden EC, Sen GC, Uze G, Silverman RH, Ransohoff RM, Foster GR, et al. Interferons atage 50, past, current and future impact on biomedicine. Nat Rev Drug Discov2007;6:975–90.

Bromberg J. Signal transducers and activators of transcription as regulators of growth,apoptosis and breast development. Breast Cancer Res 2000;2:86–90.

Caraglia M, Pinto A, Correale P, Zagonel V, Genua G, Leardi A, et al. 5-Aza-20-deoxycytidine induces growth inhibition and upregulation of epidermal growthfactor receptor on human epithelial cancer cells. Ann Oncol 1994;5:269–76.

Caraglia M, Tagliaferri P, Marra M, Giuberti G, Budillon A, Gennaro ED, et al. EGFactivates an inducible survival response via the RAS→ERK1/2 pathway tocounteract interferon-α-mediated apoptosis in epidermoid cancer cells. CellDeath Differ 2003;10:218–29.

Caraglia M, Vitale G, Marra M, Budillon A, Tagliaferri P, Abbruzzese A. Alpha-interferonand its effects on signaling pathways within the cells. Curr Protein Pept Sci 2004;5:475–85.

Caraglia M, Marra M, Pelaia G, Maselli R, Caputi M, Marsico SA, et al. Alpha- interferonand its effects on signal transduction pathways. J Cell Physiol 2005;202:323–35.

Caraglia M, Marra M, Tagliaferri P, Lamberts SWJ, Zappavigna S, Misso G, et al. Emergingstrategies to strengthen the anti-tumour activity of type I IFNs: overcomingsurvival pathways. Curr Cancer Drug Targets 2009;9:690–704.

Chan KS, Carbajal S, Kiguchi K, Clifford J, Sano S, DiGiovanni J. Epidermal growth factorreceptor-mediated activation of Stat3 during multistage skin carcinogenesis.Cancer Res 2004;64:2382–9.

Chearwae W, Bright JJ. PPARgamma agonists inhibit growth and expansion of CD133+brain tumour stem cells. Br J Cancer 2008;99:2044–53.

Chou TC, Talalay P. Quantitative analysis of dose–effect relationships: the combinedeffects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul 1984;22:27–55.

ChouTC,MotzerRJ, TongY,BoslGJ. Computerizedquantitationof synergismandantagonismof taxol, topotecan, and cisplatin against human teratocarcinoma cell growth: a rationalapproach to clinical protocol design. J Natl Cancer Inst 1994;86:1517–24.

Colomiere M, Ward AC, Riley C, Trenerry MK, Cameron-Smith D, Findlay J, et al. Crosstalk of signals between EGFR and IL-6R through JAK2/STAT3 mediate epithelial–mesenchymal transition in ovarian carcinomas. Br J Cancer 2009;100:134–44.

Garcea G, Neal CP, Pattenden CJ, StewartWP, Berry DP. Molecular prognostic markers inpancreatic cancer: a systematic review. Eur J Cancer 2005;41:2213–36.

Gelinas JN, Banko JL, Hou L, Sonenberg N, Weeber EJ, Klann E, et al. ERK and mTORsignaling couple beta-adrenergic receptors to translation initiation machinery togate induction of protein synthesis-dependent long-term potentiation. J Biol Chem2007;282:27527–35.

Gray RJ, Pockaj BA, Kirkwood JM. An update on adjuvant interferon for melanoma.Cancer Control 2002;9:16–21.

Hofland LJ, van der Hoek J, van Koetsveld PM, de Herder WW, Waaijers M, Sprij-MooijD, et al. The novel somatostatin analog SOM230 is a potent inhibitor of hormonerelease by growth hormone- and prolactin-secreting pituitary adenomas in vitro. JClin Endocrinol Metab 2004;89:1577–85.

Hofland LJ, van der Hoek J, Feelders R, van Aken MO, van Koetsveld PM, Waaijers M,et al. The multi-ligand somatostatin analogue SOM230 inhibits ACTH secretion bycultured human corticotroph adenomas via somatostatin receptor type 5. Eur JEndocrinol 2005;152:645–54.

Hua LL, Kim MO, Brosnan CF, Lee SC. Modulation of astrocyte inducible nitric oxidesynthase and cytokine expression by interferon β is associated with induction andinhibition of interferon γ-activated sequence binding activity. J Neurochem2002;83:1120–8.

Joshi S, Kaur S, Redig AJ, Goldsborough K, David K, Ueda T, et al. Type I interferon (IFN)-dependent activation of Mnk1 and its role in the generation of growth inhibitoryresponses. Proc Natl Acad Sci USA 2009;106:12097–102.

