ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn...
Transcript of ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn...
![Page 1: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/1.jpg)
ST. CECILIA CHURCH
13 December
2020
A man named John was sent from God.
He came for testimony, to testify to the light,
so that all might believe through him.
![Page 2: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/2.jpg)
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130
Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner PASTOR EMERITUS Reverend Msgr. Francis X. Dreger PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond PRINCIPAL Sister Catherine Irene Masino , IHM VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM
SACRAMENTS
Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. Attendance at a Pre-Jordan class is required for first time parents. Please register for class by contacting the Rectory at 215-725-1240.
Marriage Couples must contact a priest six months prior to the wedding.
Reconciliation Saturdays from 4:00 to 4:45pm
Homebound Visitation Please contact the Rectory.
ST. CECILIA CHURCH Sunday
Vigil 5:00pm (Saturday) 6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
Every Saturday ~ 4:00-4:45pm Wednesday, December 23
4:00-5:00pm & 6:00-7:00pm
Confessions have returned to the Confessional
Christmas Eve Thursday ~ December 24
4:00pm & 7:00pm
Christmas Day Friday ~ December 25
6:30, 8:00, 9:30, 11:00am & 12:30pm
No Confessions Christmas Eve
MASSES WILL BE LIVESTREAMED ON OUR WEBSITE
Christmas Eve: 4:00 & 7:00pm Christmas Day 8:00am, 9:30am, 11:00am
Love your neighbor as yourself
Please remember to wear a facemask in church
and practice social distancing by staying 6 feet apart.
9:30am every Sunday
![Page 3: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/3.jpg)
#179 3
Responsorial Psalm
My soul rejoices in my God.
FOCUS: Advent is a season of waiting in joyful hope for the coming of the Lord.
Gaudete Sunday affirms the value of rejoicing and gives reasons for our rejoicing: God has given hope to his people waiting for redemption. We wait with rejoicing for what God has already accomplished and will yet accomplish through Christ. LITURGY OF THE WORD: In the first reading, Isaiah rejoic-es as he brings glad tidings of God’s vindication for his people. In the second reading Paul encourages rejoicing as God prepares his people for the return of the Lord. In the Gospel, John testifies to the light and cries out in the desert to make straight the way of the Lord. REFLECTION: We are invited to stand with God who wants an end to injustice and all that afflicts God’s creatures. This Ad-vent text offers hope for personal and community transformation and assures us that God will work with us as we attempt to bring about what Isaiah envisioned and Christ came to fulfill – justice, healing and peace throughout the world. So we ask ourselves:
What “glad tidings” do I hear for myself this Advent?
How can I share that good news with others?
First Reading ~ Isaiah 61:1-2, 10-11
The spirit of the Lord GOD is upon me, because the LORD has anointed me; he has sent me to bring glad tidings to the poor, to heal the brokenhearted, to pro-claim liberty to the captives and release to the prison-ers, to announce a year of favor from the LORD and a day of vindication by our God.
I rejoice heartily in the LORD, in my God is the joy of my soul; for he has clothed me with a robe of salvation and wrapped me in a mantle of justice, like a bride-groom adorned with a diadem, like a bride bedecked with her jewels. As the earth brings forth its plants, and a garden makes its growth spring up, so will the Lord God make justice and praise spring up before all the nations.
The word of the Lord. Thanks be to God.
Second Reading ~ 1st Letter of Paul to Thessalonians 5:16-24
Brothers and sisters: Rejoice always. Pray without ceas-ing. In all circumstances give thanks, for this is the will of God for you in Christ Jesus. Do not quench the Spirit. Do not despise prophetic utterances. Test everything; retain what is good. Refrain from every kind of evil.
May the God of peace make you perfectly holy and may you entirely, spirit, soul, and body, be preserved blame-less for the coming of our Lord Jesus Christ. The one who calls you is faithful, and he will also accomplish it.
The word of the Lord. Thanks be to God.
