Morphological, anatomical and biochemical

changes associated with the infection processes of Sclerotinia sclerotiorum in a resistant cultivar of

Brassica napus

Harsh

B.Sc. Agric. (Hons.)

M.Sc. Plant Breeding & Biotechnology

This thesis is presented for the degree of Doctor of Philosophy of

the University of Western Australia

School of Plant Biology

Faculty of Natural and Agricultural Sciences

University of Western Australia

2010

iii

ABSTRACT

Host resistance offers the only economic and sustainable method for effectively

managing the disease caused by Sclerotinia sclerotiorum in Brassicas. However, the

level of host resistance to this pathogen is still inadequate. Poorly characterized

resistance mechanisms against this pathogen further confine the strategies that can be

undertaken to design durable resistance or effective disease control measures. The focus

of this thesis was to identify resistant genotypes (including the different form(s) of

resistance expression), and to define the underlying mechanism(s) of resistance in B.

napus against the pathogen.

To identify Brassica genotypes with resistance to this pathogen, the foremost pre-

requisite was to develop a rapid and reliable method of screening that could enhance

screening of large number of genotypes in a short time. To address this, the feasibility

of utilizing a cotyledon assay already developed for Sclerotinia disease on legumes was

examined for B. napus. After a series of standardization steps, a cotyledon assay was

successfully deployed for B. napus (P < 0.001) genotypes under controlled

environmental conditions. Certain genotypes (e.g., cv. Charlton) responded with a

distinct hypersensitive reaction (lesions <1 mm diameter)) with this assay, which is the

first report of this phenomenon in the B. napus-S. sclerotiorum pathosystem. Responses

of genotypes across three repeat screening experiments were significantly and positively

correlated, (r > 0.90; P < 0.001). Additionally, there was a significant positive

correlation (r = 0.62; P < 0.01) between published field data for stem rot resistance with

the cotyledon test results across the genotypes that were ‘in common’, an indication of

the relative reliability of the method developed. This assay identifies responses of B.

napus genotypes in a total of 16 days compared with up to 3-4 months when other

methods such as the stem inoculation technique are utilized.

Owing to a large diversity of S. sclerotiorum reported under field conditions, the

selected B. napus genotypes identified in the initial screening experiment were further

evaluated across a range of morphologically different S. sclerotiorum isolates. Out of

the eight isolates collected from the different regions of Western Australia, three darkly

pigmented isolates were identified and this is the first report of the occurrence of such

isolates in Australia. Significant differences were observed between different isolates (P

iv

≤ 0.001) in two separate experiments in relation to pathogenicity. Differences were also

observed between the different Brassica genotypes (P ≤ 0.001) in their responses to

different isolates of S. sclerotiorum and there was a significant host x pathogen

interaction (P ≤ 0.001) in both experiments. Responses of some genotypes (e.g., cv.

Charlton) were relatively consistent irrespective of the isolates, whereas highly variable

responses were observed in certain other genotypes (e.g., Zhongyou-ang No. 4, Purler)

against the same isolates. Results indicate that the unique genotypes which show

relatively consistent resistant reaction (e.g., cv. Charlton) across different but highly

pathogenic isolates are suitable for commercial exploitation in oilseed Brassica

breeding programmes.

To define the mechanism(s) of resistance in a B. napus genotype (cv. Charlton) that

responded consistently, particularly across the highly pathogenic isolates in the previous

experiment, ascospores were initially considered to be the ideal inoculum type as these

are known to be a primary source of infection of S. sclerotiorum. Due to the

inconsistencies reported in the literature to date for stimulation of carpogenic

germination (to produce ascosporic inoculum) under artificial conditions, a study was

undertaken, firstly, to investigate the effect on carpogenic germination of scarifying

sclerotia from two S. sclerotiorum isolates taken from canola (B. napus), and secondly,

to identify environmental factor(s) that enhance carpogenic germination. Carpogenic

germination of scarified sclerotia was significantly greater (P < 0.05) than for un-

scarified sclerotia. There was significant interaction (P < 0.001) between scarification

and the different environmental treatments in relation to the carpogenic germination.

Further, overall carpogenic germination of both scarified and un-scarified sclerotia

occurred to the greatest extent when sclerotia of either isolate were subjected to constant

rinsing with tap water.

Infection processes of two B. napus genotypes, one resistant (cv. Charlton) and one

susceptible (RQ001-02M2) to S. sclerotiorum were examined by using ascosporic

inoculum obtained in the previous experiment to understand the mechanism(s) of

resistance. Cultivar Charlton showed impeded fungal growth at 1, 2 and 3 days post

inoculation (dpi), active suppression of the infection cushions, extrusion of protoplast

from hyphal cells and hypersensitive reaction. At 8 dpi, whilst in cv. Charlton pathogen

v

invasion was mainly confined to the upper epidermis, in RQ001-02M2 colonization up

to the spongy mesophyll cells was evident. Calcium oxalate crystals were found in the

upper epidermis and in palisade cells in RQ001-02M2 at 6 dpi, and throughout leaf

tissues at 8 dpi. In cv. Charlton, crystals were not observed at 6 dpi, whereas at 8 dpi

they were mainly found in the upper epidermis. Starch deposits were more prevalent in

RQ001-02M2. This study also demonstrates, for the first time, that resistance in B.

napus to S. sclerotiorum is conferred by retardation of pathogen development on and

within tissues and associated cellular responses of the host.

To further understand the mechanism of resistance expressed in the B. napus – S.

sclerotiorum pathosystem at a biochemical level, a comparative morphological,

histological and proteomic analysis [using two-dimensional electrophoresis at 12, 24, 48

and 72 h post inoculation (hpi)] was conducted of the same two B. napus genotypes viz.,

Charlton and RQ001-02M2. Significant differences (P ≤ 0.001) were observed between

resistant cv. Charlton and susceptible RQ001-02M2 at 72 and 96 hpi in terms of a lesion

size on cotyledon. Anatomical investigations revealed impeded fungal growth (at 24 hpi

and onwards) only for resistant cv. Charlton. The proteins related to antioxidant defence

(glutathione S-transferase, monodehydroascorbate reductase), hormone biosynthesis (S-

adenosylmethionine synthase), protein synthesis (cysteine synthase), pathogenesis

related proteins (Major latex-related protein), protein folding (20 kDa chaperonin) and

those related to the metabolic pathways (e.g., carbonic anhydrase) were found to

increase in abundance only in the resistant cv. Charlton in response to the pathogen

challenge. The co-ordinated expression of all these proteins is considered to be

responsible for mediating defence responses in resistant cv. Charlton. Engineering B.

napus genotype that express enhanced levels of these proteins could increase the levels

of resistance against this pathogen in commercial cultivars. To best of my knowledge,

this is the first study in which proteomic approach has been deployed in the

incompatible interaction of B. napus and S. sclerotiorum.

The search for identifying novel and effective resistant sources to S. sclerotiorum, was

further extended to wild cruciferous species in this research. Introgression lines were

developed following hybridization of three wild crucifers (viz. Erucastrum

cardaminoides, Diplotaxis tenuisiliqua and E. abyssinicum) with B. napus or B. juncea.

vi

Their resistance responses were characterized by using a stem inoculation test. Seed of

54 lines of B. napus and B. juncea obtained from Australia, India and China through an

Australian Centre for International Agricultural Research (ACIAR) collaboration

programme were used as susceptible check comparisons. Introgression lines derived

from E. cardaminoides, D. tenuisiliqua and E. abyssinicum had much higher levels (P <

0.001) of resistance (median values for stem lesion length were 1.7, 1.2 and 2.0 cm,

respectively) as compared with the ACIAR germplasm (median value of 8.7 cm). This

is the first report of high levels of resistance against S. sclerotiorum in introgression

lines derived from these wild crucifers.

This study has taken a significant step forward to identify novel resistance sources that

can be used in oilseed Brassica breeding programmes to enhance resistance in future B.

napus and B. juncea cultivars against Sclerotinia stem rot. This study has also

significantly advanced our understanding of the mechanisms of resistance at both

cellular and biochemical levels in a B. napus genotype that can now form the basis for

developments of markers for disease resistance or to design the more effective disease

control measures. Future studies that focus on the mapping of the genes governing

resistance and further understanding of defense responses against S. sclerotiorum in the

new introgression lines resulting from this study, could be used to further enhance both

the degree and durability of resistance in the current commercial cultivars.

vii

ACKNOWLEDGEMENTS

Researching for this thesis over the past few years has been an incredibly rewarding experience. In the numerous hours of exploring this project; I acknowledge the support and encouragement from a number of people who have helped me to achieve my goals. First and foremost, I offer my sincere gratitude to my supervisors Prof. Martin Barbetti and Prof. K. Sivasithamparam from School of Plant Biology, The University of Western Australia (UWA) for their support and motivation throughout this thesis. Their timely reviews, patience, useful comments on my research questions and experimental approaches helped me immensely to improve this work. Prof. Martin Barbetti has been a constant source of immense inspiration to me during the entire course of this research. His constructive guidance, enthusiasm and especially the encouraging attitude helped me to achieve my best. His incredible abilities to understand research related issues in great depth helped me in improving my experimental design and analysis to a great extent. Prof. K. Sivasithamparam has been a great supervisor. His intellectual guidance, ability to simplify tough tasks, prudent cooperation, patience, and critical judgments have always been a motivating factor for me to achieve my goals. I enjoyed my research discussions with him because of his ability of explaining different plant pathology aspects in a way that helped me in developing a new vision to science. My warm thanks to Dr. Hua Li for providing guidance to me in lab experiments during the entire course of this study. She has been a great person, a great friend and a great colleague.

My sincere thanks to Dr. SS Banga and Dr. SK Banga (and their team) from Punjab Agricultural University, India for giving me an opportunity to work with them and for providing the access to the novel germplasm that they have developed. I am grateful to Professor Hans Lambers for his continous support during my PhD, and office staff especially Dr. Renu Sharma for assiting with the administrative help during this journey. I would also like to thank for the help given to me for microscopy studies by Professor John Kuo, Mr. John Murphy, Mr Steve Parry and Ms Lyn Kirilak from the Centre for Microscopy, Characterization & Analysis, UWA. Needless to say, I am thankful to all the agencies that funded this research project. The financial assistance given by Australian Centre of International Agricultural Research through John Allwright Fellowship is gratefully acknowledged. I am thankful to the school of plant Biology for providing me research funds for this project. My PhD journey has indeed been an enjoyable experience especially because of my friends Mily Devji, Maheswari Jayakannan and Foteini Hassiotou. Their informal support and encouragement especially during my hard time of compiling this thesis is truly indispensable. In my daily work life, I was blessed with a friendly and cheerful group of fellow colleagues. I gratefully acknowledge them especially those I shared my room with for their friendship and assistance during my PhD.

viii

Lastly, and most importantly, enormous thanks to my parents and my family members for their selfless sacrifices and uninterrupted support, regardless of the distances between us. My parents have always been a beacon light in my career and they constantly rejuvenated my spirit that enabled me to explore my potential and perform at my best. It would not have been possible for me to achieve this without their love and support. I dedicate this thesis to my parents and I hope that this achievement will fulfill the dream they had for me for all those years when they chose to give me the best education at the expense of their own leisures.

ix

TABLE OF CONTENTS

Abstract .......................................................................................................................... iii Acknowledgements........................................................................................................vii Table of Contents ...........................................................................................................ix Table of Appendices......................................................................................................xii Abbreviations List.........................................................................................................xv CHAPTER 1 General Introduction ..........................................................................1

1.1 Background .......................................................................................................1 1.1.1 Oilseed Brassicas and Sclerotinia disease ..................................................2 1.1.2 Symptoms of Sclerotinia disease ................................................................2 1.1.3 Disease cycle...............................................................................................3 1.1.4 Disease management practices....................................................................4 1.1.5 Screening techniques to identify resistant genotypes..................................7 1.1.6 Pathogenicity of S. sclerotiorum isolates ..................................................10

1.2 Host-pathogen interactions..............................................................................11 1.2.1 Host-pathogens interactions at the cellular level.......................................11 1.2.2 Host-pathogen interactions at the biochemical or molecular level ...........13

1.3 Gaps in knowledge..........................................................................................17 1.4 Research questions ..........................................................................................17 1.5 Thesis structure ...............................................................................................18

CHAPTER 2 Cotyledon Assay as a Rapid and Reliable Method of Screening for Resistance against Sclerotinia sclerotiorum in Brassica napus Genotypes ...............22

2.1 Abstract ...........................................................................................................22 2.2 Introduction .....................................................................................................23 2.3 Materials and methods ....................................................................................25

2.3.1 S. sclerotiorum isolate...............................................................................25 2.3.2 Test conditions ..........................................................................................25 2.3.3 Genotypes tested .......................................................................................25 2.3.4 Inoculum production .................................................................................26 2.3.5 Inoculations ...............................................................................................26 2.3.6 Disease assessment....................................................................................27 2.3.7 Data analyses.............................................................................................27

2.4 Results .............................................................................................................27 2.4.1 Experiments 1, 2 and 3..............................................................................27 2.4.2 Correlation of experiment 1 cotyledon test results with field ratings of Li et al. (2006) .............................................................................................................28

2.5 Discussion .......................................................................................................29 CHAPTER 3 Pathogenicity of Morphologically Different Isolates of Sclerotinia sclerotiorum with Brassica napus and B. juncea Genotypes......................................34

3.1 Abstract ...........................................................................................................34 3.2 Introduction .....................................................................................................35 3.3 Materials and Methods....................................................................................36

3.3.1 S. sclerotiorum isolates .............................................................................36 3.3.2 Molecular identification of different isolates............................................36 3.3.3 Comparison of colony characteristics .......................................................37 3.3.4 Pathogenicity of different isolates.............................................................37

3.4 Results .............................................................................................................39

x

3.4.1 Molecular identification of different isolates............................................ 39 3.4.2 Colony characteristics of isolates..............................................................41 3.4.3 Responses of various genotypes to different isolates of S. sclerotiorum.. 41 3.4.4 Pathogenicity of different isolates of S. sclerotiorum............................... 43 3.4.5 Host x pathogen interaction ...................................................................... 43 3.4.6 Correlation of responses of genotypes between experiments ................... 44

3.5 Discussion....................................................................................................... 45 CHAPTER 4 Scarification and Environmental Factors that Enhance Carpogenic Germination of Sclerotia of Sclerotinia Sclerotiorum ........................... 50

4.1 Abstract ........................................................................................................... 50 4.2 Introduction..................................................................................................... 51 4.3 Materials and Methods.................................................................................... 53

4.3.1 S. sclerotiorum isolates and production of sclerotia ................................. 53 4.3.2 Experimental design.................................................................................. 54 4.3.3 Scarification .............................................................................................. 55 4.3.4 Treatments................................................................................................. 56 4.3.5 Data collection and Data analysis ............................................................. 58

4.4 Results............................................................................................................. 59 4.4.1 Effect of scarification, environmental treatment and isolate on carpogenic germination of S. sclerotiorum............................................................................... 59 4.4.2 Environmental treatment x scarification, isolate x scarification and isolate x environmental treatment interactions................................................................... 62 4.4.3 Seasonal rhythm of the two isolates in response to the time of the year .. 63

4.5 Discussion....................................................................................................... 63 CHAPTER 5 The Infection Processes of Sclerotinia sclerotiorum in cotyledon tissue of a resistant and susceptible genotype of Brassica napus .............................. 68

5.1 Abstract ........................................................................................................... 68 5.2 Introduction..................................................................................................... 69 5.3 Materials and methods .................................................................................... 70

5.3.1 Host genotypes.......................................................................................... 70 5.3.2 S. sclerotiorum isolate............................................................................... 71 5.3.3 Inoculum production................................................................................. 71 5.3.4 Inoculum preparation, inoculation conditions and inoculation procedure 71 5.3.5 Sample preparation for light microscopy.................................................. 72 5.3.6 Sample preparation for anatomical studies ............................................... 73 5.3.7 Sample preparation for scanning electron microscopy (SEM) studies..... 73 5.3.8 Statistical analysis..................................................................................... 74

5.4 Results............................................................................................................. 74 5.4.1 Ascospore germination and fungal development in DI water .................. 74 5.4.2 Ascospore germination and fungal development in Pi-glucose medium.. 75 5.4.3 Anatomical differences ............................................................................. 77

5.5 Discussion....................................................................................................... 79 CHAPTER 6 Differentially Expressed Proteins Associated with Compatible and Incompatible Interactions of the Brassica napus – Sclerotinia sclerotiorum Pathosystem 93

6.1 Abstract ........................................................................................................... 93 6.2 Introduction..................................................................................................... 94 6.3 Methodology................................................................................................... 97

6.3.1 Host genotypes, S. sclerotiorum isolate and inoculation procedure ......... 97

xi

6.3.2 Histology...................................................................................................97 6.3.3 Protein extraction ......................................................................................98 6.3.4 Two-dimensional electrophoresis .............................................................99 6.3.5 Image analysis and protein identification ...............................................100

6.4 Results ...........................................................................................................101 6.4.1 Morphological differences ......................................................................101 6.4.2 Histological differences ..........................................................................104 6.4.3 Differential proteins from the interaction between S. sclerotiorum and the two B. napus genotypes.........................................................................................107 6.4.4 Functional classification of the protein identified...................................109

6.5 Discussion .....................................................................................................110 6.5.1 Proteins involved in metabolic pathway .................................................112 6.5.2 Proteins associated with antioxidant defence..........................................113 6.5.3 Proteins involved in protein synthesis.....................................................116 6.5.4 Pathogenesis related proteins ..................................................................117 6.5.5 Proteins involved in hormone biosynthesis and signaling ......................118 6.5.6 Molecular chaperones and post-translation modification of proteins .....119 6.5.7 Proteins of pathogen origin .....................................................................119 6.5.8 Concluding remarks ................................................................................121

CHAPTER 7 High level of Resistance to Sclerotinia sclerotiorum in Introgression Lines Derived from Hybridization between Wild Crucifers and the Crop Brassica species B. napus and B. juncea ..........................................................135

7.1 Abstract .........................................................................................................135 7.2 Introduction ...................................................................................................136 7.3 Materials and methods ..................................................................................138

7.3.1 Plant materials.........................................................................................138 7.3.2 Field experimental site ............................................................................141 7.3.3 S. sclerotiorum isolate.............................................................................141 7.3.4 S. sclerotiorum inoculations....................................................................141 7.3.5 Disease assessment..................................................................................141 7.3.6 Resistance categories ..............................................................................142 7.3.7 Data analysis ...........................................................................................142

7.4 Results ...........................................................................................................142 7.4.1 Resistance responses of introgression lines derived from three wild species (E. cardaminoides, D. tenuisiliqua and E. abyssinicum) and of ACIAR germplasm.............................................................................................................142 7.4.2 Comparison of introgression lines derived from three wild species .......146 7.4.3 Comparison of different cross combinations within each wild species/effect of second cross species...................................................................149 7.4.4 Correlation between stem lesion length and stem diameter....................149

7.5 Discussion .....................................................................................................150 CHAPTER 8 GENERAL DISCUSSION..............................................................153

8.1 Summary .......................................................................................................153 8.1.1 Identification of sources of resistance.....................................................154 8.1.2 Production and comparison of ascosporic inoculum with mycelial inoculum................................................................................................................155 8.1.3 Mechanisms of resistance .......................................................................158 8.1.4 Wild cruciferous as a potential source of high resistance to S. sclerotiorum 164

xii

8.1.5 Concluding Remarks and future work .................................................... 165 Bibliography ................................................................................................................ 167

TABLE OF APPENDICES

APPENDIX 1................................................................................................................ 205 APPENDIX 2................................................................................................................ 207 APPENDIX 3................................................................................................................ 209

xiii

Thesis Declarations Thesis Declarations Thesis Declarations Thesis Declarations aaaand Publication Listnd Publication Listnd Publication Listnd Publication List

This thesis is presented as a series of scientific papers that includes five published and

one submitted manuscripts that have been co-authored. The bibliographical details of

the work and where it appears in the thesis is outlined below:

Chapter 2: Garg H, Sivasithamparam K, Banga SS, Barbetti MJ. 2008. Cotyledon

assay as a rapid and reliable method of screening for resistance against

Sclerotinia sclerotiorum in Brassica napus genotypes. Australasian Plant

Pathology 37: 106-111.

Chapter 3: Garg H, Kohn LM, Andrew M, Hua Li, Sivasithampara m K, Barbetti

MJ. 2010. Pathogenicity of morphologically different isolates of Sclerotinia

sclerotiorum with Brassica napus and B. juncea genotypes. European Journal of

Plant Pathology 126: 305-315.

Chapter 4: Garg H, Sivasithamparam K, Barbetti MJ. 2010. Scarification and

environmental factors that enhance carpogenic germination of sclerotia of

Sclerotinia sclerotiorum. Plant Disease 94: 1041-1047.

Chapter 5: Garg H, Hua Li, Kuo J, Sivasithamparam K, Barbetti MJ. 2010. The

Infection Processes of Sclerotinia sclerotiorum in cotyledon tissue of a resistant

and susceptible genotype of Brassica napus. Annals of Botany (accepted).

Chapter 6: Garg H, Hua Li, Sivasithamparam K, Barbetti MJ. 2010. Differentially

expressed proteins associated with compatible and incompatible interactions of

the Brassica napus – Sclerotinia sclerotiorum pathosystem. Proteomics

(submitted).

Chapter 7: Garg H, Atri C, Sandhu PS, Kaur B, Renton M, Banga SK, Singh H,

Singh C, Barbetti MJ, Banga SS. 2010. High level of resistance to Sclerotinia

sclerotiorum in introgression lines derived from wild crucifers and the crop

Brassica species B. napus and B. juncea. Field Crops Research 117: 51-58.

xiv

The majority of the work carried out for these papers (or chapters) as well as the rest of

this thesis is entirely my own, with two exceptions. In chapter 3, Dr. Linda Kohn and

Dr. M. Andrew from University of Toronto, Mississauga, Canada confirmed the

identification of the fungal isolates by molecular techniques. Rest all of the work for

pathogenicity studies of chapter 3, including writing manuscript was conducted by me

at the University of Western Australia. For Chapter 7, Dr. SS Banga and his team, (Dr.

C. Attri, Miss B. Kaur and Dr. S. K. Banga) were involved in the development of the

introgression lines in Punjab Agricultural University, India. Dr. P. S. Sandhu, Dr. H.

Singh, and Mr. C. Singh helped in field screening of the germplasm. Dr. Michael

Renton helped in data analysis of this chapter. My contribution to this paper/chapter

constitutes of formulation of aims and objectives, research plan, field experiment, data

collection and interpretation, and for writing the manuscript. The contribution of different

co-authors in rest of the papers was mainly associated with giving me initial research

directions, statistical advice/help, microscopy help and in editing various versions of all

the manuscripts.

xv

ABBREVIATIONS LIST

ACIAR Australian Centre for International Agricultural Research

AdoMet S-adenosylmethionine

ANOVA Analysis of variance

CCB Colloidal Coomassie blue

D Day

DI Deionised

Dpi Days post inoculation

DTT Dithiothreitol

ET Ethylene

GMA Glycol methacrylate

GSH Glutathione

GST Glutathione S-transferase

Hpi Hours post inoculation

HR Hypersensitive

Hsps Heat-shock proteins

IEF Isolelectric focusing

l.s.d Least significant differences

LPD lipoyl-dehydrogenases

MDHAR Monodehydroascorbate reductase

PAS Periodic Acid/Schiff’s

PDA Potato dextrose agar

PDI Protein disulfide isomerise

PMSF Phenylmethylsulfonyl fluoride

PR Pathogenesis-related

RH Relative humidity

ROS Reactive oxygen species

SOD Superoxide dismutase

TCA Trichloroacetic acid

WA Western Australia

Wai Weeks after inoculation

CHAPTER 1

1

CHAPTER 1 General Introduction

1.1 BACKGROUND

Sclerotinia sclerotiorum, the causal agent of Sclerotinia disease, is one of the most

destructive and cosmopolitan of plant pathogens (Bolton et al., 2006). More than 60

names have been given to this disease, all based on symptoms such as stem rot, white

mould or cottony rot and how different crop species responded to the pathogen (Saharan

and Mehta, 2008). This necrotrophic fungal pathogen attacks over 400 plant species

worldwide, and is now considered as a serious threat to many economical important

crops including soybean (Glycine max), sunflower (Helianthus annus) and canola

(Brassica napus) (e.g., Willetts and Wong, 1980; Boland and Hall, 1994). The

devastating nature of this pathogen is also apparent from the fact that the collective

annual losses from S. sclerotiorum in the United States alone, from different crop

species have been estimated as high as $280 million

(http://www.whitemoldresearch.com). Extensive crop damage by this pathogen have

been the impetus for sustained research worldwide targeting effective disease control

measures against this pathogen (Lumsden, 1979; Willetts and Wong, 1980; Bolton et

al., 2006). For instance, US Department of Agriculture has initiated a scheme called

“National Sclerotinia Initiative” involving 20 different projects related to this pathogen

(Bolton et al., 2006). In addition, the genome of S. sclerotiorum has also been

sequenced to advance the understanding of this devastating pathogen

(http://www.broad.mit.edu/annotation/fungi/fgi/).

Effective disease control measures against S. sclerotiorum continues to be a challenge

because of the inefficiency of chemical control in managing this disease, largely due to

difficulty in timing the application with the release of ascospores (Bolton et al., 2006).

Furthermore, cultural practices tend to avoid or reduce the severity of Sclerotinia stem

rot, but none effectively controls S. sclerotiorum on its own. Host resistance offers the

only economic and sustainable method for effectively managing this disease. However,

the level of host resistance to this pathogen is still inadequate (Bolton et al., 2006; Li et

CHAPTER 1

2

al., 2007), Poorly characterized resistance mechanisms against this pathogen further

limits the strategies that can be undertaken to design durable resistance or effective

disease control measures. Overall, the aim of this thesis was to identify resistant

genotypes, (including the different form(s) of resistance expression), and to define the

underlying mechanism(s) of resistance in B. napus against S. sclerotiorum.

1.1.1 Oilseed Brassicas and Sclerotinia disease

Oilseed Brassica is an important agricultural crop in Australia, India, China, Canada

and in Europe and contributes towards 13% of the total world’s production of edible oil

(Carr, 1990). It has become increasingly important especially in Australian agriculture

over the last few decades and it is now Australia’s third largest field crop (Barbetti and

Khangura, 2000). Oilseed Brassicas are confronted by a number of diseases, such as

blackleg, downy mildew, alternaria blight (Barbetti and Khangura, 2000), of which

Sclerotinia stem rot poses a major threat to production (Saharan and Mehta, 2008).

Yield losses due to Sclerotinia disease vary among different crop species and it can be

as high as 100% (Purdy, 1979). Similarly, crop damage up to 24% has been recorded in

canola under Australian conditions (Hind- Lanoiselet and Lewington, 2004). A yield

survey of canola in New South Wales in 1998, showed 80% of petals infected with this

pathogen in an individual field, with the number of stems infected reaching 30% (Hind

et al., 2001). As a consequence, Sclerotinia is now considered to be a major threat to

canola industry in Australia.

1.1.2 Symptoms of Sclerotinia disease

The symptoms of Sclerotinia can vary among different crop species according to the

host part affected, stage of infection and environmental conditions. However,

appearance of water soaked lesion followed by the white fluffy mycelial growth are the

most obvious and typical early symptoms of Sclerotinia disease (Saharan and Mehta,

2008). An example of infected tissue of a few crops species such as bean, carrot and

Brassica is shown in Fig. 1. In Brassica, while water soaked lesions are mainly apparent

on the stem tissue, all the above-ground parts of the plants is subjected to attack by the

fungus (Hind-Lanoiselet and Lewington, 2004). The water-soaked lesions elongate, are

covered by a white cottony growth, and eventually the fungus completely girdles the

stem tissues leading to the wilt or drying of the host (Phillips et al., 2002). The infected

CHAPTER 1

3

stems tend to shred and numerous thick walled resting structures called sclerotia can be

seen either on the host surface or in the pith of the affected stems (Willetts and Wong,

1980).

Figure 1 An example of the symptoms of Sclerotinia disease in different host species, where A, B, C, D and E represent Sclerotinia disease on peas, soybean, potato, carrot and B. napus, respectively. Fig. 1A, B and C are adapted from http://www.whitemoldresearch.com and Fig. 1D is adapted from Kora et al., 2003.

1.1.3 Disease cycle

The fungus over-winters in soil or in stubble as sclerotia which remain viable for up to

eight years (William and Stelfox, 1980). Under favourable conditions (i.e. high moisture

and low temperature) sclerotia can germinate either myceliogenically or carpogenically

(Fig. 2). In myceliogenic germination, sclerotia can produce infective hyphae which

invade the tissue of the host generally near the stem base (Willets and Wong, 1980).

Myceliogenic germination is considered to be of minor importance in disease

epidemiology, with the exception of sunflower and, oilseed Brassica crops in India

where myceliogenic germination is considered to be important (Singh et al., 2008).

More commonly, sclerotia germinate carpogenically (Fig. 2), producing apothecia

CHAPTER 1

4

releasing wind-borne ascospores (Willets and Wong, 1980). These ascospores can either

germinate and penetrate at wound sites on host tissues or, on dead or live flowers,

senescent leaves and organic matter which are often in contact with the host tissue

(Abawi and Grogan, 1979; Willets and Wong, 1980; Jamaux et al., 1995; McCartney et

al., 1999). The ascosporic mycelium which develops on these nutrient bases, when

deposited on leaves, leaf axils or stem tissues leads to the development of stem rots

(Abawi and Grogan, 1979). This mode of infection involving ascospores is particularly

important for oilseed Brassica where the disease is mainly evident during and after

flowering (Turkington and Morrall, 1993). Subsequently, sclerotia are produced mainly

internally in infected stem cavities (Purdy, 1958). These sclerotia are then dislodged

during harvesting and accumulate in plant debris and in soil.

Figure 2 A schematic representation of the disease cycle of Sclerotinia sclerotiorum in Brassica spp. Fig. 2A, B and F are adapted from www.canola-council.org/

1.1.4 Disease management practices

Various methods used for managing S. sclerotiorum include chemical control, cultural

control, biological control and varietal resistance (Bardin and Huang 2001). The

CHAPTER 1

5

efficacy of a number of fungicides such as benomyl, chlorothalonil, thiophanate methyl

and dicloran has been tested (Tu, 1997; Mueller et al., 2002). However, chemical

control is often ineffective, largely due to difficulty in timing the application with the

release of ascospores (Bolton et al., 2006), especially in Australia where petal infection

can be a poor indicator of subsequent stem infection levels (Hind et al., 2003).

Development of resistance against various fungicides by the pathogen such as those

reported for benomyl in Canada (Gossen and Rimmer, 2001) is also a considerable

drawback. Furthermore, various environmental and economic concerns associated with

the use of fungicides (Saharan and Mehta, 2008) hampers their use as an effective

measure to manage S. sclerotiorum.

Cultural practices tend to avoid or reduce the severity of Sclerotinia stem rot, but none

effectively control S. sclerotiorum on their own. Cultural practices include (i) crop

rotation (Tu, 1997; Gracia-Garza et al., 2002); (ii) increased row spacing and decreased

seeding rate (Hoes and Huang, 1975); and (iii) practices that discourage apothecial

production and ascosposre release, such as maintaining high irrigation to increase

rotting of sclerotia (Teo et al., 1989) or burning of crop residues (Hind-Lanoiselet et al.,

2005). However, the persistent nature of sclerotia and lack of strain specificity in regard

to pathogenicity on various hosts, further limit the effectiveness of cultural practices

(William and Stelfox, 1980).

Biological control has also been explored as an alternative control measure strategy to

combat S. sclerotiorum. Several antagonistic and mycoparasitic fungi such as

Coniothyrium minitans, Trichoderma spp., Gliocladium spp., Sporidesmium

sclerotivorum, Cladosporium cladosporiodes and bacteria have been suggested as

potential bio-control agents (e.g., Adams and Ayers, 1979; Boland and Hunter, 1988;

Budge and Whipps, 1991; Huang et al., 2000; Jones et al., 2004). However, difficulties

associated with growing various mycoparasites in vitro such as those for S.

sclerotivorum (Del Rio et al., 2002), and requirement for large quantity of inoculum

under field conditions limit the use of biological control agents as an effective disease

control measure.

CHAPTER 1

6

1.1.4.1 Host resistance – an effective and sustainable measure of managing Sclerotinia

disease

Host resistance offers the best economic and sustainable method for effectively

managing this disease (Zhao et al., 2004; Li et al., 2006). Numerous studies with

different crop species indicate the presence of partial resistance against S. sclerotiorum,

while complete resistance against this pathogen has not been reported. For instance,

partial resistance against this pathogen has been observed in certain genotypes of

sunflower (Helianthus annuus) (Godoy et al., 2005), beans (Phaseolus coccineus)

(Gilmore et al., 2002), peas (Pisum sativum) (Porter et al., 2009), peanut (Arachis

hypogea) (Cruickshank et al., 2002), and soybean (Glycine max) (Hartman et al., 2000).

Partial resistance was also identified in some Brassica napus and, to a lesser extent B.

juncea, genotypes from China (Li et al., 1999; Zhao et al., 2004; Li et al., 2006; Li et

al., 2008), Australia (Li et al., 2006; Li et al., 2008) and India (Singh et al., 2008). These

studies suggest that different crop species possess genes that can impart resistance to S.

sclerotiorum and hence there is an urgent need to screen more germplasm to enhance

the level of resistance against this disease in existing cultivars.

1.1.4.2 Potential to use wild germplasm to broaden the genetic base of resistance

against Sclerotinia disease

Potential of wild species as a source of resistance against various pathogens has long

been recognized (e.g., Knott and Dvorak, 1976; Doney and Witney, 1990). Lack of

complete resistance to Sclerotinia disease in cultivated species has also stimulated the

interest of researchers towards exploitation of wild relatives to diversify the existing

gene pool. Higher levels of resistance against Sclerotinia have already been reported in

the secondary gene pool of bean (Abawi et al., 1978; Gilmore et al., 2002; Schwartz et

al., 2006), wild Helianthus species (Seiler, 1992; Gulya et al., 2009) and in a Pisum core

collection (Porter et al., 2009). Several successful attempts have been reported to

introgress the resistance from the secondary gene pool of bean (Phaseolus vulgaris) into

the cultivated bean species through interspecific hybridization followed by backcrossing

(e.g., Schwartz et al., 2006; Singh et al., 2009). Introgression of genomic segments

responsible for resistance against Sclerotinia from wild to cultivated species of

sunflower has been attempted in the past (e.g., Ronicke et al., 2004; Feng et al., 2007).

CHAPTER 1

7

Despite the fact that the Brassicaceae family comprises a wide array of different

species, it is interesting that the only two wild crucifers, Erucastrum gallicum (Lefol et

al., 1997a; Seguin-Swartz et al., 1999) and, Capsella bursa-pastoris (Chen et al., 2007)

have been reported to show high levels of resistance against Sclerotinia. However, it

remains to be confirmed if the introgression of resistance against S. sclerotiorum from

E. gallicum into cultivated species was in fact been accomplished (Lefol et al., 1997a;

Lefol et al., 1997b; Seguin-Swartz and Lefol, 1999). Introgressive hybrids were

successfully obtained between different Brassica (B. rapa and B. napus) species and

Capsella bursa-pastoris (Chen et al., 2007), and there remains substantial potential to

identify other wild crucifers with high levels of resistance to Sclerotinia disease and for

its successful introgression to the cultivated species.

1.1.5 Screening techniques to identify resistant genotypes

Both field and controlled environment screening methods have been deployed in

various crop species to identify resistance against S. sclerotiorum. However, field

evaluation of Sclerotinia stem rot for selection of resistant cultivars often provides

highly variable results, as the responses of various genotypes are heavily dependent

upon the environment (Abawi and Grogan, 1979). Moreover, disease pressure may not

be uniform in field situations, which further complicates the phenotypic classification of

host genotypes. In addition, under field conditions, oilseed Brassica genotypes may

differ in their plant architecture and maturity, which frequently results in measuring of

disease escape rather than physiological resistance (Phillip et al., 1990). Even though

the stem inoculation method utilized by Buchwaldt et al. (2005) and Li et al. (2006) for

B. napus and Auclair et al. (2004a) for soybean is considered to be reliable, it still takes

considerable time, space and resources to evaluate large numbers of genotypes. In

contrast to field screening, resistance against S. sclerotiorum in greenhouse or

laboratory evaluation is more likely to be due solely to physiological resistance, with

little chance of involvement of disease escape mechanisms, as demonstrated previously

for soybean and/or other non-Brassica hosts by Grau and Bissonette (1974), Nelson et

al. (1991) and Vuong et al. (2004).

Various controlled environment screening methods have been used to evaluate

resistance in oilseed rape. These include cut petiole inoculation (Zhao et al., 2004;

CHAPTER 1

8

Bradley et al., 2006), detached leaf inoculation (Bailey, 1987; Bradley et al., 2006), and

an oxalic acid assay (Bradley et al., 2006). Although the petiole inoculation method

(Zhao et al., 2004; Bradley et al., 2006) has been reported to be a good method for

comparison of the level of resistance against S. sclerotiorum, there is not always a good

correlation with results obtained from field screening. For instance, Bradley et al.

(2006) reported that disease reaction of Brassica genotypes from a petiole inoculation

method were negatively correlated with yield (P = 0.038; r = - 0.58) and, results

obtained from detached leaf and oxalic acid tests were not correlated with the field

results. Moreover, inconsistent results have been reported across different test especially

with the genotypes having intermediate reactions to S. sclerotiorum. For example, Kim

et al. (2000) reported that resistance ratings for soybean cultivars having intermediate

reactions to S. sclerotiorum were inconsistent across different tests. Similarly, while Sun

(1995) reported consistent genotype performance for resistant and susceptible spring

type B. napus accessions, they found that accessions with intermediate ratings varied

depending upon the test method utilized. Even for soybean genotypes, only moderate

correlation values were reported between screening method using excised leaf

inoculations, detached leaf and oxalic acid assays and field reactions (Kim et al., 1999;

Wegulo et al., 1998). A brief summery of various green house screening methods that

have been utilized so far to identify resistance against S. sclerotiorum, are summarized

in Table 1.

CHAPTER 1

9

Table 1 An example of greenhouse/glasshouse screening methods deployed for various crop species to identify resistant reaction in response to S. sclerotiorum challenge.

S. No

Reference Technique Crops Methodology, Type of Inoculum

Gaps in the Knowledge/ Remark

Factor used: Leaf lesions 1 Bailey,1987;

Bradley et al., 2006; Kull et al., 2003; Li et al., 2005

Detached leaf assay

oilseed rape, soybean, dry bean

Mycelial plug from a 3 day old culture placed on the middle of detached leaf

Poor indicator of the field performance of the different genotypes

2 Leone and Tonneijck, 1990

Detached leaf assay

bean Ascosporic inoculum with KH2PO4 and glucose solution, Detached leaves from 21 days old cultivars inoculated with spore suspension

Not used with oilseed rape

3 Li et al., 2005 Leaves at seedling stage

oilseed rape (B. napus)

Seedlings inoculated with mycelial plug at five fully expanded leaf stage

5 Chen and Wang, 2005; Botha et al., 2009

Spray inoculation

soybean Homogenized mycelial suspension was evenly sprayed on the leaves of plants

6 Kull et al., 2003 Cotyledon inoculation method

soybean and dry bean

Cotyledon inoculation, 3 mm mycelial plug was placed on one cotyledon adjacent to stem

Not used with oilseed rape

Factor used: Stem lesions

7 Zhao et al., 2004; Hoffmann et al., 2002; Bradley et al., 2006

Petiole inoculation technique

oilseed rape, soybean

Petioles of the third fully expanded leaf were severed and placed into the agar plug colonized with the fungus

Possibility of measuring “Disease Escape “ as winter type brassicas showed more resistance as compared to spring type; mycelial plug was used

8 Vuong et al., 2004; Kull et al., 2003

Cut stem technique

soybean, sunflower, dry bean

Mycelial plug is placed on the main stem of plants severed with a razor blade on fourth or fifth node of 6-7 wk old seedling

More time and space is required, so it can’t be used for screening large number of genotypes

9 Bradley et al., 2006; Wegulo et al., 1998

Oxalic acid assay

oilseed rape, soybean

Seedlings at 3-4 leaf stage severed at bottom of the stem and placed in test tube having 5 ml of 40 mM oxalic acid

Method needs to be refined as no wilting or stem lesions were observed

Others 10 Whipps et al.,

2002 Soil-based screening method

lettuce Planting of seedling in potted soil infested with S. sclerotiorum

-

11. Madjid et al., 1983

lettuce Agar blocks colonized by Sclerotinia to infect lettuce plants

-

12. Block et al., 2009

Soil-based screening method

sunflower Soil with Sclerotinia-infested millet used as inoculum

CHAPTER 1

10

The above table indicates that there is a need to develop

1. A rapid greenhouse screening method for Brassica genotypes to facilitate large

scale rapid evaluation of germplasm similar to the cotyledon assay technique

deployed for soybean.

2. A glasshouse/greenhouse screening method for Brassica genotypes, the results

of which can be correlated with the field results.

3. A method that can give repeatable results across various screening tests. This

objective can possibly be achieved by defining the type and amount of inoculum

that suits these tests. It is also clear from the above table that in most cases

mycelial plugs were used as the inoculum base. Although use of mycelium as a

type of inoculum facilitates easy and fast screening, there are number of

problems associated with the use of mycelium plugs such as:

- the actual amount of hyphal inoculum used for screening can vary when

using colonized agar plugs as a food base.

- asynchronous initiation of lesion development can occur when colonized

agar plugs are used as an inoculum source (Chun et al., 1987).

1.1.6 Pathogenicity of S. sclerotiorum isolates

Although S. sclerotiorum is considered to exhibit little host specificity because it

releases various toxic compounds, considerable variation in both genetic diversity and

pathogenicity have been reported for this pathogen (e.g., Pratt and Rowe, 1991; Maltby

and Mihail, 1997; Hambleton et al., 2002; Kull et al., 2003; Auclair et al., 2004b;

Sexton et al., 2006). Similarly, numerous studies have also indicated that a single host

species may show considerable variation towards the different isolates of S.

sclerotiorum (e.g., Price and Colhoun, 1975; Kull et al., 2003; Otto-Hanson et al.,

2009). Literature indicates considerable contradiction not only in relation to the reaction

of genotypes towards different isolates of S. sclerotiorum, but also in relation to the

pathogenicity of several strains to a single host genotype. For instance, no significant

differences were reported in 35 North American isolates in relation to the

aggressiveness on potato (Atallah et al., 2004). In contrast, variation in virulence on

soybean among different isolates from North and South America was reported by Kull

et al. (2004). The observed differences could result from variation in screening method,

host genotypes, isolates or could also be because of different environmental conditions.

CHAPTER 1

11

These studies suggest that host genotypes should be tested across a range of S.

sclerotiorum isolates in order to identify the genotypes that show consistent resistance

responses, and for studies focused on host-pathogen interactions.

1.2 HOST-PATHOGEN INTERACTIONS

S. sclerotiorum is one of the most successful and lethal among destructive plant

pathogens. Even though a resistant genotype can be identified, there is always a

substantial risk of breakdown of resistance due to the development of new pathotypes,

especially because of the genetically diverse population that is known to exist for this

pathogen (e.g., Hambleton et al., 2002; Malvarez et al., 2007). A complex combination

of factors has been reported to determine the severity of disease caused by S.

sclerotiorum (e.g., Lumsden, 1979). These include the ability of this pathogen to

produce oxalic acid and various hydrolytic enzymes (e.g., Lumsden, 1979; Godoy et al.,

1990; Li et al., 2004a), which helps infection so rapidly that it does not give adequate

time for the host plant to fully engage the defence responses. So, it is imperative to

understand the host-pathogen interaction at cellular, biochemical or molecular levels to

determine effective mechanism(s) of resistance in order to develop more durable

resistance or to design effective integrated disease management measures (Lumsden,

1979). The following sections include some of the examples for studies undertaken at

cellular, biochemical and molecular levels against S. sclerotiorum in order to understand

the host-pathogen interactions and also to identify various gaps in knowledge that needs

to be addressed in order to enhance our understanding of mechanism of resistance

against this pathogen.

1.2.1 Host-pathogens interactions at the cellular level

Understanding of host-pathogen interactions at the cellular level is the first key step for

the identification of biochemical basis of resistance. Although, numerous studies report

the host-pathogen interactions at cellular level in compatible interaction, infection

processes associated with the disease resistant genotypes against S. sclerotiorum are

poorly characterised. A summary of some of the research undertaken to understand

host-pathogen interaction at cellular level is described in the following section.

CHAPTER 1

12

1.2.1.1 Host-pathogen interactions at the cellular level in compatible interaction

The pathogen-suscept relationship of S. sclerotiorum has been much studied since the

pioneering work of deBary (1886, 1887), when he first investigated the infection

process of this fungus. He observed the formation of appressoria from germinating

ascospores, and penetration dependence of the mycelium on nutrient status of the

inoculum. Subsequent studies undertaken with bean (Lumsden and Dow, 1971;

Lumsden and Dow, 1973; Abawi et al., 1975; Lumsden and Wergin, 1980; Sutton and

Deverall, 1983; Tariq and Jeffries, 1986), soybean (Sutton and Deverall, 1983), lettuce

(Tariq and Jeffries, 1984; Purdy, 1958), tomato (Purdy and Bardin, 1953; Purdy, 1958),

potato (Jones, 1976), pea (Huang and Kokko, 1992), sunflower (Sedun and Brown,

1987) as well as canola (Tariq and Jeffries, 1984; Jamaux and Spire, 1994; Jamaux et

al., 1995; Huang et al., 2008) investigated the detailed phases of the infection processes

in compatible interactions. These studies confirmed that an appropriate nutrient

substrate such as flower petals, injured or senescent plant tissue is required by the

germinating ascospores, both to establish a saprophytic phase, and for preparation

necessary for successful infection of healthy plants. Based on these observations,

different researchers either have used ascospores superimposed on flower petals or

colonized agar plugs as a nutrient source to investigate the infection processes of this

pathogen in various crops (Lumsden and Dow, 1973; Jones, 1976; Lumsden and

Wergin, 1980).