Juge-Aubry C, Pernin A, Favez T, Burger AG, Wahli W, Meier CA, et al. DNA bindingproperties of peroxisome proliferator-activated receptor subtypes on variousnatural peroxisome proliferator response elements. Importance of the 5'-flankingregion. J Biol Chem 1997;272:25252–9.

Jung CH, Ro SH, Cao J, Otto NM, Kim DH. mTOR regulation of autophagy. FEBS Lett2010;584:1287–95.

Kirkwood J. Cancer immunotherapy, the interferon-α experience. Semin Oncol2002;29:18–26.

Kitagawa K, Kotake Y, Kitagawa M. Ubiquitin-mediated control of oncogene and tumorsuppressor gene products. Cancer Sci 2009;100:1374–81.

Kotenko SV, Izotova LS, Mirochnitchenko OV, Lee C, Pestka S. The intracellular domainof interferon-alpha receptor 2c (IFN-alphaR2c) chain is responsible for Statactivation. PNAS 1999;96:5007–12.

Lamberti A, Longo O,MarraM, Tagliaferri P, Bismuto E, Fiengo A, et al. C-Raf antagonizesapoptosis induced by IFN-a in human lung cancer cells by phosphorylation andincrease of the intracellular content of elongation factor 1A. Cell Death Differ2007;14:952–62.

Lehtonen A, Matikainen S, Julkunen I. Interferons up-regulate STAT1, STAT2, and IRFfamily transcription factor gene expression in human peripheral blood mononu-clear cells and macrophages. J Immunol 1997;159:794–803.

Li D, Xie K, Wolff R, Abbruzzese JL. Pancreatic cancer. Lancet 2004;363:1049–57.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time

quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 2001;25:402–8.Mo C, Chearwae W, Bright JJ. PPARgamma regulates LIF-induced growth and self-

renewal of mouse ES cells through Tyk2-Stat3 pathway. Cell Signal 2010;22:495–500.

Motomura W, Nagamine M, Tanno S, Sawamukai M, Takahashi N, Kohgo Y, et al.Inhibition of cell invasion and morphological change by troglitazone in humanpancreatic cancer cells. J Gastroenterol 2004;39:461–8.

Neoptolemos JP, Stocken DD, Friess H, Bassi C, Dunn JA, Hickey H, et al. A randomizedtrial of chemoradiotherapy and chemotherapy after resection of pancreatic cancer.N Engl J Med 2004;350:1200–10.

Novosyadlyy R, Kurshan N, Lann D, Vijayakumar A, Yakar S, LeRoith D. Insulin-likegrowth factor-I protects cells from ER stress-induced apoptosis via enhancement ofthe adaptive capacity of endoplasmic reticulum. Cell Death Differ 2008;15:1304–17.

Pattingre S, Levine B. Bcl-2 inhibition of autophagy: a new route to cancer? Cancer Res2006;66:2885–8.

Picozzi VJ, Kozarek RA, Traverso LW. Interferon-based adjuvant chemoradiationtherapy after pancreaticoduodenectomy for pancreatic adenocarcinoma. Am JSurg 2003;185:476–80.

Pitulis N, Papageorgiou E, Tenta R, Lembessis P, Koutsilieris M. IL-6 and PPARgammasignalling in human PC-3 prostate cancer cells. Anticancer Res 2009;29:2331–7.

Qiu Z, Huang C, Sun J, Qiu W, Zhang J, Li H, et al. RNA interference mediated signaltransducers and activators of transcription 3 gene silencing inhibits invasion andmetastasis of human pancreatic cancer cells. Cancer Sci 2007;98:1099–106.

Rajasingh J, Bright JJ. 15-Deoxy-delta12,14-prostaglandin J2 regulates leukemiainhibitory factor signaling through JAK-STAT pathway in mouse embryonic stemcells. Exp Cell Res 2006;312:2538–46.

Raught B, Gingras AC. eIF4E activity is regulated at multiple levels. Int J Biochem CellBiol 1999;31:43–57.

Sangfelt O, Erickson S, Grandér D. Mechanisms of interferon-induced cell cycle arrest.Front Biosci 2000;5:479–87.

Scholz A, Heinze S, Detjen KM, Peters M, Welzel M, Hauff P, et al. Activated signaltransducer and activator of transcription 3 (STAT3) supports the malignantphenotype of human pancreatic cancer. Gastroenterology 2003;125:891–905.

Smolewski P. Recent developments in targeting the mammalian target of rapamycin(mTOR) kinase pathway. Anticancer Drugs 2006;17:487–94.

Sohn TA, Yeo CJ, Cameron JL, Koniaris L, Kaushal S, Abrams RA, et al. Resectedadenocarcinoma of the pancreas—616 patients: results, outcomes, and prognosticindicators. J Gastrointest Surg 2000;4:567–79.

