Phylogenetic Status of the Turkish Red Fox (Vulpes · PDF file273 64 (2) 237 – 248 eebe...

Click here to load reader

  • date post

    06-Aug-2018
  • Category

    Documents

  • view

    212
  • download

    0

Embed Size (px)

Transcript of Phylogenetic Status of the Turkish Red Fox (Vulpes · PDF file273 64 (2) 237 – 248 eebe...

  • 273

    64 (2): 273 284

    25.7.2014 Senckenberg Gesellschaft fr Naturforschung, 2014.

    ISSN 1864-5755

    Phylogenetic Status of the Turkish Red Fox (Vulpes vulpes), based on Partial Sequences of the Mitochondrial Cytochrome b Gene

    Osman bi 1, Cokun Tez 2, * & Servet zcan 2, 3

    1 Graduate School of Natural and Applied Sciences, Erciyes University, Kayseri 38039, Turkey 2 Department of Biology, Faculty of Sciences, Erciyes University, Kayseri 38039, Turkey 3 Genome and Stem Cell Center, GENKK, Erciyes University, Kayseri 38039, Turkey * Corresponding author: tezc(at)erciyes.edu.tr

    Accepted 25.v.2014. Published online at www.senckenberg.de/vertebrate-zoology on 15.vii.2014.

    AbstractGenetic diversity and multiple mitochondrial phylogroups of the red fox have been revealed from scattered locations in previous studies. There is a still lack of information about the genetic diversity and phylogeographic structure of the red fox in Asia Minor. We investigated the genetic diversity in the Turkish red fox using a part of the cytochrome b mitochondrial gene (375 bp), and attempted to evaluate the phylogeographic structure in various geographic ranges of the species with the use of sequences available from the GenBank from various geographic origins and our data. Bayesian and Network analyses of the cytochrome b sequences from Turkey and GenBank suggested that the red fox is divided into four main phylogroups. They are grouped accordingly: Group 1 (SW Anatolia, Turkey and Hokkaido, Japan), Group 2 (Eurasia and North America), Group 3 (only North America), and Group 4 (Vietnam). The majority of Turkish haplotypes grouped with those of Eurasia. Despite the great distance between the localities, two haplotypes from SW Anatolia, Turkey grouped with previously reported haplotypes from Hokkaido, Japan. The present study shows that the Turkish red fox is nested within two main phylogroups and exhibits a high genetic diversity.

    Key wordsVulpes vulpes, Mitochondrial DNA, Cytochrome b, Turkey.

    Introduction

    The red fox Vulpes vulpes is one of the most widely dis-tributed canid species throughout Northern Hemisphere (also introduced to Australia in the 1800s Wilson & Reeder 2005, Macdonald & Reynolds 2008). During the past two decades, V. vulpes has been one of the most investigated mammals from various regions. There are comprehensive studies dealing with the phylogeograph-ic structure and pattern of genetic diversity in the red fox populations, using allozyme or isozyme (Frati et al. 1998, Simonsen et al. 2003), RAPD (Gachot-Neveu et al. 2009), mitochondrial DNA cytochrome (Cyt) b (Frati et al. 1998, Inoue et al. 2007, Perrine et al. 2007,

    Fernandes et al. 2008, Aubry et al. 2009, Sacks et al. 2010, 2011, Statham et al. 2011, 2012, Teacher et al. 2011, Edwards et al. 2012, Yu et al. 2012a), control re-gion (Inoue et al. 2007, Kirschning et al. 2007, aubry et al. 2009, Sacks et al. 2010, 2011, Statham et al. 2011, 2012, Teacher et al. 2011, Edwards et al. 2012, Kutschera et al. 2013, Galov et al. 2014), tRNA-threo-nine and tRNA-proline (Inoue et al. 2007), microsatellite data (Lade et al. 1996, Wandeler et al. 2003, Kukekova et al. 2004, Wandeler & Funk 2006; Sacks et al. 2010, 2011, oishi et al. 2011) and single nucleotide polymor-phism (Sacks et al. 2011).

  • O. bi et al.: Phylogenetic status of Turkish red fox

    274

    Multiple studies based on mitochondrial DNA of red fox emphasize that there has been a considerable impor-tance to have a comprehensive picture of genetic varia-tion in the entire range of the species, when new insights are added into phylogeographic and colonization patterns of red fox with a wider biogeographic context (Frati et al. 1998, Inoue et al. 2007, Perrine et al. 2007, Aubry et al. 2009, Teacher et al. 2011, Edwards et al. 2012, Yu et al. 2012a, Kutschera et al. 2013). Some of the studies resulted in the formation of mitochondrial phylogroups, which were classified as Holoarctic and/or Eurasian, Nearctic, and Hokkaido (Inoue et al. 2007, Aubry et al. 2009, Yu et al. 2012a, Kutschera et al. 2013). Although there is a substantial inventory of mitochondrial data from Eurasia and North America (Frati et al. 1998, Inoue et al. 2007, Perrine et al. 2007, Aubry et al. 2009, Teacher et al. 2011, Edwards et al. 2012, Yu et al. 2012, Kutschera et al. 2013), there is a still lack of information about the genetic diversity and phylogeographic structure of the red fox from Turkey and the Middle East, except Israel. In this sense, more genetic and phylogeographic studies are needed to place these new mitochondrial data in a wider context and to elucidate the current pattern of phylogeographic structure throughout the red fox range. Therefore, it would not only be beneficial to determine the genetic structure of different red fox populations but also to focus on regional details, especially those in previously unsampled areas. Turkey is one of such areas. Because of its continental position, Turkey constitutes a mysterious and interesting area for mammalian biogeography due to its climate, vegetation, heterogeneous topography and geological history; together these unique factors produce a biodiversity hotspot (mdail & Quzel 1999, Bilgin 2011). Currently, there are at least 150 or more mamma-lian species from Turkey (Krytufek & Vohralik 2001, 2009, Wilson & Reeder 2005). Although there are a few studies based on its morphology and distribution (zkurt et al. 1998, Temizer 2001), the phylogenetic status and