1.2.1.2 Host-pathogen interactions at the cellular level in incompatible interaction

In spite of a plethora of reports on the infection process of S. sclerotiorum in compatible

interactions, very few studies to date have addressed the interaction of the pathogen

associated with a resistant genotype at cellular or histological levels. These include

mainly those of Dow and Lumsden (1975) with bean (P. coccineus), of Rodriguez et al.

(2004) and Mondolot-Cosson and Andary (1994) with sunflower (Helianthus annus)

genotypes. Dow and Lumsden (1975) working with disease resistant tissues of P.

coccineus reported several stages of the infection process that were strikingly different

from those of the susceptible P. vulgaris genotype such as, penetration of the cuticle of

the resistant genotype was often impeded, secondary infection cushions developed

mainly under the cuticle and adjacent to the epidermis, and growth of the infection

hyphae (large diameter hyhae that move rapidly beneath the cuticle or intercellularly in

CHAPTER 1

13

the cortex of the susceptible genotype) were often smaller, distorted and restricted to the

cortex region instead of being subcuticular. Similarly, anatomical investigations by

Rodriguez et al. (2004) of sunflower showed cell collapse, changes in cell wall

composition and increase in phenolics compounds compared to the susceptible

genotype. Pre-existent histological structure such as cortical sclerified fiber cells, and

induced caffeoylquinic compounds, are considered to be responsible for the

incompatible interaction in a wild species of sunflower (Helianthus resinosus)

(Mondolot-Cosson and Andry, 1994). However, no attempt has been made with

Brassica genotypes resistant to S. sclerotiorum, to date.

1.2.2 Host-pathogen interactions at the biochemical or molecular level

Defence responses of various host species in response to infection by S. sclerotiorum is

poorly characterized at the molecular level, despite a number of the studies that have

focused on identifying various virulent factors released by S. sclerotiorum.

Investigations at the biochemical or molecular level to understand the mechanism of

resistance against S. sclerotiorum thus becomes immensely important in order to

develop effective disease control measures. Differentially expressed genes in response

to the pathogen challenge will not only provide information on the physiological or

molecular basis of resistance, but it may also lead to the strategic engineering of

effective resistance against this pathogen (Calla et al., 2009). Further, it can also help in

the identification of candidate genes for QTL mapping or development of molecular

marker linked to disease resistance. A brief account of the various virulent factors such

as the role of oxalic acid and various cell wall degrading enzymes, and associated

strategies employed to understand/engineer the defence responses against them is

presented in the following section.

1.2.2.1 Role of Oxalic acid

Several studies demonstrate the role of oxalic acid produced by S. sclerotiorum as an

essential determinant of pathogenicity (e.g., Lumsden, 1979; Margo et al., 1984 Godoy

et al., 1990). It has been suggested that oxalic acid released by this pathogen and other

fungi such as Sclerotium rolfsii cause tissue destruction by mainly three mechanisms; 1)

it reduces the pH of the infected tissue which favours the activity of several fungal

enzymes secreted during the invasion of host tissue (e.g., Marciano et al., 1983; Cessna

CHAPTER 1

14

et al., 2000); 2) it sequesters calcium from the cell walls of the plant tissue to form

calcium oxalate, before the middle lamella can be enzymatically degraded (e.g., Punja et

al., 1985; Thompson et al., 1995; Smith et al., 1986); and (3) it can be directly toxic to

the host genotype mainly because of its acidic properties, which can weaken the plant

tissues and facilitate invasion by S. sclerotiorum (Noyes and Hancock, 1981). Oxalic

acid is also shown to suppress the oxidative burst (Cessna et al., 2000), to impact guard

cell function (Guimaraes and Stotz, 2004), and to induce plant programmed cell death

that can assist the pathogen during disease development (Kim et al., 2008). A number of

studies thus have focused on understanding the mechanism of resistance of the host

plant or to engineer resistance in host tissue against oxalic acid. For instance, many crop

species such as Glycine max (Donaldson et al., 2001), Helianthus annus (Hu et al.,

2003), Nicotiana sp. (Walz et al., 2008) and B. napus (Thompson et al., 1995; Dong et

al., 2008) have been engineered to over express the oxalate oxidase gene (that is

responsible for oxidation of oxalic acid to CO2 and H2O2) in order to enhance the

tolerance against oxalic acid. More recently, a proteomic approach has also been

utilized by Liang et al. (2009) to identify the stress responses of B. napus genotypes to

oxalic acid secreted during the infection of S. sclerotiorum.

1.2.2.2 Cell wall degrading enzymes

S. sclerotiorum produces a wide array of cell wall degrading enzymes such as

pectinolytic, cellulolytic and proteolytic enzymes with different substrate specificity,

which facilitates colonization by the pathogen of the host tissue (e.g., Lumsden, 1976;

Riou et al., 1991; Poussereau et al., 2001; Li et al., 2004a). Of these pectinolytic

enzymes various isoforms of polygalacturonase (PG) that differ in their pIs and catalytic

properties and are sequentially secreted by S. sclerotiorum during its saprophytic as well

as pathogenic growth, have received much attention (e.g., Martel et al., 1998; Cotton et

al. 2003; Li et al., 2004b). A number of studies thus have focused towards cloning and

characterization of both endo- and exo PGs secreted by S. sclerotiorum (e.g., Waksman

et al., 1991; Li et al., 2004a; Favaron et al., 2004). To counteract the fungal PG activity,

plants are known to synthesize a class of cell wall associated proteins called

polygalacturonase inhibitory proteins (PGIPs) (De Lorenzo and Ferrari, 2002). PGIPs

are reported in a variety of dicotyledonous plants and in the pectin-rich monocotyledon

plants and comprise an important component of the plant defence system (De Lorenzo

CHAPTER 1

15

et al., 2001). For instance, Favaron et al. (1994, 2004) demonstrated that PGIPs isolated

from soybean display differential and inhibitory activity towards endoPGs secreted by

S. sclerotiorum. Moreover, P. vulgaris PGIP was also shown to prevent programmed

cell death, which was induced by S. sclerotiorum endoPGs (Zuppini et al., 2005).

Recently, PGIPs have also been characterized in the B. napus genome that were

differentially expressed in response to S. sclerotiorum infection, wounding and defence

hormone treatment (Hegedus et al., 2008). In addition to cell wall degrading enzymes,

other enzymes such as brassinin glucosyltransferase (that can detoxify phytoalexins)

released by the fungus to counteract the plant defence mechanism (Sexton et al., 2009)

or the genes encoding necrosis and ethylene-inducing peptides from this pathogen

responsible for cell death have also been reported (Bashi et al., 2010).

1.2.2.3 Various genomic approaches deployed to identify mechanism of resistance

against S. sclerotiorum

A few genomic based approaches/studies have been deployed for detailed investigations

of changes in gene expression profiles mediating the host responses to infection by S.

sclerotiorum. These include a study by Li et al. (2004), where more than 2232

expressed sequence tags (ESTs) were generated from two cDNA libraries of fungal

genes expressed during mycelial growth in a pectin medium or from infected tissues of

B. napus stems, identifying a number of genes associated with fungal pathogenesis.

Subsequently, four main studies based on different microarray platforms were

conducted to investigate the B. napus responses to S. sclerotiorum. Of these, three were

focused on the molecular basis of defence where gene expression changes associated

with S. sclerotiorum infection in a partially resistant and a susceptible genotype of

oilseed B. napus were investigated using either a cDNA microarray (Liu et al., 2005) or

a oligonucleotide platform (Zhao et al., 2007, 2009). Yang et al. (2007) investigated

genes responsible for mediating plant responses to the pathogen by comparing the leaf

tissues of a inoculated vs. non-inoculated susceptible B. napus genotype. Microarray

screening has also been conducted in a partially resistant and a susceptible genotype of

soybean to identify genes responsible for defence responses against S. sclerotiorum

(Calla et al., 2009). More recently, quantitative RT-PCR approach was utilized by Yang

et al. (2009) to examine the expression of five orthologs of B. napus genes involved in

defence signaling pathway in response to S. sclerotiorum challenge.

CHAPTER 1

16

1.2.2.4 Proteomic approach to define resistance mechanisms

Proteomic analysis is considered to be a powerful tool to study plant-pathogen

interaction such as those involving 2-DE techniques by which differentially expressed

proteins induced in response to the pathogen challenge or in various biotic and abiotic

stress conditions can be identified (Colditz et al., 2007; Sharma et al., 2008). This

technique is a valuable complement for investigations into plant-pathogen interactions

at the molecular level especially because it provides the continuity between genome

sequence information and the protein profile, which in turn gives an indication of the

possible biochemical pathways (Mehta et al., 2008). A poor correlation between mRNA

transcript level and protein abundance reported in different studies further necessitates

the use of such genomic approaches (Gygi et al., 1999; Carpentier et al., 2008),

especially in the B. napus-S. sclerotiorum pathosystem where defence mechanisms are

poorly understood.

It is interesting that most of the information in relation to molecular events occurring in

the incompatible interaction in the B. napus-S. sclerotiorum pathosystem has come

predominantly from the microarray analysis. However, protein profiles of compatible

interaction of B. napus-S. sclerotiorum has already been explored and several proteins

such as those related to photosynthesis and metabolic pathways, protein folding and

modifications, hormone signaling, and antioxidant defence were identified (Liang et al.,

2008). Similarly, proteomic approach has also been utilized to identify the responses of

a B. napus genotype in response to oxalic acid (Liang et al., 2009), as well as of fungal

mycelia of S. sclerotiorum and its secretome (Yajima and Kav, 2006). However, there is

no such study in which a proteomic approach has been deployed for the incompatible

interactions of S. sclerotiorum with any resistant Brassica host. Utilization of such

approaches in incompatible interaction of B. napus and S. sclerotiorum system will

provide the information on mechanisms of resistance at both biochemical and molecular

levels, and subsequently assists with developing durable resistance against this

pathogen.

More detailed review of the literature relevant directly to this thesis is included in the

Introduction and Discussion sections of the chapters to follow.

CHAPTER 1

17

1.3 GAPS IN KNOWLEDGE

� Relating to lack of adequate and durable resistance

• Lack of a rapid and reliable method of screening in B. napus genotypes

against S. sclerotiorum that correlates with the field results.

• Inadequate sources of resistance among B. napus genotypes in current

commercial oilseed cultivars.

• Only two wild crucifers have been reported having resistance against S.

sclerotiorum, despite the existence of a wide array of germplasm in

Brassicaceae.

� Relating to poorly characterized resistance mechanisms in B. napus genotypes

against S. sclerotiorum

• No studies to date have been undertaken to define in detail the infection

processes of S. sclerotiorum in disease resistant tissues of B. napus.

• No proteomic approach has been utilized to identify the mechanisms of

resistance in B. napus genotypes against S. sclerotiorum to date

1.4 RESEARCH QUESTIONS

The overall aim of this thesis was to identify sources of resistance and to understand the

mechanisms of resistance in B. napus against S. sclerotiorum. To address this, specific

aims of the thesis were focused upon the following detailed questions:

� Identification of sources of resistance

• Can a rapid and reliable method be designed for genotypes of Brassica

spp. that can identify resistance responses against S. sclerotiorum? What

could be the type and quantity of inoculum or stage of inoculation that

can lead to the development of a suitable technique? Will a new

greenhouse method correlate to the reactions of Brassica spp. under field

conditions? Is there any source(s) of resistance within the cultivated

CHAPTER 1

18

species of B. napus against S. sclerotiorum and can that be identified

using the new method developed?

• Will the new sources of resistance (to be identified) give consistent

responses across the range of S. sclerotiorum isolates?

� To understand the mechanism of resistance

• What are the anatomical changes in inoculated tissues associated with

symptom expressions and suppressions in resistant vs. susceptible

genotypes infected with S. sclerotiorum?

- What are the infection processes that are affected in a disease

resistant genotype when ascospores are used as inoculum

sources (the inoculum by which various stages of infection

and expression of host resistance can be finely monitored)

- What are the infection processes that are affected in disease

resistant genotype when macerated mycelium will be used as

an inoculum source? Will the infection processes following

inoculation with ascospores be the same as when macerated

mycelium is used as the source of inoculum?

• What are the different kinds of proteins that can mediate resistance

responses in a B. napus genotype in responses to a challenge from S.

sclerotiorum?

� Can wild Brassica species provide a better sources of resistance against S.

sclerotiorum or can wild species broaden the existing genetic pool of sources of

resistance against S. sclerotiorum.

1.5 THESIS STRUCTURE

This thesis is in accordance with the postgraduate and research scholarship regulation

1.3.1.33(1) of the University of Western Australia, and is presented as a series of

scientific papers with a combination of manuscripts that have either been published or

submitted for publication. The eight main chapters of the thesis consist of an

introductory account and background of the research (Chapter 1), followed by six

CHAPTER 1

19

chapters, which are in the format of the six scientific papers (Chapter 2-7) and lastly a

general discussion chapter (Chapter 8) that concludes the thesis. Chapter 2 and 3 are

related to the one research question viz. identification of resistant genotype in B. napus

in response to S. sclerotiorum infection. Similarly, chapter 4, 5 and 6 share the objective

of defining the mechanism of resistance in B. napus genotypes in response to S.

sclerotiorum infection. However, chapter 7 extends the overall horizon of this study to

wild crucifers to identify high levels of resistance against this pathogen. The first

research question makes the foundation for the second research question in terms of

identifying a resistant genotype first, so that the studies related to the mechanisms of

resistance can be conducted. These six chapters can be read either as a part of the whole

thesis, or as separate entities. Each of these chapters contains an independent

Introduction, Literature Review, Methods, Results and Discussion sections and

therefore some overlap, especially in the methodology section of chapter 2 and 3 or 5

and 6 is unavoidable as they are based on closely related research questions. A brief

account of each chapter is outlined below:

Chapter 1: The first chapter includes the introduction to the topic, scope and purpose of

the research, and a brief review of the work that has already been undertaken in this

direction. This chapter focuses on identifying gaps in the existing knowledge and set out

the fundamental research questions to be addressed in the thesis.

Chapter 2: The second chapter presents, for the first time, the development of a

cotyledon assay as a rapid and reliable screening method to screen B. napus genotypes

against S. sclerotiorum. Type and amount of inoculum that can reliably differentiate B.

napus genotypes are defined. This assay was also shown to provide a relatively reliable

indication of field performance of the B. napus genotypes. A set of B. napus germplasm

was screened with this method and reactions of these genotypes in relation to S.

sclerotiorum infection were identified. The basic approach of this chapter was to

develop a rapid and reliable method that can identify resistant genotype, which

addresses the first research question of this thesis.

Chapter 3: This chapter evaluates the pathogenicity of morphologically different

isolates of S. sclerotiorum with the selected genotypes of B. napus (Chapter 2) in

CHAPTER 1

20

addition to the previously field evaluated B. juncea genotypes. The chapter presents for

the first time the identification of darkly pigmented colonies of S. sclerotiorum in

Australia. The basic aim of this chapter is to identify a B. napus genotype with

consistent resistant responses across a range of S. sclerotiorum isolates (as a

considerable variation of this pathogen has been reported under field conditions). A

genotype with consistent resistant responses (in addition to susceptible genotype as a

control comparison) identified in this study was used to address the next research

question of this thesis i.e. to define the mechanism of resistance in B. napus in response

to S. sclerotiorum infection.

Chapter 4: The focus of the second research question is to understand mechanisms of

resistance in the selected B. napus genotype in response to S. sclerotiorum infection.

The basic aim of the work reported in this chapter was thus to produce ascospores

(which are responsible for primary infection under natural conditions), to monitor

various stages of infection processes of this pathogen (with an appropriate type and

amount of a nutrient base) with this inoculum source. This chapter focuses on

evaluating a set of various environmental factors/conditioning treatments that can

enhance carpogenic germination of S. sclerotiorum. A reliable method for carpogenic

germination of sclerotia of S. sclerotiorum was identified.

Chapter 5: This chapter focuses on understanding of mechanism of resistance at the

histological level, in a resistant B. napus genotype (identified in chapter 3) by using

ascosporic inoculum (Chapter 4). This chapter details for the first time the infection

processes of S. sclerotiorum that are affected in cotyledon tissue of the resistant B.

napus genotype. Various resistance mechanisms that confer the retardation of

development of this pathogen within a B. napus cv. Charlton were identified and

discussed.

Chapter 6: The aim of the studies reported in this chapter was also to understand the

mechanism of resistance, but mainly at a biochemical level. A comparative proteomic

approach was utilized by which differentially expressed proteins associated with

incompatible and compatible interactions of the B. napus-S. sclerotiorum pathosystem

were identified. The screening method developed in chapter 2, and resistant and

CHAPTER 1

21

susceptible genotypes of B. napus identified in chapter 3 were used to conduct this

study. Details of infection processes of S. sclerotiorum on the same resistant and the

susceptible genotypes with the same screening method (mycelial inoculum source) were

included to relate them to the changes in the proteins observed. This study presents for

the first time various proteins that can mediate resistance responses in a selected B.

napus genotype.

Chapter 7: This chapter reports for the first time the high level of resistance to S.

sclerotiorum in introgression lines derived from hybridization between wild crucifers

and the crop Brassica species B. napus and B. juncea. The aim of this chapter was to

again extend the first research question (i.e. identification of resistant genotype) with a

focus on wild Brassica species in order to evaluate whether the wild Brassica species

provide a better source of resistance against S. sclerotiorum.

Chapter 8: The final chapter includes a brief summary of the results and overall

discussion of the issues raised in the thesis with some concluding remarks. This chapter

also highlights the further work that can be undertaken in Sclerotinia research, as a

result of this thesis.

CHAPTER 2

22

CHAPTER 2 Cotyledon Assay as a Rapid and Reliable Method of Screening for Resistance against Sclerotinia sclerotiorum in Brassica napus Genotypes

2.1 ABSTRACT

Sclerotinia sclerotiorum is a major pathogen of many crops, including oilseed rape

(Brassica napus), and there is keen interest worldwide to identify Brassica genotypes

with resistance to this pathogen. However, field testing to identify resistance in B. napus

germplasm is expensive, time consuming and at times unreliable due to variability in

field environmental conditions and plant architecture. To address this, the feasibility of

utilizing a cotyledon test already developed for Sclerotinia disease on legumes was

examined for B. napus. Initially, cotyledons of 32 B. napus genotypes were drop-

inoculated using macerated mycelium (1 x 104 mycelial fragments mL-1) under

controlled environmental conditions. Significant differences were recorded between B.

napus genotypes, and the experiment was repeated twice using genotypes selected from

the first experiment. Certain genotypes responded with a distinct hypersensitive reaction

(lesions <1 mm diameter), either always (cv. Mystic) or frequently (cv. Charlton),

which is the first report for this phenomenon in the B. napus-S. sclerotiorum

pathosystem. Responses of genotypes between the three screening experiments were

significantly and positively correlated. Results obtained in the first experiment were

compared with those from the earlier field screening for stem rot that utilized the same

strain of S. sclerotiorum and the same B. napus genotypes. In particular, there was a

significant positive correlation (r = 0.62, P < 0.01) between published field data for

stem rot with the cotyledon test results across genotypes in common. This indicates the

usefulness of this cotyledon assay to provide a relatively reliable indication of field

performance of genotypes. This is the first report demonstrating that a cotyledon assay

can be successfully applied to rapidly differentiate the reactions of B. napus genotypes

against S. sclerotiorum.

CHAPTER 2

23

2.2 INTRODUCTION

Sclerotinia stem rot, caused by the fungus Sclerotinia sclerotiorum is one of the most

serious and damaging diseases of oilseed rape (Brassica napus) (McCartney et al.,

1999) and yield losses as high as 24% have been recorded under Australian conditions

(Hind- Lanoiselet, 2004). Various methods used for managing S. sclerotiorum include

cultural control, chemical control and varietal resistance (Bardin and Huang, 2001).

Chemical control in managing this disease is often ineffective, largely due to difficulty

in timing the application with the release of ascospores (Bolton et al., 2006), especially

in Australia where petal infection can be a poor indicator of subsequent stem infection

levels (Hind et al., 2003). Cultural practices tend to avoid or reduce the severity of

Sclerotinia stem rot, but none effectively controls S. sclerotiorum on its own. Selection

of host resistance is the only economic and sustainable means of managing this disease

(Zhao et al., 2004). However, host resistance works best when used in conjunction with

cultural practices: (i) practices involving crop rotation (Williams and Stelfox, 1980); (ii)

practices that increase row spacing and decrease seeding rate (Hoes and Huang, 1975);

and (iii) practices that discourage apothecial production and ascospore release, such as

maintaining high irrigation to increase rotting of sclerotia (Teo et al., 1989) or burning

of crop residues (Hind-Lanoiselet et al., 2005).

Field evaluation of Sclerotinia stem rot for selection of resistant cultivars often provides

highly variable results as the responses of various genotypes are heavily dependent upon

the environment (Abawi and Grogan, 1979). Moreover, disease pressure may not be

uniform in field situations, which further complicates the phenotypic classification of

host genotypes. In addition, under field conditions oilseed Brassica genotypes may

differ in their plant architecture and maturity, which frequently results in measuring

disease escape rather than physiological resistance in field screening experiments

(Phillip et al., 1990). In contrast to field screening, resistance against S. sclerotiorum in

greenhouse or laboratory evaluation is more likely to be due solely to physiological

resistance, with little chance of involvement of disease escape mechanisms, as

demonstrated previously for soybean and/or other non-Brassica hosts by Grau and

Bissonette (1974), Nelson et al. (1991) and Vuong et al. (2004).

CHAPTER 2

24

Various controlled environment screening methods have been used to evaluate

resistance in oilseed rape. These include cut petiole inoculation (Zhao et al., 2004;

Bradley et al., 2006), detached leaf inoculation (Bailey, 1987; Bradley et al., 2006), and

an oxalic acid assay (Bradley et al., 2006). Although the petiole inoculation method

(Zhao et al., 2004; Bradley et al., 2006) has been reported to be a good method to use to

compare the level of resistance against S. sclerotiorum, there is not always a good

correlation with results obtained from field screening. For example, Kim et al. (2000)

reported that resistance ratings for soybean cultivars having intermediate reactions to S.

sclerotiorum were inconsistent across different tests. Similarly, while Sun (1995)

reported consistent genotype performance for resistant and susceptible spring type B.

napus accessions, they found that accessions with intermediate ratings varied depending

upon the test method utilized. While Bradley et al. (2006) reported that disease reaction

of Brassica genotypes from a petiole inoculation method were negatively correlated

with yield (P = 0.038; r = - 0.58), results obtained from detached leaf and oxalic acid

tests were not correlated with field results. Even for soybean genotypes, only moderate

correlation values were reported between screening method using excised leaf

inoculations, detached leaf and oxalic acid assays and field reactions (Kim et al., 1999;

Wegulo et al., 1998).

A cotyledon test has been used by some researchers to identify resistance to S.

sclerotiorum in genotypes of soybean (e.g., Grau and Bissonette, 1974; Hartman et al.,

2000; Kim et al., 2000; Kull et al., 2003) and alfalfa (Pratt and Rowe, 1998). Kim et al.

(2000) reported that responses in greenhouse experiments to agar plugs or oat seed

infested with the mycelium applied onto cotyledons were correlated with field screening

results for soybean. Clearly, there is potential to develop a cotyledon test method for B.

napus genotypes, which can also address many of the constraints listed above.

Furthermore, a more reliable screening technique for B. napus-S. sclerotiorum

pathosystem is needed which can rapidly predict the responses of genotypes in field

while producing consistent results across repeated experiments. To address these

concerns, the feasibility of utilizing a cotyledon test to predict the field reaction of B.

napus genotypes against S. sclerotiorum was examined.

CHAPTER 2

25

2.3 MATERIALS AND METHODS

2.3.1 S. sclerotiorum isolate

A single isolate of S. sclerotiorum (MBRS1; University of Western Australia Culture

Collection Number WUF2004.1) was used. This isolate was collected from Mount

Barker Research Station in Western Australia (WA) in 2004 and this same isolate had

been used previously by Li et al. (2006) to evaluate responses of B. napus and B. juncea

genotypes to S. sclerotiorum in the field in WA. This isolate was selected on the basis of

its virulence and the fact that it was isolate from a site where there was significant

disease.

2.3.2 Test conditions

All screening test lines were on B. napus genotypes grown in 13.7 x 6.6 x 4.9 cm trays,

each having eight cells and containing a soil-less compost mixture. Groups of four trays

were placed in 10 L plastic storage boxes (34 x 13 x 23 cm). Three seeds of each

genotype were sown in each cell and thinned to a single seedling per cell after

emergence. A complete randomized block design was utilized with four replications and

two plants per genotype per replication. All experiments were conducted under

controlled environment growth room conditions of 18 ± 1oC during the day and 14 ±

1oC at night (12 hours light/dark cycles), with light intensity of 150 µE m–2 s–2.

Seedlings were grown until cotyledons were fully expanded, equivalent to growth stage

1.00 on the scale given by Sylvester-Bradley and Makepeace (1984).

2.3.3 Genotypes tested

Three separate experiments were conducted using the cotyledon inoculation method. In

experiment 1, 11 B. napus genotypes from China and 21 B. napus genotypes from

Australia, as listed in Table 1, were tested to represent various levels of resistance or

susceptibility identified by Li et al. (2006). Seed was obtained from Australia and China

through an Australian Centre for International Agricultural Research (ACIAR)

collaborative program. Twelve of these same genotypes were selected on the basis of

performance in experiment 1 for use in experiment 2, with the genotypes ranging from

most resistant to most susceptible to the disease, and retested in experiment 2 to confirm

the results of experiment 1. In experiment 3, six of the same genotypes from

CHAPTER 2

26

experiments 1 and 2 were further selected on the basis of performance in experiments 1

and 2 in order to confirm the reliability of the genotype responses to S. sclerotiorum.

2.3.4 Inoculum production

A single sclerotium of S. sclerotiorum isolate MBRS1 was surface sterilized in 1% v/v

sodium hypochlorite and 70% ethanol for 4 min followed by two washes in sterile

distilled water for 1 min as described by Clarkson et al. (2003). The sclerotium was cut

in half and placed on Potato Dextrose Agar (PDA). S. sclerotiorum was sub-cultured

and maintained in an incubator at 20oC on PDA. Seven agar plug discs (each 5 mm2

diam) were cut from the actively growing margin of a 3 day-old colony and transferred

to a 250 mL flask containing 75 mL of sterilized liquid media (Potato Dextrose Broth

24 g, Peptone 10 g, H2O 1 L ). Flasks were rotated on an Innova 2300 platform shaker

(New Brunswick Scientific, Edison, NJ) at 120 rpm/min. After 3 days, colonies of S.

sclerotiorum were harvested and washed twice with sterilized deionised water. The

fungal mats obtained were transferred to approximately 125 mL of the same liquid

medium and mycelia macerated in a Breville® food grinder for 3 min. The macerated

mycelial suspension was then filtered through 4 layers of cheese cloth and the

concentration was adjusted to 104 fragments mL-1 using a haemocytometer

(SUPERIOR®, Berlin, Germany) with the same liquid media.

2.3.5 Inoculations

Inoculations were carried out when cotyledons were 10-days old. A total of four

droplets of mycelial suspension of 10 µl were deposited on every seedling using a

micro-pipette, with a single drop on each cotyledon lobe. While inoculating, the

mycelial suspension was shaken regularly to maintain the homogenous mixture of

mycelial suspension. A 2.5 cm deep layer of water was added at the bottom of the boxes

to help maintain a high level of humidity. In addition, a very fine mist of water was

sprayed both over cotyledons and on the inside of the container lids. Together, these

procedures allowed maintenance of a relative humidity level of at ca. 100% within the

boxes. Following inoculation, the boxes were placed under the benches in the controlled

environment room and maintained at a low light intensity of approximately 13 µE m–2

s–1 for 4 days up to time of disease assessment.

CHAPTER 2

27

2.3.6 Disease assessment

Typical hypersensitive and/or necrotic and water soaked lesions were apparent by 1-2

days post-inoculation (dpi). At 4 dpi, box covers were removed and lesions assessed on

the basis of lesion diameter (mm). All lesion diameters were measured using a linear

ruler.

2.3.7 Data analyses

Verification of various assumptions of normality and homogeneity of variance required

for parametric analyses (before the actual analysis was carried out), and analysis of

lesion rating data from experiment 1 (single factor analysis of variance) were performed

using GENSTAT (9th edition, Lawes Agricultural Trust). Fishers least significant

differences (l.s.d) at P = 0.05 significant level was used to calculate the differences

between the genotypes. Regression analysis was undertaken using GENSTAT to

determine the relationship between the cotyledon responses obtained with the stem

lesion lengths with those found for the same genotypes when tested earlier by Li et al.

(2006) under WA field conditions. The relationships between experiments 1, 2 and 3

were assessed by computing correlation coefficients using the data analysis function in

Microsoft Excel.

2.4 RESULTS

2.4.1 Experiments 1, 2 and 3

Experiment 1 was the initial screening of 32 genotypes, experiment 2 was a

confirmation test of experiment 1 on selecting 12 of these genotypes, while experiment

3 was again a confirmation trial but restricted to six genotypes. Typical necrotic and/or

water-soaked lesions appeared on cotyledons of susceptible genotypes inoculated with

S. sclerotiorum (Fig. 1). The type, size and severity of lesions on cotyledons varied

between the genotypes, ranging from small necrotic hypersensitive lesions <1.6 mm, to

the other extreme where entire cotyledons collapsed and were covered with white

cottony mycelial growth. It is noteworthy that hypersensitive lesions <1 mm were

observed on genotypes Mystic and Charlton. There were significant differences (P ≤

0.001) between the different genotypes in relation to severity of cotyledon lesions by 4

dpi (Table 1). Genotypes Mystic and Charlton from Australia with mean lesion

CHAPTER 2

28

diameters ≤ 1.6 and Zhongyou-za No.8 and Ding 474 from China with mean lesion

diameters ≤ 3.8 were found to be most resistant. In contrast, Australian genotypes

TQ055-02W2, AV-Sapphire, Surpass 400, Rivette were found to be most susceptible.

All had mean lesion diameters ≥ 9.1. Generally, where lesions were in the 11-13 mm

diameter range the cotyledons totally collapsed from disease development.

Although there were small differences in lesion size on individual genotypes across the

different experiments, the relative rankings of genotypes were similar across the three

experiments, with Mystic and Charlton being the most resistant, AV-Sapphire and

Rivette very susceptible and RQ001-02M2 with an intermediate reaction (Table 2).

There was significant positive correlation between the cotyledon lesion diameter across

the genotypes between experiments 1 and 2 (r = 0.92; P < 0.001; n = 12); between

experiments 1 and 3 (r = 0.93; P < 0.001; n = 12); and between experiments 2 and 3 (r

= 0.96; P < 0.001; n = 6).

Figure 1 Typical hypersensitive (far right cotyledon) and/or necrotic and water soaked lesions of various diameters as assessed 4 days post-inoculation following inoculation of Brassica napus cotyledons with washed macerated mycelium of Sclerotinia sclerotiorum. The genotypes represented, in order from the left, are as follows: 1 = TQ055-02W2; 2 = Rivette; 3 = RR005; 4 = P617; 5 = Ding474; and 6 = Charlton

2.4.2 Correlation of experiment 1 cotyledon test results with field ratings of Li et al.

(2006)

There was significant positive correlation of genotype ratings of lesions on cotyledons

in experiment 1 (4 dpi) with stem lesion length in the previous field trial (3 weeks after

inoculation) published by Li et al. (2006) (r = 0.62; P < 0.001, n = 32) (Fig. 2). This

relationship accounted for approximately 38% of the total variation, it was noted that

the two most resistant genotypes identified in the cotyledon test both showed

intermediate reactions in the field stem test where there was no artificial control of

environmental conditions.

CHAPTER 2

29

Table 1 Reaction to Sclerotinia sclerotiorum of 32 Brassica napus genotypes from Australia and China in terms of stem lesion length 3 weeks after inoculation in field screening (data taken from Li et al., 2006) and in terms of the diameter of lesions 4 days after inoculation on the cotyledons in experiment 1 undertaken under controlled environment conditions.

Genotypes

Origin

Field stem test

Cotyledon test

Fan168 China 3.15 4.98

RR002 Australia 3.48 4.79 AG-Spectrum Australia 3.65 4.34 Oscar Australia 4.10 6.87 Lantern Australia 4.12 6.57 Fan 028 China 4.77 4.37 Zhongyou-za No.8 China 4.79 2.84 BST7-02M2 Australia 4.87 7.09 Zhongshu-ang N0.4 China 5.07 6.35 Ding474 China 5.25 2.81 Mystic Australia 5.53 0.58 RQ011 Australia 5.78 3.81 Charlton Australia 5.80 1.60 Ding110 China 5.89 3.78 P617 China 6.00 5.72 AG-Outback Australia 6.02 7.90 Fan 023 China 6.02 6.83 RR009 Australia 6.15 7.55 P3083 China 6.23 5.95 Yu 178 China 6.23 7.57 AV-Sapphire Australia 6.62 9.37 Surpass 400 Australia 6.65 9.13 Tranby Australia 6.8 7.96 Qu1104 China 6.93 7.02 Skipton Australia 7.10 8.40 Trigold Australia 7.18 7.10 Rainbow Australia 7.20 6.39 RR001 Australia 7.65 7.14 RR005 Australia 7.75 8.00 RQ001-02M2 Australia 8.69 8.31 TQ055-02W2 Australia 9.34 12.82 Rivette Significance l.s.d. (P < 0.05) =

Australia

10.39

9.63 P < 0.001 1.47

2.5 DISCUSSION

This is first report in which a cotyledon assay has been utilized to differentiate and

characterize the responses of any genotypes of Brassica species to S. sclerotiorum. The

varying lesion size on cotyledons between the different genotypes was found to be a

CHAPTER 2

30

reliable indicator of B. napus genotype resistance to S. sclerotiorum. The cotyledon

inoculation technique was successful in differentiating the reaction of the B. napus

genotypes against S. sclerotiorum. Typical necrotic and water soaked lesions appeared

on susceptible genotypes as early as 1-2 dpi. Some of the most susceptible genotypes

were covered with white mycelial growth by 4 dpi. More resistant genotypes showed a

small lesion confined to the size of the inoculum droplet. The most resistant genotypes

showed only very small necrotic flecks depicting a hypersensitive lesion that were also

always contained within the confines of the inoculated area. This is the first report of a

hypersensitive reaction in this B. napus-S. sclerotiorum pathosystem. The absence of a

hypersensitive reaction in the field, despite expression of resistance, may be due to

uncontrolled environmental conditions which may be more conducive for disease

development in the field.

The high degree of reliability of the cotyledon assay was evident from the high

correlation coefficient values between experiments 1, 2 and 3 (all with r > 0.90).

Although there were some small differences in absolute lesion sizes for one or more of

the same genotypes across different experiments, the overall relative rankings of the

genotypes against S. sclerotiorum showed similar trends with Mystic and Charlton

being the most resistant, AV-Sapphire and Rivette being very susceptible and RQ001-

02M2 having an intermediate reaction. Although genotypes with intermediate reactions

were difficult to characterize in some previous studies on soybean conducted by Kull et

al. (2003) and by Sun (1995), results in the present study showed that even genotypes

with intermediate reaction to S. sclerotiorum could readily and consistently be

characterized with the developed cotyledon assay. Moreover, even where cotyledon

assays had been utilized previously on other non-Brassica crops and compared with

other methods of assay, correlation between the cotyledon assay and other methods such

as the cut stem method for soybean (r = 0.54, P ≤ 0.05) and dry bean (r = 0.54, P ≤

0.05) were much less significant as compared with this study.

The cotyledon assay developed in the present study is an efficient, rapid and

inexpensive method of screening B. napus genotypes for resistance to S. sclerotiorum.

It takes only a total of 16 days to assess the responses of genotypes using this method

compared with up to 3-4 months when other methods such as the stem inoculation

CHAPTER 2

31

technique are utilized. Although there are detached leaf assays on B. napus that also are

rapid, these often have poor correlation with field performance of the same genotypes

(Bradley et al., 2006). It is apparent that a large number of B. napus genotypes can be

subjected to preliminary screening using the developed cotyledon method in this study

in a comparatively small time frame.

Table 2 Reaction to Sclerotinia sclerotiorum of 12 Brassica napus genotypes from Australia and China in terms of the diameter of lesions 4 days after inoculation on the cotyledons in experiments 1, 2 and 3 undertaken under controlled environment conditions.

Genotype

Expt 1

Expt 2

Expt 3

Fan168 4.98 5.65 -* AG-Spectrum 4.34 6.15 - Zhongyou-za No.8 2.84 4.87 - Mystic 0.58 1.54 3.36 Charlton 1.58 1.07 2.16 P617 5.72 7.00 5.71 P3083 5.95 7.54 - AV-Sapphire 9.37 9.90 10.36 Tranby 7.96 6.31 - RR005 8.00 9.03 - RQ001-02M2 8.31 7.34 6.33 Rivette Significance (P<) l.s.d. (P<0.05) =

9.63 0.001 1.47

9.68 0.001 1.93

10.34 0.001 2.55

* - = genotype not tested in this instance

It is noteworthy that genotype performance against S. sclerotiorum in the cotyledon

assay was significantly and positively correlated with stem lesion ratings from field

screening of the same genotypes. However, this relationship was not perfect, perhaps

due to that fact that field screening tests of oilseed Brassica genotypes can include

components of disease escape rather than physiological resistance (Phillips et al., 1990),

primarily due to differences between genotypes in plant architecture and maturity

(Phillips et al., 1990). This could also be related to the high variability associated with

the field screening test and differences in the anatomy of stem and cotyledon tissue.

Despite this imperfection, the commonality between the cotyledon and field tests that

was found in this study, confirmed the viability of utilizing the cotyledon method as a

reliable and rapid method for initial characterization of B. napus genotype responses to

CHAPTER 2

32

S. sclerotiorum. While Bradley et al. (2006) compared different controlled environment

screening methods with field test results and found that the petiole inoculation method

was significantly correlated with yield of B. napus cultivars, this is the first report in

which a cotyledon assay has been successfully utilized to differentiate B. napus

genotype responses to S. sclerotiorum in a similar way to that obtained for stem lesions

under field testing.

0

2

4

6

8

10

12

0 5 10 15

Lesion diameter (mm) in cotyledon test

Ste

m l

esio

n le

ng

th (c

m) i

n fi

eld

te

st

Figure 2 Relationship between stem lesion length (cm) caused by Sclerotinia sclerotiorum in the field with diameter of lesions (mm) on cotyledons in experiment 1. The stem lesion length was assessed 3 weeks after inoculation and this data taken from Li et al. (2006), while the lesion size on cotyledons was assessed 4 days after inoculation. Thirty two Brassica napus genotypes from Australia and China were investigated. y = 0.8848x – 2 x 10-14; (r = 0.61, P < 0.001, n = 32); R2 = 0.38

Many of the previous methods employed for screening genotypes for resistance to S.

sclerotiorum have utilized colonized agar plugs as the form of inoculum. However, use

of colonized agar plugs has limitations. For example, once mycelium is applied with an

appropriate source of energy (e.g., PDA), then the pathogen ramifies so rapidly that it

does not give adequate time for the host plant to fully engage defense responses, making

resistant genotypes difficult to distinguish. In addition, the actual amount of hyphal

inoculum used for screening can vary when using colonized agar plugs as a food base

and as a carrier of the pathogen. Additionally, asynchronous initiation of lesion

development can occur when colonized agar plugs are used as the inoculum source

(Chun et al. 1987). Although macerated mycelium of S. sclerotiorum has been used

CHAPTER 2

33

previously by others on non-cotyledon tissues [e.g., by Chen and Wang (2005) on

soybean], it was found that quantification of the mycelial suspension in the developed

cotyledon assay ensured uniform distribution of inoculum across test genotypes.

Moreover, in the cotyledon assay, any interference and/or variability in the genotype

responses from toxic metabolites released by S. sclerotiorum in liquid growth media

would have been reduced by the fact that the mycelial mats with deionised water were

washed before maceration, and then re-suspended in the liquid media.

In conclusion, cotyledon assay can be used to rapidly, reliably and cheaply characterize

B. napus genotype responses to S. sclerotiorum and the results suggest that the

technique could be useful across a wide diversity of germplasm. While the cotyledon

assay could best be utilized for initial screening of large genotype populations, the fact

that this assay relates well to results obtained with field screening, which indicates that

this assay can hasten the development of new B. napus cultivars with improved levels of

resistance against S. sclerotiorum. However, it still remains to be shown that this

technique will characterize genotype reactions against S. sclerotiorum in other

cultivated Brassica species, e.g., B. juncea, and in wild and/or weedy Brassica and

crucifer germplasm, which may have different sizes, types or shapes of cotyledons.

CHAPTER 3

34

CHAPTER 3 Pathogenicity of Morphologically Different Isolates of Sclerotinia sclerotiorum with Brassica napus and B. juncea Genotypes

3.1 ABSTRACT

Sclerotinia stem rot caused by Sclerotinia sclerotiorum is a serious threat to oilseed

production in Australia. Eight isolates of S. sclerotiorum were collected from Mount

Barker and Walkway regions of Western Australia in 2004. Comparisons of colony

characteristics on potato dextrose agar (PDA) as well as pathogenicity studies of these

isolates were conducted on selected genotypes of Brassica napus and B. juncea. Three

darkly pigmented isolates (WW-1, WW-2 and WW-4) were identified and this is the

first report of the occurrence of such isolates in Australia. There was, however, no

correlation between pigmentation or colony diameter on potato dextrose agar with the

pathogenicity of different isolates of this pathogen as measured by diameter of

cotyledon lesion on the host genotypes. Significant differences were observed between

different isolates (P ≤ 0.001) in two separate experiments in relation to pathogenicity.

Differences were also observed between the different Brassica genotypes (P ≤ 0.001) in

their responses to different isolates of S. sclerotiorum and there was also a significant

host x pathogen interaction (P ≤ 0.001) in both experiments. Responses between the two

experiments were significantly correlated in relation to diameter of cotyledon lesions

caused by selected isolates (r = 0.79; P < 0.001, n = 48). Responses of some genotypes

(e.g., cv. Charlton) were relatively consistent irrespective of the isolates of the pathogen

tested, whereas highly variable responses were observed in some other genotypes (e.g.,

Zhongyou-ang No. 4, Purler) against the same isolates. Results indicate that, ideally,

more than one S. sclerotiorum isolate should be included in any screening programme to

identify host resistance. Unique genotypes which show relatively consistent resistant

reaction (e.g., cv. Charlton) across different isolates are the best for commercial

exploitation of this resistance in oilseed Brassica breeding programmes.

CHAPTER 3

35

3.2 INTRODUCTION

Sclerotinia stem rot (SSR) caused by the ascomycete Sclerotinia sclerotiorum, is a

serious threat to oilseed rape production with substantial yield losses from this disease

recorded world-wide including Australia, Europe and North America (McCartney,

1999; Hind et al., 2003; Sprague and Stewart-Wade, 2002; Koch et al., 2007; Malvarez

et al., 2007). While, S. sclerotiorum is considered to exhibit little host specificity

(Purdy, 1979), it is important to understand the diversity of this pathogen for the

development of effective screening strategies to identify and deploy host resistance. The

diversity and pathogenicity studies of this pathogen have been investigated for different

crops in Canada and the United States (Auclair et al., 2004b; Pratt and Rowe, 1991;

Hambleton et al., 2002; Maltby and Mihail, 1997; Kull et al., 2003). Some past studies

have investigated the genetic diversity of the S. sclerotiorum, but genetic diversity was

not related to the pathogenicity of the pathogen in these studies (Kohn et al., 1991;

Kohli et al., 1992; Cubeta et al., 1997; Sun et al., 2005; Malvarez et al., 2007). Further,

only limited studies have been conducted so far, to understand the diversity and

pathogenicity of S. sclerotiorum on Brassica or other hosts in Australia. These include

the work of Sexton et al. (2006) who demonstrated genotypic diversity among S.

sclerotiorum isolates collected from oilseed rape crops from south east Australia,

utilizing microsatellite markers, and Ekins et al. (2007), who compared aggressiveness

of S. sclerotiorum isolates collected also from south east Australia on sunflower.

Differences in the morphology of S. sclerotiorum isolates have previously been

observed by Li et al. (2003) and Garrabrandt et al. (1983) where isolates producing tan

sclerotia were identified. Very few reports exist to date describing darkly pigmented

isolates of S. sclerotiorum, such as those from Canada and the south western region of

the United States of America (Lazarovits et al., 2000; Sanogo and Puppala, 2007).

Primarily, dark colour of the colonies results from the production of melanin, the main

role of which in this pathogen is to protect the sclerotia from adverse biological and

environmental conditions (Butler and Day 1998; Lazarovits et al., 2000). An association

of melanin with pathogenicity has also been reported in other pathogens. For example,

heavily-melanised variants of the ascomycete fungus Gaeumannomyces graminis var.

tritici are non-pathogenic (Goins et al., 2002), while Magnaporthe grisea and

Colletotrichum lagenarium require melanin for pathogenicity (Kubo et al., 2000).