Sriuranpong V, Park JI, Amornphimoltham P, Patel V, Nelkin BD, Gutkind JS.Epidermal growth factor receptor-independent constitutive activation of STAT3in head and neck squamous cell carcinoma is mediated by the autocrine/paracrinestimulation of the interleukin 6/gp130 cytokine system. Cancer Res 2003;63:2948–56.

Tagliaferri P, Caraglia M, Muraro R, Budillon A, Pinto A, Bianco AR. Pharmacologicalmodulation of peptide growth factor receptor expression on tumour cells as a basisfor cancer therapy. Anticancer Drugs 1994;5:379–93.

Tagliaferri P, Caraglia M, Budillon A, Marra M, Vitale G, Viscomi C, et al. Newpharmacokinetic and pharmacodynamic tools for interferon-alpha (IFN-alpha)treatment of human cancer. Cancer Immunol Immunother 2005;54:1–10.

Traganos F, Darzynkiewicz Z. Lysosomal proton pump activity: supravital cell stainingwith acridine orange differentiates leukocyte subpopulations. Methods Cell Biol1994;41:185–94.

Ulivi P, Arienti C, Amadori D, Fabbri F, Carloni S, Tesei A, et al. Role of RAF/MEK/ERKpathway, p-STAT-3 and Mcl-1 in sorafenib activity in human pancreatic cancer celllines. J Cell Physiol 2009;220:214–21.

van Koetsveld PM, Vitale G, de Herder WW, Feelders RA, van der Wansem K, WaaijersM, et al. Potent inhibitory effects of type I interferons on human adrenocorticalcarcinoma cell growth. J Clin Endocrinol Metab 2006;91:4537–43.

Vitale G, de Herder WW, van Koetsveld PM, Waaijers M, Schoordijk W, Croze E, et al.IFN-beta is a highly potent inhibitor of gastroenteropancreatic neuroendocrinetumor cell growth in vitro. Cancer Res 2006;66:554–62.

Vitale G, van Eijck CH, van Koetsveld PM, Erdmann JI, Speel EJ, van der Wansem, et al.Type I interferons in the treatment of pancreatic cancer: mechanisms of action androle of related receptors. Ann Surg 2007;246:259–68.

von Gise A, Lorenz P, Wellbrock C, Hemmings B, Berberich-Siebelt F, Rapp UR, et al.Apoptosis suppression by Raf-1 and MEK1 requires MEK- and phosphatidylinositol3-kinase-dependent signals. J Mol Cell Biol 2001;21:2324–36.


Wang LH, Yang XY, Zhang X, Farrar WL. Nuclear receptors as negative modulators ofSTAT3 in multiple myeloma. Cell Cycle 2005;4:242–5.

Wang D, Zhou Y, Lei W, Zhang K, Shi J, Hu Y, et al. Song Signal transducer and activator oftranscription3 (STAT3) regulates adipocytedifferentiation viaperoxisome-proliferator-activated receptor gamma (PPARgamma). J Biol Cell 2009;23(102):1–12.

Xue A, Scarlett CJ, Jackson CJ, Allen BJ, Smith RC. Prognostic significance of growthfactors and the urokinase-type plasminogen activator system in pancreatic ductaladenocarcinoma. Pancreas 2008;36:160–7.

Yan J, Yang H, Wang G, Sun L, Zhou Y, Guo Y, et al. Autophagy augmented bytroglitazone is independent of EGFR transactivation and correlated with AMP-activated protein kinase signaling. Autophagy 2010;6:67–73.

Yu JH, Kim KH, Kim H. SOCS 3 and PPAR-gamma ligands inhibit the expression of IL-6and TGF-beta1 by regulating JAK2/STAT3 signaling in pancreas. Int J Biochem CellBiol 2008;40:677–88.

Zhang SS, Wei J, Qin H, Zhang L, Xie B, Hui P, et al. STAT3-mediated signaling in thedetermination of rod photoreceptor cell fate in mouse retina. Invest OphthalmolVis Sci 2004;45:2407–12.

Zhou H, Li XM, Meinkoth J, Pittman RN. Akt regulates cell survival and apoptosis at apostmitochondrial level. J Cell Biol 2000;151:483–94.

Zhou J, Zhang W, Liang B, Casimiro MC, Whitaker-Menezes D, Wang M, et al.PPARgamma activation induces autophagy in breast cancer cells. Int J Biochem CellBiol 2009;41:2334–42.

The PPAR-γ agonist troglitazone antagonizes survival pathways induced by STAT-3 in recombinant...

Documents

Transcript of The PPAR-γ agonist troglitazone antagonizes survival pathways induced by STAT-3 in recombinant...