Holy Gospel ~ John 1:6-8, 19-28
A man named John was sent from God. He came for testimony, to testify to the light, so that all might believe through him. He was not the light, but came to testify to the light.
And this is the testimony of John. When the Jews from Jerusalem sent priests and Levites to him to ask him, “Who are you?” He admitted and did not deny it, but ad-mitted, “I am not the Christ.” So they asked him, “What are you then? Are you Elijah?” And he said, “I am not.” “Are you the Prophet?” He answered, “No.” So they said to him, “Who are you, so we can give an answer to those who sent us? What do you have to say for yourself?” He said: “I am the voice of one crying out in the desert, ‘make straight the way of the Lord,’” as Isaiah the prophet said.” Some Pharisees were also sent. They asked him, “Why then do you baptize if you are not the Christ or Elijah or the Prophet?” John answered them, “I baptize with water; but there is one among you whom you do not recognize, the one who is coming after me, whose sandal strap I am not worthy to untie.” This happened in Bethany across the Jordan, where John was baptizing.
The Gospel of the Lord. Praise to you, Lord Jesus Christ.
![Page 4: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/4.jpg)
#179 4
Mass Schedule ~ December 19-20 Saturday (Vigil) Celebrant: Fr. Lucas 5:00pm Lector: Paula Potts 6:30am Celebrant: Fr. Bonner Lector: Ruem Tan 8:00am Celebrant: Fr. Bonner Lector: Celine Severino 9:30am Celebrant: Fr. Lucas Guitar Group Lector: Michelle Riccobono 11:00am Celebrant: Fr. Lucas Lector: Rose Messina
This is the weekend to bring your gifts to the Riley and Sons Moving truck parked in the church parking lot. These gifts will be delivered to the shelters on Monday. We thank you for your generosity and the joy you are bringing to everyone receiving
these gifts. May you be blessed this Christmas season just as you have blessed others.
NICENE CREED
I believe in one God, the Father almighty, maker of heaven and earth, of all things visible and invisible.
I believe in one Lord Jesus Christ, the Only Begotten Son of God, born of the Father before all ages. God from God, Light from Light, true God from true God, begotten, not made, con-substantial with the Father; through him all things were made. For us men and for our salvation he came down from heaven,
(all bow) and by the Holy Spirit was incarnate of the Virgin Mary, and became man.
For our sake he was crucified under Pontius Pilate, he suf-fered death and was buried, and rose again on the third day in accordance with the Scriptures. He ascended into heaven and is seated at the right hand of the Father. He will come again in glory to judge the living and the dead and his kingdom will have no end. I believe in the Holy Spirit, the Lord, the giver of life, who pro-ceeds from the Father and the Son, who with the Father and the Son is adored and glorified, who has spoken through the prophets. I believe in one, holy, catholic and apostolic Church. I confess one Baptism for the forgiveness of sins and I look forward to the resurrection of the dead and the life of the world to come. Amen.
Please pick up a bulletin each week as you enter church. The Sunday readings will be printed in the bulletin every week. And, don’t forget to take that bulletin with you when you leave.
We would love to see everyone in person at Mass, but if you have any health issues, we strongly suggest you take advantage of the livestreaming of our Masses. We livestream the 9:30am Sunday Mass every week. For a list of the Christmas Masses, please see page 2 of this bulletin.
Emily Barr Riley Caggiano Anishka Chery Katherine Cole Rory Donnelly Keira Doris Alexandra Felice Lucas Free Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois Fiona King Sophia Klepcynski Rose Klepesky Mandy Knox Francesca Marzullo Finley McHugh Melany Merida Penelope Mullin Rebecca Montvydas Madeleine Monsonego Steven Nguyen Amilio Noel Jorge Prado Ryan Prosperi Jose Rosario Attis Rudic Anthony Schiavone Grady Shipton Avery Smith Edwin Smith Joseph Toomey Maggie Vogler Anthony Voscott Emma White Juliette Zolynski
Manna Food Drive Next weekend we contin-ue the collection of non-perishable food items. Thank you for bringing canned goods, peanut butter, cereal, pasta, etc. to the vesti-bule of the church. God bless you for helping others.