CHAPTER 3

36

However, there are no reports of relationship between pigmentation and pathogenicity

in S. sclerotiorum. Furthermore, colony characteristics including radial growth rates of

isolates of S. sclerotiorum in vitro have been related to pathogenicity of this pathogen

under controlled environmental conditions. (e.g., Ziman et al., 1998; Durman et al.,

2003). However, no such studies have been undertaken with Australian isolates of S.

sclerotiorum.

For this study, isolates of S. sclerotiorum were obtained from the Mount Barker and

Walkaway regions of Western Australia in 2004 where significant losses from the

disease have been reported on B. napus. The aims of this study were firstly, to relate

colony characteristics to the pathogenicity for eight isolates of S. sclerotiorum from the

two different regions, and secondly, to evaluate the differences in their pathogenicity to

selected genotypes of B. napus and B. juncea, under controlled environmental

conditions.

3.3 MATERIALS AND METHODS

3.3.1 S. sclerotiorum isolates

Eight isolates of S. sclerotiorum were used to study isolate x cultivar interactions. Four

isolates (viz MBRS-1, MBRS-2, MBRS-3 and MBRS-5) collected from the Mount

Barker and four isolates (WW-1, WW-2, WW-3 and WW-4) from the Walkaway

regions of Western Australia in 2004 were used in this study. The initial cultures were

then sub-cultured on to water agar and stored at 4oC. All isolates were subsequently

sub-cultured to PDA as this medium allows the best expression of any pigmentation

occurring in S. sclerotiorum colonies (Lazarovits et al., 2000; Sanogo and Puppala,

2007).

3.3.2 Molecular identification of different isolates

Single nucleotide polymorphism (SNP) based diagnostics were conducted to identify

the eight strains of Sclerotinia isolated in the present study. SNP data from seven loci as

described by Carbone (2000) were analyzed to develop species-specific

oligonucleotides for identification among S. sclerotiorum, S. minor and S. trifoliorum.

Oligonucleotides using Primer 3 (Rozen and Skaletsky, 2000) were designed to

CHAPTER 3

37

hybridize to SNPs in regions that had high relative sequence similarity to ensure

hybridization across the board. In addition to the 8 isolates used in this study, two

confirmed isolates of S. sclerotiorum (1980, the genome sequence reference isolate

http://www.broad.mit.edu/annotation/genome/sclerotinia_sclerotiorum/Home.html and

LMK211), one of S. trifoliorum (LMK36) and one of S. minor (FA2-1) were also

included as positive controls, with an isolate of Botrytis cinerea (LMK 18) included as a

negative control (L. M. Kohn and M. Andrew, unpublished).

3.3.3 Comparison of colony characteristics

Mycelial plugs of each isolate were taken from the growing margins of colonies grown

on PDA for 3 days and inoculated on to fresh PDA. All cultures were incubated at 20oC

and colony diameter measured after 24 and 48 hours of incubation. Eight replications

with two plates per replication were used for each isolate.

3.3.4 Pathogenicity of different isolates

3.3.4.1 Fungal isolates

All eight isolates (viz. MBRS-1, MBRS-2, MBRS-3, MBRS-5, WW-1, WW-2, WW-3,

and WW-4) were used singly to determine the reaction of various genotypes to each

isolate in experiment 1. In experiment 2, four isolates viz. MBRS-2,-5 (both highly

pathogenic), WW-3 (moderately pathogenic) and WW-4 (least pathogenic) were used to

provide a similar range of pathogenicity for both experiments in order that host

responses and host-pathogen interactions identified in experiment 1 could be compared.

3.3.4.2 Genotypes tested

16 genotypes (12 B. napus and 4 B. juncea) from Australia and China as listed in Table

4 were selected for evaluation on the basis of differences in their resistance reaction as

identified earlier by Li et al. (2006) and Garg et al. (2008/Chapter 2). Seed was obtained

from Australia and China through an Australian Centre for International Agricultural

Research (ACIAR) collaborative program. The experiment was repeated (experiment 2)

with the same 16 cultivars as described above.

CHAPTER 3

38

3.3.4.3 Test conditions and inoculum production

All procedures, test conditions and inoculum production were as described previously

by Garg et al. (2008/Chapter 2). Briefly, the host genotypes screened were grown in

13.7 x 6.6 x 4.9 cm trays, each having 8 cells and containing a soil-less compost

mixture. Groups of 4 trays were placed in 10 L plastic storage boxes (34 x 13 x 23 cm).

Three seeds of each genotype were sown in each cell and thinned to a single seedling

per cell after emergence. A complete randomized block design was utilized with four

replications with two plants per replication of each genotype x isolate combination. All

experiments were conducted under controlled environment growth room conditions of

18 ± 1oC day and 14 ± 1oC night (12 hours light/dark cycles), with light intensity of

150 µE m–2 s–1. Seedlings were grown until cotyledons were fully expanded, equivalent

to growth stage 1.00 on the scale given by Sylvester-Bradley and Makepeace (1984).

Seven agar plug discs (each 5 mm2 diam) were cut from the actively growing margin of

3 day-old colonies of S. sclerotiorum on PDA at 20oC and transferred to 250 mL flasks

containing 75 mL of sterilized liquid medium (Potato Dextrose Broth 24 g, Peptone 10

g, H2O 1 L ). Flasks were rotated on an Innova® 2300 platform shaker at 120 rpm min-1.

After 3 days, colonies of S. sclerotiorum were harvested and washed twice with

sterilized deionized water. The fungal mats obtained were transferred to 125 mL of the

same liquid medium and mycelia macerated in a Breville® food grinder for 3 min. The

macerated mycelial suspension was then filtered through 4 layers of cheese cloth and

the concentration adjusted with the same liquid medium to 1 x 104 fragments mL-1 using

a haemocytometer (SUPERIOR®, Berlin, Germany).

3.3.4.4 Inoculations

Inoculations were carried out when cotyledons were 10-days old. A total of four

droplets of mycelial suspension each of 10 µl were deposited on each plant using a

micro-pipette, with a single drop on each cotyledon lobe. While inoculating, the

mycelial suspension was shaken regularly to maintain a homogeneous mycelial

suspension. A 2.5 cm deep layer of water was added at the bottom of the plastic

containers to maintain high humidity. In addition, a very fine mist of water was sprayed

both over cotyledons and on the inside of the container lids. Together, these procedures

allowed maintenance of a relative humidity level of ca. 100% within the plastic

CHAPTER 3

39

containers. Following inoculation, the boxes were placed under the benches in the

controlled environment room and maintained at a low light intensity of approximately

13 µE m–2 s–1 for 4 days up to time of disease assessment. Previous studies (Garg et al.,

2008/Chapter 2) had shown this technique to be a reliable means of determining the

level of resistance in Brassica genotypes.

3.3.4.5 Disease assessment

At 4 dpi, box covers were removed and lesions assessed on the basis of lesion diameter

(mm) as described by Garg et al. (2008/Chapter 2).

3.3.4.6 Data analyses

Verification of various assumptions of normality and homogeneity of variance required

for parametric analyses (before the actual analysis was carried out), and analysis of the

lesion rating data from intial experiment and from repeat experiment (single factor

analysis of variance) were performed using GENSTAT (9th edition, Lawes Agricultural

Trust). Fisher’s least significant differences (P < 0.05) were used to calculate the

differences between the genotypes and isolates. The relationships between the two

experiments were assessed by computing Pearson correlation coefficients using data

analysis function in Microsoft Excel.

3.4 RESULTS

3.4.1 Molecular identification of different isolates

Three loci (CAL-calmodulin, RAS-ras protein, IGS-intergenic spacer region) were

amplified and sequenced in the SNP-based diagnostic. Two sites were chosen to be

diagnostic for each species, and the sites chosen for S. sclerotiorum were CAL19 and

CAL448. Tables 1 and 2 show the sequencing results for these sites, including

representative isolates of each species and all eight test isolates. The isolates of

Sclerotinia from Western Australia that were tested in this study had identical sequences

at the SNP site to the representative isolates from S. sclerotiorum as listed in Tables 1

and 2. All the isolates used in this study shared SNP sequences with previously

identified S. sclerotiorum isolates. Additionally, there was no hybridization of the

isolates used in this study at SNP sites that were diagnostic for S. trifoliorum and S.

minor, and no hybridization to the probes for the negative control.

CHAPTER 3

40

Table 1 Sequences of Australian isolates (WW-1,2,3,4; MBRS-1,2,3,5) and representative isolates of Sclerotinia sclerotiorum, S. trifoliorum, S. minor species at site CAL19, where T is diagnostic for S. sclerotiorum

Isolate

Sequence at CAL19

S. sclerotiorum (1980) TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

S. sclerotiorum (LMK211) TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

WW-1 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

WW-2 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

WW-3 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

WW-4 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

MBRS-1 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

MBRS-2 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

MBRS-3 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG

MBRS-5 TCTTTGTAAGTTCATCTC T CTAACTTTTACAATCTCAG S. trifoliorum (LMK36) TCTTTGTGAGTTCATCTC C CTAACTTTTACAATCTCAG S. minor (FA2-1) TCTTTGTAAGTTCATCTC C CTGACTTTTATAATCTCAG

Table 2 Sequences of Australian isolates and representative isolates of Sclerotinia sclerotiorum, S. trifoliorum, S. minor at site CAL448, where A is diagnostic for S. sclerotiorum

Isolate

Sequence at CAL448/500

S. sclerotiorum (1980) CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

S. sclerotiorum (LMK211) CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

WW-1 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

WW-2 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

WW-3 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

WW-4 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

MBRS-1 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

MBRS-2 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

MBRS-3 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT

MBRS-5 CCATTGATTTCCCAGGTACGGC A AAGCATAATATAGT S. trifoliorum (LMK36) CCATTGATTTCCCAGGTACGGC G AAGCATAATATAGT

S. minor (FA2-1) CCATTGATTTCCCAGGTACGGC T AAGCATGACATAGT

CHAPTER 3

41

3.4.2 Colony characteristics of isolates

3.4.2.1 Pigmentation

Of the eight isolates, three (viz. WW-1, WW-2, and WW-4) were found to be darkly

pigmented. However, intensity of melanization varied among the pigmented isolates.

Pigmentation was most pronounced in WW-1 as compared to WW-2 and WW-4

following 1 month of incubation at 20oC.

3.4.2.2 Colony diameter

There were significant differences between different isolates in relation to the colony

diameter measured after 24 and 48 hours of incubation (Table 3). However, there was

no significant correlation between pathogenicity and the colony diameter of different

isolates (data not shown).

Table 3 Colony diameter (cm) of different Sclerotinia sclerotiorum isolates growing on potato dextrose agar after 48 h incubation

Isolate Colony Diameter

MBRS-1 7.96 MBRS-2 6.65 MBRS-3 6.67 MBRS-5 8.06 WW-1 7.64 WW-2 5.97 WW-3 6.14 WW-4 7.08 P<0.001; l.s.d (P≤0.05) = 0.72

3.4.3 Responses of various genotypes to different isolates of S. sclerotiorum

3.4.3.1 Experiment 1

Small necrotic and water-soaked lesions were observed after 24 h post-inoculation, their

size depending upon the isolate used. After 24 h, an increase in lesion size was observed

across the different genotypes when inoculated with MBRS-1, MBRS-2, MBRS-3,

MBRS-5, WW-1 and WW-3. In contrast, no such progression in lesion size after 24 h

was observed in the genotypes when inoculated with isolates WW-2 or WW-4, with

CHAPTER 3

42

Table 4 Experiment 1: Reaction (lesion diameter, mm) and rank order (numbers in parenthesis) of 12 Brassica napus and 4 B. juncea genotypes from Australia and China to different isolates of Sclerotinia sclerotiorum (viz. MBRS-1, 2, 3 and 5; WW-1, 2, 3, and 4) 4 days after inoculation on the cotyledons

Genotype Origin Type MBRS-1 MBRS-2 MBRS-3 MBRS-5 WW-1 WW-2 WW-3 WW-4 Means

AG- Spectrum Australia B. napus 6.2(9) 9.7(12) 7.1(12) 9.8(12) 5.5(8) 1.5(7) 3.0(7) 0.4(2) 5.3 AV-Sapphire Australia B. napus 10.1(15) 9.8(14) 7.1(12) 7.1(3) 7.0(10) 1.6(8) 3.6(13) 1.0(11) 5.8 Charlton Australia B. napus 1.0(1) 2.5(1) 1.7(1) 0.8(1) 1.6(1) 3.1(16) 2.5(5) 0.7(6) 1.7 Ding 474 China B. napus 7.7(14) 8.5(10) 5.3(3) 9.3(8) 6.3(9) 1.0(3) 3.1(8) 0.3(1) 5.1 Fan168 China B. napus 5.8(7) 5.9(5) 7.8(14) 9.4(9) 5.2(6) 1.2(5) 3.2(10) 0.7(7) 4.9 JM16 Australia B. juncea 5.1(6) 6.7(7) 5.4(4) 10.7(13) 7.7(11) 1.3(6) 3.2(9) 0.8(8) 5.0 JN010 Australia B. juncea 2.6(3) 6.1(6) 6.2(7) 9.7(11) 3.0(3) 0.9(1) 1.0(1) 0.4(3) 3.7 JN028 Australia B. juncea 6.9(10) 5.8(4) 5.7(5) 7.3(4) 2.3(2) 0.9(2) 1.4(2) 0.5(4) 3.8 JR042 Australia B. juncea 5.9(8) 5.7(3) 6.5(10) 9.0(7) 5.4(7) 1.1(4) 1.6(3) 0.6(5) 4.4 Mystic Australia B. napus 1.5(2) 4.3(2) 4.3(2) 3.9(2) 3.7(4) 1.9(10) 2.0(4) 1.0(10) 2.8 P617 China B. napus 7.1(11) 9.7(13) 6.4(9) 9.4(10) 8.2(14) 2.1(11) 2.6(6) 1.3(16) 5.7 Purler Australia B. napus 4.1(4) 8.2(9) 6.0(6) 10.6(14) 8.3(15) 2.5(13) 4.1(14) 1.3(15) 5.6 Rivette Australia B. napus 10.1(16) 7.7(8) 8.9(15) 12.0(16) 8.0(13) 2.9(15) 4.5(16) 1.0(9) 6.8 RQ001-02M2 Australia B. napus 7.5(12) 10.9(15) 6.2(8) 10.9(15) 11.2(16) 2.2(12) 4.2(15) 1.1(12) 6.7 RR013 Australia B. napus 7.5(13) 12.0(16) 7.0(11) 8.7(6) 7.9(12) 2.7(14) 3.3(12) 1.1(14) 6.2 Zhongyou–ang No. 4 China B. napus 4.9(5) 8.7(11) 9.0(16) 8.7(5) 5.2(5) 1.8(9) 3.3(11) 1.1(13) 5.3 Means 5.9 7.6 6.3 8.6 6 1.8 2.9 0.8 Significance of genotypes P<0.001; l.s.d (P≤0.05) = 0.60 Significance of isolates P<0.001; l.s.d (P ≤0.05) = 0.42 Significance of genotypes x isolates P<0.001; l.s.d (P≤0.05) = 1.70

CHAPTER 3

43

necrotic lesions only developing directly underneath where the drops of the inoculum

had been applied (data not shown).

Significant differences were observed between the genotypes (P < 0.001; Table 4) in

relation to the severity of lesions on cotyledons across the isolates tested. Cultivar

Charlton was identified as the most resistant cultivar with mean lesion diameter of 1.72

mm, whereas cv. Rivette was found to be the most susceptible genotype with a mean

lesion diameter of 6.82 mm at 4 dpi.

3.4.3.2 Experiment 2

There were significant differences between genotypes (P < 0.001, Table 5) in relation to

cotyledon lesion diameter across the isolates tested. Cultivar Charlton was again found

to be the most resistant cultivar with mean lesion length of 1.24 mm and while B. napus

lines AV-Sapphire and Ding 474 were the most susceptible genotypes with mean lesion

length of 6.2 mm.

3.4.4 Pathogenicity of different isolates of S. sclerotiorum

Significant differences were observed between eight isolates (P < 0.001) in relation to

their pathogenicity towards the 16 Brassica genotypes used in Experiment 1 as well as

in Experiment 2. Overall, MBRS-5 was the most pathogenic isolate with a mean lesion

length of 8.6 and 5.9 mm in experiments 1 and 2 mm, respectively, at 4 dpi. Similarly,

WW-4 was the least pathogenic isolate with a mean lesion length of 0.8 (experiment 1)

and 1.7 (experiment 2) mm at 4 dpi.

3.4.5 Host x pathogen interaction

A significant (P < 0.001) host x pathogen interaction was observed in both experiments.

However, some of the genotypes (e.g., cv. Charlton) performed consistently better in

relation to cotyledon lesion diameter against most of the isolates used in this study (viz.

top ranked resistant genotype for five isolates, rank 5 or 6 for two other isolates, rank 16

for the isolate which was the least pathogenic and where the differences in the lesion

diameters between the more resistant genotypes were very small; Table 4). Some of the

genotypes (e.g., cv. AG- Spectrum, Purler, Zhongyou-ang No. 4) were found to be

strongly and differentially responsive to isolates of S. sclerotiorum tested, suggesting

CHAPTER 3

44

that there can be a strong interaction between genotypes and the isolates of the pathogen

used in this study.

Table 5 Experiment 2: Reaction (lesion diameter, mm) and rank order (numbers in parenthesis) of 12 Brassica napus and 4 B. juncea genotypes from Australia and China to different isolates of Sclerotinia sclerotiorum (viz. MBRS- 2, and 5; WW-3, and 4) 4 days after inoculation on the cotyledons

Genotype

MBRS-2

MBRS-5

WW-3

WW-4

Means

AG- Spectrum 3.6(5) 7.7(12) 6.0(9) 1.3(6) 4.7 AV-Sapphire 5.4(13) 7.8(13) 9.33(16) 2.1(12) 6.2 Charlton 1.0(1) 2.0(2) 1.36(1) 0.5(1) 1.2 Ding 474 7.2(16) 8.1(14) 7.34(13) 2.1(11) 6.2 Fan168 5.4(12) 7.6(11) 6.66(10) 2.3(15) 5.5 JM16 5.0(9) 6.4(8) 5.21(6) 1.3(4) 4.5 JN010 2.7(2) 6.9(9) 5.13(5) 1.2(3) 4.0 JN028 5.2(10) 8.5(16) 3.55(3) 1.4(7) 4.7 JR042 3.3(4) 5.9(7) 5.22(7) 1.3(5) 3.9 Mystic 3.3(3) 1.2(1) 2.4(2) 1.2(2) 2.0 P617 5.0(8) 4.2(5) 8.61(15) 2.8(16) 5.2 Purler 6.6(14) 5.1(6) 4.97(4) 2.0(10) 4.7 Rivette 6.6(15) 7.3(10) 6.79(12) 2.2(14) 5.7 RQ001-02M2 5.2(11) 3.5(3) 5.59(8) 1.7(8) 4.0 RR013 4.2(6) 8.4(15) 6.73(11) 2.0(9) 5.3 Zhongyou-ang No. 4 4.9(7) 4.1(4) 8.13(14) 2.2(13) 4.8 Means 4.7 5.9 5.8 1.7 Significance of genotypes P<0.001; l.s.d (P≤0.05) = 0.95 Significance of isolates P<0.001; l.s.d (P≤0.05) = 0.48 Significance of genotypes x isolates P<0.001; l.s.d (P ≤0.05) = 1.91

3.4.6 Correlation of responses of genotypes between experiments

Overall, there was a significant positive correlation (r = 0.78; P < 0.001, n = 16, Fig. 1)

between experiments 1 and 2 for mean values for genotypes in relation to cotyledon

lesion diameter.

There was significant positive correlation between experiments 1 and 2 for individual

values for cotyledon lesion diameter of different genotypes across three isolates of S.

sclerotiorum (MBRS-2, MBRS-5 and WW-4) (r = 0.79; P < 0.001, n = 48, Fig. 2).

However, when S. sclerotiorum isolate WW-3 was included in analysis the “r” value

decreased from 0.79 to 0.56, but was still significant (r = 0.56; P < 0.001, n = 64, Fig.

CHAPTER 3

45

3). There was a significant positive correlation in relation to diameter of the lesion on

cotyledons for various genotypes inoculated with MBRS-1 in this study when compared

with responses for these same genotypes that were reported previously (Garg et al.,

2008/Chapter 2; r = 0.84, P = 0.002, n = 10, Fig. 4).

Figure 1 Correlation between experiments 1 and 2 for overall mean values of diameter of cotyledon lesions in each experiment across each of the 12 B. napus and 4 B. juncea genotypes 4 days post- inoculation with Sclerotinia sclerotiorum

Figure 2 Correlation between experiments 1 and 2 for individual values for cotyledon lesion diameter 4 days post-inoculation with three isolates of Sclerotinia sclerotiorum (viz. MBRS-2, MBRS-5 and WW-4) onto 12 B. napus and 4 B. juncea genotypes

3.5 DISCUSSION

In comparing the colony characteristics of the eight isolates of S. sclerotiorum isolated,

three darkly pigmented colonies (viz. WW-1, WW-2, and WW-4) were obtained.

However, no correlation between pathogenicity and either pigmentation or colony

diameter (data not shown) was found. This is the first report of the occurrence of darkly

pigmented mycelial isolates of S. sclerotiorum on Brassicas in Australia. Three isolates

y = 0.7673x + 0.7502R 2 = 0.61

0

1

2

3

4

5

6

7

0 2 4 6 8

Means of cotyledon lesion diameter (Experiment 1)

Mea

ns

of

coty

led

on

les

ion

dia

met

er

(Exp

erim

ent

2)

y = 0.4659x + 1.4525

R 2 = 0.6284

0

1

2

3

4

5

6

7

8

9

0 5 10 15

Cotyledon lesion diameter (Experiment 1)

Co

tyle

do

n l

esio

n d

iam

eter

(E

xper

imen

t 2)

CHAPTER 3

46

(viz. WW-1, WW-2, and WW-4) with varying intensity of pigmentation were identified

from the Walkaway region of Western Australia. Of the three pigmented isolates found

in this study, WW-1 was relatively more pathogenic than isolates WW-2 and WW-4. A

darkly pigmented isolate was also identified as pathogenic by Sanogo and Puppala

(2007). However, results in the present study demonstrate that pigmentation and colony

diameter do not necessarily relate to pathogenicity of S. sclerotiorum. This is, however,

in contrast to previous reports, for example, Zhou and Boland (1999) examined factors

affecting virulence and found that while a hypo-virulent isolate showed reduced

mycelial growth, pathogenicity was mainly affected by reduced or delayed production

of oxalic acid.

There were significant differences observed among different Brassica genotypes when

challenged by different strains of S. sclerotiorum and also among different isolates in

relation to their pathogenicity as measured by cotyledon lesion diameter on different

Brassica genotypes. There was also a significant host x pathogen interaction in both the

experiments. It is noteworthy that some genotypes showed consistent host responses

irrespective of the isolates of S. sclerotiorum used in this study, whereas others showed

a variable pattern of responses depending upon the isolate used. For instance, in terms

of lesion length, cv. Charlton consistently showed a high level of resistance to most of

the isolates. It is interesting that where variable ranking for cv. Charlton was observed,

it was against the S. sclerotiorum isolates that were least pathogenic (viz. WW-2, WW-3

and WW-4). Similarly, cv. Rivette and RQ001-02M2 were also consistent in terms of

their responses, showing susceptible reactions against most of the isolates that were

used in this study (Table 4). In contrast, the ranking of certain other genotypes (e.g.,

Zhongyou-ang No. 4, AV-Sapphire) was highly variable in response to inoculation with

different isolates of S. sclerotiorum. These particular genotypes showed response

ranging from resistant to highly susceptible, depending upon the isolate. Genotypes that

show the most consistent and promising responses across a range of S. sclerotiorum

isolates should be used as standards in disease screening programs and in commercial

breeding programs, as these are the most likely genotypes to perform consistently across

different national and international geographic locations. Such differences in responses

of genotypes depending upon the isolate, also suggest that resistance in Brassicas

against S. sclerotiorum is most likely to be polygenic.

CHAPTER 3

47

There are very few published reports of significant genotype x S. sclerotiorum

interaction of the type that was observed in this study, probably because in most of

previous studies either more isolates were included but with only a very small number

of genotypes or vice versa (e.g., Riddle et al., 1991; Ekins et al., 2007; Morrall et al.,

1972; Auclair et al., 2004b; Pratt and Rowe, 1995). It is interesting that no significant

interaction was observed between Glycine max and S. sclerotiorum isolates (Auclair et

al., 2004b) in Canada where 5 host cultivars and 4 pathogen isolates were involved or

with five isolates and seven alfalfa cultivars (Pratt and Rowe, 1995) in the USA. The

host genotypes used in this study were representative of a wide genetic diversity of

Brassica germplasm available from Australia and China, which could have enhanced

the significant host-pathogen interactions observed.

Figure 3 Correlation between experiments 1 and 2 for individual values for cotyledon lesion diameter 4 days post-inoculation with four isolates of Sclerotinia sclerotiorum (viz. MBRS-2, MBRS-5, WW-3, WW-4) onto 12 B. napus and 4 B. juncea genotypes

Figure 4 Correlation of data for diameter of cotyledon lesions on 10 B. napus genotypes 4 days post-inoculation with Sclerotinia sclerotiorum in experiment 1 with data taken from Garg et al. (2008) when inoculated with MBRS-1

Significant differences were observed among the isolates of S. sclerotiorum in relation

to their pathogenicity. At 4 dpi, some isolates were less pathogenic (WW-2, WW-4)

irrespective of the host genotypes tested, whereas others (MBRS-5, MBRS-2) were

y = 0.3372x + 2.8712

R 2 = 0.2625

0

1

2

3

4

5

6

7

8

9

10

0 5 10 15

Cotyledon Lesion diameter (Experiment 1)

Co

tyle

do

n l

esio

n d

iam

eter

(E

xper

imen

t 2)

y = 0.8567x + 1.772

R 2 = 0.7048

0

2

4

6

8

10

12

0 2 4 6 8 10

Cotyledon lesion diameter in Experiment 1 of MBRS-1

Co

tyle

do

n l

esio

n d

iam

eter

in

Gar

g e

t al

. (2

008)

CHAPTER 3

48

highly pathogenic to almost all of the Brassica genotypes evaluated in this study. This

may be related to some form of physiological specialization in S. sclerotiorum in

Western Australia. This further illustrates the advantage of screening Brassica

genotypes with a range of S. sclerotiorum isolates so that reaction of different host

genotypes can be precisely identified. Where such spectrum of isolates is not readily

available, it is best to use a highly pathogenic isolate such as MBRS-1, as used by Li et

al. (2006, 2007).

Only eight isolates were used in this study. However, similar differences among S.

sclerotiorum isolates have been reported by others even where a larger number of

isolates were investigated (e.g., Riddle et al., 1991; Ekins et al., 2007; Morrall et al.,

1972). While variations in pathogenicity have been reported among isolates, the

differences did not justify grouping of S. sclerotiorum isolates on the basis of their

pathogenicity. This is further supported by the observations of Melzer and Boland

(1996) working on lettuce and Morrall et al. (1972) on 23 different hosts, who defined a

“continuum” (in contrast to distinct categories) in the pathogenicity of this pathogen.

Even where significant differences in pathogenicity among isolates of this pathogen

occur, their responses were found to be overlapping (e.g., Riddle et al., 1991; Ekins et

al., 2007).

Some isolates (e.g., MBRS-2, MBRS-5 and WW-4) in the present study behaved

consistently across the two experiments as compared to others (e.g., WW-3).

Differences in pathogenicity of this pathogen observed between repeated experiments

have also been reported by other workers e.g., Pratt and Rowe (1995) on alfalfa;

Errampalli and Kohn (1995) on canola; Brenneman et al. (1988) on peanuts, when only

a few isolates were tested, or when large number of isolates were involved (e.g., Ekins

et al., 2007 on sunflower; Riddle et al., 1991 on dandelion).

In conclusion, this study is the first to identify darkly pigmented isolates of S.

sclerotiorum in Australia, although the pathogenicity of the pathogen was not

influenced by pigmentation or colony diameter of the isolates. Significant differences in

pathogenicity were observed between different isolates across different genotypes,

suggesting a form of physiological specialization occurs in this pathogen in Western

CHAPTER 3

49

Australia. For this reason, it is best to include more than one S. scleortiorum isolate in

any germplasm screening program. Further, genotypes such as cv. Charlton which

showed consistent resistant reactions to different isolates in this study, and also showed

useful resistance under field conditions (Li et al., 2006), are those most likely best

suited for commercial exploitation of this resistance in oilseed rape breeding programs.

This is especially so in relation to developing cultivars for deployment in areas where

physiological specialization occurs.

CHAPTER 4

50

CHAPTER 4 Scarification and Environmental Factors that Enhance Carpogenic Germination of Sclerotia of Sclerotinia Sclerotiorum

4.1 ABSTRACT

Ascospores of Sclerotinia sclerotiorum are the primary source of inoculum for disease

epidemics in many economically important crops. Mass production of ascospores under

laboratory conditions is required to prepare inoculum for use in selection of genotypes

with resistance against Sclerotinia diseases. A study was undertaken, first, to investigate

the effect on carpogenic germination of scarifying sclerotia from two S. sclerotiorum

isolates taken from canola (Brassica napus), and second, to identify environmental

factor(s) that enhance carpogenic germination. Seven different environmental

treatments were applied to scarified and un-scarified sclerotia, viz. 1) sterilized distilled

water for four months at 15oC, 2) aerated water for four months at 4oC, 3) constant

rinsing with tap water for eight weeks at 4oC, 4) cold-conditioning for four weeks at 4oC

and subsequent transfer into moist unsterilized compost at 15oC, or 5) sclerotia

incubated into sterilized river sand at 15oC, 6) air-drying of sclerotia for two weeks

followed by subsequent transfer into sterilized moist river sand at 15oC, or, 7) sclerotia

placed into 0.5% water agar and incubated at 15oC. Carpogenic germination of scarified

sclerotia was significantly greater (P < 0.05) than for un-scarified sclerotia. There was

significant interaction (P < 0.001) between scarification and the different environmental

treatments in relation to the carpogenic germination. Carpogenic germination of

scarified sclerotia was enhanced by incubation of sclerotia in compost or in sterilized

river sand. Further, overall carpogenic germination of both scarified and un-scarified

sclerotia occurred to the greatest extent when sclerotia of either of the two isolates were

subjected to constant rinsing with tap water. This is a first report, both of the enhanced

carpogenic germination by scarification in S. sclerotiorum and for the environmental

factors that enhance carpogenic germination of scarified sclerotia.

CHAPTER 4

51

4.2 INTRODUCTION

Sclerotinia sclerotiorum is an important pathogen of soybean (Glycine max), sunflower

(Helianthus annuus) and canola (Brassica napus L.) in North America, Europe,

Australia, India and China (Purdy, 1979; Boland and Hall, 1994; Li et al., 1999;

McCartney et al., 1999; McDonald and Boland, 2004; Young et al., 2004; Koch et al.,

2007; Malvarez et al., 2007; Singh et al., 2008). While sclerotia of this pathogen can

germinate to produce infective hyphae, myceliogenic germination generally plays only a

minor role in disease epidemiology (Abawi and Grogan, 1979). An exception is

Sclerotinia stem rot of oilseed Brassica crops in India where myceliogenic germination

considered to be important (Singh et al., 2008). More commonly, sclerotia germinate

carpogenically, producing apothecia that release wind-borne ascospores (McCartney et

al., 1999), which are generally considered the primary inoculum source for Sclerotinia

disease epidemics on many economically important crops (Keay, 1939; Newton and

Sequeira 1972; Abawi and Grogan, 1975; Purdy, 1979; Smith and Boland, 1989;

Williams et al., 1980). For this reason, artificial production of ascospore inoculum is of

prime importance, both in the selecting genotypes with resistance against S.

sclerotiorum (Dillard et al., 1995) and also for studies to better understand aspects of the

epidemiology of this disease (Abawi and Grogan, 1975).

Sclerotia of most isolates of S. sclerotiorum are known to possess constitutive and

exogenous dormancy that must be overcome before they can be germinated

carpogenically to produce ascospores (Coley-Smith and Cooke, 1971; Phillips, 1987).

The role of temperature (Saito, 1973; Kohn, 1979; Mylchreest and Wheeler, 1987;

Smith and Boland, 1989; Clarkson et al., 2003; Clarkson et al., 2004; Clarkson et al.,

2007), soil moisture (Morrall, 1977; Saito, 1977; Phillips, 1986; Wu and Subbarao,

2008) and aeration and/or burial depth (Phillips, 1987; Wu and Subbarao, 2008) as

conditioning treatments to induce carpogenic germination or to break the dormancy of

sclerotia, have been well documented. The sclerotial rind is also known to impose

constitutive dormancy, even though it is considered to be permeable to water, gases and

some molecules like carbohydrate (Coley-Smith and Cooke, 1971). Sclerotia of both S.

sclerotiorum and S. trifoliorum are reported to germinate more rapidly when the

sclerotial rind is broken or damaged (Makkonen and Pohjakallio, 1960), even though

CHAPTER 4

52

rind is known to regenerate (Coley-Smith and Cooke, 1971; Young and Ashford, 1996).

There have also been a few studies for other pathogens on this aspect. For example,

Scott (1954) observed that artificial abrasion of the rind was required for immediate

germination of sclerotia of Sclerotium cepivorum, while Boswell (1958) and Chet

(1969) reported increased germination of sclerotia of Sclerotium rolfsii following

mechanical damage of the rind. These studies suggested that in an undamaged state, the

sclerotial rind may play a role in inhibition of sclerotial germination. However, most

published studies on the role of damage to sclerotial rind relate to myceliogenic

germination, and role of the damage to the sclerotial rind in stimulating carpogenic

germination of S. sclerotiorum is not clear. Further, the effect of various environmental

treatments on scarified sclerotia to stimulate the carpogenic germination of scarified

sclerotia has not been investigated to date.

A great deal of work has been reported on environmental factors such as temperature,

light, moisture, and burial depth required to stimulate carpogenic germination of

sclerotia of S. sclerotiorum (e.g., Willetts and Wong, 1980). However, findings

frequently differ among different studies and can even be contradictory (Phillips, 1987;

Wu and Subbarao, 2008). For example, while there is general agreement that favorable

apothecial production occurs at 10oC - 20oC (Willetts and Wong, 1980), specific

temperatures of 7oC to 25oC are reported by others (e.g., Phillips, 1987). Moreover,

reports on specific temperature requirements for preconditioning of sclerotia to

stimulate carpogenic germination are also incongruous among different studies, e.g.,

0oC (Kohn, 1979), 3oC (Saito, 1977), 4oC (Clarkson, 2003), 5oC (Phillips, 1986), 7oC

(Cobb and Dillard, 1996), 8oC (Dillard et al., 1995) and 10oC (Huang and Kozub,

1991). In contrast, some isolates of S. sclerotiorum have also been reported to germinate

without any chilling requirements (Ramsey, 1925; Bedi, 1956). The length of the pre-

conditioning period suggested to stimulate carpogenic germination is also highly

variable, ranging from 7-10 days to 8 weeks (Abawi and Grogan, 1975; Phillips, 1987;

Mila and Yang, 2008). Such differences in germination behaviour of the sclerotia of the

S. sclerotiorum isolates could partially be due to the geographical origin (Huang and

Kozub, 1991) and/or the temperature conditions under which sclerotia were formed

(Huang and Kozub, 1989).

CHAPTER 4

53

Moisture is also considered as a vital requirement for carpogenic germination and even

a small osmotic stress can inhibit apothecial formation (Williams and Western, 1965;

Grogan and Abawi, 1975; Abawi and Grogan, 1979; Sun and Yang, 2000; Wu and

Subbarao, 2008). Additionally, light is also reported to be essential for the development

of mature apothecia, but not for the stipe formation (Sproston and Pease, 1957; Thaning

and Nilsson 2000). The substrate used for production of sclerotia (Smith and Boland,

1989; Willetts and Wong, 1980) and burial depth (Wu and Subbarao, 2008) can also

influence apothecial production of S. sclerotiorum. As a large number of different

variables can influence carpogenic germination, it is not surprising that reproducibility

of different individual treatments/methods used to induce apothecial production in

different locations has often been reported to be very poor (e.g., Grogan, 1979;

Mylchreest and Wheeler, 1987; Smith and Boland, 1989; Dillard et al., 1995). Such

variability makes it particularly difficult to relate published findings on carpogenic

germination of sclerotia of S. sclerotiorum to particular geographical locations, such as

the Mediterranean environment of southwest Western Australia.

The inconsistencies in the results reported to date in relation to the carpogenic

germination of S. sclerotiorum prompted us to evaluate the effects of scarification and

environmental factors on carpogenic germination of S. sclerotiorum and to test for the

presence of any seasonal patterns associated with their germination. The objectives of

this study were: Firstly, to determine whether carpogenic germination of the sclerotia of

S. sclerotiorum can be enhanced by scarification, secondly, to evaluate if certain

environmental factors can enhance carpogenic germination and, thirdly, to determine

the seasonal influences or time of the year upon induction of carpogenic germination.

4.3 MATERIALS AND METHODS

4.3.1 S. sclerotiorum isolates and production of sclerotia

Two isolates of S. sclerotiorum (MBRS-1 and WW-3) were collected from the Mount

Barker (MBRS-1) and Walkaway (WW-3) regions of the Western Australia (WA) in

2004, in each instance from infected tissue of B. napus and from a site where there was

a significant disease on a canola crop (Li et al., 2006). Initial isolation and sterilization

of sclerotia were carried out as described by Clarkson et al. (2003) and Sansford and

CHAPTER 4

54

Coley-Smith (1992). Briefly, a single sclerotium each of S. sclerotiorum isolates

MBRS-1 and WW-3 was surface sterilized in 50% (v/v) sodium hypochlorite and 70%

ethanol for 4 min followed by two washes in sterilized distilled water for 1 min. The

sclerotium was then cut into half and placed on potato dextrose agar (PDA). Sclerotia

obtained from this culture were removed, air dried and maintained at 4oC for future

studies.

Bulk production of sclerotia of the two isolates (MBRS-1 and WW-3) was undertaken

by growing each isolate on sterilized wheat grain. Wheat media for mass production of

the sclerotia of the two isolates was used primarily to ensure uniformity among all the

treatments and to mitigate any substrate influence on the carpogenic germination as

reported previously (e.g., Smith and Boland, 1989). Erlenmeyer flasks (250 ml)

containing 25 g of wheat grain and 60 ml of distilled water (autoclaved three times at

120oC for 20 min) were inoculated by using four agar plugs from the edge of three- day

old S. sclerotiorum colonies (Mylchreest and Wheeler, 1987; Clarkson et al., 2003).

Flasks were placed in incubator at 20oC for 4 weeks to obtain mature sclerotia. During

this period, these flasks were shaken three times a week to even the colonization of

wheat grains. After 4 weeks, sclerotia were harvested by sieving under running water to

obtain sclerotia of a uniform size of 2-5mm diameter and to remove any remnants of

colonized and un-colonized wheat grains.

4.3.2 Experimental design

A three-way asymmetric factorial design (i.e., 2 x 2 x 7) was utilized for this study. For

each isolate of S. sclerotiorum, sclerotia were separated into two groups, viz. scarified

and un-scarified sclerotia (1400 sclerotia/isolate and 700 sclerotia/group). Each isolate

and sclerotial treatment group was then divided into seven separate lots (each of 100

sclerotia) for each treatment applied in relation to carpogenic germination. Each lot was

further divided into four units to obtain 4 replications with 25

sclerotia/replication/treatment. Each replication unit (25 sclerotia) was then placed in

transparent plastic container (650 ml; Bunzl Australasia) with air-tight lids containing

either river sand, water or unsterilized organic compost to 2 cm depth according to each

treatment tested for its ability to stimulate carpogenic germination. However, round

plastic autoclavable containers (6.5 x 7.0 cm (diameter x height)) with air-tight lids

CHAPTER 4

55

were used where sclerotia were placed in water agar. Sclerotia that comprised of each

replication (together for scarified and un-scarified sclerotia) were taken from each flask

separately for each treatment. All plastic containers were then randomly placed in

controlled environment incubator (Thermoline, Australia) maintained at 15oC with 12h

light/dark cycle as described by Clarkson et al. (2003). At saturation, gravimetric

moisture content of the sand and compost was 22.1 and 64.5% respectively. Water

potential of the compost was maintained at -10 kPa by firstly measuring the initial

weight of every container containing the appropriate amount of water. Subsequently,

water added each week to maintain the weight of each container at the original weight

(Clarkson et al. 2003). However, containers with sand were watered up to saturation

(0.1 kPa) and water in these containers (with holes at the bottom) was freely drained,

maintaining moisture content at near to field capacity. All the plastic containers were

randomly redistributed within the incubator every month in order to ensure uniform

exposure to light and temperature. No treatment showed any sign of carpogenic

germination (i.e., no initiation of apothecial stipe) for the first four months of incubation

in the controlled environment cabinet (except for sclerotia in 0.5% water agar where a

few sclerotia of WW-3 carpogenically germinated). Plastic containers were then

transferred on the benches of an air conditioned laboratory where the maximum

temperature was maintained between 23 to 25oC. Redistribution of the container on the

lab benches was undertaken weekly to ensure uniform light and temperature exposure.

Sclerotia were monitored for stipe formation over two years i.e. 2006-07 and 2007-08

on a weekly basis.

The experimental design comprised of sclerotia, firstly subjected to scarification (or

maintained as un-scarified sclerotia), followed by conditioning with seven different

environmental factors (for both scarified and un-scarified sclerotia). The description of

all seven treatments and their respective temperature regimes used are summarized in

Table 1. The procedure for scarification and other details of the different environmental

factors tested, by application of seven treatments in this study, are described below.

4.3.3 Scarification

Scarification of the two isolates was performed using sand paper (medium-course, grit

size No. 80). Sclerotia were placed between two 8 x 8 cm sand paper sheets and were

CHAPTER 4

56

uniformly rubbed by hand for approx 30 sec by which time the light whitish medulla

layers of sclerotia were just visible. Scarification of sclerotia incubated on water agar

was done using autoclaved sand paper (120oC for 20 min) in a laminar flow cabinet.

Table 1 Different environmental treatments and the respective temperature regime used to stimulate carpogenic germination of scarified and un-scarified sclerotia of two isolates (MBRS-1 and WW-3) of Sclerotinia sclerotiorum.

S. No.

January 2007 – April 2007 May 2007 – December 2008 Time on which first apothecial stipe was visible

Treatment Temperature Treatment Temperature MBRS-1

WW-3

1 Sclerotia incubated in sterile distilled water

15oC Sclerotia transferred into sterilized river sand

23-25oC * Aug-07

2 Sclerotia in aerated water

4oC Sclerotia transferred into sterilized river sand

23-25oC Jul-08 Aug-07

3 Constant rinsing with tap water at 4oC for 8 weeks and subsequently transferred into sterile river sand at 15oC

4oC for 8 weeks and then 15oC

Sclerotia in sterilized river sand

23-25oC Jun-07 Jun-07

4 Cold-conditioning at 4oC for 4 weeks without sieving and then transferred to unsterilized compost at 15oC after sieving sclerotia with running water

4oC for 4 weeks and then 15oC

Sclerotia in unsterilized compost

23-25oC Oct-08 Sep-07

5 Sclerotia incubated in sterile river sand

15oC Sclerotia in sterilized river sand

23-25oC Oct-08 Aug-07

6 Air-drying of sclerotia for 2 weeks on lab bench and then incubation in sterilized river sand

15oC Sclerotia in sterilized river sand

23-25oC Nov-08 Jul-07

7 Sclerotia pressed into 0.5% sterilized water agar

15oC Sclerotia in 0.5% sterilized water agar

23-25oC Jun-08 Apr-07

*No carpogenic germination was recorded in this instance.

4.3.4 Treatments

4.3.4.1 Treatment 1

Sclerotia were incubated in sterilized distilled water in a plastic container containing

150 ml of sterilized distilled water (SDW) at 15oC as described by Grogan and Abawi

(1975), and Ekins et al. (2002). The water in plastic containers was changed every

week. Since no sclerotial germination was recorded for four months (January 2007-

CHAPTER 4

57

April 2007) in this treatment, these pre-conditioned sclerotia were then transferred into

sterilized river sand at 15oC, as some sclerotia in one replication were disintegrating

from having been in water for this period.

4.3.4.2 Treatment 2

Sclerotia were loosely packed in a cheese cloth bag and each replication was placed in a

separate container containing water with constant aeration (using an aquarium pump) at

4oC as described by Dillard et al. (1995), Nelson et al. (1988) and Cobb and Dillard

(1996). Water in the containers was changed every week. No carpogenic germination

was recorded in this treatment up to 4 months, when sclerotia were then transferred into

sterilized river sand at 15oC.

4.3.4.3 Treatment 3

Sclerotia were loosely packed in a cheese cloth bag and evenly distributed at the bottom

of a plastic container ( 36 x 20 x 17 cm) having holes (2 mm diameter) at one end. Each

box (with each replication) was placed at a 45o angle and positioned separately

underneath of the tap water with the end of the box with the holes furthest away from

the falling tap water from a height of 80 cm. Sclerotia were then subjected to constant

rinsing with tap water at a flow rate of approx. 3L/hr while maintained at 4oC for 8

weeks (Dillard et al., 1995), followed by subsequent placement of sclerotia into

sterilized river sand at 15oC.