    genetic diversity of Turkish red fox have not been previ-ously investigated. Therefore, there is a lack of informa-tion in this respect. In reference to the red fox dentition study, Szuma (2008) suggested that the modern red fox evolved either in Asia Minor (Ana tolia) or North Africa during the early Pleistocene. Con sequently, to confirm this, the phylogenetic status of Tur kish red fox should be revealed using different markers. In this study, our primary purpose was to determine the magnitude of genetic diversity within the Turkish red fox by sequencing part of the Cyt b gene. With emphasis on this information we provide new insights into phylo-geographic processes which may be essential for a better understanding of evolution.

    Material and Methods

    Localization, tissue sampling and DNA extraction

    Various tissues (ear, tail, skin and skeletal muscle) of 51 red foxes, which were road kills, were collected from 51 different localities in Turkey (Table 1, Fig. 1) during 2002-2010. Tissue samples had been stored in the cor-responding authors private collection at the Department of Biology, Faculty of Sciences, Erciyes University in Kayseri, Turkey. Total genomic DNA was extracted by using the DNeasy Blood and Tissue Kit (QIAGEN), following the manufacturers instructions. A segment of the mi to-chondrial cytochrome (Cyt) b (375 base pairs) from each Turkish sample was amplified by polymerase chain reac-tion (PCR) using the primer pair L14724 (5 GATATGAAAAACCATCGTTG 3) and H15149 (5 CAGAATGATATTTGTCCTCA 3)

    Fig. 1. Collection localities and distribution of red foxes (Vulpes vulpes) in Turkey. Map numbers are locality codes (see Table 1).

  • 275

    VERTEBRATE ZOOLOGY 64 (2) 2014

    Table 1. List of Turkish samples and sequences/haplotypes used in the present study (* Map numbers are locality codes in Figure 1).

    Map number*

    Cyt b haplotype

    Tissue Locality Coordinate/Altitude

    1 TR1 Tail zlce/Boazlyan/Yozgat N 39 29.185 E 35 04.298 H 1099m

    2 TR1 Muscle Boazkale/orum N 39 56.087 E 34 42.963 H 1215m

    3 TR1 Tail Kemerhisar/Bor/Nide N 37 45.509 E 34 34.032 H 1128m

    4 TR1 Tail Karabk N 41 09.810 E 32 38.428 H 304m

    5 TR1 Tail Bozca/Avanos/Nevehir N 38 44.331 E 35 02.312 H 1048m

    6 TR1 Tail Avanos/Nevehir N 38 41.409 E 34 48.850 H 1012m

    7 TR1 Tail Konya N 38 01.340 E 32 51.829 H 1001m

    8 TR1 Tail Konya N 37 53.613 E 32 09.022 H 1565m

    9 TR1 Tail Yozgat N 39 48.504 E 34 46.330 H 1204m

    10 TR1 Tail Tokat N 40 03.833 E 36 29.187 H 1143m

    11 TR1 Ear amlbel/Tokat N 40 04.261 E 36 29.011 H 1132m

    12 TR1 Tongue Amasya N 40 41.779 E 35 48.765 H 408m

    13 TR1 Ear Bekdiin/Havza /Samsun N 40 59.861 E 35 46.125 H 725m

    14 TR1 Muscle Eirdir/Isparta N 37 52.000 E 30 15.000

    15 TR1 Tubercle Acgl/Nevehir N 38 32.691 E 34 29.174 H 1264m

    16 TR1 Ear Aksaray N 38 30.969 E 34 21.098 H 1227m

    17 TR1 Ear Kayan Mah./Karaman N 37 14.318 E 33 21.128 H 1039m

    18 TR1 Ear Kirehir N 39 05.094 E 34 16.287 H 1200m

    19 TR1 Ear Elmada/Ankara N 39 55.348 E 33 15.923 H 1072m

    20 TR1 Ear Eskiehir N 39 30.058 E 31 13.424 H 1028m

    21 TR1 Muscle Ilgn/Konya N 38 18.062 E 31 39.356 H 1080m

    22 TR1 Ear Emekaya/Aksaray N 38 15.152 E 33 28.976 H 971m

    23 TR1 Ear al/Nevehir N 38 58.846 E 34 54.890 H 1316m

    24 TR1 Ear Pnarba/Kayseri N 38 43.000 E 36 23.000

    25 TR2 Tail Kzlrmak/ankiri N 40 21.169 E 33 58.767 H 555m

    26 TR2 Tail Yeniyapan/Keskin/Kirikkale N 39 35.319 E 33 42.013 H 922m

    27 TR3 Tail Kandra/Kocaeli N 41 04.907 E 30 10.238 H 41m

    28 TR4 Tail Isparta N 39 03.203 E 31 25.615 H 1200m

    29 TR4 Tail Dikici Ky/Dinar/Afyon N 38 00.140 E 30 11.522 H 940m

    30 TR4 Ear Beyehir/Konya N 37 54.691 E 31 56.955 H 1270m

    31 TR5 Tail Bahadin/Sarkaya/Yozgat N 39 36.066 E 35 15.707 H 1123m

    32 TR5 Tail Isparta N 37 52.539 E 30 30.730 H 935m

    33 TR5 Tail Eirdir/Isparta N 37 50.753 E 30 51.579 H 922m

    34 TR5 Muscle Arguvan/Malatya N 38 46.000 E 38 16.000

    35 TR5 Tail Takpr/Babaeski/Kirklareli N 41 27.000 E 27 03