Madeline Elizabeth Schiavone
God Bless
to the children who received their First Penance on Friday ~ December 4, 2020
![Page 5: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/5.jpg)
#179 5
Don’t miss this opportunity Watch ‘The Search’
You will be amazed how good it will make you feel.
To set up your FREE account 1. Visit FORMED.org 2. Click Sign Up 3. Select “I Belong to a Parish or Organization” 4. Type in St. Cecilia Parish Community 5. Enter your email ~ and you’re in!
Our parish has a FORMED subscription just for YOU!
![Page 6: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/6.jpg)
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece
ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste
Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur
Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community
overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod
To all thoserivate & Publicrivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
keepingcs - PublicuCommunCommun
s safe,chnologychnology
yzardouzardouD fD
service isvices DefensDefenmercial Facimercial Faci
invaluable &idential & Shelteidential & ShelteH i P dH i Ptha
nk yo
u
afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se
ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor
After
Now Hiring friends and family caregivers.www.Bayada.com/careathome
Quality Senior Home Care Services since 1975.
Call today to learn more!(215) 419-7868
MONDAY, December 14 6:30am – Thomas Wagner 8:30am – Ed & Rose Lieber
TUESDAY, December 15 6:30am – Mary & Edward McGuinn 8:30am – Thomas O. Maginnis, Sr.
WEDNESDAY, December 16 6:30am – Alice Vozzelli 8:30am – William McFeely
THURSDAY, December 17 6:30am – Ursula Wolff 8:30am – Charles & Margaret Heller
FRIDAY, December 18 6:30am – John & Anne Robbins 8:30am – Grace Bartleson
SATURDAY, December 19 8:30am – William E. Staudt & Patricia Staudt 5:00pm – Frank Chiccino (birthday)
Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Stephanie Morgan Kirsten Hosack-Edling James Potts Mary Benson Mary Jane Brough Esther Sharp Leo Wuestkamp Stephen Ruczynski Helen Tobin Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Gregory Farrell Lisa Kovacs-Breuer Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Josephine O’Donnell Mary Matthews Jack Vogler Marguerite Zeltman Eileen Gaynor Alberta DeMasi Marian Diel Kathi Silcox Eleanor DeNoble Eugenia DiSilva Alonso Castillo Connie Merkel Catherine Needham Betty Harding Bill Scott Catherine Davis Theresa Halbherr Isabel Schmidt Robert McGrody Vincent Florian Fran McManus Helen Flood Clare Gilchrist Lou Baldwin John Carr Joseph Smyth Brendan Roth
Always in our prayers Mary Mikus
Frank Rozniakowski Edward Brown
![Page 7: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/7.jpg)
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBSCITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Patronize the Adve isers who make this bulletin possible!
BUILD YOUR COMMUNITY!
Patt o i e the A
SHOP LOCAL
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.
This describes the power of...
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!
Call 1.800.333.3166 TODAY!
Pranic Healing infl uences your natural life force to bring about a
healthier body.
Dan McMeans Pranic Healer
215 962 [email protected]
https://danmcmeans.wixsite.com/advancehealing
![Page 8: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois](https://reader033.fdocuments.net/reader033/viewer/2022060922/60ae42ff0676fa140b3332d3/html5/thumbnails/8.jpg)
IT'S TAX TIME!Be Confi dent In Your Accountant
For pricing & appointments at your home or my offi ce call:
215-603-4535 or 215-572-0529
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org
Friends, Family, Neighbors!
1-844-640-4200 PaulsRun.org/Living
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
WE CARE AND IT SHOWS
Beautiful On-Site Chapel with Daily Mass - Respite Stay Available
We Acknowledge We Appreciate
2990 Holme Ave., Phila.215-335-2100
www.imrehab.org
IMMACULATE MARYCENTER
Rehabilitation & Healthcare
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net