4.3.4.4 Treatment 4

This treatment was according to the procedure described by Clarkson et al. (2003),

Mylchreest and Wheeler (1987) and Sansford and Coley-Smith (1992), but with slight

modifications. Mature sclerotia were cold conditioned by transferring the Erlenmeyer

flasks (250ml) with sclerotia to 4oC for 4 weeks. After this period, sclerotia were

removed from the flask and sieved under running tap water as described above.

Sclerotia were then air-dried overnight in a laminar flow cabinet and then evenly

distributed into a 2 cm layer of unsterilized organic compost at 15oC (Richgro®,

Jandakot, Western Australia) in plastic containers. Plastic containers were then placed

in a controlled environment incubator as described above.

CHAPTER 4

58

4.3.4.5 Treatment 5

Sclerotia were incubated in sterilized river sand at 15oC, directly after sieving with

water and without any preconditioning treatments, using the method as described by

Grogan and Abawi (1975).

4.3.4.6 Treatment 6

Sclerotia were air-dried for two weeks on a laboratory bench (Hao et al., 2003) followed

by incubation in sterilized river sand at 15oC, using the methods as described by Grogan

and Abawi (1975) and Steadman and Nickerson (1975).

4.3.4.7 Treatment 7

Sclerotia were sterilized with 70% ethanol for 30 sec in a laminar flow cabinet, and then

pressed 0.5 cm deep into 0.5% sterilized water agar (4 cm depth of water agar in total)

contained in a round plastic container (6.5 x 7.0 cm (diameter x height)) with the help of

sterilized forceps (Steadman and Nickerson, 1975; Sutton and Deverall, 1983). Plastic

containers with sclerotia and water agar were then incubated at 15oC.

4.3.5 Data collection and Data analysis

Sclerotia were observed weekly for stipe formation. Sclerotia for which stipe initiation

(up to 3 to 4 mm in size) was observed were removed from the respective plastic

containers in order to avoid any duplication of data. The total number of sclerotia

germinated in each replication of every treatment was compiled at the end of the two

year period. Square root transformation of the total number of sclerotia germinated in

each replication was undertaken to obtain a more normal distribution of the observed

data. The carpogenic germination data were then analyzed by three-way ANOVA using

GENSTAT (9th edition, Lawes Agricultural Trust, Rothamsted, UK). Fisher’s least

significant differences (l.s.d.) at P < 0.05 were used to test for differences between the

treatments. The comparison of scarified and un-scarified sclerotia in relation to

carpogenic germination when subjected to constant rinsing with tap water was also

made separately in the month of June at different time intervals by using a single factor

ANOVA using GENSTAT (9th edition, Lawes Agricultural Trust, Rothamsted, UK).

Progression of sclerotial germination in each month of each isolate was obtained by

adding the total number of sclerotia germinated for each replication of each treatment to

identify any evidence of seasonal rhythm in relation to the carpogenic germination.

CHAPTER 4

59

4.4 RESULTS

4.4.1 Effect of scarification, environmental treatment and isolate on carpogenic

germination of S. sclerotiorum

Overall, scarification enhanced the carpogenic germination of sclerotia of both the

isolates used. There was significantly greater (P < 0.05) carpogenic germination in

scarified than un-scarified sclerotia for both isolates (MBRS-1 and WW-3) of S.

sclerotiorum used in this study (Table 2).

Table 2 Three-way analysis of variance showing significance of effect of isolate, scarification and environmental treatments in relation to the carpogenic germination of the sclerotia of Sclerotinia sclerotiorum.

† n.s. = not significant at P ≤ 0.05, a Seven environmental treatments were used to induce carpogenic germination viz. 1) sclerotia incubated in sterilized distilled water, 2) sclerotia placed in water with constant aeration at 4oC, 3) sclerotia subjected to constant rinsing with tap water, 4) sclerotia cold-conditioned for four weeks at 4oC and then transferred into moist unsterilized compost, 5) sclerotia incubated in sterilized river sand, 6) sclerotia air-dried for two weeks on a laboratory bench and then incubated in sterilized moist river sand and, 7) sclerotia incubated in 0.5% water agar

Significant differences (P < 0.001) were also observed among different environmental

treatments used to induce carpogenic germination of the two isolates of the S.

sclerotiorum (Table 2). Carpogenic germination of the sclerotia of isolate MBRS-1,

tested in this study was greatest when sclerotia were subjected to constant rinsing with

tap water at 4oC. For WW-3 isolate, while the total number of sclerotia germinated was

greatest when subjected to constant rinsing with tap water, two other treatments (viz.

sterilized distilled water and sterilized river sand) produced similar high levels of

Significance of: P values l.s.d

Isolate < 0.001 0.17

Scarification < 0.05 0.17

Environmental treatmenta < 0.001 0.33

Isolate x Scarification n.s†. -

Isolate x Environmental treatment < 0.001 0.46

Scarification x Environmental treatment < 0.001 0.46

Isolate x Scarification x Environmental treatment n.s†.

CHAPTER 4

60

germination (Table 3; Fig. 1). However, sterilized distilled water and sterilized river

sand treatments resulted in sporadic germination patterns, with the majority of sclerotia

germinating only after 18 months of incubation. In contrast, the treatment involving

constant rinsing with tap water ensured reliable carpogenic germination of sclerotia of

both the isolates after only 5 months of incubation of sclerotia, with 90% of the sclerotia

germinating within the month of June itself. Further, overall carpogenic germination of

isolate WW-3, as observed across the different environmental treatments, was

significantly greater (P < 0.001) as compared to the isolate MBRS-1 (Table 2; Fig. 1).

Number of stipes observed per sclerotia varied from 1 to 5, with a median value of 1.0.

Moreover, for treatment 1, approx. 5% of the sclerotia of isolate MBRS-1 (when both

scarified and un-scarified sclerotia were taken together) appeared to have rotted.

0

10

20

30

40

50

60

1 2 3 4 5 6 7

Environmental treatments for carpogenic germination of S. sclerotiorum

Mea

n va

lue

of s

cler

otia

ger

min

ated MBRS-1

WW-3

Figure 1 The mean value of sclerotia germinated (scarified and un-scarified, taken together) for two isolates of Sclerotinia sclerotiorum. Error bars indicate the standard errors associated with the mean value of sclerotia germinated per treatment. The X- axis represents the various environmental treatments for stimulating carpogenic germination: 1) sclerotia incubated in sterilized distilled water, 2) sclerotia placed in water with constant aeration at 4oC, 3) sclerotia subjected to constant rinsing with tap water, 4) sclerotia cold-conditioned for four weeks at 4oC and then transferred into moist unsterilized compost, 5) sclerotia incubated in sterilized river sand, 6) sclerotia air-dried for two weeks on a laboratory bench and then incubated in sterilized moist river sand and, 7) sclerotia incubated in 0.5% water agar.

CHAPTER 4

61

Table 3 Carpogenic germination of scarified and un-scarified sclerotia from two isolates (MBRS-1 and WW-3) of Sclerotinia sclerotiorum when pre-conditioned with seven environmental treatments.

Number and percentage germinateda

Treatmentsb

Isolate Scarification 1 2 3 4 5 6 7

MBRS-1 Scarified 0(0) 2.68(30.0) 4.74(90.0) 1.14(7.00) 0.71(4.0) 0(0) 0.60(3.0)

Un-scarified 0(0) 2.21(22.0) 4.69(88.0) 0(0) 0(0) 0.35(2.0) 0.43(3.0)

WW-3 Scarified 4.51(82.0) 3.58(52.0) 4.87(95.00) 4.30(74.0) 4.74(90.0) 3.43(48.0) 2.36(23.0)

Un-scarified 4.82(93.0) 3.66(54.0) 4.84(94.0) 3.08(41.0) 2.76(32.0) 4.53(83.0) 3.38(46.0)

l.s.d (P < 0.05) 0,25 0.76 0.14 0.58 0.61 0.46 0.60

a25 sclerotia were tested for each replication of each treatment. Numbers in the table represent the mean values for carpogenic germination per

treatment after square root transformation, and numbers in parenthesis represent the percentage for carpogenic germination of sclerotia for the two

isolates for each environmental treatment. b1) sclerotia incubated in sterilized distilled water, 2) sclerotia placed in water with constant aeration at 4oC, 3) sclerotia subjected to constant rinsing

with tap water, 4) sclerotia cold-conditioned for four weeks at 4oC and then transferred into moist unsterilized compost, 5) sclerotia incubated in

sterilized river sand, 6) sclerotia air-dried for two weeks on a laboratory bench and then incubated in sterilized moist river sand and, 7) sclerotia

incubated in 0.5% water agar.

CHAPTER 4

62

4.4.2 Environmental treatment x scarification, isolate x scarification and isolate x

environmental treatment interactions

There was significant overall interaction between scarification and environmental

treatments (P < 0.001) in relation to the carpogenic germination. Scarification

significantly enhanced carpogenic germination of sclerotia for both the isolates but only

for certain environmental treatments, such as for sclerotia incubated in compost and in

sterilized river sand. However, for WW-3, carpogenic germination of un-scarified

sclerotia was improved, as compared to scarified sclerotia, when sclerotia were either

placed into 0.5% water agar (WW-3 only) or when air-dried for two weeks followed by

their placement into sterilized river sand. It is noteworthy that carpogenic germination

of the scarified and un-scarified sclerotia was comparable across the three treatments

where sclerotia had continuing exposure to water (i.e., sclerotia incubated in sterilized

distilled water; sclerotia placed in water with constant aeration at 4oC; and where

sclerotia were subjected to constant rinsing with tap water). However, of these three

treatments, with the constant rinsing with tap water treatment, carpogenic germination

of scarified sclerotia occurred one week earlier as compared with un-scarified sclerotia.

There was no significant interaction observed between isolates and the scarification

treatment in relation to the carpogenic germination, suggesting that enhanced

carpogenic germination in scarified sclerotia was independent of the isolate used.

There was a significant isolate x environmental treatment interaction (P < 0.001) with

respect to the carpogenic germination of the two isolates, suggesting that carpogenic

germination of the two isolates was influenced by the type of the environment

factor/treatment, as illustrated in data presented in Fig. 1.

As June, 2007, was the period when maximum carpogenic germination of WW-3 was

obtained, the effect of scarification on sclerotia subjected to constant rinsing with tap

water was also analyzed at different time intervals in this month. There were significant

differences between scarified and un-scarified sclerotia in relation to the carpogenic

germination for this isolate, showing an approximate one week earlier peaking of

carpogenic germination in scarified sclerotia compared with un-scarified sclerotia.

CHAPTER 4

63

There was no significant three-way interaction between isolate, scarification, and

environmental treatment with regard to the carpogenic germination of the sclerotia.

4.4.3 Seasonal rhythm of the two isolates in response to the time of the year

A seasonal rhythm-like pattern for carpogenic germination of the sclerotia of both

isolates (MBRS-1 and WW-3) was observed (Fig. 2). Maximum carpogenic

germination of the two isolates occurred from June to September for the two

consecutive years. There was little germination of sclerotia for MBRS-1 outside of this

period with only a few germinating over the period of October to December in second

year (Fig. 2). In contrast, there was relatively more germination outside the months from

June to September for isolate WW-3, as compared to MBRS-1, with some sclerotial

germination also occurring from January to May, 2007 and from September, 2007 to

May, 2008 (Fig. 2).

0

2

4

6

8

10

12

14

16

18

Jan-07

Feb-07

M ar-07

Apr-07

M ay-07

Jun-07

Jul-07

Aug-07

Sep-07

Oct-07

Nov-07

Dec-07

Jan-08

Feb-08

M ar-08

Apr-08

M ay-08

Jun-08

Jul-08

Aug-08

Oct-08

Nov-08

Dec-08

Time of the year

Mea

n va

lue

of s

cler

otia

ger

min

ated

M BRS-1

WW-3

LSD (M BRS-1)

LSD (WW-3)

Figure 2 The mean value of sclerotia showing carpogenic germination (per month) for two isolates (MBRS-1 and WW-3) of Sclerotinia sclerotiorum from January 2007 to December 2008. Numbers presented represent the mean values of total sclerotial (scarified and un-scarified) germination across all the environmental treatments for each isolate separately.

4.5 DISCUSSION

This is the first report, both of the enhanced carpogenic germination following

scarification and for the environmental factors that enhance carpogenic germination of

scarified sclerotia of S. sclerotiorum.

CHAPTER 4

64

Overall, carpogenic germination of scarified sclerotia was significantly better as

compared with un-scarified sclerotia, possibly for one or both of the following reasons:

Firstly, sclerotia of S. sclerotiorum are mainly comprised of two layers, an outer

pigmented rind and a medulla of prosenchymatous tissue (Saito, 1973; Kohn, 1979;

Willets and Wong, 1980). The primordia which originate from the medulla rupture the

rind and form young apothecial stipes (Saito, 1973). Artificial abrasion of the rind in

this study may have encouraged carpogenic germination of sclerotia as primordia

developing directly underneath of the ruptured rind may have greater opportunity to

grow as apothecial stipes. Secondly, the rind can also impose a constitutive dormancy of

the sclerotia because of being thick-walled and highly melanized (Coley–Smith and

Cooke, 1971). The act of physical scarification of the sclerotia may help in breaking this

dormancy by facilitating increased diffusion of oxygen and moisture through the

scarified surface, as these factors have been reported as essential for carpogenic

germination in S. sclerotiorum (Morrall, 1977; Bardin and Huang, 2001; Wu and

Subbarao, 2008).

There were significant interactions (P < 0.001) between scarification and the various

environmental factors tested and/or applied to stimulate carpogenic germination of

sclerotia of S. sclerotiorum. For instance, scarified sclerotia had higher levels of

carpogenic germination when incubated in compost or in sterilized river sand. In

contrast, carpogenic germination of un-scarified sclerotia was improved, as compared to

scarified sclerotia, when they were either placed into 0.5% water agar (WW-3, only) or

when air-dried for two weeks followed by their placement into sterilized river sand

(particularly for isolate WW-3).

It is noteworthy that carpogenic germination of the scarified and un-scarified sclerotia

was comparable where sclerotia had continued exposure to water in the three treatments

where sclerotia were incubated in sterilized distilled water, placed in water with

constant aeration at 4oC, or where subjected to constant rinsing with tap water.

However, of these three treatments, it was with constant rinsing with tap water that

carpogenic germination of the scarified sclerotia occurred one week earlier as compared

with un-scarified sclerotia. Moreover, it is interesting that the overall carpogenic

CHAPTER 4

65

germination for both isolates tested was greatest for this same treatment (constant

rinsing with tap water). Although, germination of sclerotia of isolate WW-3 incubated

in sterilized distilled water and in sterilized river sand were similar as with constant

rinsing with tap water (Fig. 1), sclerotia in the former two treatments, however, showed

an inconsistent germination pattern with most sclerotia germinating only after 18

months of incubation. In contrast, sclerotia of both isolates when placed under constant

rinsing with tap water, germinated after only 5 months. These findings are consistent

with Dillard et al. (1995) where carpogenic germination of the sclerotia was observed to

be the greatest when they were subjected to constant rinsing with water for 8 weeks.

The need for adequate oxygen and continuous exposure to water in order to break down

the sclerotial reserve material (i.e. required for carpogenic germination) (Bullock et al.,

1983) could explain the enhanced germination observed from constant rinsing with tap

water. Moreover, sclerotia of S. sclerotiorum are known to excrete many soluble

carbohydrates, salts, amino acids, proteins, lipids and enzymes during the development

and maturation phase (Chet and Henis, 1975; Willetts and Wong, 1980). These may also

include a range of sugars (e.g., glucose, sucrose and trehalose) and other organic and

inorganic compounds that have been reported to inhibit sclerotial germination (e.g.,

Steadman and Nickerson, 1975). Therefore, the enhancement of germination observed

with constant rinsing with tap water could also be a consequence of the leaching of the

inhibitory compounds present in the form of dried exudates on the sclerotial surface, as

suggested by Dillard et al. (1995).

Carpogenic germination of sclerotia of both isolates of S. sclerotiorum placed in water

with constant aeration and in sterilized distilled water was much less effective in

comparison with constant rinsing with tap water. This was despite all three methods

involving continual exposure of sclerotia to water. This difference could perhaps be due

to the presence of the inhibitors of carpogenic germination being contained within the

container for the first two treatments, but leached away in the treatment involving

constant rinsing with tap water. This may also be related to the substrate used for bulk

production of the sclerotia (Smith and Boland, 1989; Cobb and Dillard, 1996).

CHAPTER 4

66

A seasonal rhythm-like pattern in relation to the carpogenic germination from both

isolates of S. sclerotiorum tested was observed in this study (Fig. 2). The majority of

sclerotia for both isolates germinated between the months of June to September during

the two consecutive years (2007-08, 2008-09). The presence of a “biological clock”

relying on the accumulated information of daily photoperiodic changes and other

physical cues such as temperature, moisture and humidity has been suggested for insects

(Danks, 2005), with its proposed function being to provide an internal measure of the

external time (Bell-Pedersen et al., 1996). This is also evident in the present study

where the majority of carpogenic germination of sclerotia was initiated at and following

the arrival of appropriate seasonal timing and climatic conditions coinciding with the

availability of the host crop, including the flowering period. It is possible that the

exposure of sclerotia to extremely hot dry summers and then subsequently to cool wet

cropping seasons in the Mediterranean regions of southern Australia could be related to

the development of a seasonal rhythm-like pattern of S. sclerotiorum, as this could offer

a significant competitive advantage to the pathogen. Ideally, further studies on

carpogenic germination that examine the effects of age of sclerotia and include setting

experiments across different periods of the year, utilizing sclerotia from different

climatic zones and monitoring carpogenic germination under a range of different

controlled environment conditions, are needed to confirm these findings. Further,

studies at molecular level, such as those conducted for the Neurospora crassa circadian

system (de Paula et al., 2006; Dunlap and Loros, 2006), could then help to elucidate the

mechanism(s) involved.

As indicated above, overall, scarification or constant rinsing with tap water enhanced

the carpogenic germination of sclerotia under the environmental conditions that were

deployed in this study. Similarly, in the Mediterranean climate of southern Australia, it

may be possible that the opening rainfall events in the early winter period after the hot-

dry summer period could provide a somewhat similar “scrubbing effect” as that of

treatment conditions that were imposed in this study. Further, the unique soil

environment of the Mediterranean regions of southwest of Western Australia affects the

saprophytic and parasitic phases of fungal plant pathogens (Sivasithamparam, 1993).

This environment has also been shown to affect ageing and dormancy of seed in unusual

CHAPTER 4

67

ways (Tieu, 2000; Tieu et al., 2001), with their timing of germination coinciding with

the breaking rains following a hot period of the Mediterranean summer. However, it

remains a challenge to correlate the findings on factors influencing carpogenic

germination observed in this study directly with the influence of the complex

combinations of variable environmental factors operating under field conditions. Future

work based on confirming the results of similar conditioning treatments that were

deployed in this study, but involving burial of variously conditioned sclerotia in the

field under different climatic conditions, could help not only in developing prediction

models for carpogenic germination, and but also could lead to development of a disease

forecasting system for Sclerotinia for Brassica spp. in Australia as reported for lettuce

by Clarkson et al. (2007, 2004).

Overall, this study has shown, not only that carpogenic germination of scarified

sclerotia was significantly improved as compared with the un-scarified sclerotia, but,

that carpogenic germination was further enhanced by some environmental factors, such

as incubation of sclerotia in compost or in sterilized river sand. Moreover, while

carpogenic germination of scarified and un-scarified sclerotia was comparable within

the treatments where a continual supply of the water was maintained, scarified sclerotia

germinated slightly earlier than un-scarified sclerotia when subjected to constant rinsing

with tap water. Of all the environmental treatments, constant rinsing with tap water

maximized the carpogenic germination of the two isolates used in this study. The

seasonal rhythm-like pattern observed in this study in relation to the carpogenic

germination of S. sclerotiorum has not been previously reported and further

investigations into this aspect may offer valuable insights into pathogen behavior in the

field.

CHAPTER 5

68

CHAPTER 5 The Infection Processes of Sclerotinia sclerotiorum in cotyledon tissue of a resistant and susceptible genotype of Brassica napus

5.1 ABSTRACT

Sclerotinia sclerotiorum can attack more than 400 plant species worldwide. Very few

studies have investigated host-pathogen interactions at the plant surface and cellular

level in resistant genotypes of oilseed rape/canola (Brassica napus). The infection

processes of S. sclerotiorum on two B. napus genotypes, one resistant cv. Charlton and

one susceptible RQ001-02M2 by light and scanning electron microscopy from 4 hours

post inoculation (hpi) to 8 days post inoculation (dpi) were examined. The resistant cv.

Charlton impeded fungal growth at 1, 2 and 3 dpi, suppressed formation of appresoria

and infection cushions, caused extrusion of protoplast from hyphal cells and produced a

hypersensitive reaction. At 8 dpi, whilst in Charlton pathogen invasion was mainly

confined to the upper epidermis, in the susceptible RQ001-02M2, colonization up to the

spongy mesophyll cells was evident. Calcium oxalate crystals were found in the upper

epidermis and in palisade cells in susceptible RQ001-02M2 at 6 dpi, and throughout leaf

tissues at 8 dpi. In resistant Charlton, crystals were not observed at 6 dpi, whereas at 8

dpi they were mainly confined to the upper epidermis. Starch deposits were also more

prevalent in RQ001-02M2. This study demonstrates for the first time at the cellular

level that resistance to S. sclerotiorum in B. napus is a result of retardation of pathogen

development both on the plant surface and within host tissues. The resistance

mechanisms identified in this study will be useful for engineering disease resistant

genotypes and for developing markers for screening for resistance against this pathogen.

CHAPTER 5

69

5.2 INTRODUCTION

Sclerotinia sclerotiorum, the causal agent of stem rot, is a necrotrophic and non host-

specific fungal pathogen which can attack more than 400 plant species worldwide and is

now considered a serious threat to many economical important crops including soybean,

peanut and oilseed rape/canola (Brassica napus) (Boland and Hall, 1994; Hegedus and

Rimmer, 2005). Disease management through chemical and cultural practices is largely

unreliable and the level of host resistance to this pathogen is inadequate (Bolton et al.,

2006; Li et al., 2008). Studies of host-pathogen interactions at the cellular level will

contribute to development of more effective disease control measures (Lumsden, 1979;

Tariq and Jeffries, 1986).

The compatible interaction of S. sclerotiorum with several different host species has

been studied since the pioneering work of deBary (1886, 1887), who investigated the

formation of appresoria from germinating ascospores, and penetration dependence of

the mycelium upon the nutrient status of the inoculum. Subsequent studies undertaken

in bean (Lumsden and Dow, 1973; Abawi et al., 1975; Lumsden and Wergin, 1980;

Tariq and Jeffries, 1986), soybean (Sutton and Deverall, 1983), lettuce (Purdy, 1958;

Tariq and Jeffries, 1984), tomato (Purdy and Bardin, 1953; Purdy, 1958), potato (Jones,

1976), pea (Huang and Kokko, 1992), sunflower (Sedun and Brown, 1987) as well as in

oilseed rape/canola (Jamaux et al., 1995; Huang et al., 2008), investigated the infection

processes of S. sclerotiorum in compatible interactions. These studies confirmed that an

appropriate nutrient source such as flower petals, injured or senescent plant tissue is

required by the germinating ascospores both to establish a saprophytic phase and for

successful infection of healthy plants.

A few studies have examined the interaction between the pathogen and a resistant

genotype at the cellular or histological level including Dow and Lumsden (1975) in

common bean, Mondolot-Cosson and Andary (1994) and Rodriguez et al. (2004) in

sunflower. However, no such attempts have been made with resistant genotypes of

oilseed rape/canola. Studies of infection processes in incompatible interactions may

have been hampered due to the lack of material with resistance against this pathogen.

The situation is further exacerbated where adequate nutrients are availabile to the

CHAPTER 5

70

pathogen which encourages rapid ramification of the tissues, giving the host little time

to engage defence responses. For example, when colonized agar pieces or petals were

superimposed on leaves, formation of infection cushions led to invasion within a few

hours of inoculation (Lumsden and Dow, 1973; Abawi et al., 1975; Huang et al., 2008).

This study describes in detail the previously unreported infection processes of S.

sclerotiorum on cv. Charlton cotyledons, which has been shown to have resistance

against this pathogen (Garg et al., 2010b/Chapter 3). A moderately pathogenic strain

(i.e., an isolate with an intermediate reaction to several Brassica napus genotypes) of S.

sclerotiorum along with resistant and susceptible genotypes (Garg et al., 2010b/Chapter

3) was used. An artificial minimal medium (Leone and Tonneijck, 1990) instead of

flower petals or agar pieces was further used, to extend the initial interface between host

and the pathogen prior to cytological damage to the tissue. Results showed that the

factors involved in the expression of resistance against S. sclerotiorum in cv. Charlton

are impeded fungal growth, suppression of infection cushion development, protoplast

extrusion from hyphal cells and a hypersensitive response.

5.3 MATERIALS AND METHODS

5.3.1 Host genotypes

Two spring type B. napus genotypes, viz. Charlton and RQ001-02M2, were used in this

study. Charlton has resistance to S. sclerotiorum while RQ001-02M2 is highly

susceptible (Garg et al., 2008; Garg et al., 2010b). Both genotypes were grown in 13.7 x

6.6 x 4.9 cm trays, each having eight cells and containing a soil-less compost mixture

(Garg et al., 2008). Four seeds of each genotype were sown in each cell and thinned to

two seedlings per cell after emergence. Both genotypes were grown under controlled

environment conditions in a growth room at 18/14 (± 1) oC (day/night) with light

intensity of 150 µE m–2 s–1 (Garg et al., 2008) for 12 hours light/dark cycles. Seedlings

were grown until cotyledons were fully expanded, equivalent to growth stage 1.00 on

the scale given by Sylvester-Bradley and Makepeace (1984).

CHAPTER 5

71

5.3.2 S. sclerotiorum isolate

A single isolate of S. sclerotiorum WW-3, collected in 2004 from the Walkaway region

of Western Australia from a severely affected oilseed rape/canola crop was used

through out this study. The WW-3 isolate was previously reported to be moderately

pathogenic on several B. napus genotypes (Garg et al., 2010b/Chapter 3). Isolation,

surface sterilization and multiplication from a field-collected sclerotium were performed

as described by Clarkson et al. (2003).

5.3.3 Inoculum production

Apothecial production of isolate WW-3 was undertaken as described by Garg et al.

(2010c; Chapter 4). Apothecia bearing mature ascospores were formed after 3 months

incubation of pre-conditioned sclerotia in sterilized river sand in Petri plates. The

apothecia thus produced released ascospores for two weeks. Ascospores were collected

on a Millipore filter paper (Whatman, 42, Ashless, 125mm) by inverting a funnel

(containing the filter paper) over the Petri plate and by applying vacuum suction

(Steadman and Cook, 1974; Hunter et al., 1982). The filter paper with ascospores were

stored at 4oC in a desiccator containing silica gel (Ajax Finechem, NSW, Australia)

until needed as suggested by Steadman and Cook (1974) and Hunter et al., (1982).

5.3.4 Inoculum preparation, inoculation conditions and inoculation procedure

Individual cells containing two Brassica seedlings were placed in separate relative

humidity (RH) chambers to eliminate any possibility of cross contamination. Each RH

chamber comprised a 1 L snap-lock glass jar (Luminarc®, France) containing approx.

50 ml of a saturated salt solution of ZnSO4 to maintain RH above 90% at 18oC (Sun,

2002; Young, 1967). A support for each individual cell was made from mouldable

plastic mesh. Humidity levels and temperatures in individual jars were confirmed using

a humidity and temperature measuring meter (HM34C, VAISALA, Vic, Australia).

Two types of ascospore suspensions were prepared for inoculation of the seedlings. In

the first instance, free ascospores were obtained by immersing the filter paper

containing ascospores into deionised (DI) water. In the other instance, filter paper with

ascospores were immersed in a Pi-glucose medium (62.5 mM KH2PO4 + 5.5 mM

CHAPTER 5

72

glucose). This latter option was reported previously as a reliable medium to obtain leaf

lesions with ascospores of S. sclerotiorum in bean cultivars (Leone and Tonneijck,

1990). Ascospore concentration in both DI water and Pi-glucose medium was adjusted

to 2 x 106 spores ml-1 as suggested by Leone and Tonneijck (1990) using a

haemocytometer (SUPERIOR®, Berlin, Germany).

Three different inoculation treatments were performed, viz. 1) both B. napus genotypes

inoculated separately with an ascospore suspension prepared in a Pi-glucose medium, 2)

both genotypes inoculated separately with an ascospore suspension prepared in DI

water, and 3) both types of ascospore suspensions (i.e., prepared in Pi-glucose medium

or in DI water) were deposited separately on to glass microscope slides (Livingstone,

NSW, Australia). For the first and second inoculation, treatments, each cotyledon was

inoculated with four droplets (10 µL) ascospore suspension, with one drop on each

cotyledon lobe using a micropipette. For control comparison, 10 µL of DI water was

deposited onto each of the four cotyledon lobes as described above. A very fine mist of

water was sprayed by a hand-held mister both over cotyledons and on the insides of the

chamber lids. The glass microscope slides were placed in Petri dishes lined with wet

filter paper to maintain high humidity for spore germination. There were six replications

for each treatment for the samples taken for light microscopy studies and three

replications for each treatment for those taken for internal microscopy studies. Each RH

chamber containing B. napus seedlings and Petri dishes containing glass slides were

randomly placed on shelves inside a incubator (Model TLMRIL 396-1-SD-ADF,

Thermoline L+M, Australia) set at 18 ± 1oC day and 14 ± 1oC night (12 /12 h, 2x 15 W

cool white fluorescent tubes, average light intensity 50 µE m –2 s –1) for 12 hours

light/dark cycles. The chambers were monitored daily to maintain saturated salt

solutions and a constant level of RH.

5.3.5 Sample preparation for light microscopy

Inoculated cotyledons were sampled at 4 and 12 hours post inoculation (hpi), and then

daily for 6 days post inoculation (dpi). A total of six cotyledons (one from each replicate

plant from each treatment) were sampled at each of the eight time points. Sampled

cotyledons were decolourised in an acetic acid : ethanol : water (2:2:1) solution at 25oC.

CHAPTER 5

73

Cotyledons were then washed with two changes of DI water and stained with 1% cotton

blue in lactophenol (Hua Li et al., 2004). Whole wet mounts of cotyledons on

microscope glass slides were examined and photographed using a Zeiss Axioplan 2

microscope with an AxioCam digital photograph system with bright field optics (Hua Li

et al., 2007a; 2007b). One hundred spores were counted at six random fields of view per

cotyledon for six replication (one from each replicate plant from each treatment) ( (i.e.,

600 spores per treatment). The percentage spores germinated, hyphal penetration and

size of the appresoria were determined. The length of aerial hyphae and diameter of

protoplast extruded from fungal cells were measured by observing fifty spores at

random at inoculated sites across six cotyledons in each treatment at 12 hpi and daily

for 3 dpi.

5.3.6 Sample preparation for anatomical studies

Cotyledons were sampled for anatomical studies at 4, 6 and 8 dpi. Three cotyledons

were taken from each treatment and prepared for glycol methacrylate (GMA) biological

tissue sampling as described by Hua Li et al. (2004). Cross sections were stained for

detection of polyphenols and lignin (0.5% Toluidine Blue O in benzoate buffer, pH 4.4),

starch [periodic Acid/Schiff’s (PAS) reagent], and suberin (saturated Sudan Black B in

70% ethanol) (O’ Brien and McCully, 1981). Histochemical detection of calcium

oxalate crystals was performed as described by Yasue (1969) and Bonner and Dickinson

(1989). Control sections for studies in relation to calcium oxalate crystals were

immersed in 5 % acetic acid to remove calcium phosphate and carbonate, and then

stained as described by Yasue (1969). Sections were studied and photographed using

the Zeiss Axioplan 2 system as described above. In addition, unstained GMA sections

were also studied using the same microscope system, but with an excitation filter (G

365) and an emission filter (LP 420) inserted into a beam of incident light from a

mercury vapor lamp.

5.3.7 Sample preparation for scanning electron microscopy (SEM) studies

Plants were sampled at 4 hpi, 12 hpi and daily for 4 days. The infected segments of the

cotyledon were fixed in 2.5% glutaraldehyde in 0.05M phosphate buffer, pH 7, at 25oC

for 24 hours. Samples were then processed using the following microwave (PELCO,

BioWave Microwave Processor) preparation method. Specimens were vacuum

CHAPTER 5

74

infiltrated for 6 min (2 min on/2 min off/2 min on) at 80 W followed by washing with

0.05M phosphate buffer for 40 s at 80W. Samples were then dehydrated through a series

of ethanol solutions ranging from 50% to 100% (dry ethanol) and finally twice with 100

% dry acetone for 40 s at 250 W. Samples were then critically point dried (PELCO

Critical Point Dryer) using liquid carbon dioxide, sputter coated with gold and

examined using a JEOL 6400 scanning electron microscope (JEOL Ltd, Tokyo, Japan).

5.3.8 Statistical analysis

The ascospore germination and hyphal elongation data were analyzed separately by

analysis of variance using GenStat® (9th Edition, Lawes Agricultural Trust, Rothamsted

Experimental Station, UK). Fisher’s least significant differences (P < 0.05) were used

to calculate the differences between the two B. napus genotypes and inoculation

treatments. Average number of cells with starch deposits were determined by counting

the number of cells showing these interactions in six random sections taken for each of

the three replications of each genotype at every time course for internal anatomical

studies.

5.4 RESULTS

5.4.1 Ascospore germination and fungal development in DI water

Ascospore germination and fungal development on glass slides, resistant Charlton and

susceptible RQ001-02M2 when ascospore suspensions were prepared in DI water

Ascospore germination began within 2 hpi on both the resistant and susceptible

genotypes as well as on glass slides. Germination was observed as either a small

swelling at the end of the spore or a very short germ tube. More than 90% of the

ascospores germinated by 4 hpi, and there were, no significant differences between

glass slides, resistant or susceptible genotypes irrespective of whether ascospore

suspension was prepared in Pi-glucose medium or in DI water (Fig. 1A). Approximately

2% of ascospores exhibited germ tube elongation with average hyphal length of 16.0

µm at 12 hpi, but no further elongation of fungal hyphae was observed at 1 dpi.

CHAPTER 5

75

5.4.2 Ascospore germination and fungal development in Pi-glucose medium

Ascospore germination and fungal development on glass slides, resistant Charlton and

susceptible RQ001-02M2 when ascospore suspensions prepared in Pi-glucose medium

5.4.2.1 4 hpi

Germination of ascospores was observed within 2 hpi. At 4 hpi, there were no

significant differences between responses on glass slides, resistant or susceptible

genotypes irrespective of whether ascospore suspension was prepared in Pi-glucose

medium or in DI water (Table 1).

5.4.2.2 12 hpi

Germ tubes that emerged from ascospores continued growth on the upper surface of the

cotyledon (Fig. 1B). Hyphal length was significantly less (P < 0.001) on glass slides

(14.9 µm) compared with either resistant Charlton or susceptible RQ001-02M2 which

both had hyphal lengths of approx. 28 µm (Table 1).

5.4.2.3 1 dpi

Fungal hyphae continued growth on the surface of cotyledons of both genotypes (Fig.

1C) and on glass slides, and one or two very small lateral branches emerged from the

hyphae were also apparent (Fig. 1D). There was a significant increase (P < 0.001) in

hyphal length, especially on the susceptible RQ001-02M2, increasing from 28.0 µm at

12 hpi to 113.0 µm at 1 dpi. Significant increases (P < 0.001) in hyphal length were also

observed on cotyledons of the resistant Charlton with mean values progressing from

27.8 µm at 12 hpi to 70.8 µm at 1 dpi; as compared with glass slides where only a small

increase in hyphal length was observed from 14.9 µm at 12 hpi to 23.7 µm at 1 dpi

(Table 1). The mean value for hyphal length on the susceptible RQ001-02M2 (113.03

µm) was significantly greater (P < 0.001) than on the resistant Charlton (70.8 µm) by 1

dpi. In addition, slightly swollen hyphal apices were also observed, mainly on

susceptible RQ001-02M2 and on glass slides at 1 dpi (Table 2; Fig. 1C).

5.4.2.4 2 dpi

There was a slight increase in the length of aerial hyphae on cotyledons of both resistant

Charlton (from 70.8 to 77.2 µm) and susceptible RQ001-02M2 (from 113.0 to 122.7

CHAPTER 5

76

µm) at 2 dpi compared with 1 dpi. In contrast, a significant increase (P < 0.001) in

aerial hyphae length was observed on glass slides with mean values progressing from

23.7 µm at 1 dpi to 96.3 µm by 2 dpi. Moreover, lateral branches also increased in

length on both genotypes (Fig. 1E), and on glass slides (data not shown). The hyphal

apices on the surface of cotyledonary tissue of susceptible RQ001-02M2 (Fig. 1E) as

well as on glass slides showed dichotomous branching that gave rise to simple

appresoria. However, dichotomous branching of the terminal hyphae was not evident in

the resistant Charlton, despite a slight increase in diameter of the hyphal cells being

apparent in this genotype by 2 dpi (Table 2; Fig. 1F). Penetration of both host genotypes

by swollen hyphal apices at 2 dpi was observed where complex appresoria were not

formed. Both types of penetration i.e. stomatal penetration (Fig. 1G) and cuticular

penetration (Fig. 1H, 1I) were observed on both resistant Charlton and susceptible

RQ001-02M2. There were no differences between the resistant Charlton and susceptible

RQ001-02M2 in relation to the mode of penetration at this stage of the infection process

(data not shown).

5.4.2.5 3 dpi, and onwards

There was a significant increase (P < 0.001) in the length of fungal hyphae from 122.7

µm at 2 dpi to 347.9 µm at 3 dpi on the susceptible RQ001-02M2. However, there was

no further increase in hyphal length on the resistant Charlton or on glass slides (Table

1). Lateral branch lengths increased on both genotypes and on glass slides from 2 dpi to

3 dpi. Measurement of length of aerial hyphae was not possible by 4 dpi on the

susceptible RQ001-02M2 because of extensive growth of both primary hyphae and of

lateral branches. In addition, hyphae growth on the surface of cotyledon tissue of the

susceptible RQ001-02M2 at certain inoculation sites frequently appeared as dense

hyphal “mounds” as a result of the extensive mycelial growth at 4 dpi.

The sequence of events leading to the formation of appresoria from hyphal apices was

similar on glass slides and the susceptible RQ001-02M2. Simple appresoria apparent by

2 dpi (Fig. 1E), were further branched with more complex appresoria formed by 3 and 4

dpi (Fig. 1J). Repeated dichotomous branching of these appresoria eventually resulted

in dome shaped infection cushions by 6 dpi (Table 2; Fig. 1K). In contrast, no

appresoria or infection cushions were observed on the resistant Charlton.

CHAPTER 5

77

In addition to the impeded hyphal growth on the resistant Charlton, a significant

interplay was observed between the pathogen and resistant Charlton at 3 and 4 dpi.

Firstly, protoplast extrusions from the hyphal cells were observed, which were either

accompanied by cytoplasm shrinkage and/or an increase in hyphal cell diameters (Table

2; Fig. 1L); however, not in all instances (Fig. 1M). Secondly, there was an increase in

diameter of hyphal cells with time followed by the disintegration of the hyphal cell wall

resulting in the liberation of its contents (Fig. 1N). Extruded protoplasts were either

spherical in shape at average diameter of 3.9 µm (Fig. 1L), or amorphous (Fig. 1O,

2A). These were observed either at intercalary sites from within the fungal cells (Fig.

1L, M), or as bud-like extrusion of protoplast mainly at the apex of the hyphae (Fig.

2B). In some instances, protoplast extrusion was synchronous, occurring from

consecutive hyphal cells (Fig. 2C); in others, fewer hyphal cells extruded protoplasts.

Following the release of protoplasts, hyphal cells were found to be devoid of

cytoplasmic content by 5 dpi or 6 dpi (Fig. 2A).

5.4.3 Anatomical differences

5.4.3.1 4 dpi

In the susceptible RQ001-02M2, hyphae grew within intercellular spaces after

penetration and invaded the palisade mesophyll cells, with browning and

disorganization of epidermal cells beneath the germinated ascospores. In contrast, in the

resistant Charlton, fungal invasion was confined to upper epidermal layer (Table 3).

While, starch deposits were observed by this stage in both genotypes, they were,

however, more prevalent in susceptible RQ001-02M2 in the palisade mesophyll layer,

showing an average of 13 cells with starch grains per field of view at 100 x

magnification (Table 3; Fig. 2D) as compared to resistant Charlton, showing an average

of 3 cells per field of view at 100 x magnification. In addition, a hypersensitive reaction

was clearly evident in resistant Charlton, with cytoplasmic disorganization and darkly

stained areas around the dead palisade mesophyll cells evident at 4 dpi (Fig. 2E). While

cell death of some palisade mesophyll cells was also observed in susceptible RQ001-

02M2, no darkly stained areas were visible around these cells.

CHAPTER 5

78

5.4.3.2 6 dpi

Palisade mesophyll tissue of the susceptible RQ001-02M2 was extensively colonized by

mycelia in both intercellular and intracellular spaces, particularly where starch grains

were pronounced (Fig. 2F). The entire epidermal cell layer and the majority of

associated palisade mesophyll tissue were collapsed where infection cushions were in

close proximity (Fig. 2F). In contrast, fungal invasion was mainly confined to epidermal

layer in resistant Charlton, with only a few palisade mesophyll cells invaded by the

fungal hyphae and only in those areas where starch deposits were found. However,

extensive areas of disorganized protoplasts in the palisade mesophyll layer and

underneath the intact upper epidermis were evident in this genotype indicating a

hypersensitive reaction (Fig. 2G). Oxalic acid crystals, that were histochemically shown

to be calcium oxalate crystals, were visible in the epidermal and palisade mesophyll

tissues of susceptible RQ001-02M2 (Table 3; Fig. 2H). In contrast, in resistant

Charlton, no calcium oxalate crystals were found at this stage (Fig. 2I). While the

average number of cells with starch deposits in the resistant Charlton at 6 dpi were

similar to 4 dpi, it was not possible to count the number of cells with starch deposits in

the susceptible RQ001-02M2 because of the extensive deterioration of the palisade

mesophyll layer by the pathogen.

5.4.3.3 8 dpi

Hyphae continued growing in intercellular and intracellular spaces in susceptible

RQ001-02M2 and spongy mesophyll tissues were eventually invaded along with

extensive damage to palisade mesophyll cells. In contrast, colonization by the pathogen

was generally restricted to the epidermal layer in resistant Charlton (Fig. 2J), apart from

a very few cells in the palisade mesophyll layer where starch deposits were present.

Furthermore, calcium oxalate crystals were found in susceptible RQ001-02M2

throughout the leaf tissues from the upper epidermal to lower epidermal layers (Fig. 2K)

and the crystals were also observed in advance of the invading hyphae. While, calcium

oxalate crystals were also present in resistant Charlton, they were mainly confined to the

upper epidermal cells except for a very few palisade mesophyll cells where both starch

deposits and hyphal invasion were observed (Fig. 2L). The average number of cells with

starch deposits in resistant Charlton increased to 12 cells per field of view at 100x

CHAPTER 5

79

magnification by 8 dpi, similar to the number of cells with starch deposits in susceptible

RQ001-02M2 by 4 dpi (Table 3).

5.5 DISCUSSION

This study describes, for the first time, the factors involved in the infection processes of

S. sclerotiorum that are responsible for resistance to S. sclerotiorum in a resistant B.

napus genotype (cv. Charlton). The absence of significant differences between

ascospore germination on glass slides, resistant Charlton or susceptible RQ001-02M2 at

4 hpi, irrespective of whether water or the nutrient (Pi–glucose) medium was used for

preparing spore suspensions, suggest that signals for germination of ascospores are

triggered by the availability of adequate moisture and corroborate earlier findings of

Purdy (1958), Sutton and Deverall (1983) and Jamaux et al. (1995). These results

further suggest that both resistant Charlton and susceptible RQ001-02M2 are equally

likely to be infected at this early stage. Germ tubes emerging from ascospores only

continued growth when the ascospore suspension was prepared with Pi–glucose

medium. This confirmed the earlier studies demonstrating that the presence of nutrients

is essential for hyphal development, penetration and for subsequent establishment of a

successful invasion of a susceptible host by this pathogen (e.g., Abawi and Grogan,

1975; Jamaux et al., 1995). Furthermore, the frequency of stomatal and cuticular

penetration was similar on resistant Charlton and as on susceptible RQ001-02M2.

It is noteworthy that interplay between S. sclerotiorum and the cotyledons of the

resistant Charlton or susceptible RQ001-02M2 were evident by 1 dpi. Hyphal growth on

the cotyledons of the resistant Charlton was significantly impeded as measured at 1, 2

and 3 dpi. These results confirmed the earlier findings of Dow and Lumsden (1975)

where small and distorted infection hyphae were observed in disease-resistant tissues of

P. coccineus against S. sclerotiorum. Moreover, enhancement of hyphal activity on

susceptible tissue as compared with resistant Charlton and with glass slides, suggests

that signals from the susceptible RQ001-02M2 prompted hyphal activity on its surface.

In contrast, significantly impeded hyphal growth on the surface of resistant Charlton

suggests that this genotype produces certain antifungal/fungistatic compounds, as

suggested by Kowalska and Niks (1999) for a resistant flax (Linum usitatissimum)

CHAPTER 5

80

genotype against Melampsora lini and by Blakeman and Sztejnberg (1973) in beetroot

(Beta vulgaris) against Botrytis cinerea.

Infection cushions and/or complex appresoria were observed on the surface of glass

slides and on the susceptible genotype, but not on the resistant genotype. This is in

contrast to Dow and Lumsden (1975), who reported secondary infection cushions

beneath the cuticle and adjacent to the epidermis layer even in a resistant genotype of P.

coccineus. Further, it has been suggested that the complexity of the appresoria depends

on the nutritional status of the inoculum and the physical resistance of the surface that is

encountered by the fungus (Abawi et al., 1975; Tariq and Jeffries, 1984). However, the

complete absence of infection cushions on resistant Charlton indicates active

suppression of the infection cushions as a consequence of the incompatible interaction,

even though sufficient nutrients for fungal development should have been available.

Similarly, previous reports for S. sclerotiorum and other related pathogens such as S.

trifoliorum and Scleorotium rolfsii also indicated that the infection cushion assists with

breaching the cuticle barrier of the host epidermis by exerting mechanical pressure

(Boyle, 1921; Purdy, 1958; Lumsden and Dow, 1973; Lumsden and Wergin, 1980)

and/or by enzymatic dissolution of the host surface (e.g., Prior and Owen, 1964; Smith

et al., 1986; Tariq and Jeffries, 1986). From this study, it seems that active suppression

of the infection cushions by the resistant Charlton is the most important component of

the defence mechanisms through which this genotype resists penetration and

colonization by this pathogen.

The set of unique responses involving protoplast extrusion from hyphal cells only

occurred on the cotyledonary surface of the resistant Charlton. Although, there are

several reports regarding the liberation of protoplasts from filamentous fungi, including

ascomycetes, using artificial extracellular enzyme preparations such as chitinase and β-

glucanase which digest cell walls of fungal hyphae (e.g., Emerson and Emerson, 1958;

DeVries and Wessels, 1972; Dhar and Kaur, 2009), this is the first report where

protoplast extrusion from hyphal cells has been reported in any Brassica – S.

sclerotiorum pathosystem. Tariq and Jeffries (1986) described an ephemeral phase of

wall-less protoplasm in S. sclerotiorum in Phaseolus spp. when the infection peg arising

CHAPTER 5

81

from the infection cushion breached the cuticle of the host epidermis. The invading

protoplast rapidly swelled to form a subcuticular vesicle followed by the deposition of

the fungal cell wall which regained its ‘normal’ cell wall appearance. The notable

difference between their study and the present study is that the extrusion occurred on the

surface of cv. Charlton while the protoplast phase in the study of Tariq and Jeffries

(1986) occurred only within the host tissue. It is concluded that, in the present study, the

contents emerging from the fungal cells as protoplasts extrusion from hyphal cells were

not appresoria on the basis of the following arguments. Firstly, appresoria of S.

sclerotiorum on the surface of the susceptible host genotype always resulted from

dichotomous branching of the terminal hyphae (Lumsden, 1979) and not from the

intercalary hyphal cells as observed in this study. Secondly, the extensive shrinkage of

the cytoplasmic content of the hyphal cells (Fig. 2B), presence of hyphal cells devoid of

cytoplasmic content following protoplast extrusion (Fig. 2A), and disintegration of the

hyphal cells (Fig. 1N) as observed in this study, have not been previously reported.

Interestingly, different forms of protoplast extrusion were observed by light microscope

or SEM in this study, viz. bud like emergence of the protoplast from the hyphae at the

end or at the centre of the fungal hyphae (Fig. 1M, 2A), intercalary hyphal cells

swelling followed by protoplast extrusion (Fig. 1L), and, hyphal cells clearly devoid of

cytoplasmic contents following protoplast extrusion (Fig. 2A). These observations

clearly resembled those of previous reports where protoplast liberation of different

filamentous fungi was artificially induced (e.g., Bachmann and Bonner, 1959; Talburt

and Johnson, 1965; Bartnicki-Garcia and Lippman, 1966; Fenice et al., 1999), thus

supporting the idea that the contents emerging from the fungal cells were in fact

protoplast extrusions. Furthermore, extrusion of protoplasts by hyphal cells without

treatment with any extracellular enzyme preparations, suggests that the resistant

Charlton could be producing one or more cell wall degrading enzymes, such as those

reported for Brassica napus cultivar ZhongYou 821 (Zhao et al., 2009), causing a pore

or larger scale disruption of the hyphal cell wall. The occurrence of protoplast extrusion

from hyphal cells, and only on the resistant genotype, highlights the existence of a yet

undefined defence mechanism in the resistant Charlton to impede pathogen

development.

CHAPTER 5

82

Fungal invasion up to spongy mesophyll cells was observed in the susceptible RQ001-

02M2, but not in the resistant Charlton where the pathogen was generally confined to

the upper epidermis. The resistance to fungal invasion observed in the resistant Charlton

appears to be due to the hypersensitive reaction (HR) as evidenced by the localized

necrosis of the palisade mesophyll cells near the site of infection at 4 and 6 dpi . This

finding agrees with the previous finding of Garg et al. (2008/Chapter 2), where a HR

was frequently observed on the resistant Charlton. Additionally, cell death of palisade

mesophyll cells was also evident in susceptible RQ001-02M2 at 4 dpi. It is possible that

the cell death observed in susceptible RQ001-02M2 might have supported the growth of

this necrotrophic pathogen that obtains nutrients from the necrotic host tissues, similar

to the observations of Govrin and Levine (2000) in Arabidopsis thaliana, and Kim et al.

(2008) and Dickman et al. (2001) in Nicotiana tabacum. This is further evident in the

susceptible RQ001-02M2, where extensive colonization of the palisade mesophyll cells

at 6 dpi preceded the death of the same cells at 4 dpi. However, the production of

antifungal metabolites such as phytoalexins by resistant Charlton might have prevented

the invasion of mycelia into the plant tissues outside the HR lesion. This is further

supported by the histochemical examination of the HR lesions on the resistant Charlton,

where a number of darkly stained areas around the dead cells of palisade mesophyll

layer were observed when stained with toluidine blue. These darkly stained regions

indicate the presence of polyphenolic or phytoalexin compounds, similar to those

observed by Hua Li et al. (2007b) in association with infection of B. napus by

Leptosphaeria maculans, compounds known to be synthesized by plants in response to

infection or other stress conditions (Darvill and Albersheim, 1984; Beckman, 2000).

Moreover, the HR lesions observed in resistant Charlton could also be the consequence

of this particular patho-system and/or the inoculation procedure that were used in this

study.

Calcium oxalate crystals in the resistant Charlton were only observed at 8 dpi and were

mainly confined to the upper epidermis as compared with the susceptible genotype

where they were already present at 6 dpi and were observed throughout the cotyledon

tissue by 8 dpi. It has been suggested that oxalic acid produced by S. sclerotiorum, apart

from operating synergistically with pectolytic enzymes (e.g., Marciano et al., 1983;

CHAPTER 5

83

Godoy et al., 1990), also sequesters calcium from plant cell walls to form calcium

oxalate prior to the middle lamella being enzymatically degraded (Lumsden, 1979;

Punja et al., 1985; Thompson et al., 1995). A previous study of Qiu et al. (2001) also

established such crystals as calcium oxalate by SEM studies of sunflower infected with

S. sclerotiorum. Further, formation of crystals in bean and sunflower infected with S.

sclerotiorum has also been previously reported occurring in advance of the invading

hyphae (Lumsden and Dow, 1973; Smith et al., 1986). The reduced levels of calcium

oxalate crystals in the resistant Charlton is likely related to the impeded fungal growth,

as a direct relationship between mycelial growth and the amount of oxalic acid released

has been reported for Sclerotium rolfsii (Punja et al., 1985). Reduced oxalate could

possibly be caused by expression of an oxalate oxidase gene in the resistant Charlton

that promotes its oxidation into CO2 and H2O2 as reported in Helianthus annuus (Hu et

al., 2003) and in B. napus (Dong et al., 2008).

It is noteworthy that starch deposits were more prevalent in the susceptible RQ001-

02M2 as compared with the resistant Charlton by 4 dpi. In other host-pathogen

interactions particularly involving biotrophic pathogens such as rusts and powdery

mildews (Long et al., 1975; Minarcic and Janitor, 1994;) as well as with necrotrophic

fungi such as Kabatiella caulivora (Bayliss et al., 2001) or L. maculans (Hua Li et al.,

2007a), starch deposits were observed close to the infection site, as observed in this

study. Further, numerous studies, especially those involving biotrophic pathogens, have

reported pathogen interference with the source-sink relationship of the host genotype

and its ability to reprogram plant metabolism for the pathogen’s benefit such that

photosynthetic products (sucrose) start accumulating at (or near) the site of infection at

the expense of other parts of the host plant (e.g., Wright et al., 1995; Berger et al., 2007;

Kocal et al., 2008). Increase in the levels of photosynthetic products is accompanied by

the increased expression of invertase at the site of infection depending upon the type

and stage of the host-pathogen interaction (e.g., Long et al., 1975; Herbers et al., 2000;

Roitsch et al., 2003). Glucose and fructose, produced from hydrolysis of sucrose by acid

invertase (Chou et al., 2000), then undergo glycolysis leading to the formation of

triosephosphate that may penetrate into chloloplasts where it gets metabolized into

starch (Long et al., 1975). It is possible that the greater biomass of the pathogen in the

CHAPTER 5

84

susceptible RQ001-02M2 led to photosynthate accumulation within host tissues to a

greater extent as compared to the resistant genotype, and, correspondingly, increased

signals for invertase activity (Joosten et al., 1990) leading to the high starch

accumulation. The large accumulation of starch in susceptible RQ001-02M2 may have

provided the pathogen with the carbon source required for its saprophytic and parasitic

activities. This is further supported by Zhao et al. (2009) where changes in the

expression of several genes related to the carbon metabolism were found (in addition to

induction of genes related to invertase activity) in B. napus in response to S.

sclerotiorum infection, and suggested that the carbon storage reserves of the plants are

accessed and shuttled through the photorespiration pathway by this pathogen.

The current study has detailed the infection processes viz. impeded fungal growth,

active suppression of infection cushion development, protoplast extrusion, and the

hypersensitive response associated with resistance to S. sclerotiorum in B. napus and

highlighted the importance of retardation of pathogen development both on the plant

surface and within host tissues. The novel resistance mechanisms identified in this study

can be useful for strategic engineering of disease resistant genotypes and for developing

markers for screening for resistance against this pathogen.

CHAPTER 5

85

Table 1 Infection processes of Sclerotinia sclerotiorum isolate WW-3 on resistant Brassica napus cultivar Charlton and susceptible B. napus RQ001-02M2 cotyledons or on a glass surface. Analysis of variance (ANOVA) for percent ascospore germination at 4 hours post inoculation (hpi) (100 spores across six cotyledon per treatment) and hyphal length at 12 hours post inoculation, and at 1, 2 and 3 days post inoculation as an average of 50 spores across six cotyledons per treatment. Where there were significant differences, the numbers in parenthesis represent the number of degrees of freedom, the standard error of difference, and the % coefficient of variation, respectively.

Average hyphal length Hours/days post

inoculation Resistant genotype

(µm)

Susceptible

genotype (µm)

Glass slide (µm)

ANOVA of

resistant,

susceptible, and

glass slidesa

ANOVA of resistant

vs susceptibleb

ANOVA of resistant

vs glass slidesc

ANOVA of

susceptible vs

glass slidesd

4 hpi

-

-

-

ns

ns

ns

ns

12 hpi

27.8

28.1

14.9

P < 0.001

(892, 0.7, 12.3)

ns

P < 0.001

(593, 0.6, 13.4)

P < 0.001

(593, 0.6, 11.7)

1 dpi

70.8

113.0

23.7

P < 0.001

(892, 3.1, 7,9)

P < 0.001

(593, 3.7, 8.2)

P < 0.001

(593, 1.7, 24.5)

P < 0.001

(593, 3.2, 13.5)

2 dpi

77.2

122.7

96.3

P < 0.001

(892, 3.1, 4.0)

P < 0.001

(593, 3.0, 6.7)

P < 0.001

(593, 2.4, 5.2)

P < 0.001

(593, 3.7, 4.5)

3 dpi

78.4

347.9

98.8

P < 0.001

(892, 8.7, 7.5)

P < 0.001

(593, 10.2, 8.7)

P < 0.001

(593, 3.6, 6.3)

P < 0.001

(593, 10.5, 9.1)

ns’ represents not significant at P < 0.05 aOverall analysis of variance between resistant Charlton, susceptible RQ001-02M2 and glass slide data in relation to percentage of ascospores germinated (4 hpi) or hyphal length

(12 hpi, 1, 2 or 3 dpi). bAnalysis of variance between resistant Charlton with susceptible RQ001-02M2 in relation to percentage of ascospores germinated (4 hpi) or hyphal length (12 hpi, 1, 2 or 3 dpi). c Analysis of variance between resistant Charlton and glass slide in relation to percentage of ascospores germinated (4 hpi) or hyphal length (12 hpi, 1, 2 or 3 dpi). d Analysis of variance between susceptible RQ001-02M2 and glass slide in relation to percentage of ascospores germinated (4 hpi) or hyphal length (12 hpi, 1, 2 or 3 dpi).

CHAPTER 5

86

Table 2 Description of growth of Sclerotinia sclerotiorum isolate WW-3 on the surface of glass slides, resistant Brassica napus cv. Charlton and susceptible B. napus RQ001-02M2 cotyledons from 2 hours post inoculation (hpi) to 6 days post inoculation (dpi).

Hours/days post

inoculation

Resistant Susceptible Glass slide

2 hpi Ascospores beginning to germinate Ascospores beginning to germinate Ascospores beginning to germinate

4 hpi > 90 % ascospores germinated > 90 % ascospores germinated > 90 % ascospores germinated

12 hpi Germ tube elongation Germ tube elongation Germ tube elongation

1 dpi Increase in hyphal length, emergence of

small lateral branches

Increase in hyphal length, hyphal apices

swollen, emergence of small lateral

branches

Increase in hyphal length, hyphal apices

swollen, emergence of small lateral

branches

2 dpi Increase in diameter of some of the

hyphal cells, cytoplasmic content within

the hyphal cells started shrinking

Simple appressoria visible, increase in

length of fungal hyphae and of lateral

branches

Simple appressoria, increase in hyphal

length

3 dpi Extensive cytoplasm shrinkage in some of

the hyphal cells, protoplast extrusion

Complex appressoria, extensive increase

in length of fungal hyphae and of lateral

branches

Complex appressoria

4 dpi Protoplast extrusion, disintegration of the

hyphal cells

Complex appressoria Complex appressoria

6 dpi Protoplast extrusion, disintegration of the

hyphal cells, hyphal cells devoid of

cytoplasm

Infection cushion Infection cushion

CHAPTER 5

87

Table 3 Anatomical differences in resistant Brassica napus cv. Charlton and susceptible B. napus RQ001-02M2 cotyledons when inoculated with Sclerotinia sclerotiorum isolate WW-3 from 4, to 8 days post inoculation (dpi).

4 dpi

6 dpi

8 dpi

Description

Resistant Susceptible Resistant Susceptible Resistant Susceptible

Colonization of

fungus

Fungal hyphae

mainly confined to

upper epidermis

Fungal invasion up

to palisade

mesophyll layer

Fungal hyphae

mainly confined to

upper epidermis

Extensively

damaged palisade

mesophyll layer

Fungal hyphae

mainly confined to

upper epidermis,

but a few cells of

palisade mesophyll

layer were

colonized where

starch deposits

were observed

Fungal invasion in

intercellular and

intracellular spaces

of palisade

mesophyll cells and

spongy mesophyll

cells, extensively

damaged upper

epidermis and

palisade mesophyll

cells

Appressoria Simple appressoria

if present

Complex

appressoria

Simple appressoria

if present

Infection cushion Simple appressoria

if present

Infection cushion

Starch deposits (at

100 x magnification)

Average number of

cells with starch

deposits 3

Average number of

cells with starch

deposits 13

Average number of

cells with starch

deposits 3

All the cells with

starch deposits

heavily colonized

with fungus

Average number of

cells with starch

deposits12

All the cells with

starch deposits

heavily colonized

with fungus

CHAPTER 5

88

Calcium oxalate

crystals

No crystals were

visible

No crystals were

visible

No crystals were

visible

Crystals visible in

upper epidermis

and palisade

mesophyll layer

Crystals up to upper

epidermis and those

cells of palisade

mesophyll layer

where starch

deposits were found

Crystals through out

the leaf tissue from

upper epidermis to

lower epidermis

Hypersensitive-

type response/

cytoplasmic

disorganization

Extensive

cytoplasmic

disorganization

Extensive

cytoplasmic

disorganization and

necrotic cells

underneath of intact

epidermis

- -

CHAPTER 5

89

Figure 1

Light and scanning electron micrographs (SEM) following inoculation of Sclerotinia

sclerotiorum isolate WW-3 onto cotyledons of resistant cv. Charlton and susceptible RQ001-

02M2 Brassica napus as well as a glass slide surface. In A to G and K to N the samples were

cleared in acetic acid: ethanol: water (2:2:1), stained with 1 % cotton blue in lactophenol, and

photographed using a Zeiss Axioplan 2 microscope photograph system. (H) A 2 µm thick

section was photographed using an AxioCam Digital photograph system with an exciter filter

and a barrier filter into a beam of incident light from a mercury vapor lamp. (A) Ascospore

germination in distilled water on the surface of resistant Charlton at 4 hours post inoculation

(hpi). (B) Germ tube emerged from ascospores in Pi-glucose medium at 12 hpi on susceptible

RQ001-02M2. (C) Swollen hyphal apices (arrow) at 1 day post inoculation (dpi) on susceptible

RQ001-02M2. (D) Emergence of lateral hyphal branches (arrow) from aerial hyphae on

susceptible RQ001-02M2 at 1 dpi. (E) Repeated dichotomous branching (arrow) of the terminal

hyphae leading to formation of appresoria at 2 dpi on susceptible RQ001-02M2. (F) Limited

hyphal growth on resistant Charlton at 2 dpi. Arrows indicate a slight increase in hyphal

diameter. (G)-(I) Different modes of penetration by fungal hyphae observed at an early stage of

infection on the surface of resistant Charlton and susceptible RQ001-02M2, when ascospore

suspension was prepared in Pi-glucose medium. (G) Penetration through stomata (arrow) on

resistant Charlton. (H) Cuticular penetration (arrow) by the ascospore germ tube on susceptible

RQ001-02M2. (I) SEM of adaxial surface of the resistant Charlton demonstrating cuticular

penetration (arrow) by the fungal hyphae. (J) Repeated dichotomous branching of the terminal

hyphae (arrows) leading to the formation of appresoria at 3 dpi on a glass slide. (K) Infection

cushion on the surface of susceptible RQ001-02M2. (L) Protoplast extrusion in spherical forms

(smaller black arrows) accompanied by cytoplasm shrinkage (larger black arrow) and with

(larger red arrow) or without (larger green arrow) increase in hyphal cell diameter of hyphae on

resistant Charlton at 4 dpi. (M) Protoplast extrusion without any increase in diameter or

cytoplasm shrinkage of hyphal cell on resistant Charlton at 4 dpi. (N) Disintegration of hyphal

cell wall followed by liberation of cell contents (arrow) on resistant Charlton at 4 dpi. (O) SEM

of adaxial surface of the resistant Charlton demonstrating protoplast extrusion in amorphous

form (arrows) at 4 dpi.

CHAPTER 5

90

Figure 1

CHAPTER 5

91

Figure 2

Light micrographs showing histology of resistant Brassica napus cv. Charlton and susceptible

B. napus, RQ001-02M2 cotyledons following inoculation with Sclerotinia sclerotiorum isolate

WW-3 i. (A)-(C) Samples cleared in acetic acid: ethanol: water (2:2:1) and stained with 1%

cotton blue, and photographed using a Zeiss Axioplan 2 microscope photograph system. (D)-(I)

2 µm thick sections photographed using the same photograph system. Section (D) stained with

periodic acid / Schiff’s reagent. Sections (E), (F), (G) and (J) stained with 0.5% toluidine blue.

Sections (H), (I), (K) and (L) stained using the method described by Yasue (1969) for detection

of calcium oxalate crystals. (A) Protoplast extrusion in amorphous form (smaller arrows) and

hyphal cells devoid of cytoplasmic content (larger arrow) following release of protoplast on

resistant Charlton at 6 dpi. (B) Bud like extrusion of protoplast (arrow) at the apex of the fungal

hyphae on resistant Charlton. (C) Synchronous protoplast extrusion on resistant Charlton. (D)

Starch deposits (arrow) in palisade mesophyll cells of susceptible RQ001-02M2 at 4 dpi. (E)

Darkly stained areas (arrows) around the dead cells of palisade mesophyll layer at 4 dpi in

resistant Charlton. (F) Fungal invasion (smaller arrow) up to palisade mesophyll cells and

extensively damaged upper epidermis in susceptible RQ001-02M2 at 6 dpi. Note presence of

infection cushion near epidermis (larger arrow). (G) Cytoplasmic disorganization and necrotic

cells (arrows) of palisade mesophyll cells underneath of intact epidermis layer in resistant

Charlton at 6 dpi. (H) Calcium oxalate crystals (arrows) were visible in upper epidermis and

palisade mesophyll cells in susceptible RQ001-02M2 at 6 dpi. (I) Resistant Charlton at 6 dpi

without evidence of calcium oxalate crystals. (J) Fungal invasion mainly confined to upper

epidermis in resistant Charlton at 8 dpi. (K) Calcium oxalate crystals present throughout the leaf

tissue at 8 dpi in susceptible RQ001-02M2. (L) Calcium oxalate crystals mainly confined to

upper epidermis in resistant Charlton at 8 dpi.

CHAPTER 5

92

Figure 2

CHAPTER 6

93

CHAPTER 6 Differentially Expressed Proteins Associated with Compatible and Incompatible Interactions of the Brassica napus – Sclerotinia sclerotiorum Pathosystem

6.1 ABSTRACT

Sclerotinia rot caused by the fungus Sclerotinia sclerotiorum is one of the most serious

and damaging diseases of oilseed rape. To understand the mechanism of resistance

expressed in the Brassica napus – S. sclerotiorum pathosystem, a comparative

histological and proteomic analysis was conducted of two B. napus genotypes that were

previously identified to exhibit resistant (cv. Charlton) or susceptible (cv. RQ001-

02M2) reactions in response to infection by S. sclerotiorum. Significant differences (P ≤

0.001) were observed between the resistant Charlton and the susceptible RQ001-02M2

at 72 and 96 h post inoculation (hpi) in terms of a lesion size on cotyledon. Anatomical

investigations revealed impeded fungal growth (at 24 hpi and onwards) only on the

resistant Charlton. Temporal changes (12, 24, 48 and 72 hpi) in protein profile were

investigated in both B. napus genotypes in response to the pathogen challenge using

two-dimensional electrophoresis. The proteins related to antioxidant defence

(glutathione S-transferaes, monodehydroascorbate reductase) were found to increase in

abundance only in the resistant Charlton. The resistant Charlton also showed increased

activity of proteins related to hormone biosynthesis (S-adenosylmethionine synthase),

protein synthesis (cysteine synthase), protein folding (20 kDa chaperonin) and

metabolic pathways (e.g., carbonic anhydrase). The coordinated expression of all these

proteins is considered to be responsible for mediating defence responses in the resistant

Charlton. Deploying a proteomic approach in the incompatible interaction of the B.

napus and S. sclerotiorum pathosystem, this study gives novel insights into the

resistance mechanisms of B. napus against S. sclerotiorum and can form the basis for

development of markers for disease resistance.

CHAPTER 6

94

6.2 INTRODUCTION

Sclerotinia sclerotiorum, the causal agent of Sclerotinia disease, is one of the most

destructive and cosmopolitan of plant pathogens (Bolton et al., 2006). This necrotrophic

fungal pathogen attacks over 400 plant species worldwide, and is now considered a

serious threat to many economical important crops, including soybean (Glycine max),

sunflower (Helianthus annus) and canola (Brassica napus) (e.g., Boland & Hall, 1994;

Hegedus & Rimmer, 2005). The collective annual losses from S. sclerotiorum in the

United States from different crop species have exceeded $200 million (Bolton et al.,

2006), and yield losses as high as 24% have been recorded in canola in Australia (Hind-

Lanoiselet, 2004). Effective disease control measures against S. sclerotiorum continues

to be a challenge because of the inefficiency of the chemical control in managing this

disease, largely due to difficulty in timing the application with the release of ascospores

(Bolton et al., 2006). Further, cultural practices tend to avoid or reduce the severity of

Sclerotinia stem rot, but none effectively controls S. sclerotiorum on its own. Host

resistance offers the only economic and sustainable method for effectively managing

this disease. However, the level of host resistance to this pathogen is still inadequate

(Bolton et al., 2006; Li et al., 2008), except for few studies where useful levels of host

resistance have been identified in Brassica spp. (e.g., Li et al., 2007, Garg et al.,

2010a/Chapter 7).

A complex combination of factors has been reported to determine the severity of the

disease caused by S. sclerotiorum (Lumsden, 1979). These include the ability of this

pathogen to produce oxalic acid and various hydrolytic enzymes, such as pectinases and

polygalactouronases, by which this fungus can establish itself within the host species so

rapidly that it does not give adequate time for the host plant to fully engage defence

responses (Lumsden, 1979; Godoy et al., 1990; Li et al., 2004a). A number of studies

have thus focused on understanding the molecular aspects to pathogenicity of this

fungus, with much emphasis given on oxalic acid and cell wall degrading enzymes (e.g.,

Cessna et al., 2000; Guimaraes et al., 2004; Li et al., 2004b) as well as on

engineering/identifying resistance against various secretome of S. sclerotiorum. For

example, Hu et al. (2003) demonstrated that transgenic sunflower constitutively

expressing a wheat oxalate oxidase gene exhibited enhanced resistance against this

CHAPTER 6

95

pathogen. Similarly, polygalacturonase inhibitor genes that responded to the infection

caused by S. sclerotiorum have also been characterised in B. napus (Hegedus et al.,

2008). In addition, breeding efforts have been made to define the inheritance of

resistance, mainly by identifying various quantitative traits loci (QTLs) associated with

resistance against this pathogen (Micic et al., 2005; Zhao et al., 2006). In spite of studies

at the molecular level in relation to the various cell wall degrading enzymes, and of

various breeding efforts to understand the genetic basis of resistance, defence responses

of various host species against S. sclerotiorum have been, at best, poorly characterized.

This may be a consequence of the multi-factorial defence responses that can be

occurring in response to infection by this pathogen (Zhao et al., 2007). Hence, detailed

molecular investigations are warranted to elucidate the mechanism of resistance against

this pathogen. Identification of the genes mediating the defence responses against S.

sclerotiorum will not only enhance the understanding of molecular basis of resistance,

but will also help to develop effective disease control measures and molecular markers

for disease resistance (Calla et al., 2009).

Relatively few genomic-based approaches have been deployed so far which detail

changes in gene expression profile mediating the host responses to the infection of S.

sclerotiorum. Li et al. (2004a), identified several genes associated with fungal

pathogenesis by monitoring expressed sequence tags (ESTs) generated from two cDNA

libraries of fungal genes during mycelial growth of S. sclerotiorum in pectin medium or

in infected tissues of B. napus stems. Subsequently, four particular studies based on

microarray platform were conducted to investigate the B. napus responses to S.

sclerotiorum. Of these, three focused on the molecular basis of defence where gene

expression changes associated with S. sclerotiorum infection in a partially resistant and

a susceptible genotype of oilseed B. napus were investigated using either cDNA

microarray (Liu et al., 2005) or an oligonucleotide platform (Zhao et al., 2007, 2008).

However, Yang et al. (2007) investigated the genes responsible for mediating plant

responses to the pathogen by comparing the leaf tissue of inoculated vs. non-inoculated

susceptible B. napus genotypes. Microarray screen has also been conducted in a

partially resistant and a susceptible genotype of soybean to identify genes responsible

for defence responses against S. sclerotiorum (Calla et al., 2009). More recently, a

quantitative RT-PCR approach has been used by Yang et al. (2009) to examine the

CHAPTER 6

96

expression of five orthologs of B. napus genes involved in defence signaling pathways

in response to challenge by S. sclerotiorum.

It is interesting that most of our knowledge of the molecular events occurring in the

incompatible interaction of B. napus-S.sclerotiorum pathosystem has come from

microarray analysis. However, there is no such study in which a proteomics approach

has been deployed in the incompatible interaction of B. napus-S. sclerotiorum

pathosystem, even though the protein profile of a compatible interaction of this

pathosystem (Liang et al., 2008) and of fungal mycelia of S. sclerotiorum and its

secretome have already been explored (Yajima and Kav, 2006). Proteomic analysis is

now considered to be a powerful tool to study plant-pathogen interaction such as those

involving 2-DE techniques by which differentially expressed proteins induced in

response to the pathogen challenge can be identified (Colditz et al., 2007; Sharma et al.,

2008). This technique is a valuable complement for genomic approaches for

investigations into plant-pathogen interactions at the molecular level, particularly as it

provides a continuity between genome sequence information with the protein profile,

which in turn indicates possible biochemical cellular pathways involved (Mehta et al.,

2008). A poor correlation between the mRNA transcript levels and protein abundance

reported in different studies further necessitates the use of such genomic approaches

(Gygi et al., 1999; Carpentier et al., 2008) in B. napus-S. sclerotiorum pathosystem, in

which the defence mechanism is poorly understood.

The identification of a B. napus genotype by Garg et al. (2008/Chapter 2) (cv. Charlton)

capable of resisting invasion by S. sclerotiorum through a hypersensitive response (HR)

at cotyledon stage provided a model pathosystem to study the mechanism(s) of

resistance to this pathogen. In the present study, the proteome-level changes associated

with the cotyledon tissues of a B. napus genotypes (cv. Charlton) in response to S.

sclerotiorum infection are reported. Details of the disease progression and infection

processes of S. sclerotiorum on resistant and susceptible genotypes are included to

relate them to the proteomic changes observed. Moreover, nine enzymes of the

pathogen origin (S. sclerotiorum) extracted from the infected tissue of the B. napus

genotypes are also identified. Finally, the relationships between morphological,

histological and protein factors in susceptible and resistant host genotypes in response to

CHAPTER 6

97

the pathogen challenges defines the expression of resistance to S. sclerotiorum in B.

napus.

6.3 METHODOLOGY

6.3.1 Host genotypes, S. sclerotiorum isolate and inoculation procedure

Two spring type B. napus genotypes, viz. Charlton and RQ001-02M2, were used in this

study. The cv. Charlton has resistance to S. sclerotiorum while RQ001-02M2 is highly

susceptible (Garg et al., 2008/Chapter 2; 2010b/Chapter 3). Both genotypes were grown

in 13.7 x 6.6 x 4.9 cm trays, each having eight cells and containing a soil-less compost

mixture. Groups of four (eight cells) trays (two containing the resistant Charlton and

two the susceptible RQ001-02M2) were placed randomly in 10-L plastic storage boxes

(34 x 13 x 23 cm). Two seeds of each genotype were sown in each cell and then

thinned to one seedling per cell after emergence. Both test lines were grown under

controlled environment growth room conditions of 18/14 (±1)oC (day/night) for 12

hours light/dark cycles, with light intensity of 150 µE m–2 s–1. A highly virulent isolate

of S. sclerotiorum (MBRS-5) collected from the Mount Barker region of Western

Australia (WA), from a site where there was a significant disease, was used throughout

in this study (Garg et al., 2010b/Chapter 3). All the test conditions, inoculum storage,

inoculum production, inoculation method and disease assessment were carried out as

described by Garg et al. (2008/Chapter 2). Inoculations were carried out when

cotyledons were 10-d old. Macerated mycelial suspension at a concentration of 2 x 104

fragments mL-1, prepared in sterilized liquid media (Potato Dextrose Broth 24 g,

Peptone 10 g, H2O 1 L), was used. A total of four droplets of mycelial suspension of 10

µl were deposited on each seedling using a micropipette, with a single drop on each

cotyledon lobe. The sterilized liquid medium (un-inoculated) was similarly deposited on

the cotyledons of both lines as a control comparison. Disease progression was

monitored at 24, 48, 72 and 96 h post inoculation (hpi).

6.3.2 Histology

Cotyledons were sampled at 12, 24, 48 and 72 hpi. Six cotyledons from each treatment

(inoculated and non-inoculated treatments of both test genotypes, and from separate

inoculated boxes) were removed from each of the six plants at each time interval.

CHAPTER 6

98

Sampled cotyledons were decolourised by the acetic acid : ethanol : water (2:2:1)

solution at 25oC. At the time of examination, cotyledons were washed with two changes

of DI water and stained with 1% cotton blue (Hua Li et al., 2004). Whole wet mounts of

cotyledons on microscope glass slides were then examined and photographed using a

Zeiss Axioplan 2 microscope with an AxioCam digital photograph system with bright

field optics (Hua Li et al., 2007a; 2007b). Cotyledons were sampled for anatomical

studies at 24, 48 and 72 hpi. Three cotyledons (from three separate seedlings) from each

treatment (inoculated and non-inoculated treatments of both test genotypes) were

prepared for glycol methacrylate (GMA) biological tissue sampling as described by Hua

Li et al. (2004). Cross sections were stained for detection of polyphenols and lignin

(0.5% Toluidine Blue O in benzoate buffer, pH 4.4), and were photographed as

described above.

6.3.3 Protein extraction

Cotyledons were sampled at 12, 24, 48 and 72 hpi for this experiment. Twenty

cotyledons were randomly harvested from twenty different seedlings (per treatment),

pooled and flash frozen in liquid nitrogen and then stored at -80oC until protein

extractions were carried out. Experimental design comprised three replications (pooled

cotyledon tissue from twenty different plants per replication), for each treatment (i.e.

resistant, resistant control, susceptible and susceptible control), and for each time of

sampling. Three independent protein extractions were performed (one protein extraction

per replication) for each treatment and for each time of sampling.

Protein extractions were performed as described by Jacobs et al. (2001) and Marra et al.

(2006), with some modifications. The pooled B. napus cotyledons (approximately

2g/replication) were ground to a fine powder using liquid nitrogen and then suspended

in 10 ml of cold (-20°C) acetone solution containing 20% trichloroacetic acid (TCA;

Sigma-Aldrich, Australia) and 0.2% dithiothreitol (DTT; Sigma-Aldrich, Australia) in a

centrifuge tube. The samples were maintained at -20°C for at least 4 h to allow

complete protein precipitation, and then centrifuged (20 min, 30,000g at 4°C). The

supernatant was discarded and the pellet was re-suspended in 5 ml of cold acetone

solution (-20°C) containing 0.2% DTT and centrifuged as described above. The dried

pellet was re-suspended in a rehydration buffer containing 7 M urea, 2 M thiourea, 1%

CHAPTER 6

99

DTT, 2% 3-[(3-cholamidopropyl)-dimethyl-ammonia]-1-propane sulfonate (CHAPS)

(Sigma), 10mM phenylmethylsulfonyl fluoride (PMSF) (Sigma). The samples were

then centrifuged (60 min, 30,000g at 20°C), and supernatant were recovered, and

transferred to fresh eppendorf tubes and stored at –20°C. Protein concentration was

determined by a Bradford Dc protein assay (Bio-Rad, Gladesville, NSW, Australia).

The samples were then cleaned by using ReadyPrepTM 2-D Cleanup Kit (Bio-Rad)

according to the manufacturer’s instructions in order to remove ionic impurities from

the samples, re-suspended in rehydration buffer, and concentrations re-determined using

the same protein assay, and finally, stored at –20°C until use.

6.3.4 Two-dimensional electrophoresis

Isoelectric focusing (IEF) of protein extracts in the first dimension was mainly

performed as described by Marra et al. (2006) with some modifications. One 2-DE gel

was performed for each replication for each treatment and for each time of sampling.

IEF was performed by using 11 cm immobilized-pH-gradient (IPG) strips (Bio-Rad)

with a pH range from 4 to 7. The strips were passively rehydrated overnight in a

immobiline drystrip reswelling tray, with 500 µg of protein in 200 µl of solution

containing 7 M urea, 2 M thiourea, 1% DTT, 2% CHAPS, 10mM PMSF and 2% Bio-

Lyte (Bio-Rad). IEF was performed using the PROTEAN IEF Cell system (Bio-Rad).

IPG strips were focused at 300 V for 1 min, gradient from 300 to 3500 V for 1.5 h, and

3500 V for 4 h. The focused IPG strips were equilibrated in 10 ml of equilibration

buffer containing 6 M urea, 50 mM Tris/HCl pH 8.8, 20% (v/v) glycerol, 2% (w/v)

SDS, and 2% DTT for 10 min followed by a second equilibration in the same

equilibration buffer containing 2.5% of iodoacetamide instead of DTT for another 10

min. IPG strips were finally loaded on a 12.5% polyacrylamide gels (20 x 20 cm, 1.5

mm thickness, containing 0.377 M Tris-HCl pH 8.8, 0.1% SDS, 0.5% ammonium per

sulphate, 12.5% arylamide/bis, and 0.5% TEMED) in a PROTEAN II XI cell (Bio-

Rad), and run at 15 mA per gel for 30 min, and then increased to 30 mA per gel until

dye front reached the bottom of the gel. Gels were fixed for three times in Colloidal

Coomassie blue (CCB) fixing solution (30% absolute alcohol and 2.0% of concentrated

H3PO4) for 30 min each, rinsed three times in CCB rinsing solution (2.0% H3PO4) for

20 mins each, and then equilibrated in CCB equilibration solution (18% ethanol, 2%

H3PO4, 15% (NH4)2SO4) for 30 min. Gels were finally stained with CCB equilibration

CHAPTER 6

100

solution containing 2 x 10-4 % of Coomassie brilliant blue G-250 (Bio-Rad) for three

days and then detained in distilled water until protein spots were clearly visible. Gels

were scanned by GS-800 imaging densitometer (Bio-Rad) with a red filter (wavelength

595-750 nm) and a resolution of 63.5 x 63.5 µm.

6.3.5 Image analysis and protein identification

PDQuest software (version 8.0.1) was used to assemble and analyse the gel images. Out

of the three 2-DE gels run per treatment, the two best gels were selected to perform

statistical analysis using PDQuest software. Eight gels [two replicates per treatment and

four treatments in total (control vs. inoculated)] together consisted of one complete

independent match set for each time course. Various criteria of PDQuest software (such

as sensitivity, smoothing, streaks etc.) were kept constant for the different time course

evaluated. Normalization of the spots data using a local regression model was done

utilizing the inbuilt feature of the PDQuest software to compensate for any gel to gel

variation. The automated spot detection feature of the PDQuest software was then used

to detect, match and compare spots between control and inoculated treatments of

resistant or susceptible genotype. The group consensus feature of the software was used

to manually match/check each spots within replicates of each treatment. Several

stringent criteria were followed for the spots which were retained in the each replicated

group. For instance, every spot of the replicate group was matched manually, all the

apparent artifacts were removed and any spots that were missed by the automated spot

detection feature of the software were manually added. Finally, only those spots that

were present in both gels were retained in the replicate group of each treatment, such

that the correlation coefficient for each individual replicate group was ~1.0. The

information of all the spots which were manually matched and/or removed was updated

in the standard gel either by the PDQuest software automatically or was done manually.

The inbuilt Student’s t-test module of the PDQuest software was used to analyze

different replicate groups, and protein spots were identified that were significantly

different (P < 0.05) in response to the pathogen challenge in inoculated replicate groups

of resistant or susceptible genotype in comparison to the respective control replicate

group (both qualitative and quantitative analysis were performed).

CHAPTER 6

101

In addition to the inbuilt Student’s t-test module of the PDQuest software, additional

statistical analysis was also done to verify whether the spots identified were

significantly different (P < 0.05) in terms of their change in abundance in response to

the pathogen challenge. A match set comprising all the gels of all the treatments, and

across all the time courses was created. Average spot densities were measured from the

filtered images (to reduce the ‘noise’) for each spot that were statistically measured as

significantly different (by PDQuest software) for each replication across all the

treatments and time courses. Each spot densitiy value comprises the sum of the signal

intensities (expressed as spot/optical density units) of all the pixels that make up the

object. Expression ratios (fold changes) for each spot for every treatment across all the

time points were calculated from the spot densities data with respect to their control

genotype (i.e. resistant vs resistant control or susceptible vs susceptible control at 12, 24,

48 and 72 hpi, separately). Spot densities were further analysed using additional

Student’s t-test comparisons of resistant or susceptible genotypes with respect to control

genotypes at a specific time point (e.g., resistant vs resistant control or susceptible vs

susceptible control at 12, 24, 48 and 72 hpi, separately).

Protein spots that exhibited statistically significant differences (P < 0.05) and

reproducible results in terms of their spot density measured through PDQuest software,

were excised with a sterile scalpel. Excised pieces of the gel were further processed by

“Proteomics International”, Nedlands, Western Australia. Protein samples were trypsin-

digested and peptides extracted using standard techniques as described by Bringans et

al. (2008). Peptides were analysed by MALDI TOF-TOF (electrospray ionisation

MS/MS) mass spectrometer using a 4800 Proteomics Analyzer (Applied

Biosystems/MDS SCIEX). Spectra were analysed to identify protein of interest using

Mascot sequence matching software [Matrix Science] with Ludwig NR Database

(http://www.matrixscience.com/help/seq_db_setup_nr.html).

6.4 RESULTS

6.4.1 Morphological differences

The responses of the resistant and susceptible genotypes following inoculation and their

respective disease progressions at 24, 48, 72 and 96 hpi are shown in Figs. 1 and 2.

CHAPTER 6

102

Hypersensitive lesions were apparent only on cotyledons of the resistant genotype.

Water-soaked lesions were visible on cotyledons of the susceptible genotype at 48 hpi.

After 48 hpi, an increase in cotyledon lesion diameter was observed only on the

susceptible genotype with its mean value progressing from 3.4 mm at 48 hpi to 6.2 mm

at 72 hpi, and then to 10.5 mm at 96 hpi. Furthermore, cotyledons of the susceptible

genotype were covered with white mycelial growth by 96 hpi. In contrast, lesions on the

resistant genotype remained small (approx. 3.5 mm) and were always confined within

the diameter of the inoculum droplet at 48, 72 and 96 hpi. There were significant

differences (P ≤ 0.001) between resistant and susceptible genotypes in relation to

cotyledon lesion diameters at 72 and 96 hpi.

0

2

4

6

8

10

12

1 dpi 2 dpi 3 dpi 4 dpi

Days post inoculation

Cot

yled

on le

sion

dia

met

er (

mm

)

Charlton

RQ001-02M2

Figure 1 Mean value of cotyledon lesion diameter (mm), days post inoculation (dpi) on spring type Brassica napus resistant Charlton and susceptible RQ001-02M2. Bar on each value represents standard error associated with the mean value of cotyledon lesion diameter.

CHAPTER 6

103

Figure 2 Appearance of spring type Brassica napus resistant Charlton and susceptible RQ001-02M2 when inoculated with Sclerotinia sclerotiorum, over time. Where “hpi” represents hours post inoculation and “control” represents the mock inoculated control comparison of resistant and susceptible genotype.

CHAPTER 6

104

6.4.2 Histological differences

6.4.2.1 12 hpi

There were no differences between the resistant Charlton and the susceptible RQ001-

02M2 in relation to the hyphal growth on the cotyledon surface at 12 hpi (Table 1).

6.4.2.2 24 hpi

Hyphae continued to grow on the cotyledons of both resistant Charlton and susceptible

RQ001-02M2 by 24 hpi. However, hyphal growth on the resistant Charlton (Fig. 3A)

was significantly (P < 0.001) impeded as compared to the susceptible RQ001-02M2

(Fig. 3B; Table 1). The dichotomous branching of the terminal hyphae was also

apparent both on resistant Charlton and susceptible RQ001-02M2, resulting in the

formation of simple appressoria (Fig. 3A, 3B). There was, however, an increase in the

diameter of a few hyphal cells on resistant Charlton (Fig. 3C). Anatomical examinations

of the resistant Charlton and the susceptible RQ001-02M2 showed cytoplasmic

disorganization of the palisade mesophyll cells underneath of the intact upper epidermis

layer (Fig. 3D). Furthermore, toluidine blue-stained sections of the resistant Charlton

showed a number of darker blue-stained regions around the dead cells of the palisade

mesophyll layer (Fig. 3E), which were not evident on the susceptible RQ001-02M2.

6.4.2.3 48 hpi

On the cotyledons of susceptible RQ001-02M2, extensive hyphal growth appearing as a

mycelial mat was observed but within the confines of the inoculum droplet area, hyphae

had also extended beyond the periphery of the inoculum droplet area (Fig. 3F), and the

dichotomous branching of the terminal hyphae lead to the formation of complex

appresoria (Fig. 3G). In contrast, hyphal growth on resistant Charlton was significantly

impeded (P < 0.001) (Fig. 3H), a trend similarly observed at 24 hpi. Anatomical studies

of the susceptible RQ001-02M2 revealed extensively damaged upper epidermis and

palisade mesophyll cells with hyphal invasion up to spongy mesophyll layer (Fig. 3I). In

contrast, hyphal invasion was mainly confined to the upper epidermis in the resistant

Charlton with extensive disorganization of palisade mesophyll cells observed

underneath of intact epidermis layer.

CHAPTER 6

105

CHAPTER 6

106

Figure 3 Light micrographs showing histology of resistant (Brassica napus, Charlton) and susceptible (B. napus, RQ001-02M2) genotypes in response to Sclerotinia sclerotiorum isolate MBRS-5 infection. (A)-(C), (F)-(H), (J)-(L) Samples were cleared in acetic acid: ethanol: water (2:2:1), stained with 1% cotton blue, and photographed using a Zeiss Axioplan 2 microscope photograph system. (D), (E), (I) 2 µm thick sections obtained and photographed using the same photograph system. (A) Impeded fungal growth on resistant Charlton at 24 hours post inoculation (hpi). Arrow indicates the presence of simple appressoria (B) Hyphal growth on susceptible RQ001-02M2 at 24 hpi. Arrow indicates the presence of simple appressoria. (C) Increase in hyphal diameter of fungal cells on resistant Charlton at 24 hpi. (D) Cytoplasmic disorganization and necrotic cells (arrow) of palisade mesophyll cells in the susceptible RQ001-02M2 at 24 hpi. (E) Darkly-stained areas (arrows) around the dead cells of palisade mesophyll layer at 24 hpi in the resistant Charlton. (F) Hyphal growth on cotyledons of the susceptible RQ001-02M2. Arrows indicate the extension of hyphal growth beyond the periphery of the inoculum droplet area. (G) Repeated dichotomous branching (arrow) of the terminal hyphae led to formation of appressoria at 48 hpi on susceptible RQ001-02M2. (H) Hyphal growth on resistant Charlton at 48 hpi. (I) Fungal invasion up to palisade mesophyll cells and extensively damaged upper epidermis in the susceptible RQ001-02M2 at 48 hpi. (J) Hyphal growth on susceptible RQ001-02M2 extended across almost whole of the upper surface of the cotyledon at 72 hpi (K) Hyphal growth arrested at the periphery of the inoculum droplet area on resistant Charlton at 72 hpi. (L) Disintegration of hyphal cell wall arrow on resistant Charlton at 72 hpi.

6.4.2.4 72 hpi

In the susceptible RQ001-02M2, hyphae emerging from the inoculum droplet area

extended across almost whole of the upper surface of the cotyledon (Fig. 3J). Approx.

30% of the inoculated samples of the resistant Charlton were also observed with

extensive mycelial growth on the cotyledon surface, which however seemed to be

within the periphery of the inoculum droplet area, with only a very few strands of

hyphae emerging out of it (Fig. 3K). An increase in diameter of a few hyphal cells was

also apparent in the resistant Charlton followed by the disintegration of hyphal cell wall

(Fig. 3L). Mycelial mat within the inoculum droplet area on resistant Charlton appeared

darker (Fig. 3K) compared with the susceptible RQ001-02M2.

CHAPTER 6

107

Table 1 Description of growth of Sclerotinia sclerotiorum isolate MBRS-5 on the surface of resistant (Brassica napus Charlton) and susceptible (B. napus RQ001-02M2) genotypes over time (12 to 72 hours post inoculation (hpi)).

Hours post inoculation (hpi)

Resistant Charlton Susceptible RQ001-02M2

12 No increase in hyphal length No increase in hyphal length 24 Significantly impeded hyphal

growth as compared to susceptible genotype, increase in hyphal cell diameter

Extensive hyphal growth, but confined within the inoculum droplet area

48 Significantly impeded hyphal growth, increase in hyphal cell diameter

Extensive hyphal growth, hyphae had extended beyond the periphery of the inoculum droplet area

72 Hyphal growth within the confines of inoculated area or arrested at the periphery of the inoculum droplet area, disintegration of hyphal cell wall

Whole cotyledon covered with mycelial growth

6.4.3 Differential proteins from the interaction between S. sclerotiorum and the two

B. napus genotypes

Comparative proteome analysis of the resistant Charlton and the susceptible RQ001-

02M2 in response to the S. sclerotiorum infection was conducted at 12, 24, 48 and 72

hpi and a representative image of 2-DE gel is shown in Fig. 4. An average of

approximately 400 protein spots in the resistant Charlton and 380 in the susceptible

RQ001-02M2 were detected that were resolved within the pH range of 4-7 across the

different time points. Approximately 340 spots were subjected to an inbuilt Student t-

test (P < 0.05) feature of the PD Quest software. These 340 protein spots were

identified on the basis of the stringent conditions (as indicated above) that were set out

to retain a spot in the gels of a replicate group (i.e. only those protein spots were

retained that were present in both replication of each treatment).

A total of 55 protein spots were identified as differentially regulated in the resistant

Charlton and/or the susceptible RQ001-02M2. Out of these 55 protein spots, only 39

spots were identified through MS/MS analysis (Fig. 5, 6). Details of all the protein spots

that were significantly affected in response to the pathogen challenge (as determined by

the Student t-test feature of the PD Quest software) are shown in Table 2, and in Fig 5

CHAPTER 6

108

and 6. Among these 39 spots, 23 spots at 72 hpi, 4 at 48 hpi, 5 at 24 hpi and 7 at 12 hpi

time points were identified. Out of the 23 spots detected at 72 hpi, 14 spots were from

the resistant Charlton and/or the susceptible RQ001-02M2, and nine spots were of

pathogen origin that were most likely extracted from the infected tissues of both/either

B. napus genotypes. Some protein spots were significantly affected in response to the

pathogen challenge across more than one time point (e.g., spots 3, 4, 9 and 15; Table 2).

It is also interesting that a trend was seen in the expression of some of the protein spots

that were expressed in response to the infection in both B. napus genotypes investigated

in this study. For example, a few protein spots were significantly either up-regulated or

down-regulated (e.g., spots 6, 10, 11, 12 and 13; Table 2) only in the resistant Charlton

and at a specific time point following inoculation. A similar trend was also observed in

the susceptible RQ001-02M2 (e.g., spots 5, 19 and 20). For a few protein spots, the

intensities were either significantly increased or decreased in both the resistant Charlton

and the susceptible RQ001-02M2 (e.g., spots 3 and 24). A few protein spots were also

identified with significantly increased intensity in the resistant Charlton but decreased in

intensity in the susceptible RQ001-02M2 or vice versa (e.g., spots 1 and 9). There were

few protein spots that were solely identified in the resistant Charlton or solely in the

susceptible RQ001-02M2 because of the absence any protein spot in the relative

position of 2-DE gels (e.g., spots 7 and 17). Further, a few proteins identified in this

study were detected at more than one position in the 2-DE gels (e.g., spots 8 and 9, 24

and 28). Spot 3 (Protein disulfide isomerase) was detected in both genotypes separately

with MS/MS analysis, with its corresponding position on 2-DE gel for both the

genotypes relatively close to each other. The change in abundance of individual protein

in each treatment across the different time points is shown in Table 2.

As indicated above, fold expressions and ANOVA of every protein spot (significantly

identified by PDQuest) with respect to the control genotype for each treatment (e.g.,

resistant vs. resistant control at 12 hpi) and for each time point was performed

separately by measuring the spot density data from filtered images. Additional Student

t-test performed for each spot confirmed the results obtained by PDQuest software.

However, spot numbers 8, 21 and 22 were not identified as significantly affected in

response to the pathogen challenge with the additional set of analysis. Exception to

these was also observed with the two protein spots [Spots 2 (down-regulated in the

CHAPTER 6

109

resistant genotype) and 13 (up-regulated in the resistant genotype); Table 2] as they

were not in accordance with the results obtained by PDQuest software analysis only at

72 hpi. Expression ratio calculated for each spot for every treatment across every time

point clearly set out the modulation of the proteins in response to the pathogen

challenge across different time points (Table 2).

Figure 4 A representative image of the Brassica napus resistant cv. Charlton leaf proteins separated by 2-DE and stained with Coomassie brilliant blue. The numbers shown correspond with the spot numbers mentioned in Table 2.

6.4.4 Functional classification of the protein identified

A total of 30 proteins identified from the resistant Charlton and/or the susceptible

RQ001-02M2 were classified into seven different functional categories. The protein

CHAPTER 6

110

functions were assigned based on the available literature and protein function database

Pfam (pfam.sanger.ac.uk/) or InterPro (www.ebi.ac.uk/interpro/). A large proportion of

the proteins (32%) identified that were modulated in response to the pathogen challenge

were those involved in metabolism (including carbon and phosphorous metabolism),

whereas 18% of the proteins could not be classified as their function was not known.

The next largest group comprised enzymes involved in protein synthesis (12%),

followed by the group having a role as antioxidants (9%) and those involved in protein

folding and post-translation modification (9%). The remainder of the group comprised

pathogenesis-related proteins (3%), and of those, proteins involved in hormone

biosynthesis and signaling (3%). In addition, nine proteins were identified as being of

fungal origin and were most likely extracted from the infected tissues of the B. napus

genotypes. The majority of these nine proteins play a role in one or more metabolic

pathways, including those that are associated with the pathogenicity of S. sclerotiorum

(Table 2).

6.5 DISCUSSION

This study has identified the proteins that were up-regulated only the in resistant

Charlton, such as those related to metabolic pathways (carbonic anhydrase, malate

dehydrogenase), antioxidant defence (glutathione S- transferase, monodehydroascorbate

reductase), protein synthesis (cysteine synthase), pathogenesis related protein (Major

latex-related protein), and hormone biosynthesis (S-adenosylmethionine synthase). The

potential role(s) of mainly these proteins in mediating resistance against S. sclerotiorum

is discussed below. Some of the fungal proteins extracted from the infected tissues of B.

napus are also discussed in context to the responses of the resistant Charlton and the

susceptible RQ001-02M2 to the various virulent factors released by S. sclerotiorum.

CHAPTER 6

111

CHAPTER 6

112

Figure 5. Closer views of spots showing significant changes. The numbers shown correspond with the spot numbers mentioned in Table 2. Where R, Rc, S and Sc represent resistant (cv. Charlton), Resistant control (mock inoculated resistant cultivar), susceptible (cv. RQ001-02M2) and susceptible control (cv. mock inoculated susceptible cultivar) respectively.

6.5.1 Proteins involved in metabolic pathway

Carbonic anhydrase (CA) plays an important role in the photosynthetic CO2 fixation in

a diversity of photosynthetic organisms by catalyzing the conversion of CO2 to HCO3-,

which is further fixed by Rubisco or PEP carboxylase (Badger and Price, 1994).

Significant increases in the abundance of CA were evident only in the resistant Charlton

at 12 hpi (~3 fold), with significant decreases at 48 hpi in the susceptible RQ001-02M2,

indicating its potential role in mediating resistance against S. sclerotiorum. A previous

study by Restrepo et al. (2005) reported that a CA-silenced genotype of Nicotiana

benthamiana was more susceptible to infection caused by Phytophthora infestans.

Further, Slaymaker et al. (2002) reported that the chloroplastic CA also exhibits

salicyclic acid (SA) activity that is known to activate local and systemic defence

responses. In addition, CA also plays an important role in the HR defence response, as it

was shown that silencing of the CA gene in leaf tissue of Nicotiana benthamiana

suppressed Pto:avrPto-mediated HR (Slaymaker et al., 2002). This is also in agreement

with the histological investigations in this study, where hypersensitive reaction was only

observed in the resistant Charlton, further supporting the potential involvement of CA in

mediating resistance against S. sclerotiorum.

6.5.1.1 Protein involved in ROS generation

The imbalance between generation and metabolism of reactive oxygen species (ROS)

leads to oxidative stress (Neill et al., 2002). Production of ROS is a key event to HR,

which is characterized by the localized programmed cell death at the site of the

attempted invasion by the pathogen (Lamb and Dixon, 1997). ROS generation is

responsible for the reinforcement of the cell wall, restricting hyphal growth, and also

acts as a diffusible signal for induction of cellular protectant genes. A few proteins

known to be involved in generation of ROS were also identified in this study and were

generally up-regulated in the resistant Charlton, suggesting their role in mediating

defence responses at an early stage of the infection process. Such proteins include

malate dehydrogenase, the activity of which was increased ~2.5 fold in the resistant

CHAPTER 6

113

Charlton in response to the pathogen challenge at 12 hpi. Malate dehydrogenase is an

enzyme of the tricarboxylic acid cycle and catalyses the conversion of malate into

oxaloacetate, producing sufficient quantity of NAD(P)H, which can then be used to

form H2O2, possibly by NAD(P)H oxidase on plasmalemma (Gross et al., 1977; Ishida

et al., 1987). Several past studies have demonstrated the increase in abundance of

malate dehydrogenase in response to biotic and abiotic stresses (e.g., Cushman, 1993;

Subramanian et al., 2005). Another enzyme identified in this study as being elevated in

response to the pathogen challenge was mitochondrial dihydrolipoyl dehydrogenase,

showing increase in abundance in both resistant and susceptible genotypes.

Dihydrolipoyl dehydrogenase is a shared subunit of α-ketoglutarate and the pyruvate

dehydrogenases complex, which catalyses NADH oxidation by oxygen with the

concomitant formation of H2O2 (Alwine et al., 1973; Gazaryan et al., 2002). Tahara et

al. (2007) demonstrated the role of dihydrolipoyl dehydrogenase as a source of reactive

oxygen species in Saccharomyces cerevisiae, as the strains lacking the LPD1 (lipoyl-

dehydrogenase) gene prevented induction of oxidative stress. Increase in the abundance

of both of these enzymes at an early stage of infection process, and predominantly in the

resistant Charlton, supports their potential role in the generation of ROS and hence in

mediating resistance against S. sclerotiorum.

6.5.2 Proteins associated with antioxidant defence

ROS generated in response to various biotic and abiotic stresses need rapid processing

because of their ability to cause oxidative damage to proteins, DNA and lipids (Halliwel

and Gutteridge, 1989). In order to keep ROS below threshold levels, compatible for cell

metabolism, plants possess a battery of both enzymatic and a non-enzymatic ROS-

detoxifying mechanisms (Gara et al., 2003). This study identified involvement of three

enzymes viz. glutathione S-transferase (GST), monodehydroascorbate reductase

(MDHAR) and superoxide dismutase (SOD), which are components of the main plant

enzymatic system involved in protecting cells against oxidative damage. The resistant

Charlton exhibited significant increases in the levels of the enzyme glutathione S-

transferase by ~ 2 fold in response to the pathogen challenge at 48 and 72 hpi. It is

significant that no corresponding protein spot was detected (in 2-DE gels) for the

susceptible RQ001-02M2. As glutathione S-transferase is a part of the diverse protein

family and is widely distributed among living organisms, it is possible that the

CHAPTER 6

114

susceptible RQ001-02M2 could possess other isoform(s) of this enzyme. However, no

such isoform(s) were identified in the susceptible RQ001-02M2 in the present study that

exhibited significant changes in the expression levels in response to the pathogen

challenge. These results suggest that the significant increase in the levels of this enzyme

was only found in the resistant Charlton. Similarly, a significant increase in the levels of

another antioxidant enzyme, monodehydroascorbate reductase, in response to the

pathogen challenge, was only found in the resistant Charlton at 72 hpi. In contrast,

whilst the susceptible RQ001-02M2 exhibited significant ~ 2 fold decrease in the levels

of the enzyme superoxide dismutase at 48 and 72 hpi, no significant changes in the

abundance of this enzyme were found in the resistant Charlton. The three enzymes

GST, MDHAR and SOD are individually discussed in the following section.

The GST identified in the resistant Charlton comprises a family of multifunctional

enzymes that play a critical role in the detoxification of xenobiotics and protect tissues

by catalyzing the conjugation reaction of reduced glutathione (GSH) to a variety of

substrate with electrophillc reaction groups (Marrs, 1996). Past studies have

demonstrated the induction of GSTs in response to the various biotic and abiotic

stresses and their respective role as a cellular protectant (Marrs, 1996). The increased

levels of GSTs and glutathione peroxidases reported by Levine et al. (1994) in soybean

by the signals imparted by H2O2 are again indicative of prevailing oxidative stress in the

resistant Charlton. Furthermore, the defence pathway against oxidative damage between

GSTs and GSH is coordinally regulated (Hayes and McLellan, 1999), as evident from

the increase in GSTs activity with the exogenously supplied GSH in wheat and bean

(Wingate et al., 1988; Mauch and Dudler, 1993).

Elevated levels of GSTs and GSH are known to stimulate transcription of other defence

genes including those that encode (a) cell wall hydroxyproline-rich glycoproteins; (b)

the phenylpropanoid biosynthetic enzymes phenylalanine ammonia lyase (PAL) and

chalcone synthase (CHS) that are involved in lignin (PAL) and phytoalexin (PAL, CHS)

production (Loyall et al., 2000; Edwards et al., 1991); and (c) various pathogenesis-

related proteins such as chitinase or β-glucanse (Wingate et al., 1988; Marrs, 1996;

Loyall et al., 2000). The anatomical investigations of the resistant Charlton in this study

further confirmed up-regulation of these enzymes as a number of darkly-stained areas

CHAPTER 6

115

around the dead cells of palisade mesophyll layer were evident, indicating accumulation

of polyphenolic and/or phytoalexin compounds. Similar observations were also made by

Hua Li et al. (2007b) in association with resistance of B. napus to Leptosphaeria

maculans, where darkly-stained areas suggested accumulation of polyphenolic or

phytoalexin compounds known to be synthesized by the plants in response to the

infection or other stress conditions (Darvill & Albersheim, 1984; Beckman, 2000).

Similarly, increases in hyphal cell diameter (and hyphal swellings) was observed on the

cotyledons of the resistant Charlton at 48 and 72 hpi, but not in the susceptible RQ001-

02M2. Hyphal swellings and vacuolation of the mycelial content have also been

observed in the interaction of S. sclerotiorum with Pseudomonas cepacia, and

antifungal compounds released by P. cepacia were found to be responsible for such

abnormalities (Upadhyay and Jayaswal, 1992). It is possible that the enhanced level of

GSTs may have induced the production and release of various hydrolytic enzymes

and/or antifungal proteins, leading to the observed hyphal swellings on the cotyledons

of the resistant Charlton, and further suggesting a role of GSTs in mediating resistance

against Sclerotinia disease.

Another enzyme involved in the detoxification of ROS the activity of which increased

in response to the pathogen challenge in the resistant Charlton was MDHAR. This

enzyme is an important component of the ascorbate-glutathione cycle and is involved in

the detoxification of H2O2 (Noctor and Foyer, 1998). Additionally, MDHAR is also

found to be capable of reducing phenoxyl radicals to their respective parental phenols

that are potent antioxidants with an activity equivalent to ascorbate in relation to

detoxification of ROS (Sakihama., et al., 2000; Rice-Evans et al., 1997). Increased

activity of MDHAR, and only in the resistant Charlton, indicates that the antioxidant

defence can mediate resistance responses against Sclerotinia disease. Previous studies

have also indicated that the change in the expression/ activity of ROS-scavenging

enzymes could be a key step in the activation of defence mechanism(s) against various

phytopathogens (Noctor and Foyer, 1998; Mittler, 2002; Gara, 2003).

Another important enzyme that was identified in this study was SOD that is one of the

main components of the ROS scavenging machinery of the plant defence system

(Bowler et al., 1992). Interestingly, significantly lower levels of SOD were observed

CHAPTER 6

116

only in the susceptible RQ001-02M2 at 48 and 72 hpi, indicating a decrease in the

levels of antioxidant defence in response to the pathogen challenge in this genotype, and

hence enhanced oxidative damage and/or localized cell death. Interestingly, these results

were further corroborated with those of the morphological studies of the susceptible

RQ001-02M2 where increase in the expansion of cotyledon lesion diameter at 48 hpi

and 72 hpi correlated with the decrease in the levels of SOD enzyme. The anatomical

investigations further revealed cytoplasmic disorganization of the palisade mesophyll

cells in the susceptible genotype underneath an intact epidermis, indicating cell death in

response to the pathogen invasion. Thus, enhanced cell death due to ROS generation in

response to the pathogen invasion may have aided the infection caused by and

colonization of S. sclerotiorum by providing nutrients needed by the pathogen. Previous

studies in Arabidopsis have also established that it is the increased levels of

accumulated (or generated) superoxide in response to the pathogen challenge that

facilitates infection caused by nectrotrophic pathogens such as S. sclerotiorum (Govrin

and Levin, 2000; Dickman et al., 2001). These findings suggest that ROS scavenging

mechanism(s) of the susceptible RQ001-02M2 would have been countered during

pathogen invasion by one or more toxic metabolites produced by S. sclerotiorum, in a

way similar to the observation by Liang et al. (2009), who found suppressed SOD

activity in B. napus by exogenously supplied oxalic acid.

6.5.3 Proteins involved in protein synthesis

This proteomics analysis revealed a significant increase in the abundance of cysteine

synthase, a key enzyme that catalyses cysteine biosynthesis (Wirtz et al., 2001), only in

the resistant Charlton at 12, 48 and 72 hpi. Cysteine is incorporated into different kinds

of proteins and/or acts as a precursor for a range of sulfur-containing metabolites (Noji

et al., 2001). For example, cysteine is involved in the biosynthesis of tripeptide

glutathione (GSH), which is (as indicated above) an important universal antioxidant (or

detoxifier of ROS) (Noctor and Foyer, 1998). Over-expression of cysteine synthase has

been reported to increase both cysteine and GSH in Nicotiana tabacum (Noji et al.,

2001). Additionally, in this study an increase in the levels of glutathione S-transferases

(GSTs) was also found, the abundance of which is known to be enhanced concurrently

with GSH activity (Mauch and Dudler, 1993). Increased abundance of cysteine synthase

together with GSTs suggests an increase in GSH content only in the resistant Charlton,

CHAPTER 6

117

which could be mediating resistance against S. sclerotiorum. Furthermore, cysteine also

acts as a sulfur donor of amino-acid methionine, an immediate precursor of S-

adenosylmethionine (Ravanel et al., 1998), and an enzyme that was found in higher

levels only in the resistant Charlton.

The nucleophillic thiol group of cysteine is easily oxidized, allowing cysteine to be

incorporated into various defence-related proteins, inlcuding antifungal proteins (Terras

et al., 1995), phytoalexins (Zook and Hammerschmidt, 1997) and pathogenesis-related

proteins, such as chitinase or 1,3-β-glucanases (Shinshi et al., 1990; Margis-Pinheiro et

al., 1991; Rasmussen et al., 1992). Interestingly, anatomical investigations in the present

study revealed impeded fungal growth in the resistant Charlton which is known to occur

due to various antifungal proteins or hydrolytic enzymes. This supports the fact that

cysteine synthase (similar to GSTs and GSH) is involved in biosynthesis of defence-

related compounds. Based on sequence-alignment and inhibitor studies, it has also been

suggested that cysteine is an integral part of cysteine proteases that regulate

programmed cell death and the HR response in plants (D’Silva et al., 1998; Solomon et

al., 1999). This is in agreement with the histological results in which an HR response

was observed in the resistant Charlton. These findings suggest that cysteine synthase,

which eventually synthesises cysteine together with GSTs, is involved in mediating

defence responses against S. sclerotiorum in B. napus.

6.5.4 Pathogenesis related proteins

Pathogenesis-related (PR) proteins comprise one of the important components of the

inducible repertoire of the plant self-defence mechanisms that are produced in response

to the invading pathogen and/or abiotic stresses (Liu et al., 2006). PR proteins are

categorized into 17 different families on the basis of their primary structure and

biological activities (Van Loon et al., 2006; Krishnaswamy et al., 2008). The major

latex-related proteins detected in this study were assigned to the PR-10 family on the

basis of their sequence homology (Osmark et al., 1998; Liu et al., 2006). PR-10 proteins

are involved in defence responses because of their ribonucleolytic, antifungal and

antibacterial activities (Park et al., 2004; Liu and Ekramoddoullah, 2006). Here, major

latex-related proteins were up-regulated (by 2-fold) only in the resistant Charlton at 24

hpi, which indicates that PR-10 proteins could also be involved in mediating the defence

CHAPTER 6

118

responses against S. sclerotiorum. Recently, homologs to genes encoding PR-10 have

also been identified in soybean stem tissue in response to the S. sclerotiorum (Calla et

al., 2009), supporting their potential role in defence responses of B. napus against this

pathogen. However, contrary to the above, Liu et al. (2006) found that the recombinant

PR-10 protein (i.e. SsPR10) from Solanum surattense inhibited the hyphal growth of

Magnaporthe grisea (the rice blast fungus), but not of S. sclerotiorum.

6.5.5 Proteins involved in hormone biosynthesis and signaling

Increase in abundance of S-adenosylmethionine synthetase (AdoMet synthetase) was

found in the resistant Charlton (~ 4 fold) at 72 hpi, in contrast to the susceptible RQ001-

02M2 in which no significant increase in the levels of this enzyme was observed

following inoculation. AdoMet synthetase catalyses the biosynthesis of S-

adenosylmethionine (AdoMet), a precursor molecule of ethylene (ET) (Yang and

Hoffman, 1984; Peleman et al., 1989) and polyamines (Bouchereau et al., 1999).

AdoMet acts as a major methyl donor for numerous methylation reactions involving

polysaccharides, lipids, proteins and nucleic acids (Peleman et al., 1989). ET plays an

important role in the activation of various defence responses such as induction of PR

proteins and the synthesis of phytoalexin against various microbial pathogens (e.g.,

Broekaert et al., 2006). Increases in ET production in response to various pathogen

challenges have been well recognized (e.g., Broekaert et al., 2006). A previous report by

Liang et al. (2008) on the compatible interaction in the B. napus – S. sclerotiorum

pathosystem found decreased levels of methionine adenosyltransferase, which is

responsible for the catalysis of AdoMet, and suggested the possible role of ET in

mediating responses of Brassica spp. to the challenge by S. sclerotiorum. Yang et al.

(2009) also found that transgenic canola producing low levels of ET was relatively more

susceptible to S. sclerotiorum as compared with its wild-type counterpart. The increased

levels of AdoMet synthetase only in resistant Charlton in this study supports previous

reports that ET signaling plays an important role in mediating defence responses of B.

napus against S. sclerotiorum. Further, the jasmonic acid (JA) and the ET signaling

pathway are known to act synergistically as well as independently in mediating non-

specific disease resistance against various microbial pathogens depending upon the

host-pathogen system. It is interesting that no enzyme involved in the JA pathway was

identified in this study, in contrast to the previous observation of Liang et al. (2008).

CHAPTER 6

119

6.5.6 Molecular chaperones and post-translation modification of proteins

Molecular chaperones comprise groups of unrelated classes of proteins that mediate the

correct assembly of other proteins, but are themselves not a component of the final

functional protein structures (Hartl et al., 1996). Chaperones are known to assist protein

refolding under stress conditions and their levels are known to be affected in many

studies investigating both compatible and incompatible plant-pathogen interactions

(e.g., Ray et al., 2003; Wang et al., 2004; Buttner and Bonas, 2006). The present study

revealed three proteins with chaperone activity viz. 20 kDa chaperonin, protein disulfide

isomerase (PDI) and protein grpE (spots 2, 3 and 15) that were modulated in response to

the pathogen challenge. The abundance of a 20kDa chaperonin was significantly

increased only in the resistant Charlton at 12 hpi and 48 hpi in response to the pathogen

challenge. Interestingly, Liang et al. (2008) observed a decrease in the levels of the

enzyme chaperonin in compatible interactions in B. napus-S. sclerotiorum pathosystem,

which further suggests that chaperonin mediates defence responses against this

pathogen. Similarly, levels of grpE, which is a co-chaperone of heat-shock proteins

(Hsps) chaperones, decreased in response to the pathogen challenge in the susceptible

RQ001-02M2 at 48 hpi. However, the levels of PDI in this study were significantly

increased in both resistant and susceptible genotypes at 72 hpi, in contrast to the

observation of Liang et al. (2008) of decreased levels of PDI in a susceptible B. napus

genotype in response to S. sclerotiorum infection. Increase in PDI in both the resistant

Charlton and the susceptible RQ001-02M2 suggests that the activity of PDI was

probably modulated in response to the stress conditions, instead of mediating defence

responses in response to the S. sclerotiorum infection.

6.5.7 Proteins of pathogen origin

Proteins of pathogen origin- that were extracted from the infected tissue of the resistant

Charlton and the susceptible RQ001-02M2

This study revealed nine enzymes which were of fungal origin and were most likely

expressed in the infested tissue of the B. napus genotypes. Of these, the function of the

four protein spots remains to be determined, whilst the majority of the rest corresponded

to enzymes involved in metabolic pathways and were mainly expressed in the

susceptible RQ001-02M2.

CHAPTER 6

120

Figure 6 Closer views of protein spots of pathogen origin (Sclerotiorum sclerotiorum) origin extracted from the infected tissue of Brassica napus genotypes. The numbers shown correspond with the spot numbers mentioned in Table 2. Where R, and S represent resistant (cv. Charlton) and susceptible (cv. RQ001-02M2) genotypes.

It is noteworthy that an aspartate protease was identified in the susceptible RQ001-

02M2, with its spot intensity as 0.02 and 0.09 (each spot densitiy value comprises the

sum of the signal intensities of all the pixels that make up the object) at 48 and 72 hpi,

respectively. In contrast, the spot density value of only 0.01 was found in the resistant

Charlton and only at 72 hpi. Aspartate proteases are secreted by S. sclerotiorum and are

most likely required by the pathogen to degrade cell wall and plasma membrane

proteins of the host (Poussereau et al., 2001). This enzyme is also reported as one of the

virulence factors in S. sclerotiorum (Li et al., 2004a) and in other necrotrophic

pathogens such as Botrytis cinerea (Moyahedi and Heale, 1990), and is required by the

pathogen to establish itself within host tissues (Moyahedi and Heale, 1990).

Interestingly, increase in abundance of this enzyme in the susceptible RQ001-02M2

coincided with an expansion of lesion size, with its maximum expression at 72 hpi when

the cotyledons were fully covered by mycelial growth. These findings corroborate the

earlier finding of Poussereau et al. (2001), where increases in the signal of this enzyme

in sunflower cotyledons coincided with intensive mycelial colonization of leaf tissues.

Further decrease in intensity was observed when the cotyledons were completely

invaded or degraded (Poussereau et al. 2001). Apart from being proteolytic, aspartate

proteases may also inactivate or inhibit defence response proteins of the host (such as

antifungal enzymes) which are stimulated in response to the pathogen challenge

CHAPTER 6

121

(Poussereau et al., 2001; Yajima and Kav, 2006). It is possible that defence responses of

the susceptible RQ001-02M2 were countered by this enzyme assisting the successful

establishment of the disease in this genotype. However, delayed and reduced expression

of aspartate protease for the incompatible interaction involving the resistant genotype

Charlton suggests that it is either resistant to the damages caused by the aspartate

proteases and/or is associated with the production of certain antifungal compounds due

to the increased levels of cysteine synthase or GSTs, which are protease inhibitors (e.g.,

as reported for cystatin against protease enzymes secreted by B. cinerea; Pernas et al.,

1999).

6.5.8 Concluding remarks

This proteomics investigation revealed that the coordinated expression of proteins such

as those related to metabolic pathways (carbonic anhydrase, malate dehydrogenase),

antioxidant defence (glutathione S- transferase, superoxide dismutase), protein synthesis

(cysteine synthase), hormone biosynthesis (S-adenosylmethionine synthase) and

pathogenesis (Major latex-related protein) are responsible for mediating defence

responses in the resistant Charlton. Further, the anatomical studies also revealed the

cytoplasmic disorganization of palisade mesophyll cells indicating initiation of cell

death in response to S. sclerotiorum challenge in both the resistant Charlton and the

susceptible RQ001-02M2. In the susceptible genotype, the increased levels of ROS

were manifested by either increased levels of the enzyme involved in ROS generation

(dihydrilipoyl dehydrogenase) at an early stage of the infection process and/or

decreased levels of enzymes involved in ROS detoxification at later stages of the

infection process. However, increased levels of the enzymes responsible for ROS

generation, such as malate dehydrogenase and dihydrilipoyl dehydrogenase, in the

resistant Charlton were mainly manifested at an early stage of infection process. It could

be concluded that the cell death caused by the enhanced levels of ROS in the susceptible

RQ001-02M2 was in fact advantageous to this necrotrophic pathogen as it assists in

sustaining pathogen growth through provision of adequate nutrients. However, any

selective advantage of localized cell death to the pathogen in the resistant Charlton was

prevented by increased levels of other defence-related enzymes such as cysteine

synthase (which was up-regulated at an early stage of infection) and by cellular

protectant such as glutathione S-trasferase. These enzymes may have stimulated the

CHAPTER 6

122

transcription of various phytoalexins and pathogenesis-related proteins that prevented

the spread of the pathogen within the host tissue. These findings were supported by the

anatomical studies in which darkly-stained areas surrounding the dead cells of palisade

mesophyll layer (indicative of phytoalexins and phenolics compounds) were only

observed in the resistant Charlton. It is noteworthy that enzymes involved in cellular

detoxification were also only triggered in the resistant Charlton, where levels of ROS

may be modulated to the advantage of the host. Engineering B. napus plants to over-

express the enzymes that were only up-regulated in the resistant Charlton, and

especially cysteine syntase and glutathione S-transferase, could be an effective strategy

for enhancing resistance against this pathogen.

CHAPTER 6

123

Table 2 Details of the proteins identified in Brassica napus resistant Charlton and susceptible RQ001-02M2 at various times after inoculation with Sclerotinia sclerotiorum.

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

1

*

*

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

72

50S ribosomal protein

L12-C [Arabidopsis

thaliana]

12 2 201/54 K.IGSEISSLTLEEAR.I

R.ILVDYLQDK.F Q8LBJ7 16.6/4.9 19.7/6.0

2

*

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

72

Protein grpE

[Prochlorococcus

marinus]

3 1 70/53 R.ISADFDNFR.K A2BNE2 35.7/4.6 27.5/4.6

3

*

** *

-3.5

-2.5

-1.5

-0.5

0.5

1.5

2.5

3.5

72

Protein disulfide

isomerase [Brassica

carinata]

37 14 681/53

K.IQGFPTIK.I

K.VVVYEGSR.T

K.GFPTIYFR.S

K.SIQDYNGPR.E

R.TKEDFISFIEK.N

R.ADYDFAHTLDAK.L

R.LFKPFDELFVDSK.D

K.AAAELSSQSPPIFLAK.I

K.LSGEEFDSFMAVAEK.L

K.LDATANDIPSDTFDVK.G

K.IDASEESNKGIANEYK.I

K.NVLIEFYAPWCGHCQK.L

K.LAPILDEVALAFQNDPSVIVAK.L

K.ESSIPLVTVFDKDPSNHPYVSK.F

Q38HW3 56/5.1 55.9/5.0

CHAPTER 6

124

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

4

*

* *

*

*

-10.0

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

10.0

72

Uncharacterized

protein At3g54890.4

[Arabidopsis thaliana]

12 5 275/54

K.ESELIHCR.W

R.YKESELIHCR.W

K.YPGGAFDPLGYSK.D

K.KYPGGAFDPLGYSK.D

K.YPGGAFDPLGYSKDPK.K

A8MS75 21.1/5.7 23.4/6.9

5

*

*

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

72 Superoxide dismutase

[Raphanus sativus] 19 5 242/53

R.DFTSYEK.F

R.AYVDNLKK.Q

K.QTLEFHWGK.H

K.QTLEFHWGKHHR.A

K.TFMNNLVSWEAVSSR.L

O65327 22.7/6.2 23.8/6.0

6

-0.16

-0.12

-0.08

-0.04

0.00

0.04

0.08

0.12

0.16

72

UPF0312 protein

PFL_5802

[Pseudomonas

fluorescens]

31 6 409/54

K.DPWGGYR.A

K.EGQHAFVDFK.I

R.TASVFTNHAER.D

K.FSFDAAKPEDAK.I

K.ISHLGYSFITGTFK.D

K.ATFLGEGKDPWGGYR.A

Q4K4H3 21.7/6.5 21.1/7.0

7

*

*

-3.5

-2.5

-1.5

-0.5

0.5

1.5

2.5

3.5

72

Glutathione-S-

transferase [Brassica

rapa subsp.

pekinensis]

42 10 525/54

R.VLLTLHEK.N

R.AITQYIAHR.Y

K.VPAFEDGDLK.L

R.RVLLTLHEK.N

K.VFGHAASTATR.R

K.LATVLDVYEAR.L

K.NLDFELVHVELK.D

R.NPFGKVPAFEDGDLK.L

K.VPAFEDGDLKLFESR.A

Q5DNA8 24.5/6.1 24.3/5.7

.

CHAPTER 6

125

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

K.LFYGMTTDQAVVEEEEAK.L

8

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

72

Uncharacterized

protein At3g63140,

chloroplastic

Tax_Id=3702

[Arabidopsis thaliana]

22 8 391/54

K.DLLGWESK.T

R.NMHFYAEPR.A

K.TVEIVHYDPK.A

K.TNLPEDLKER.F

K.DCEEWFFDR.I

K.QFLFISSAGIYK.S

K.DLDTVRPVVDWAK.S

K.NVLIVNTNSGGHAVIGFYFAK.E

Q9LYA9 40.6/6.2 44.1/8.5

9

**

*

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

72

Uncharacterized

protein At3g63140

[Arabidopsis thaliana]

15 7 336/54

R.FEEYVK.I

K.ERFEEYVK.I

R.NMHFYAEPR.A

K.TVEIVHYDPK.A

K.DCEEWFFDR.I

K.QFLFISSAGIYK.S

K.DLDTVRPVVDWAK.S

Q9LYA9 40.9/6.4 44.1/8.5

10

**

*

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

72 Cysteine synthase

[Populus trichocarpa] 6 2 143/53

K.VTEGCGAYIAAK.Q

K.LIVTIHASFGER.Y A9PGL6 38.8/6.9 40.4/8.6

CHAPTER 6

126

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

11

*

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

72

S-adenosylmethionine

synthetase [Brassica

rapa subsp.

pekinensis]

23 7 468/43

R.WLRPDGK.T

K.TAAYGHFGR.D

K.TIFHLNPSGR.F

R.FVIGGPHGDAGLTGR.K

K.TNMVMVFGEITTK.A

R.SIGFISDDVGLDADKCK.V

R.VHTVLISTQHDETVTNDEIAR.D

Q5DNB1 47.4/6 43.6/5.7

12

*

-12.0

-8.0

-4.0

0.0

4.0

8.0

12.0

72

Monodehydroascorbat

e reductase [Brassica

rapa subsp.

pekinensis]

34 10 591/43

K.GYLFPEGAAR.L

R.RVEHVDHSR.K

R.FGAYWVQDGK.V

K.EAVAPYERPALSK.G

K.YIILGGGVSAGYAAK.E

K.AVVVGGGYIGLELSAALR.I

K.EFASQGVKPGELAVISK.E

K.TSVPDVYAVGDVATFPLK.M

K.GTVASGFTAHPNGEVNEVQLK.D

K.AAEGGGAVEEYDYLPFFYSR.S

Q93X74 45.9/6 46.6/5.8

13

*

-3.5

-2.5

-1.5

-0.5

0.5

1.5

2.5

3.5

72 Malate dehydrogenase

[Arabidopsis thaliana] 12 3 251/43

R.DDLFNINAGIVK.N

K.KLFGVTTLDVVR.A

K.ALEGADLVIIPAGVPR.K

A8MQK3 38.3/6.2 33.3/9.5

14 *

*

-15.0

-12.0

-9.0

-6.0

-3.0

0.0

3.0

6.0

9.0

12.0

15.0

72

Major latex-related

protein [Capsella

rubella]

23 3 121/42

R.GLEGHVMEQLK.V

K.VYDVIYQFIPK.S

R.SWNYTWDGKEEMFK.E

B2WS86 16.7/6.1 17.7/5.7

CHAPTER 6

127

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

15

*

*

*

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

48

20 kDa chaperonin,

chloroplastic

[Arabidopsis thaliana]

23 5 350/43

K.DLKPLNDR.V

K.DGSNYIALR.A

K.YTSIKPLGDR.V

K.YAGTEVEFNDVK.H

K.EKPSIGTVIAVGPGSLDEEGK.I

O65282 24.1/5.6 26.8/8.9

16

*-5.0

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

5.0

48

Putative elongation

factor P (EF-P)

[Arabidopsis thaliana]

18 4 209/53

K.VVDVDPGLR.G

R.NYVNGSTVER.T

R.VLEFLHVKPGK.G

K.AGTNIEVDGAPWR.V

Q8VZW6 23.2/5.4 26.4/8.6

17

*

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

48

Putative

uncharacterized protein

At3g52150

[Arabidopsis thaliana]

13 5 121/43

R.FGFATMK.S

R.FGFATMK.S R.VYIGNIPR.T

R.RVYIGNIPR.T

K.LVEEHGAVEKVQVMYDK.Y

Q8VYM4 28.7/5.6 27.7/8.9

18

*

-10.0

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

10.0

48

ATP synthase

(Fragment) [Brassica

campestris]

40 4 258/43

K.ITDTQLAEVR.S

K.LEPPQLAQIAK.Q

K.TVLDPSLVAGFTIR.Y

K.KQLEDIAAQLELGEIQLAA.-

Q39409 21.3/5.6 14.9/9.2

CHAPTER 6

128

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

19

*

*

*-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

24

Putative

uncharacterized protein

[Mus musculus]

8 2 64/53 R.VAPEEHPTLLTEAPLNPK.A

K.QEYDEAGPSIVHR.K Q3TG92 30.5/4.7 42.4/5.2

20

*

*

*

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

24

RuBisCO large

subunit-binding protein

subunit alpha,

chloroplastic [Brassica

napus]

19 7 352/53

K.LLVEFENAR.V

R.NVVLDEFGSPK.V

K.ITAIKDIIPILEK.T

R.GYISPQFVTNPEK.L

R.AIELPDAMENAGAALIR.E

K.DSTTLIADAASKDELQAR.I

K.ALVAPAALIAQNAGIEGEVVVEK.I

P21239 55.5/4.9 57.7/4.8

21

-5.0

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

5.0

24

Cytochrome b6-f

complex iron-sulfur

subunit, chloroplastic

[Arabidopsis thaliana]

17 3 217/53

K.GDPTYLVVENDK.T

K.VLFVPWVETDFR.T

K.FLCPCHGSQYNAQGR.V

Q9ZR03 18.0/6.2 24.6/8.8

22

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

24

Predicted protein

Tax_Id=3694 [Populus

trichocarpa]

5 1 76/43 R.FCDYTNDKSNLK.G B9I1Y5 16.2/5.2 26.4/8.1

CHAPTER 6

129

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

23

*

-10.0

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

10.0

24

Eukaryotic translation

initiation factor-5A

[Brassica napus]

25 3 154 /54

K.TYPQQAGNIR.K

K.CHFVAIDIFTAK.K

K.KLEDIVPSSHNCDVPHVNR.I

Q6RJS1 18.0/5.9 17.3/5.7

24

*

*

-8.0

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

8.0

12

Ribulose bisphosphate

carboxylase large

chain [Brassica

juncea]

14 7 296/53

K.NHGMHFR.V

K.DTDILAAFR.V

R.DNGLLLHIHR.A

R.ESTLGFVDLLR.D

R.FLFCAEAIYK.S

K.LNYYTPEYETK.D

K.TFQGPPHGIQVER.D

Q6Y9Y8 46.7/6.7 53.4/5.9

25

*

*

*

*

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

12

Putative p-

nitrophenylphosphatas

e [Arabidopsis thaliana]

3 10 611/53

R.YFNYYK.I

K.IQPDFYTSK.I

K.IQYGTLCIR.E

K.VYVIGEEGILK.E

K.RLVFVTNNSTK.S

R.ENPGCLFIATNR.D

K.LIEGVPETLDMLR.A

K.LIEGVPETLDMLR.A

K.GDKLIEGVPETLDMLR.A

K.TLLVLSGVTSISMLESPENK.I

Q8GY27 33.7/5.0 34.3/5.1

CHAPTER 6

130

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

26

*

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

12

Chloroplast fructose-

1,6-bisphosphatase I

[Fragaria ananassa]

1 3 95/53

R.YIGSLVGDFHR.T

R.VLDIQPTEIHQR.V

K.YIDDLKDPGPSGKPYSAR.Y

A8VYM0 48.7/5.1 44.7/5.2

27

*

*

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

12

ATP synthase subunit

beta [Physalis sp.

P078]

9 3 140/53

R.IVGEEHYETAQKVK.Q

R.IVGEEHYETAQRVK.Q

K.GIYPAVDPLDSTSTMLQPR.I

A8Y6H4 16.9/5.3 36/5.2

28

*

*

*

-6.0

-4.0

-2.0

0.0

2.0

4.0

6.0

12

Ribulose bisphosphate

carboxylase large

chain [Leucas

capensis]

9 4 172/54

K.DTDILAAFR.V

R.FLFCAEAIYK.S

K.LNYYTPEYETK.D

K.TFQGPPHGIQVER.D

A2VAR6 50.9/6.7 49.7/6.6

29

*

*

-12.0

-8.0

-4.0

0.0

4.0

8.0

12.0

12

Dihydrolipoyl

dehydrogenase 1,

mitochondrial

[Arabidopsis thaliana]

7 3 140/52

R.TPFTSGLDLEK.I

K.EAAMATYDKPIHI.-

K.ALLHSSHMYHEAK.H

Q9M5K3 56.4/6.8 54.2/7.0

CHAPTER 6

131

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

30

*

*

-4.0

-3.0

-2.0

-1.0

0.0

1.0

2.0

3.0

4.0

12

Carbonic anhydrase,

chloroplast

[Arabidopsis thaliana]

33 8 50/43

K.YMVFACSDSR.V R.NIANMVPPFDK.V

K.YETNPALYGELAK.G

R.NIANMVPPFDKVK.Y

K.VENIVVIGHSACGGIK.G

K.EKYETNPALYGELAK.G

K.VISELGDSAFEDQCGR.C

R.EAVNVSLANLLTYPFVR.E

Q56X90 27.6/6.5 28.5/5.3

31

0.00

0.01

0.01

0.02

0.02

0.03

0.03

0.04

72

Putative

uncharacterized protein

[Sclerotinia

sclerotiorum]

17 2 114/54 R.SASDAFGLISIR.S ,

R.SGSNLQNQAINAFQGGLWIGK.E A7ES05 17.2/4.6 19.4/4.5

32

0.00

0.01

0.01

0.02

0.02

0.03

0.03

0.04

0.04

0.05

0.05

72

Elongation factor 1-

beta [Sclerotinia

sclerotiorum]

11 2 75/55 R.SYIVGYSPSQADVAVFK.A

K.LVAVGFGIK.K A7EN12 34.7/4.7 25.5/4.4

33

0.00

0.02

0.04

0.06

0.08

0.10

72

Aspartate protease

[Sclerotinia

sclerotiorum]

22 4 289 /53

R.SGHDIYTSSK.S

K.GASYSNSYGGYVFPCSATLPTLSFK.I

K.YTGSLTYTSVSSGNGFWEFPSTSYK.V

R.SLSGYSWDISYADGSGASGVVGTDTV

TIGK.T

A7ECZ2 34.8/4.3 41.7/5.1

CHAPTER 6

132

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

34

0.00

0.02

0.04

0.06

0.08

0.10

0.12

0.14

72

Putative

uncharacterized protein

[Sclerotinia

sclerotiorum]

13 5 149/53

K.ALAPEYEEAATTLKEK.K

K.VFRGPDNVSPYSGAR.K

K.AEGVSFPSIVLYK.S

R.TSLAEALKPIAEKHR.G

K.FVQQYVDGKVEPSIK.S

A7ECC8 58.5/4.9 57.9/4.8

35

0.00

0.05

0.10

0.15

0.20

0.25

0.30

72

Putative

uncharacterized protein

[Sclerotinia

sclerotiorum]

52 4 148/54

R.EGKPVSHAFAK.E

K.ELLAGFAAGEVDKLVETK.G

R.SQEQAEHLYDQHYGQDDQYDPNQR.

D R.DAPEHFNRYDNNW.-

A7E835 17.1/5.1 14.6/5.0

36

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0.40

72

ATP synthase subunit

beta [Sclerotinia

sclerotiorum]

14 6 294/53

K.IGLFGGAGVGK.T

K.VVDLLAPYAR.G

R.VQQMLQEYK.S

R.VVGQDHYDTATR.V

K.AHGGYSVFTGVGER.T

R.GISELGIYPAVDPLDSK.S

A7ER40 49.6/5.2 55.6/5.2

37

0.00

0.05

0.10

0.15

0.20

0.25

72

Malate dehydrogenase

[Sclerotinia

sclerotiorum]

17 2 114/54 R.SASDAFGLISIR.S

R.SGSNLQNQAINAFQGGLWIGK.E A7ES05 35.2/6.9 19.4/4.5

CHAPTER 6

133

S. NoA

Time kineticsB

R12S12 R24S24 R48S48 R72S72

hpiC

Identification % Coverage NPD ScoreE Peptide Sequence Accession no.F

Thr Mr/pI (kDa)

Exp Mr/pI (kDa)

38

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

72

Glyceraldehyde 3-

phosphate

dehydrogenase

[Botryotinia fuckeliana]

9 3 125/53

K.YDSTHGQFK.G

R.VLDLLHYISK.V

K.LVSWYDNEWGYSR.R

A6SGS7 42.1/6.6 36.7/5.9

39

0.00

0.02

0.04

0.06

0.08

0.10

0.12

0.14

0.16

0.18

0.20

72

Putative

uncharacterized protein

[Sclerotinia

sclerotiorum]

11 3 123/54

K.TIHWINEAGK.A

K.LIYGDGSGDTFK.S

K.ELITEADQDGGIGTYNTQDR.V

A7F824 43.1/6.1 41.3/5.6

A Spot number as given on the 2-D gel image (Figure 4) that were significantly affected in response to the pathogen challenge as determined by

PDQuest software.

B Time kinetics represents the “expression ratio” for each spot of both resistant Charlton and susceptible RQ001-02M2 at four time points (12, 24, 48

and 72 hours post inoculation (hpi)). Where, R and S represent the resistant and susceptible genotypes respectively. The data was taken in terms of

“fold changes” with respect to the control value (in relation to the average values of spot densities) for each genotype at every time point separately.

However, spots 6 and 31-39 represent the actual values of the spot density data in the absence of detection of any protein in the control genotype (for

these spots). These spot densities were measured from the filtered 2-DE images and each spot density value comprises the sum of the signal intensities

(expressed as spot/optical density units) of all the pixels that make up the object.

CHAPTER 6

134

“ *” indicates statistically significant expression ratio (ER) in response to the pathogen challenge for each genotype at a given time point separately that

is confirmed by Student’s t-test in addition to PDQuest analysis. Bar on each value represents standard error associated with the mean value of

expression ratio for each spot and for each genotype at different time points separately.

C hpi represent hour post inoculation

D NP represents number of peptides

E MASCOT score for the most significant hit/MASCOT cutoff (threshold score)

F Accession number for proteins generated by the MASCOT search

CHAPTER 7

135

CHAPTER 7 High level of Resistance to Sclerotinia sclerotiorum in Introgression Lines Derived from Hybridization between Wild Crucifers and the Crop Brassica species B. napus and B. juncea

7.1 ABSTRACT

Sclerotinia rot caused by the fungus Sclerotinia sclerotiorum is one of the most serious

and damaging diseases of oilseed rape and there is keen worldwide interest to identify

Brassica genotypes with resistance to this pathogen. Complete resistance against this

pathogen has not been reported in the field, with only partial resistance being observed

in some Brassica genotypes. Introgression lines were developed following hybridization

of three wild crucifers (viz. Erucastrum cardaminoides, Diplotaxis tenuisiliqua and E.

abyssinicum) with B. napus or B. juncea. Their resistance responses were characterized

by using a stem inoculation test. Seed of 54 lines of B. napus and B. juncea obtained

from Australia, India and China through an Australian Centre for International

Agricultural Research (ACIAR) collaboration programme were used as susceptible

check comparisons. Introgression lines derived from D. tenuisiliqua, E. cardaminoides

and E. abyssinicum had much higher levels (P < 0.001) of resistance compared with the

ACIAR germplasm. Median values of stem lesion length of introgression lines derived

from the wild species were 1.2, 1.7 and 2.0 cm, respectively, as compared with the

ACIAR germplasm where the median value for stem lesion length was 8.7 cm. This is

the first report of high levels of resistance against S. sclerotiorum in introgression lines

derived from E. cardaminoides, D. tenuisiliqua and E. abyssinicum. The novel sources

of resistance identified in this study are a highly valuable resource that can be used in

oilseed Brassica breeding programmes to enhance resistance in future B. napus and B.

juncea cultivars against Sclerotinia stem rot.

CHAPTER 7

136

7.2 INTRODUCTION

Sclerotinia disease, caused by the fungal pathogen Sclerotinia sclerotiorum, is a serious

threat to oilseed rape production with substantial yield losses recorded world-wide

including India, Europe, China, North America and Australia (Li et al., 1999;

McCartney et al., 1999; Sprague and Stewart-Wade, 2002; Hind et al., 2003; Koch et

al., 2007; Malvarez et al., 2007; Singh et al., 2008). Various methods used for managing

Sclerotinia disease include cultural control, chemical control and varietal resistance

(Bardin and Huang, 2001). The persistent nature of sclerotia and the wide host range of

this pathogen from taxonomically diverse hosts (over 408 plant species) generally

render cultural practices such as crop rotation to be ineffective (Williams and Stelfox,

1980; Boland and Hall, 1994). Further, disease management through chemical control is

also largely ineffective due to difficulty in timing the fungicide application with the

release of ascospores (Bolton et al., 2006). Host resistance offers the only economic and

sustainable method for effectively managing this disease (Zhao et al., 2004; Li et al.,

2006).

While partial resistance against this pathogen has been observed in certain genotypes of

sunflower (Helianthus annuus) (Godoy et al., 2005), beans (Phaseolus coccineus)

(Gilmore et al., 2002), peas (Pisum sativum) (Porter et al., 2009), peanut (Arachis

hypogea) (Cruickshank et al., 2002), or soybean (Glycine max) (Hartman et al., 2000),

complete resistance has not been reported in the field. Partial resistance was also

identified in some of the Brassica napus and, to a lesser extent B. juncea, genotypes

from China (Li et al., 1999, 2006, 2008; Zhao et al., 2004), Australia (Li et al., 2006,

2008) and India (Singh et al., 2008). Although, a significant number of at least partially

resistant genotypes have been identified, breeding to increase the levels of resistance

against Sclerotinia disease, in B. napus and/or B. juncea has been ineffective. This is

mainly because resistance to S. sclerotiorum in existing cultivars of Brassica and in

other cultivated germplasm appears to be of a complex nature i.e., it can either be

monogenic and/or polygenic depending on the different plant species and materials

under investigation (Abawi et al., 1978; Baswana et al., 1991; Zhao and Meng, 2003;

Zhao et al., 2006). Genotypes with higher levels of resistance are urgently required for

CHAPTER 7

137

inclusion in oilseed Brassica breeding programmes to enhance the level of field

resistance in cultivated species such as B. napus and B. juncea.

Lack of effective resistance to Sclerotinia disease in cultivated species has stimulated

the interest of researchers towards exploitation of wild crucifer species to diversify the

existing gene pool. Higher levels of resistance against Sclerotinia have already been

reported in the secondary gene pool of bean (Abawi et al., 1978; Gilmore et al., 2002;

Schwartz et al., 2006), wild Helianthus species (Seiler, 1992; Gulya et al., 2009) and in

a Pisum core collection (Porter et al., 2009). Several successful attempts have been

reported to introgress the resistance from the secondary gene pool of bean (Phaseolus

vulgaris) into the cultivated bean species through interspecific hybridization followed

by backcrossing (e.g., Schwartz et al., 2006; Singh et al., 2009). Introgression of

genomic segments responsible for resistance against Sclerotinia from wild to cultivated

species of sunflower has been attempted in the past (e.g., Ronicke et al., 2004). Despite

the Brassicaceae family comprises of a wide array of different species, to date, it

appears that only two wild crucifers, Capsella bursa-pastoris (Chen et al., 2007) and

Erucastrum gallicum (Lefol et al., 1997a; Seguin-Swartz and Lefol, 1999), have been

previously reported to show high levels of resistance against Sclerotinia disease.

Although introgressive hybrids were successfully obtained between different Brassica

(B. rapa and B. napus) species and Capsella bursa-pastoris (Chen et al., 2007), it

remains to be confirmed if the introgression of resistance against S. sclerotiorum from

E. gallicum into cultivated species has in fact been accomplished (Lefol et al., 1997a, b

Seguin-Swartz et al., 1999). There remains substantial potential both to identify wild

crucifers with high levels of resistance to Sclerotinia disease and for its successful

introgression to the cultivated species.

Three wild crucifers, viz. Erucastrum cardaminoides, Diplotaxis tenuisiliqua and E.

abyssinicum, have been identified with very high levels of resistance against S.

sclerotiorum (S.S. Banga, unpublished data). The aim of this study was to introgress the

genomic segments responsible for resistance against S. sclerotiorum from these three

wild species into the cultivated germplasm. This study reports the results of screening

highly fertile (S4/S5) introgression lines of B. juncea and B. napus derived from three

CHAPTER 7

138

different wild Brassica species, viz. E. cardaminoides, D. tenuisiliqua and E.

abyssinicum, against S. sclerotiorum.

7.3 MATERIALS AND METHODS

7.3.1 Plant materials

7.3.1.1 Experiment 1

Introgression lines, carrying alien genomic segments, were developed for B. juncea and

B. napus by introgression from three wild crucifers viz. E. cardaminoides (2n=18), D.

tenuisiliqua (2n=18) and E. abyssinicum (2n=32). The general outlines of breeding

schemes to introgress genomic segments from wild crucifers into these cultivated

species are detailed in Figures 1- 3. These lines were developed by S. S. Banga

(surin11@rediffmail.com) and co-workers, Punjab Agricultural University from

identified wild crucifers by synthesizing intergeneric hybrids, E. cardaminoides / B.

rapa (Chandra et al., 2004), E. cardaminoides / B. nigra (Chandra et al., 2004), B.

napus / E. cardaminoides, B. juncea / D. tenuisiliqua, and B. juncea / E. abyssinicum.

Chromosome doubling was achieved using colchicine in cross combinations involving

monogenomic Brassica species to restore seed fertility. In crosses of wild crucifers with

digenomics, chromosome doubling was not required as these were partially fertile. The

synthetic amphiploids or the trigenomic hybrids were subsequently used as pollen/seed

parents to hybridize with cultivated digenomics, B. juncea or B. napus (Figs.1-3). This

was followed by three to four generations of selfing using the single pod descent

method. Special attempts were made to select plants showing higher degree of pollen

stainability and self-seed set to initiate next round of selfing and selection.

Selfed progenies of either up to four (BC1S4) or five (S5) generations of all the ten cross

combinations (Table 1) were involved in experiment 1 for identifying their reactions

against S. sclerotiorum. The numbers of genotypes evaluated in each cross combination

are shown in Table 1. These genotype were selected randomly from the populations

(BC1S4/S5) derived from the cross combinations involving wild species and cultivated

germplasm.

CHAPTER 7

139

Figure 1 The general breeding scheme used to introgress segments of the genome from wild species Erucastrum cardaminoides into cultivated lines of Brassica juncea

Figure 2 The schematic representation for developing introgression lines by crossing Brassica napus with Erucastrum cardaminoides

B. napus x E. cardaminoides

Amphihaploid x B. napus

BC1

S-4 generation

Selfing

E. cardaminoides x B. rapa / B. nigra

F1

Synthetic amphidiploid

F1

S-4 generation SSD

Introgression lines

Embryo rescue

Chromosome doubling

Selfing

B. juncea

x

CHAPTER 7

140

Figure 3 The schematic representation for the development of introgression lines from wild crucifers Erucastrum abyssinicum and Diplotaxis tenuisiliqua

7.3.1.2 Susceptible check comparison genotypes

Fifty four germplasm lines of B. napus and B. juncea obtained from Australia, India and

China through an Australian Centre for International Agricultural Research (ACIAR)

collaboration programme were used as susceptible comparison genotypes to the

introgression lines derived from three wild crucifers. These materials were included as

susceptible check comparisons from genotypes of B. napus and B. juncea and these

included some of the most resistant Brassica lines identified in the current ACIAR

disease screening programme (Li et al., 2008).

7.3.1.3 Experiment 2

Introgression lines that showed stem lesion lengths <1cm in first experiment were re-

inoculated at late flowering stage above the site of the first inoculation in order to

confirm the resistance observed in experiment 1. The second experiment was performed

approximately 4 weeks after the initial inoculation (data not presented).

7.3.1.4 Experiment 3

Introgression lines with stem lesion length, <1cm in experiment 1 were selected for

further evaluation in 2008-2009. Three genotypes of B. napus and B. juncea, viz. JLM

298, PBR 91 and GSC 5, were used as susceptible check comparisons during screening

undertaken to identify resistance responses (data not presented).

B. juncea x E. abyssinicum / D. tenuisiliqua

F1

S-4 generation SSD

x B. juncea

CHAPTER 7

141

7.3.2 Field experimental site

All the introgression lines were tested under field conditions at the field site of the

Punjab Agricultural University, India during December to February in 2007-2008 and

again in 2008-2009 (Figs.1-3). For the purpose of screening, twenty seeds per

introgression line were hand sown in single rows of 2 m length and with 0.6 m between

rows. Plants were not thinned after germination.

7.3.3 S. sclerotiorum isolate

A single isolate of S. sclerotiorum was collected from infested B. juncea at the field site

of the Punjab Agricultural University, where significant disease on Brassica lines is

frequently observed during flowering. Surface sterilization of a field collected

sclerotium was done in 50% (v/v) sodium hypochlorite and 70% ethanol for 4 min with

agitation, followed by two washes in sterile distilled water for 1 min as described by

Clarkson et al. (2003) and Li et al. (2006). The sclerotium was then cut in half, placed

on potato dextrose agar (PDA) and incubated at 20°C with 12/12 h light/dark (Clarkson

et al., 2003). Sclerotia subsequently produced were then harvested from the incubated

plates after 4 weeks, air dried overnight at 15oC and finally stored at 4°C, for future use.

7.3.4 S. sclerotiorum inoculations

Resistance responses of all introgression lines were evaluated by using the stem

inoculation test as described by Buchwaldt et al. (2005) and Li et al. (2006). Briefly, ten

plants in each test line were randomly picked and were inoculated at the flowering stage

when 50% of the plants in the rows had at least one opened flower. For each plant, a

single agar plug disc (5 mm diameter) was cut from the actively growing margin of a 3-

day-old colony on a glucose-rich medium (peptone 10 g, glucose 20 g, agar 18 g,

KH2PO4 0.5 g, H2O 1 L, adjusted to pH 4.0 with HCl before autoclaving) and an

inoculum plug was wrapped onto the first internode above the middle node of each stem

using Parafilm®.

7.3.5 Disease assessment

All disease assessments were made at three weeks after inoculation (wai) as impact of

different times of flowering of Brassica genotypes for determining physiological

resistance is insignificant at this particular time of disease assessment (Li et al., 2007).

CHAPTER 7

142

Stem lesion length was measured with a ruler and vernier callipers were used to

measure stem diameters of all inoculated plants as done in earlier studies by Li et al.

(2006; 2007).

7.3.6 Resistance categories

Introgression lines were categorized into five different classes based on their resistant

responses, namely highly resistant (HR), resistant (R), moderately resistant (MR),

susceptible (S) and highly susceptible (HS) with stem lesion lengths ranging from 0 to

<2.5; 2.5 to <5.0; 5.0 to <7.5; 7.5 to 10.0 and > 10.0 cm, respectively.

7.3.7 Data analysis

The R statistical (version 2.8.0) programme was used to identify significant differences

in resistance responses between introgression lines. Significant differences in relation to

stem lesion length between different wild species and ACIAR germplasm were

evaluated using the non-parametric Kruskal–Wallis test. The Mann–Whitney U-test

(Wilcoxon–Mann–Whitney test) was used to compare significant differences with

respect to stem lesion length between all the wild species taken together and the ACIAR

germplasm. The Wilcoxon test was also used for pair-wise comparison of different wild

species (E. cardaminoides, E. abyssinicum and D. tenuisiliqua) and to compare different

cross combinations within a wild species, e.g., comparison of the cross of E.

cardaminoides and B. rapa with E. cardaminoides and B. nigra. Proportions of different

resistant categories as described above were calculated using R statistical within every

cross combination and the significance of differences in these proportions were tested

using the Chi-square test. Non-parametric tests were used because the data was clearly

not normally distributed and standard transformations failed to normalise it.

7.4 RESULTS

7.4.1 Resistance responses of introgression lines derived from three wild species (E.

cardaminoides, D. tenuisiliqua and E. abyssinicum) and of ACIAR germplasm

7.4.1.1 Experiment 1

The Kruskal–Wallis test indicated significant differences (P < 0.001) between

introgression lines derived from three wild species and the ACIAR germplasm in

CHAPTER 7

143

relation to the stem lesion length 3 wai. Introgression lines derived from D. tenuisiliqua

were highly resistant with a median value for stem lesion length of 1.2 cm as compared

with wild species E. cardaminoides and E. abyssinicum (median values =1.7 and 2.0

cm, respectively; Figs. 4-6). The range of stem lesion lengths for introgression lines

derived from three wild species viz. E. cardaminoides, D. tenuisiliqua and E.

abyssinicum varied from 0 to 20, 0.2 to 12.0 and 0 to 25 cm, respectively (Figs. 5-6).

The median value for stem lesion length of ACIAR germplasm was very high, (i.e., 8.7

cm as compared to introgression lines) with stem lesion lengths ranging up to 47.8 cm,

which also confirms the high level of pathogenicity of the isolate of S. sclerotiorum

utilized for this study.

Significant differences were also observed (P < 0.001) between different crosses

involving the wild species with the ACIAR germplasm. The most resistant cross was (B.

juncea x D. tenuisiliqua) x B. juncea with a median value for stem lesion length of 1.0

cm (Fig. 7). The maximum median value for stem lesion length in the (B. juncea x E.

abyssinicum) x B. juncea cross combination was 2.9 cm, which is much smaller than in

the ACIAR germplasm which had a median value of 8.7 cm (Table 1).

Figure 4 An example of reactions of introgression lines against Sclerotinia sclerotiorum developed from wild crucifers Erucastrum cardaminoides, Diplotaxis tenuisiliqua and Erucastrum abyssinicum in relation to stem lesion length assessed 3 weeks after inoculation

Example of a highly resistant [(E. cardaminoides x B. nigra) x B. juncea)] genotype

Example of a susceptible [(B. juncea x E. abyssinicum) x B. juncea] genotype

Example of a highly susceptible (susceptible check comparison, B. juncea) genotype

CHAPTER 7

144

A B C ACIAR

010

2030

40

Introgression lines and ACIAR germplasm

Ste

m le

sion

leng

th (

cm)

3 w

ai

Figure 5 Box plot representation of resistance responses against Sclerotinia sclerotiorum of ACIAR Brassica napus and B. juncea germplasm and introgression lines derived from wild crucifers Erucastrum cardaminoides, Diplotaxis tenuisiliqua and Erucastrum abyssinicum in relation to stem lesion length assessed 3 weeks after inoculation. The central bar represents the median value and each box corresponds to the range between 25th and 75th percentiles. Whiskers from the boxes include the lowest and highest values. A, B and C represent introgression lines developed from E. cardaminoides, D. tenuisiliqua and E. abyssinicum, respectively

A ACIAR B C

0.0

0.5

1.0

1.5

2.0

Introgression lines and ACIAR germplasm

Ste

m le

sion

leng

th (

cm)

3 w

ai

Figure 6 A magnified scale view of resistance responses against Sclerotinia sclerotiorum of ACIAR Brassica napus and B. juncea germplasm and introgression lines derived from wild crucifers Erucastrum cardaminoides, Diplotaxis tenuisiliqua and Erucastrum abyssinicum by box plot representation when range of stem lesion length was restricted to 0-2.0 cm as assessed 3 weeks after inoculation. The central bar, lower bar of the boxes and the lower whisker represent the median value, 25th percentile and the minimum value of the stem lesion length, respectively. A, B and C represent introgression lines developed from E. cardaminoides, D. tenuisiliqua and E. abyssinicum, respectively

CHAPTER 7

145

Table 1 Reactions against Sclerotinia sclerotiorum of different cross combinations of wild crucifers with cultivated species (Brassica rapa, B. nigra, B. juncea and B. napus) and ACIAR Brassica napus and B. juncea germplasm in relation to stem lesion length (cm) 3 weeks after inoculation

Cross combinations Number of genotypes tested

Median value of Stem lesion length (cm)

E. cardaminoides x B. rapaa 5 1.8 E. cardaminoides x B. nigraa 367 2.0 (E. cardaminoides x B. rapa) x B. juncea 331 1.3 (E. cardaminoides x B. nigra) x B.juncea 1154 1.6 (E. cardaminoides x B. nigra) x B. nigra 96 1.5 B. napus x E. cardaminoides 105 2.5 B. juncea x D. tenuisiliqua 109 1.2 (B. juncea x D. tenuisiliqua) x B. juncea 21 1.0 B. juncea x E. abyssinicum 227 1.7 (B. juncea x E. abyssinicum) x B. juncea 334 2.9 ACIAR 1080 8.7

aSelfed progenies of up to five generations (S5) were evaluated and in other cross combinations selfed progenies of up to four generations followed by backcross (BC1S4) were evaluated.

7.4.1.2 Experiment 2

All introgression lines with a stem lesion length of <1.0 cm were re-inoculated at the

late flowering stage above the site of inoculation for the first experiment. Overall,

genotypes showed reasonably consistent results between experiments 1 and 2

(significant linear relationship; P < 0.001), confirming the physiological resistance

identified in experiment 1.

7.4.1.3 Experiment 3

As determined by the Kruskal–Wallis test, there were significant overall differences (P

< 0.001) between the introgression lines derived from three different wild crucifers and

with the susceptible check comparison genotypes, in relation to stem lesion lengths 3

wai. The mean stem lesion length of genotypes used as susceptible check comparisons

in experiment 3 was 4.0 cm with a range varying from 0 to 15.5 cm. However, mean

values for stem lesion length for introgression lines developed from the wild crucifers E.

cardaminoides, D. tenuisiliqua and E. abyssinicum were much lower, viz. 0.42, 0.36 and

0.36 cm, with ranges for stem lesion length of 0-1.5, 0-1.2 and 0-1.2 cm, respectively.

The highly reduced stem lesion lengths recorded on the introgression lines were in

accordance with what was expected, as only introgression lines with stem lesion lengths

CHAPTER 7

146

<1.0 cm in experiment 1 were selected for testing in experiment 3. Moreover, 98% of

the genotypes selected in experiment 3 exhibited consistent results with stem lesion

length <1.0 cm, confirming the high level of resistance in the introgression lines derived

from the three wild crucifers as well as reliability of the screening technique used in this

study.

ACIAR B. juncea x Wiild species B

010

2030

40

aciar a b c d e f g h i j

010

2030

40

wild species crosses

Ste

m le

sion

leng

th (c

m) 3

wai

Figure 7 A box plot representation against Sclerotinia sclerotiorum of resistance responses of ACIAR Brassica napus and B. juncea germplasm and different cross combinations involving wild crucifers Erucastrum cardaminoides, Diplotaxis tenuisiliqua and Erucastrum abyssinicum with cultivated species of B. rapa, B. nigra, B. juncea and B. napus in relation to stem lesion length assessed at 3 weeks after inoculation. The central bar, boxes represent the median value, 25-75th percentile and whiskers the full range of responses

7.4.2 Comparison of introgression lines derived from three wild species

Significant differences were observed between the introgression lines developed from

the wild species E. cardaminoides and D. tenuisiliqua (P = 0.003), E. cardaminoides

and E. abyssinicum (P < 0.001), and D. tenuisiliqua and E. abyssinicum (P < 0.001)

[aciar] “ACIAR" [a] "(B. juncea x D. tenuisiliqua) x B. juncea" [b] "(B. juncea x E. abyssinicum) x B. juncea" [c] "(E. cardaminoides x B. nigra) x B.juncea" [d] "(E. cardaminoides x B. rapa) x B.juncea" [e] "B. juncea x D. tenuisiliqua [f] " B. juncea x E. abyssinicum" [g] "B. napus x E. cardaminoides" [h] "(E. cardaminoides x B. nigra) x B. nigra" [i] " E. cardaminoides x B. nigra" [j] " E. cardaminoides x B. rapa"

CHAPTER 7

147

with respect to stem lesion length 3wai as observed in experiment 1. However, no

significant differences were found when responses of introgression lines in relation to

stem lesion length were compared in experiment 3, which was expected as only those

genotypes whose stem lesion length were <1.0 cm in experiment 1 were evaluated in

this experiment.

Individuals from each cross combination (involving wild species with cultivated

species), along with introgression lines developed solely from the three wild species,

were divided into different resistance categories (HR, R, MR, S, HS) based on their

responses to S. sclerotiorum. The percent proportions of every resistant category

between different cross combinations and introgression lines were significantly different

(P < 0.001) as calculated using the Chi-square test (Fig. 8; Table 2).

Figure 8 The percent distribution of resistance responses against Sclerotinia sclerotiorum of introgression lines developed from wild crucifers Erucastrum cardaminoides, Diplotaxis tenuisiliqua and Erucastrum abyssinicum and ACIAR Brassica napus and B. juncea germplasm in relation to stem lesion length assessed at 3 weeks after inoculation. HR, R, MR, S and HS represent highly resistant, resistant, moderately resistant, susceptible and highly susceptible categories with stem lesion length ranging from 0 to <2.5; 2.5 to <5.0; 5.0 to <7.5; 7.5 to 10.0 and > 10.0 cm, respectively.

CHAPTER 7

148

Table 2 Resistance responses against Sclerotinia sclerotiorum of different cross combinations of wild crucifers with cultivated species of Brassica rapa, B. nigra, B. juncea and B. napus and ACIAR Brassica napus and B. juncea germplasm.

Cross HR R MR S VS Totals E. cardaminoides x B. rapaa 4(80.0) 0(0) 0(0) 1(20) 0(0) 5 E. cardaminoides x B. nigraa 261(71.1) 80(21.8) 15(4.1) 6(1.6) 5(1.4) 367 (E. cardaminoides x B. rapa) x B. juncea 256(77.3) 55(16.6) 15(4.5) 3(0.9) 2(0.6) 331 (E. cardaminoides x B. nigra) x B.juncea 895(77.6) 170(14.7) 58(5.0) 22(1.9) 9(0.8) 1154 (E. cardaminoides x B. nigra) x B. nigra 61(63.5) 18(18.8) 9(9.4) 5(5.2) 3(3.1) 96 B. napus x E. cardaminoides 66(62.9) 38(36.2) 1(1.0) 0(0) 0(0) 105 B. juncea x D. tenuisiliqua 80(73.4) 17(15.6) 6(5.5) 3(2.8) 3(2.8) 109 (B. juncea x D. tenuisiliqua) x B. juncea 18(85.7) 2(9.5) 1(4.8) 0(0) 0(0) 21 B. juncea x E. abyssinicum 142(62.6) 45(19.8) 27(11.9) 8(3.5) 5(2.2) 227 (B. juncea x E. abyssinicum) x B. juncea 162(48.5) 70(21.0) 45(13.5) 32(9.6) 25(7.5) 334 ACIAR 232(21.5) 162(15) 118(10.9) 69(6.4) 499(46.2) 1080

HR, R, MR, S and HS stand for highly resistant, resistant, moderately resistant, susceptible and highly susceptible categories with stem lesion length (cm) ranging from 0 to <2.5; 2.5 to <5.0; 5.0 to <7.5; 7.5 to 10.0 and > 10.0 cm, respectively. Values shown represent total number of genotypes of each cross combination for each resistance category while figures in parenthesis represent their percent proportions aSelfed progenies of up to five generations (S5) were evaluated and in other cross combinations selfed progenies of up to four generations followed by backcross (BC1S4) were evaluated.

CHAPTER 7

149

Table 3 Comparison of different crosses within each wild species Erucastrum cardaminoides, Diplotaxis tenuisiliqua and Erucastrum abyssinicum.

Combination 1 Combination 2 Significance

E. cardaminoides x B. nigra E. cardaminoides x B. rapa ns

(E. cardaminoides x B. nigra) x B. juncea (E. cardaminoides x B. rapa) x B. juncea s

(E. cardaminoides x B. nigra) x B. juncea E. cardaminoides x B. nigra s

(E. cardaminoides x B. rapa) x B. juncea E. cardaminoides x B. rapa ns

(B. juncea x D. tenuisiliqua) x B. juncea B. juncea x D. tenuisiliqua s

(B. juncea x E. abyssinicum) x B. juncea B. juncea x E. abyssinicum s

(P < 0.05) ‘s’ and ‘ns’ represent significant and non-significant differences, respectively, between crosses in relation to stem lesion length assessed 3 weeks after inoculation with Sclerotinia sclerotiorum

7.4.3 Comparison of different cross combinations within each wild species/effect of

second cross species

The cross combinations within the wild species E. cardaminoides, D. tenuisiliqua and

E. abyssinicum were significantly different (P < 0.05) in relation to stem lesion length at

3 wai. However, while crosses involving B. nigra or B. rapa with the wild species E.

cardaminoides (E. cardaminoides x B. nigra, E. cardaminoides x B. rapa) were not

significantly different from each other, significant differences were observed when

these same crosses were further back-crossed with B. juncea i.e [(E. cardaminoides x B.

nigra) x B. juncea and (E. cardaminoides x B. rapa) x B. juncea)] (Table 3). However,

proportion of the plants in the highly resistant (HR) category was similar in all the

crosses mentioned above (Table 2).

7.4.4 Correlation between stem lesion length and stem diameter

Positive significant correlation between stem lesion length and stem diameter (r = 0.05,

P < 0.001, n = 5040) was observed in experiment 1. However, the value of this Pearson

correlation coefficient was so low that this relationship between stem lesion length and

stem diameter was of very little importance. Similar results were also obtained when

stem lesion length was compared with stem diameter in experiment 3 (r = 0.0015, P <

0.001, n = 1135).

CHAPTER 7

150

7.5 DISCUSSION

Introgression lines developed from the three different wild crucifers (viz. E.

cardaminoides, D. tenuisiliqua and E. abyssinicum) showed extremely high levels of

resistance against S. sclerotiorum as compared to the currently available B. napus and B.

juncea germplasm. It is noteworthy that 98% of the progenies of the selected resistant

plants (experiment 3) exhibited consistent responses with stem lesion length <1.0 cm.

This demonstrates a very high transmission frequency of the gene(s) governing

resistance. Such high transmission frequency would be improbable if introgression was

incomplete or if there were one or more addition chromosomes. Maximum transmission

frequency of addition chromosomes can not be more than 0.5% through the female

gamete and is much less through male gamete as reported previously in Brassicas (Hua

et al., 2006) and in other cultivated crops (Chetelat et al., 1998; Shigyo et al., 1998;

Becerra Lopez-Lavalle and Brubaker 2007). Furthermore, selfed progenies of up to four

generations (BC1S4) of each different cross combination involving wild and cultivated

species were used in this study to evaluate their responses against Sclerotinia disease.

The probability of transmission of the alien chromosome is reduced with each selfed

generation. This coupled with very high male and female fertility of the introgression

lines justifies the contention of stable introgression of the gene(s) governing resistance

into the lines used for evaluation in this study.

The very high levels of resistance identified in these introgression lines against S.

sclerotiorum is the first example of such resistance being reported anywhere among

oilseed Brassicas. Only one B. napus line from China, viz. ZY006, with mean stem

lesion length <0.45 cm in a similar stem inoculation test, had been previously identified

as having high levels of resistance among cultivated genotypes of oilseed Brassica (Li

et al., 2008). Progeny of a single cross between B. napus and Capsella bursa-pastoris

were the next most resistant genotypes previously reported with mean stem lesion

length of 1.3 cm (Chen et al., 2007). The next most resistant B. napus genotypes that

have been previously reported included 06-6-3792 (China), ZY004 (China) and RT 108

(Australia) with mean stem lesion lengths of <3.0 cm (Li et al., 2008) and also

Zhongyou 821 (He et al., 1987; Li et al., 1999). In addition, the levels of resistance

reported previously in B. juncea were, in particular, far lower, e.g., B. juncea JM06018

CHAPTER 7

151

and JM 06006 with mean stem lesion lengths of ≤4.8cm (Li et al., 2008) as compared

with B. napus genotypes. This study, in contrast, identified 60% and 3.8% of the

genotypes with mean stem lesion lengths <3.0 and <0.45 cm respectively, amongst

introgression lines involving the cross combinations of three wild crucifers with B.

juncea and B. napus, signifying the outstanding levels of resistance present in these

genotypes.

Median values for stem lesion length for introgression lines derived from D.

tenuisiliqua, E. cardaminoides and E. abyssinicum were 1.2, 1.7 and 2.0 cm,

respectively, as compared to 8.7 cm for the ACIAR genotypes. Clearly, all three wild

crucifers used in this study had extremely high levels of resistance against S.

sclerotiorum. Even though the wild crucifer E. gallicum had been previously reported to

have better resistance to Sclerotinia disease as compared to cultivated lines of Brassica

species (Lefol et al., 1997a; Seguin–Swartz and Lefol, 1999), it was only evaluated

using a cut leaf bioassay with ascospores as the inoculation source. The efficacy of cut

leaf bioassays or detached leaf methods remains debatable, as this method correlates

poorly with the field performance of the Brassica genotypes (Bradley el al., 2006, C-X

Li and M.J. Barbetti, unpublished). However, this study utilized a field stem inoculation

technique across two consecutive years, a methodology shown to be reliable and

repeatable in differentiating oilseed B. napus genotypes responses to Sclerotinia disease

(Li et al., 2006; Buchwaldt et al., 2005). Consistent resistant reactions were observed in

introgression lines across experiments 1 and 2 and also across experiments 1 and 3,

confirming the very high level of physiological resistance identified in the developed

introgression lines.

Previous studies have reported that some of the morphological traits such as stem

diameter and growth stage of canola can affect the reaction of Brassica genotypes to

Sclerotinia disease (Zhao et al., 2004; Zhao and Wang, 2004; Li et al., 2006). While the

present study showed some relationship between stem lesion length and stem diameter

in both experiments 1 and 3, this relationship was weak and not considered meaningful.

This finding, taken in conjunction with the consistent results between experiments 1 and

2, which were performed at two different stages of flowering, is indicative that high

CHAPTER 7

152

levels of resistance identified in these introgression lines were not related to these

morphological traits.

The novel sources of resistance identified in this study are highly valuable genetic

resources that can be utilized in oilseed Brassica breeding programmes to increase

resistance in new cultivars against Sclerotinia disease. The present study constitutes the

first report of successful introgression of very high levels of resistance against S.

sclerotiorum from three wild crucifers, namely E. cardaminoides, D. tenuisiliqua and E.

abyssinicum, into cultivated Brassicas. Future work will focus on the identification and

mapping of the genes governing resistance against S. sclerotiorum.

CHAPTER 8

153

CHAPTER 8 GENERAL DISCUSSION

8.1 SUMMARY

Sclerotinia sclerotiorum is a hugely destructive plant pathogen and poses a major threat

to several economically important crops. Lack of effective disease control measures and

inadequate resistance in the cultivated germplasm limits the management of this disease

under field conditions. Poorly characterized resistance mechanisms against this

pathogen further confine the strategies that can be undertaken to design durable

resistance or effective disease control measures. Further, release of various toxic

compounds by this pathogen (Lumsden, 1979) and variation in the responses of

cultivars to this pathogen that are highly dependent even on slight changes in

environmental conditions makes it difficult to distinguish resistant genotypes. To

address all these, this project was set out with a basic approach to identify resistant

genotypes, (including the different form(s) of resistance expression), and to define the

underlying mechanism(s) of resistance in Brassica napus against S. sclerotiorum.

This project was successful in developing a rapid and reliable method of screening that

can identify reactions of B. napus genotypes to the disease caused by S. sclerotiorum.

Earlier reports on resistance to this pathogen in Brassica spp. (primarily in B. napus and

B. juncea) have only identified partial resistance and this is clearly the first report of the

identification of resistance in B. napus genotypes (e.g., cvs. Charlton and Mystic) at the

cotyledon stage. This investigation also provides a valuable insight into the mechanisms

of resistance at cellular (first report) and biochemical levels by which the resistant

cultivar Charlton was better able to meet the challenges from the pathogen, and was

identified in this study as the first B. napus genotype to show a hypersensitive reaction

to S. sclerotiorum. This study also reports the high level of resistance in introgression

lines developed from the wild crucifers with B. napus and B. juncea (as compared to the

ACIAR germplasm), that supports our initial hypothesis that the wild crucifers can

provide better sources of resistance than those that are available in commercial oilseed

Brassica germplasm, against this pathogen.

CHAPTER 8

154

8.1.1 Identification of sources of resistance

The deployment of a cotyledon assay to identify reactions of B. napus genotypes to S.

sclerotiorum, which although shown to be useful in other pathosystems (Kim et al.,

2000), proved to be highly successful in differentiating responses of B. napus genotypes

against S. sclerotiorum. The development of this method was essentially a prerequisite

of this project so that large numbers of B. napus genotypes can be rapidly screened in as

short a time as possible to identify resistant genotypes. However, various combinations

of the standardization steps had to be employed before achieving this objective, such as

use of an appropriate inoculum medium, as nutrients are necessary for initial

establishment of this pathogen (to simulate petals that are the common substrate in the

field), use of macerated mycelium instead of agar plugs so that mycelial inoculum can

be quantified, identification of the inoculum concentration that can fine-tune the

differentiation of responses of the B. napus genotypes, and defining the time of disease

assessments where maximum differences between resistant and susceptible genotypes

were apparent (data not presented). The resulting cotyledon test thus proved to be

invaluable, especially as it lead to the discovery of the unique responses of cv. Charlton

to S. sclerotiorum involving production of a hypersensitive reaction (Chapter 2, 3, 5 and

6) following application of a specific amount of inoculum while controlling various

environmental factors. Details of the pedigree of the two highly resistant cultivars viz.

Charlton and Mystic identified in this study have previously been described by Cowling

(2007), and could be of interest to the breeders for evolutionary studies and for

introgression of segments responsible for resistance into the cultivated germplasm.

The high degree of repeatability and precision of the cotyledon assay developed in this

study was evident from the high correlation coefficient values between various repeat

experiments [all with r > 0.90, with MBRS-1 isolate (Chapter 2) or r = 0.79 with

combination of isolates (Chapter 3)]. Such high correlation values are difficult to

achieve, especially with Sclerotinia disease where a slight change in environmental

conditions or inoculum pressure can result in highly variable resistance responses to this

pathogen (Bradley et al ., 2006). Further, the reliability of the method developed is also

reflected from the fact that genotype performance against S. sclerotiorum in the

cotyledon assay was significantly and positively correlated with stem lesion ratings

CHAPTER 8

155

from field performances of promising Brassica genotypes. Moreover, the cotyledon

assay developed in this study is an efficient, rapid and inexpensive method of screening

B. napus genotypes for resistance to S. sclerotiorum. It takes only a total of 16 days to

assess the responses of genotypes using this method compared with up to 3-4 months

when other methods such as the stem inoculation technique are utilized.

Another salient finding made in this study was when new sources of resistance

identified in initial screening experiment were further evaluated, with the developed

cotyledon test, across a range of S. sclerotiorum isolates. It is noteworthy that certain

genotypes showed consistent host responses (cv. Charlton) irrespective of the isolates of

S. sclerotiorum used in this study, whereas others showed a significantly variable

pattern of responses (ranging from resistant to susceptible responses, e.g., Zhongyou-

ang No. 4) depending upon the individual isolate used. These findings suggest that the

unique genotypes which show relatively consistent resistant reaction (e.g., cv. Charlton)

across different isolates should be preferentially used as standards in disease screening

programs and in commercial breeding programs, as these are the most likely genotypes

to perform consistently across different national and international geographic locations.

This further illustrates the advantage of screening Brassica genotypes with a range of S.

sclerotiorum isolates so that reaction of different host genotypes can be precisely

identified. Where such a spectrum of isolates is not readily available, it is best to use a

highly pathogenic isolate such as MBRS-1, as used by Li et al. (2006, 2007).

8.1.2 Production and comparison of ascosporic inoculum with mycelial inoculum

Ascospores are considered as a primary source of infection of S. sclerotiorum (Purdy,

1958; Jamaux et al., 1995) and were initially considered to be the ideal inoculum type

for the present study relating to defining the mechanism(s) of resistance against this

pathogen. Due to the inconsistencies reported in literature to date for carpogenic

germination of this pathogen under artificial conditions, different environmental

methods that can enhance carpogenic germination in the laboratory were evaluated in

the present study.

This study found that the overall scarification or constant rinsing with tap water

enhanced the carpogenic germination of sclerotia compared with the other

CHAPTER 8

156

environmental treatments employed. In contrast, other methods (e.g., sterilized distilled

water; sclerotia placed in water with constant aeration) where sclerotia still had

continued exposure to water, did not duplicate this affect. It is possible that the

enhanced carpogenic germination of sclerotia in constant rinsing with water also

involved a “scrubbing” affect apart from a passive leaching of the possible inhibitory

compounds present in the form of dried exudates on the sclerotial rind. This effect is

also similar to the reports relating to fungistasis in which spores of fungal pathogens

exposed to continuous rinsing germinated rapidly, as the fungistasis (Lockwood; 1977)

was negated by this “scrubbing” effect. It should also be noted that the environment in

the south west of Western Australia is typically Mediterranean and is characterized by

hot dry summer and cool wet winters often commencing in late autumn, and rainfall

occurring at this time could simulate the “scrubbing effect” similar to the treatment

conditions employed for carpogenic germination in this study. This behaviour is similar

to that of the seeds of the native plants of Western Australia where factors related to

aging and dormancy have been found to be critical (Sivasithamparam, 1993), with their

timing for germination coinciding with the breaking rains following a hot period of the

Mediterranean summer (Tieu, 2000; Tieu et al., 2001).

The majority of carpogenic germination of sclerotia occurring in this study under

laboratory conditions appeared to be initiated at the same time of the year as well as the

phase of plant growth when flowering of Brassicas occurs, under Western Australian

conditions. This indicates the probable presence of a seasonal rhythm like pattern in

relation to the carpogenic germination of this pathogen. The presence of a “biological

clock” relying on the accumulated information of daily photoperiodic changes and other

physical cues such as temperature, moisture and humidity has already been suggested

for other organisms such as insects (Danks, 2005). It could be that one or more of these

same cues could also be involved in the seasonal rhythm observed for carpogenic

germination in this study, which could be critical for fungi known to produce spores at a

time when appropriate host tissues become available for infection. This seasonal

rhythm-like pattern in this study was observed over a period of two years, and with two

isolates of this pathogen under laboratory conditions. Ideally, further studies on

carpogenic germination that also examine the effects of age of sclerotia and include

setting experiments across different periods of the year, utilizing sclerotia from different

CHAPTER 8

157

climatic zones and monitoring carpogenic germination under a range of different

controlled environmental conditions are needed to confirm the seasonality pattern in

carpogenic germination of this pathogen. Future, studies at molecular level, such as

those conducted for the Neurospora crassa circadian system (dePaula, et al., 2006;

Dunlap and Loros, 2006), would then help to elucidate the seasonality mechanism(s) for

carpogenic germination observed in this study.

8.1.2.1 Comparison of ascosporic inoculum with mycelial inoculum

Owing to the limited amount of ascospores produced in this project (due to the

difficulties associated with the large scale production of ascospores/chapter 4), its

utilization was only restricted to the study aimed at defining the mechanisms of

resistance at a histological level in order that various infection processes could be finely

monitored, starting with spore germination. However, for the proteomics investigation

where large amounts of infected tissue was required at different points of time, mycelial

inoculum was used only after the determination of the approximate level of inoculum

required for monitoring infection processes under the microscope (Chapter 2, Chapter

6).

This study also demonstrated that the macerated mycelial inoculum at the levels used in

this study was equally successful in differentiating the resistant and susceptible

cultivars. This is especially important, as it is a more readily available inoculum source

than the ascospores. Previous studies have also suggested that once mycelium, based on

agar plugs, is applied with a rich source of energy (e.g., PDA), it results in rapid and

extensive ramifications of the host tissue resulting in the provision of inadequate time

for the host to fully engage natural defense responses. For instance, as in earlier work

of Lumsden and Dow (1973) and in Huang et al., (2008), where colonized agar pieces

or petals superimposed on leaves led to the formation of an infection cushion enhancing

pathogen invasion within a few hours of inoculation. However, the amount of mycelial

inoculum used for the cotyledon assays in the project yielded the same results as with

ascosporic inoculum. This was apparent from the early phases of infection (histological

studies) where there were no differences in hyphal length between resistant and

susceptible genotypes at 12 hpi, and impediment of the fungal growth at 1 dpi on

CHAPTER 8

158

resistant Charlton was similar irrespective of the type of inoculum (ascospores vs.

mycelial) used.

8.1.3 Mechanisms of resistance

A valuable insight into the resistance mechanisms that was operational in the resistant

B. napus cultivar Charlton in response to the S. sclerotiorum infection was obtained

through morphological, anatomical and the proteomics investigations. Further, the

infection processes that were affected in resistant Charlton were investigated by using

both ascosporic and mycelial inoculum. It is noteworthy that in all inoculations there

was never any increase in lesion length on the resistant cultivar (data not presented for

ascosporic inoculum) beyond the HR lesion. However, infection on cotyledon (with

mycelial inoculum) on susceptible RQ001-02M2 progressed until day 4, when the

whole cotyledon collapsed.

At 12 h post inoculation (hpi), however there were no significant differences in resistant

Charlton and susceptible RQ001-02M2 in relation to the hyphal length irrespective of

the type of inoculum used for the investigations (Table 1). These histological results

suggest that no signals were imparted by either compatible or incompatible interactions

at this stage that could have affected the growth of the fungal hyphae on the surface of

the host genotype. However, initiation of a biochemical investigations revealed several

proteins, such as those involved in protein synthesis (cysteine synthase), protein folding

(20 kDa chaperonin), and those related to the metabolic pathways (including the one

involved in production of reactive oxygen species), that were significantly upregulated

in resistant Charlton (at 12 hpi) and they could have been responsible for mediating

defence responses against this pathogen. The possible impact of the activity of these

proteins on the pathogen, however, was evident on the resistant host a further 12 h later.

However, susceptible RQ001-02M2 also showed significant upregulation of some of the

proteins involved in metabolic pathways (e.g., dihydrolipoyl dehydrogenase).

CHAPTER 8

159

Table 1 Morphological, anatomical (using both ascosporic and mycelial inoculum) and biochemical changes associated with the infection processes of Sclerotinia sclerotiorum in resistant (cv. Charlton) and susceptible (RQ001-02M2) genotypes of Brassica napus at different time points

Hours/days post inoculation

Genotype Morphological (with mycelial inoculum)

Ascosporic inoculum Mycelial inoculum Proteins (biochemical)

12 hpi Resistant No visible lesion on the surface of the cotyledon

Germ tube elongation No visible growth in hyphal length

Cysteine synthase Malate dehydrgenase, Dihydrolipoyl dehydrogenase 1, 20 kDa chaperonin,Carbonic anhydrase

Susceptible No visible lesion on the surface of the cotyledon

Germ tube elongation No visible growth in hyphal length

Dihydrolipoyl dehydrogenase

1 dpi Resistant Small necrotic lesion Increase in hyphal length, emergence of small lateral branches

Significantly impeded hyphal growth as compared to susceptible genotype, increase in hyphal cell diameter

Major latex-related protein

Susceptible - Increase in hyphal length, hyphal apices swollen, emergence of small lateral branches

Extensive hyphal growth, but confined within the inoculum droplet area

Protein disulfide isomerase

2 dpi Resistant No increase in lesion size (No difference in Resistant and susceptible)

Increase in diameter of some of the hyphal cells, cytoplasmic content within the hyphal cells started shrinking

Significantly impeded hyphal growth, increase in hyphal cell diameter

Glutathione S-transferase, Cysteine synthase, 20 kDa chaperonin,

Susceptible Increase in lesion size (No difference in Resistant and susceptible)

Simple appressoria visible, increase in length of fungal hyphae and of lateral branches

Extensive hyphal growth, hyphae had extended beyond the periphery of the inoculum droplet area

Aspartate protease (virulent factor of S. sclerotiorum)

CHAPTER 8

160

Table 1 (Contd.) Morphological, anatomical (using both ascosporic and mycelial inoculum) and biochemical changes associated with the infection processes of Sclerotinia sclerotiorum in resistant (cv. Charlton) and susceptible (RQ001-02M2) genotypes of Brassica napus at different time points

Hours/days post inoculation

Genotype Morphological (with mycelial inoculum)

Ascosporic inoculum Mycelial inoculum Proteins (biochemical)

3 dpi Resistant No increase in lesion size

Extensive cytoplasm shrinkage in some of the hyphal cells, protoplast extrusion

Hyphal growth within the confines of inoculated area or arrested at the periphery of the inoculum droplet area, disintegration of hyphal cell wall

Glutathione S-transferase, S-adenosylmethionine synthetase, Monodehydroascorbate reductase, Major latex-related protein , Cysteine synthase, Protein disulfide isomerase

Susceptible Increase in lesion size and differences between R and S

Complex appressoria, extensive increase in length of fungal hyphae and of lateral branches

Whole cotyledon covered with mycelial growth

Protein disulfide isomerase, Superoxide dismutase (downregulated), Carbonic anhydrase (downregulated), Aspartate protease (virulent factor of S. sclerotiorum)

4 dpi Resistant No increase in lesion size

Protoplast extrusion, disintegration of hyphal cell

Susceptible Whole cotyledon is collapsed

Complex appressoria

CHAPTER 8

161

It is interesting that impedance of fungal growth on resistant Charlton occurred at the

beginning of the infection process and continued to be evident from 1 day post

inoculation (dpi) onwards (Table 1). This phenomenon was observed irrespective of the

type of the inoculum (ascosporic or mycelial), kind of inoculum medium (Pi glucose

medium or PDB + peptone medium) or type of the S. sclerotiorum isolate deployed

[WW-3(ascosporic inoculum)/MBRS-5(mycelial inoculum)] as evident in the

anatomical studies. Significant and prolonged impedance of hyphal growth on the

surface of resistant Charlton suggests that this resistant genotype perhaps produced

certain antifungal/fungistatic compounds, as suggested by Blakeman & Sztejnberg

(1973) in beetroot (Beta vulgaris) against Botrytis cinerea or Tsuji et al. (1992) in

Arabidopsis thaliana against Pseudomonas syringae. Interestingly, only one protein

type, i.e. pathogenesis related (PR) proteins (Major latex-related protein) was found to

increase in abundance at 1 dpi and that could be the first factor to be hypothetically

related to the impeded hyphal growth if its activity had an immediate affect on the

pathogen. Other proteins such as cysteine synthase and glutathione S-transferase were

increased in abundance only in resistant Charlton at different stages of infection

process. These proteins are known to stimulate transcription of various defence related

proteins such as phenylalanine ammonia lyase (PAL), antifungal proteins or

phytoalexins, and pathogenesis-related proteins involving chitinase or 1,3-β-glucanases

(e.g., Shinshi et al., 1990; Margis-Pinheiro et al., 1991; Rasmussen et al., 1992; Terras

et al., 1995; Zook and Hammerschmidt, 1997) that might have significantly retarded

hyphal growth as well as restricted increases in lesion size on resistant Charlton.

Purification and quantification of phytoalexin/antifungal compounds from resistant

Charlton at each phase of the infection processes can further support this hypothesis and

can elaborate the prevailing resistance mechanism(s) in this genotype.

It is noteworthy that the inoculum sources differed in subsequent behaviour of the

hyphae on resistant Charlton in which there was protoplast extrusion only from the

hyphae arising from the ascospores and not from mycelial inoculum. No explanation is

given to explain this differential response. However, some of the phenomena such as the

increases in diameter of hyphal cells followed by their disintegration were similar in

subsequent stages of infection processes irrespective of the inoculum source used. The

CHAPTER 8

162

protoplast extrusion observed on resistant Charlton could be attributed to the production

of various enzymes such as chitinase and β-glucanase which can digest cell walls of the

fungal hyphae. It is interesting increase in abundance of the genes responsible for

chitinase and β-glucanase production has also been reported in canola genotypes in

response to S. sclerotiorum infection (Zhao et al., 2009). Proteomic investigations

undertaken in this study also tend to support such involvement as several proteins such

as cysteine synthase, glutathione S-transferase, S-adenosylmethionine synthetase

(Ethylene biosynthesis) were found (interestingly coinciding with the protoplast

extrusion phase) only in resistant Charlton. These proteins are also known to induce

transcription of PR proteins including chitinase and β-glucanase (Wingate et al., 1988).

A combination of techniques such as quantification of chitinase/ β-glucanase activity

from resistant and susceptible genotypes (Guthrie et al., 2002) at different stages of

infection processes and/or exogenous application of artificial chitinase (Choquer et al.,

2007) on resistant and susceptible genotypes infected with the pathogen or its mutants

with and without chitinase genes, can further explain the phenomenon of protoplast

extrusion on the resistant Charlton.

Anatomical investigations of Charlton using ascosporic inoculum revealed that the

fungal hyphae arising from the mycelial mat was restricted up to the upper epidermis at

4, 6 and even at 8 dpi except for a few cells of palisade mesophyll layer where starch

deposits were found (Chapter 5). At 4 dpi, simple appressoria was present on resistant

Charlton, however, complex appressoria were consistently evident only on the

susceptible genotype. At 6 dpi and at 8 dpi, there was clear occurrence of infection

cushions on susceptible RQ001-02M2 and there was complete suppression of these in

the resistant genotype. These findings support the earlier established findings that the

formation of infection cushions is a prerequisite for successful invasion, and is not

unusual for certain necrotrophic pathogens such as Rhizoctonia solani (Anderson,

1982), where the invasion of cortical cells is mainly preceded by the production of

infection cushions. These cushions not only constitute large biomass of the fungus at a

specific point of contact to the host, but also facilitate production of larger quantities of

lytic enzymes and other metabolites that are required for pathogenesis (e.g., Prior &

Owen, 1964; Lumsden & Wergin, 1980; Tariq & Jeffries, 1986). Starch deposits were

CHAPTER 8

163

more prevalent in the susceptible RQ001-02M2 as compared with the resistant Charlton

by 4 dpi, which may have provided the pathogen with the carbon source required for its

saprophytic (growth on dead tissues) and parasitic activity (Chapter 5). Additionally,

calcium oxalate crystals in the resistant Charlton in this study were only observed at 8

dpi and were mainly confined to the upper epidermis of the infected tissue as compared

with the susceptible genotype where they were already present by 6 dpi and were

observed throughout the cotyledon tissue by 8 dpi (Chapter 5). As discussed in the

Review of Literature, oxalate crystals clearly play an important role in pathogenesis of

S. sclerotiorum, and it is quite clear that production of these crystals were suppressed in

the tissues of the resistant Charlton. This could be because of the improved expression

of oxalate oxidase gene by resistant Charlton that can enhance resistance to oxalic acid

secreted by the pathogen, by its oxidation into CO2 and H2O2 as reported in Helianthus

annus (Hu et al., 2003) or B. napus (Dong et al., 2008).

Another significant finding in this project was the production of the HR response (as

indicated before) by resistant Charlton, apparent during the early phases of infection as

evidenced by cytoplasmic disorganization of palisade mesophyll cells at 4 dpi and 6 dpi

with ascosporic inoculum, and at 1 dpi with mycelial inoculum. HR lesion observed in

resistant Charlton could be the consequence of the patho-system and inoculation

procedure that were used in this study. It is noteworthy that resistance through HR is

easily explained for biotrophic pathogens, however, it may be a complex mechanism

with necrotrophs which can utilize dead cells as substrates for growth. As a result, a

controversial role of HR response has been proposed involving necrotrophic pathogens.

With necrotrophs, it is considered that HR trigger the production of other antifungal

metabolites such as phytoalexins which prevents the invasion of mycelia into the plant

tissues outside the HR lesion (Hua Li et al., 2004, 2007a). Similarly, the selective

advantage of HR in resistant Charlton was provided by the increased levels of other

defence related enzymes such as cysteine synthase (which was upregulated at an early

stage of infection) and glutathione S-trasferase. These enzymes are also known to

stimulate the transcription of various phytoalexins and pathogenesis related proteins that

might have prevented the spread of the pathogen within the host tissue in addition to

keeping ROS levels under control. Furthermore, the results of these findings were also

CHAPTER 8

164

supported by the anatomical studies where darkly stained areas around the dead cells of

palisade mesophyll cells (indicative of phenolic or phytoalexins compounds) were only

observed in resistant Charlton. Further, Kim et al. (2008) reported that the oxalic acid

elicits plant programmed cell death during S. sclerotiorum disease development. It will

be interesting to compare the induction of genes involved in programmed cell death in

both resistant Charlton and susceptible RQ001-02M2 in addition to using TUNEL assay

or quantifying ROS and various antifungal compounds produced by these genotypes.

The result of these findings may confirm the hypothesis that the selective advantage of

hypersensitive response in the resistant genotype in response to S. sclerotiorum

infection is prevented due to the up-regulation of specific defence related genes.

It is also interesting that increases in abundance of various proteins in resistant Charlton

were apparent at different stages of the infection process. For instance, the enzyme

“Major latex-related enzyme” was significantly upregulated only at 1 and 3 dpi.

Similarly, the enzymes related to antioxidant defence (glutathione S-transferase and

monodehydrascorbate reductase) were only found to increase in abundance at 2 dpi and

3 dpi. Additionally, enzymes such as dihydrolipoyl dehydrogenase 1, 20 kDa

chaperonin were significantly increased in abundance only at 12 hpi. These findings

suggest that it may be possible that certain proteins are more important at specific

phases of the infection process, rather than all of them being active at all times.

8.1.4 Wild cruciferous as a potential source of high resistance to S. sclerotiorum

The search for resistant sources was further extended to wild cruciferous species to test

whether the alien germplasm can provide better sources of resistance to S. sclerotiorum

in comparison to the cultivated species. This study reports the very high level of

resistance in the introgression lines developed following hybridization of three wild

crucifers (viz. Erucastrum cardaminoides, Diplotaxis tenuisiliqua and E. abyssinicum)

with B. napus or B. juncea. The resistance responses of these genotypes were evaluated

in comparison to the 54 lines of B. napus and B. juncea obtained from Australia, India

and China (as a susceptible check comparison). A highly pathogenic isolate of S.

sclerotiorum was used in this screening test which was based on the conclusion of a

previous chapter (Chapter 3) that suggested the need to use a highly pathogenic strain of

CHAPTER 8

165

this pathogen when it is not practicable to use a broad spectrum of isolates to identify

genotypes with consistent resistance responses. The resistance responses of the

introgression lines evaluated in this field were characterized by using a stem inoculation

test (Li et al., 2006). The cotyledon assay was not used in this study as this method was

not standardized for such kind of populations.

8.1.5 Concluding Remarks and future work

The deployment of the cotyledon assay for screening B. napus genotypes lead to the

discovery of resistance in cv. Charlton through the production of a hypersensitive

response. Cultivar Charlton also showed consistent resistant responses across range of

isolates that were used in this project and hence is more suitable for inclusion into the

various breeding programmes.

Various investigations at morphological, histological and proteomic levels conducted in

resistant Charlton (in comparison to susceptible RQ001-02M2) revealed that a co-

ordinated expression of different factors were mediating defence responses in this

genotype in response to S. sclerotiorum infection. For instance, impendence of hyphal

growth, suppression of infection cushion and protoplast extrusion of fungal hyphae were

the significant defence responses that occurred at an anatomical level. It is also

noteworthy that some of the defence responses (impedance of hyphal growth and

increase in hyphae cell diameter) in resistant Charlton persisted irrespective of the type

of inoculum (ascospores/mycelium) used for histological investigations. These

anatomical investigations were further supported by the results of proteomic work

where proteins, including important defence related proteins such as cysteine synthase,

Glutathione S-transferase, monodehydroascorbate reductase and S-adenosylmethionine

synthase, were upregulated only in the resistant genotype. It also shows that resistance

in B. napus to S. sclerotiorum involves a spectrum of genes that may have to operate in

consort to be effective in managing Sclerotinia disease under severe disease pressure.

Further research in this area is needed to address the amount and activity of individual

proteins, in relation to each phase of the infection process, that were identified in the

resistant variety. This would fine-tune our understanding of effective resistance

mechanisms against this pathogen.

CHAPTER 8

166

This study has also opened a spectrum of possibilities especially from agronomic point

of view. One of the most notable outcomes was to identify the mechanistic basis for the

high levels of resistance in introgression lines developed from hybridization between

wild crucifers and B. napus or B. juncea. Future work that focuses on the identification

and mapping of the genes governing resistance against S. sclerotiorum and engineering

them into the cultivated Brassica species offers significant potential to further enhance

the levels of resistance against this devastating pathogen. It will also be useful to

investigate the defence responses that occur in the new introgression lines studied and

their comparison with those found in cv. Charlton in this project. This can not only

further broaden our understanding of mechanism(s) of resistance against this

devastating pathogen, but can also help in designing more effective and sustainable

disease control measures.

Overall, this study has taken a significant step forward in terms of identifying new

sources of resistance in B. napus genotype and defining the mechanisms of resistance

that are associated with symptom suppression in resistant Charlton. This study has also

significantly advanced our understanding of the mechanisms of resistance at both

cellular and biochemical levels in a B. napus genotype that can now form the basis for

developments of markers for disease resistance or to design the effective disease control

measures. The huge losses caused by this pathogen, lack of effective chemical and

cultural disease control practices, high variability in disease outbreaks (depending on

environmental conditions) and the cosmopolitan distribution of this pathogen, further

increases the importance of outcomes of this study. Additionally, this study has also

identified the areas where additional research is needed that can further enhance our

understanding of mechanisms of resistance in B. napus genotypes in response to the

recalcitrant pathogen S. sclerotiorum.

167

Bibliography

Abawi, G.S., Grogan, R.G., 1975. Source of primary inoculum and effects of

temperature and moisture on infection of beans by Whetzelinia sclerotiorum.

Phytopathology 65, 300-309.

Abawi, G.S., Grogan, R.G., 1979. Epidemiology of diseases caused by Sclerotinia

species. Phytopathology 69, 899-904.

Abawi, G.S., Polach, F.J., Molin, W.T., 1975. Infection of bean by ascospores of

Whetzelinia sclerotiorum. Phytopathology 65, 673-678.

Abawi, G.S., Provvidenti, R., Crosier, D.C., Hunter, J.E., 1978. Inheritance of resistance

to white mold disease in Phaseolus coccineus. The Journal of Heredity 69, 200-

202.

Adams, P.B., Ayers, W.A., 1979. Ecology of Sclerotinia species. Phytopathology 69,

896-899.

Alwine, J.C., Russell, F.M., Murray, K.N., 1973. Characterization of an Escherichia

coli mutant deficient in dihydrolipoyl dehydrogenase activity. Journal of

Bacteriology 115, 1-8.

Anderson, N.A., 1982. The Genetics and Pathology of Rhizoctonia Solani. Annual

Review of Phytopathology 329-347 329-347.

Atallah, Z.K., Larget, B., Chen, X., Johnson, D.A., 2004. High genetic diversity,

phenotypic uniformity, and evidence of outcrossing in Sclerotinia sclerotiorum

in the Columbia Basin of Washington State. Phytopathology 94, 737-742.

Auclair, J., Boland, G.J., Cober, E.R., Graef, G.L., Steadman, J.R., Zilka, J., Rajcan, I.,

2004a. Development of a new field inoculation technique to assess partial

resistance in soybean to Sclerotinia sclerotiorum. Canadian Journal of Plant

Science 84, 57-64.

168

Auclair, J., Boland, G.J., Kohn, L.M., Rajcan, I., 2004b. Genetic interactions between

Glycine max and Sclerotinia sclerotiorum using a straw inoculation method. Plant

Disease 88, 891-895.

Bachmann, B.J., Bonner, D.M., 1959. Protoplasts from Neurospora crassa. Journal of

Bacteriology 78, 550 -556.

Badger, M.R., Price, G.D., 1994. The role of carbonic anhydrase in photosynthesis.

Annual Review of Plant Physiology and Plant Molecular Biology 45, 369-392.

Bailey, D.J., 1987. Screening for resistance to Sclerotinia sclerotiorum in oilseed rape

using detached leaves. Tests of Agrochemicals and Cultivars 8, 152--153.

Barbetti, M., Khangura, R., 2000. Fungal diseases of canola in Western Australia.

Bulletin 4406 (ed.) Agriculture Western Australia.

Bardin, S.D., Huang, H.C., 2001. Research on biology and control of Sclerotinia disease

in Canada. Canadian Journal of Plant Pathology 23, 88--98.

Bartnicki-Garcia, S., Lippman, E., 1966. Liberation of protoplasts from the mycelium of

phytophthora. Journal of General Microbiology 42, 411-416.

Bashi, Z.D., Hegedus, D.D., Buchwaldt, L., Rimmer, S.R., Borhan, M.H., 2010.

Expression and regulation of Sclerotinia sclerotiorum necrosis and ethylene-

inducing peptides (NEPs). Molecular Plant Pathology 11, 43-53.

Baswana, K.S., Rastogi, K.B., Sharma, P.P., 1991. Inheritance of stalk rot resistance in

cauliflower (Brassica oleracea var. Botrytis L.). Euphytica 57, 93–96.

Bayliss, K.L., Kuo, J., Sivasithamparam, K., Barbetti, M.J., Lagudah, M.J., 2001.

Infection of subterranean clover (Trifolium subterraneum) by Kabatiella

caulivora. Journal of Phytopathology 149, 699-705.

Becerra Lopez-Lavalle, L.A., Brubaker, C.L., 2007. Frequency and fidelity of alien

chromosome transmission in Gossypium hexaploid bridging populations.

Genome 50, 479-491.

169

Beckman, C.H., 2000. Phenolics-storing cells: keys to programmed cell death and

periderm formation in wilt disease resistance and in general defence response in

plants? Physiological and Molecular Plant Pathology 57, 101-110.

Bedi, K.S., 1956. A simple method for producing apothecia of Sclerotinia sclerotiorum

(Lib) de Bary. Indian Phytopathology 9, 39-43.

Bell-Pedersen, D., Garceau, N., Loros, J.J., 1996. Circadian rhythm in fungi. Journal of

Genetics 75, 387-401.

Berger, S., Sinha, A.K., Roitsch, T., 2007. Plant physiology meets phytopathology:

plant primary metabolism and plant-pathogen interactions. Journal of

Experimental Botany 58, 4019–4026.

Blakeman, J.P., Sztejnberg, A., 1973. Effect of surface wax on inhibition of germination

of Botrytis cinerea spores on beetroot leaves. Physiological Plant Pathology 3,

269-278.

Block, C.C., Gulya, T.J., Marek, L.F., 2009. Evaluation of wild sunflower species for

resistance to Sclerotinia stalk rot Phytopathology 99, S13.

Boland, G.J., Hall, R., 1994. Index of plant hosts of Sclerotinia sclerotiorum. Canadian

Journal of Plant Pathology 16, 93-108.

Boland, G.J., Hunter, J.E., 1988. Influence of Alternaria alternata and Cladosporium

cladosporiodes on white mold of bean caused by Sclerotinia sclerotiorum.

Canadian Journal of Plant Pathology 10, 172-177.

Bolton, M.D., Thomma, B.P.H.J., Nelson, B.D., 2006. Sclerotinia sclerotiorum (Lib.)

de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular

Plant Pathology 7, 1-16.

Bonner, L.J., Dickinson, H.G., 1989. Anther dehiscence in Lycopersicon esculentum

Mill. I. Structural aspects New Phytologist 113, 97-115.

170

Boswell, T.E., 1958. Studies on the effect of some conditions upon the germination of

sclerotia of Sclerotioum rolfsii Sacc. Texas A. and M. University, College

Station.

Botha, C., McLaren, N.W., Swart, W.J., 2009. Evaluation of greenhouse inoculation

techniques used to screen for Sclerotinia stem rot resistance in soybeans : short

communication. South African Journal of Plant and Soil 26, 48-50.

Bouchereau, A., Aziz, A., Larher, F., Martin-Tanguy, J., 1999. Polyamines and

environmental challenges: recent development. Plant Science 140, 103-125.

Bowler, C., Montagu, M.V., Inze, D., 1992. Superoxide dismutase and stress tolerance.

Annual Review of Plant Physiology and Plant Molecular Biology 43, 83-116.

Boyle, C., 1921. Studies in the physiology of parasitism. VI. Infection by Sclerotinia

libertiana. Annals of Botany 35, 337-347.

Bradley, C.A., Henson, R.A., Porter, P.M., LeGare, D.G., del Río, L.E., Khot, S.D.,

2006. Response of canola cultivars to Sclerotinia sclerotiorum in controlled and

field environments. Plant Disease 90, 215-219.

Brenneman, T.B., Phipps, P.M., Stipes, R.J., 1988. A rapid method for evaluating

genotype resistance, fungicide activity, and isolate pathogenicity of Sclerotinia

minor in peanut. Peanut Science 15, 104-107.

Bringans, S., Eriksen, S., Kendrick, T., Gopalakrishnakone, P., Livk, A., Lock, R.,

Lipscombe, R., 2008. Proteomic analysis of the venom of Heterometrus

longimanus (Asian black scorpion). Proteomics 8, 1081-1096.

Broekaert, W.F., Delauré, S.L., De Bolle, M.F.C., Cammue, B.P.A., 2006. The role of

ethylene in host-pathogen interactions. Annual Review of Phytopathology 44,

393-416.

Buchwaldt, L., Li, R., Hegedus, D.D., Rimmer, S., 2005. Pathogenesis of Sclerotinia

sclerotiorum in relation to screening for resistance. Proceedings of the 13th

International Sclerotinia workshop, Monterey, CA, USA, p. 22.

171

Budge, S.P., Whipps, J.M., 1991. Glasshouse trials of Coniothyrium minitans and

Trichoderma species for the biological control of Sclerotinia sclerotiorum in

celery and lettuce. Plant Pathology 40, 59-66.

Büttner, D., Bonas, U., 2006. Who comes first? How plant pathogenic bacteria

orchestrate type III secretion. Current Opinion in Microbiology 9, 193-200.

Bullock, S., Willetts, H.J., Ashford, A.E., 1983. The structure and histochemistry of

sclerotia of Sclerotinia minor Jagger III, changes in ultrastructure and loss of

reserve materials during carpogenic germination. Protoplasma 117, 214-225.

Butler, M.J., Day, A.W., 1998. Fungal melanins: a review. Canadian Journal of

Microbiology 44, 1115-1136.

Calla, B., Vuong, T., Radwan, O., Hartman, G.L., Clough, S.J., 2009. Gene expression

profiling soybean stem tissue early response to Sclerotinia sclerotiorum and in

silico mapping in relation to resistance markers. The Plant Genome 2, 149-166.

Carbone, I., 2000. Population history and process: Nested clade and coalescent analysis

of multiple gene genealogies in a parasite of agricultural and wild

plants[dissertation]. University of Toronto, Toronto (ON).

Carpentier, S.C., Coemans, B., Podevin, N., Laukens, K., Witters, E., Matsumura, H.,

Terauchi, R., Swennen, R., Panis, B., 2008. Functional genomics in a non-model

crop: transcriptomics or proteomics? Physiologia Plantarum 133, 117-130.

Carr, 1990. Rapeseed/Canola. In: Erickson, D.R. (Ed.), Edible fats and oil processing:

Basic principles and modern practices, pp. 289-298.

Cessna, S.G., Sears, V.E., Dickman, M.B., Low, P.S., 2000. Oxalic acid, a

pathogenicity factor for Sclerotinia sclerotiorum suppresses the oxidative burst

of the host plant. Plant Cell 12, 2119-2199.

Chandra, A., Gupta, M.L., Ahuja, I., Kaur, G., Banga, S.S., 2004. Intergeneric

hybridization between Erucastrum cardaminoides and two diploid crop Brassica

species. Theoretical and Applied Genetetics 108, 1620–1626.

172

Chen, H.-F., Wang, H., Li, Z.-Y., 2007. Production and genetic analysis of partial

hybrids in intertribal crosses between Brassica species (B. rapa, B. napus) and

Capsella bursa-pastoris. Plant Cell Reports. 26, 1791-1800.

Chen, Y., Wang, D., 2005. Two convenient methods to evaluate soybean for resistance

to Sclerotinia sclerotiorum. Plant Disease 89, 1268-1272.

Chet, I., 1969. The role of sclerotial rind in the germinability of sclerotia of Sclerotium

rolfsii. Canadian Journal of Botany 47, 593-595.

Chet, I., Henis, Y., 1975. Sclerotial morphogenesis in fungi. Annual Review of Phytopathology 13, 169-172.

Chetelat, R.T., Rick, C.M., Cisneros, P., Alpert, K.B., DeVerna, J.W., 1998.

Identification, transmission, and cytological behavior of Solanum

lycopersicoides Dun. monosomic alien addition lines in tomato (Lycopersicon

esculentum Mill.). Genome 41, 40-50.

Choquera, M., Beckerb, H.F., Vidal-Crosb, A., 2007. Identification of two group A

chitinase genes in Botrytis cinerea which are differentially induced by

exogenous chitin. Mycological Research 111, 615-625

Chou, H.M., Bundock, N., Rolfe, S.A., Scholes, J.D., 2000. Infection of Arabidopsis

thaliana leaves with Albugo candida causes a reprogramming of host

metabolism. Molecular Plant Pathology 1, 99–113.

Chun, D., Kao, L.B., Lockwood, J.L., Isleib, T.G., 1987. Laboratory and field

assessment of resistance in soybean to stem rot caused by Sclerotinia

sclerotiorum. Plant Disease 71, 811--815.

Clarkson, J.P., Phelps, K., Whipps, J.M., Young, C.S., Smith, J.A., Watling, M., 2007.

Forecasting sclerotinia disease on lettuce: a predictive model for carpogenic

germination of Sclerotinia sclerotiorum sclerotia. Phytopathology 97, 621-631.

173

Clarkson, J.P., Staveley, J., Phelps, K., Young, C.S., Whipps, J.M., 2003. Ascospore

release and survival in Sclerotinia sclerotiorum. Mycological Research 107,

213-222.

Clarkson, J.P., Whipps, J.M., Phelps, K., Young, C.S., Smith, J.A., Walting, M., 2004.

Forecasting sclerotinia disease on lettuce: towards developing a prediction

model for carpogenic germination of sclerotia. Phytopathology 94, 268-279.

Cobb, A.C., Dillard, H.R., 1996. A reliable method for producing ascospores of

Sclerotinia sclerotiorum in vitro. Phytopathology 86, S94.

Colditz, F., Krajinski, F., Niehaus, K., 2007. Plant proteomics upon fungal attack. In:

Šamaj, J., Thelen, J.J. (Eds.), Plant Proteomics. Springer Berlin Heidelberg, pp.

283-309.

Coley-Smith, J.R., Cooke, R.C., 1971. Survival and germination of fungal sclerotia.

Annual Review of Phytopathology 9, 65-92.

Cotton, P., Kasza, Z., Bruel, C., Rascle, C., Fevre, M., 2003. Ambient pH controls the

expression of endopolygalacturonase genes in the necrotrophic fungus

Sclerotinia sclerotiorum. FEMS Microbiology Letters 227, 163-169.

Cowling, W.A., 2007. Genetic diversity in Australian canola and implications for crop

breeding for changing future environments. Field Crops Research 104, 103-111.

Cruickshank, A.W., Cooper, M., Ryley, M.J., 2002. Peanut resistance to Sclerotinia

minor and S. sclerotiorum. Australian Journal of Agricultural Research 53,

1105-1110.

Cubeta, M.A., Cody, B.R., Kohli, Y., Kohn, L.M., 1997. Clonality in Sclerotinia

sclerotiorum on infected cabbage in eastern North Carolina. Phytopathology 87,

1000-1004.

174

Cushman, J.C., 1993. Molecular cloning and expression of chloroplast NADP-malate

dehydrogenase during Crassulacean acid metabolism induction by salt stress.

Photosynthesis Research 35, 15-27.

D’Silva, I., Poirier, G.G., Heath, M.C., 1998. Activation of cysteine proteases in cowpea

plants during the hypersensitive response - a form of programmed cell death.

Experimental Cell Research 245, 389-399.

Danks, H.V., 2005. How similar are daily and seasonal biological clocks? Journal of

Insect Physiology 51, 609–619.

Darvill, A.G., Albersheim, P., 1984. Phytoalexins and their elicitors-a defense against

microbial infection in plants. Annual Review of Plant Physiology 35, 243-275.

de Bary, A., 1886. Ueber einige Sclerotinien und Sclerotienkrankheiten. Botanische

Zeitimg 44, 374-474.

de Bary, A., 1887. Comparative Morphology and Biology of the Fungi, Mycetozoa and

Bacteria. Clarendon Press, Oxford, UK.

De Gara, L., de Pinto, M.C., Tommasi, F., 2003. The antioxidant systems vis-à-vis

reactive oxygen species during plant–pathogen interaction. Plant Physiology and

Biochemistry 41, 863-870.

De Lorenzo, G., D’Ovidio, R., Cervone, F., 2001. The role of polygalacturonase-

inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annual Review

of Phytopathology 39, 313-325.

De Lorenzo, G., Ferrari, S., 2002. Polygalacturonase-inhibiting proteins in defense

against phytopathogenic fungi. Current Opinion in Plant Biology 5, 1-5.

Del Rio, L.E., Martinson, C.A., Yang, X.B., 2002. Biological control of Sclerotinia

stem rot of soybean with Sporidesmium sclerotivorum. Plant Disease 86, 999-

1004.

dePaula, R.M., Lewis, Z.A., Greene, A.V., Seo, K.S., Morgan, L.W., Vitalini, M.W.,

Bennett, L., Gomer, R.H., Bell-Pedersen, D., 2006. Two circadian timing

175

circuits in Neurospora crassa cells share components and regulate distinct

rhythmic processes. Journal of Biological Rhythms 21, 159-168.

DeVries, O.M.H., Wessels, J.G.H., 1972. Release of protoplasts from Schizophyllum

commune by a lytic enzyme preparation from Trichoderma viride. Journal of

General Microbiology 73, 13-22.

Dhar, P., Kaur, G., 2009. Optimization of different factors for efficient protoplast

release from entomopathogenic fungus Metarhizium anisopliae. Annals of

Microbiology 59, 183-186.

Dickman, M.B., Park, Y.K., Oltersdorf, T., Li, W., Clemente, T., French, R., 2001.

Abrogation of disease development in plants expressing animal antiapoptotic

genes. Proceedings of the National Academy of Sciences of the United States of

America 98, 6957–6962.

Dillard, H.R., Ludwig, J.W., Hunter, J.E., 1995. Conditioning sclerotia of Sclerotinia

sclerotiorum for carpogenic germination. Plant Disease 79, 411-415.

Donaldsona, P.A., Andersonb, T., Lanec, B.G., Davidsona, A.L., Simmonds, D.H.,

2001. Soybean plants expressing an active oligomeric oxalate oxidase from the

wheat gf-2.8 (germin) gene are resistant to the oxalate-secreting pathogen

Sclerotina sclerotiorum. Physiological and Molecular Plant Pathology 59, 297-

307.

Doney, D.L., Whitney, E.D., 1990. Genetic enhancement in beta for disease resistance

using wild relatives: A strong case for the value of genetic conservation

Economic Botany 44, 445-451.

Dong, X., Ji, R., Guo, X., Foster, S.J., Chen, H., Dong, C., Liu, Y., Hu, Q., Liu, S.,

2008. Expressing a gene encoding wheat oxalate oxidase enhances resistance to

Sclerotinia sclerotiorum in oilseed rape (Brassica napus). Planta 228, 331-340.

Dow, R.L., Lumsden, R.D., 1975. Histology of resistance of Phaseolus coccineus

(Scarlet runner bean) to Sclerotinia sclerotiorum (Abstract). Proceedings of the

American Phytopathological Society 2, 122.

176

Dunlap, J.C., Loros, J.J., 2006. How fungi keep time: circadian system in Neurospora

and other fungi. Current Opinion in Microbiology 9, 579-587.

Durman, S.B., Menendez, A.B., Godeas, A.M., 2003. Mycelial compatibilty groups in

Buenos Aires field populations of Sclerotinia sclerotiorum (Sclerotiniaceae).

Australian Journal of Botany 51, 421-427.

Edwards, R., Blount, J.W., Dixon, R.A., 1991. Glutathione and elicitation of the

phytoalexin response in legume cell cultures. Planta 184, 403-409.

Ekins, M.G., Aitken, E.A.B., Goulter, K.C., 2002. Carpogenic germination of

Sclerotinia minor and potential distribution in Australia. Australasian Plant

Pathology 31, 259-265.

Ekins, M.G., Aitken, E.A.B., Goulter, K.C., 2007. Aggressiveness among isolates of

Sclerotinia sclerotiorum from sunflower. Australasian Plant Pathology 36, 580-

586.

Emerson, S., Emerson, M.R., 1958. Production, reproduction and reversion of

protoplast like structures in the osmotic strains of Neurospora crassa.

Proceedings of the National Academy of Sciences 44, 668-671.

Errampalli, D., Kohn, L.M., 1995. Comparison of pectic zymograms produced by

different clones of Sclerotinia sclerotiorum in culture. Phytopathology 85, 292-

298.

Favaron, F., D’Ovidio, R., Porceddu, E., Alghisi, P., 1994. Purification and molecular

characterization of a soybean polygalacturonase-inhibiting protein. Planta 195,

80-87.

Favaron, F., Sella, L., D’Ovidio, R., 2004. Relationships among endopolygalacturonase,

oxalate, pH, and plant polygalacturonase-inhibiting protein (PGIP) in the

interaction between Sclerotinia sclerotiorum and soybean. Molecular Plant-

Microbe Interactions 17, 1402-1409.

177

Feng, J., Seiler, G.J., Gulya, T.J., Li, C., Jan, C.C., 2007. Sclerotinia stem and head rot

resistant germplasm development utilizing interspecific amphiploids. 29th

Sunflower Research Workshop, January 10-11, 2007, Fargo, ND,

http://www.sunflowernsa.com/research/researchworkshop/documents/feng_etal_

amphiploids_2007.pdf.

Fenice, M., Giambattista, R.D., Leuba, J.L., Federici, F., 1999. Inactivation of Mucor

plumbeus by the combined actions of chitinase and high hydrostatic pressure.

International Journal of Food Microbiology 52, 109-113.

Garg, H., Atri, C., Sandhu, P.S., Kaur, B., Renton, M., Banga, S.K., Singh, H., Singh,

C., Barbetti, M.J., Banga, S.S., 2010a. High level of resistance to Sclerotinia

sclerotiorum in introgression lines derived from wild crucifers and the crop

Brassica species B. napus and B. juncea. Field Crops Research 117, 51-58.

Garg, H., Kohn, L.M., Andrew, M., Hua Li, Sivasithamparam, K., Barbetti, M.J.,

2010b. Pathogenicity of morphologically different isolates of Sclerotinia

sclerotiorum with Brassica napus and B. juncea genotypes. European Journal of

Plant Pathology 126, 305-315.

Garg, H., Sivasithamparam, K., Banga, S.S., Barbetti, M.J., 2008. Cotyledon assay as a

rapid and reliable method of screening for resistance against Sclerotinia

sclerotiorum in Brassica napus genotypes. Australasian Plant Pathology 37, 106-

111.

Garg, H., Sivasithamparam, K., Barbetti, M.J., 2010c. Scarification

and environmental factors that enhance carpogenic germination of

sclerotia of Sclerotinia sclerotiorum. Plant Disease 94, 1041-1047.

Gracia-Garza, J.A.S., Neumann, S., Vynn, T.J., Boland, G.J., 2002. Influence of crop

rotation and tillage on production of apothecia by Sclerotinia sclerotiorum.

Canadian Journal of Plant Pathology 24, 137-143.

Gazaryan, I.G., Krasnikov, B.F., Ashby, G.A., Thorneley, R.N.F., Kristal, B.S., Brown,

A.M., 2002. Zinc is a potent inhibitor of thiol oxidoreductase activity and

178

stimulates reactive oxygen species production by lipoamide dehydrogenase. The

Journal of Biological Chemistry 277, 10064-10072.

Garrabrandt, L.E., Johnston, S.A., Peterson, J.L., 1983. Tan scleortia of Sclerotinia

scleortiorum from lettuce. Mycologia 75, 451-456.

Gilmore, B., Myers, J.R., Kean, D., 2002. Completion of testing of Phaseolus coccineus

plant introductions (PIs) for white mold, Sclerotinia sclerotiorum, resistance.

Annual Report of the Bean Improvement Cooperative, 45.

Godoy, G., Steadman, J.R., Dickman, M.B., Dam, R., 1990. Use of mutants to

demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum

on Phaseolus vulgaris. Physiological and Molecular Plant Pathology 37, 179–

191.

Godoy, M., Castano, F., Re, J., Rodriguez, R., 2005. Sclerotinia resistance in sunflower:

Genotypic variations of hybrids in three environment of Argentina. Euphytica

145, 147-154.

Goins, T.Q., Edens, W.A., Henson, J.M., 2002. Heavily-melanized variants of the

sexual Gaeumannomyces graminis var. tritici are non-pathogenic and

indistinguishable from the asexual, Phialophora state. Mycological Research

106, 1179-1186.

Gossen, B.D., Rimmer, S.R., 2001. First report of resistance to benomyl fungicide in

Sclerotinia sclerotiorum. Plant Disease 85, 1206.

Govrin, E.M., Levine, A., 2000. The hypersensitive response facilitates plant infection

by the necrotrophic pathogen Botrytis cinerea. Current Biology 10, 751-757.

Grau, C.R., Bissonette, H.L., 1974. Whetzelinia stem rot of soybean in Minnesota. Plant

Disease Reporter 58, 693--695.

Grogan, R.G., 1979. Sclerotinia species: Summary and comments on needed research.

Phytopathology 69, 908-910.

179

Grogan, R.G., Abawi, G.S., 1975. Influence of water potential on growth and survival

of Whetzelina sclerotiorum. Phytopathology 65, 122–138.

Gross, G.G., Janse, C., Elstner, E.F., 1977. Involvement of malate, monophenols, and

the superoxide radical in hydrogen peroxide formation by isolated cell walls

from horseradish (Armoracia lapathijolia Gilib.). Planta 136, 271-276.

Guimaraes, R.L., Stotz, H.U., 2004. Oxalate production by Sclerotinia sclerotiorum

deregulates guard cells during infection. Plant Physiology 136, 3703–3711.

Gulya, T., Block, C., Marek, L.F., 2009. Identifying sources of Sclerotinia stalk rot

resistance in wild annual Helianthus species for improvement of cultivated

sunflower., 14th International Sclerotinia Workshop Wilmington, North

Carolina, USA, May 31 - June 4.

Guthrie, J.L., Khalif, S., Castle, A.J., 2005. An improved method for detection and

quantification of chitinase activities. Canadian Journal of Microbiology 51, 491-

495.

Gygi, S.P., Rochon, Y., Franza, B.R., Aebersold, B.R., 1999. Correlation between

protein and mRNA abundance in yeast. Molecular and Cellular Biology 19,

1720-1730.

Halliwell, B., Gutteridge, J.M.C., 1989. Free Radicals in Biology and Medicine (2nd

ed.). Oxford University Press, Oxford, UK: Clarendon.

Hambleton, S., Walker, C., Kohn, L.M., 2002. Clonal lineages of Sclerotinia

sclerotiorum previously known from other crops predominate in 1999-2000

samples from Ontario and Quebec soybean. Canadian Journal of Plant Pathology

24, 309-315.

Hao, J.J., Subbarao, K.V., Duniway, J.M., 2003. Germination of Sclerotinia minor and

S. sclerotiorum sclerotia under various soil moisture and temperature

comibinations. Phytopathology 93, 443-450.

180

Hartl, F.U., 1996. Molecular chaperones in cellular protein folding. Nature 381, 571-

580.

Hartman, G.L., Gardner, M.E., Hymowitz, T., Naidoo, G.C., 2000. Evaluation of

perennial Glycine species for resistance to soybean fungal pathogens that cause

Sclerotinia stem rot and sudden death syndrome. Crop Science 40, 545--549.

Hayes, J.D., McLellan, L.I., 1999. Glutathione and glutathione-dependent enzymes

represent a co-ordinately regulated defence against oxidative stress. Free radical

Research 31, 273-300.

He, Y.H., Yang, R.F., Luo, S.Q., 1987. Development and study of new rapeseed variety

Zhongyou 821 with high yield and disease resistance (tolerance). Oil Crops of

China 2, 11-15.

Hegedus, D.D., Li, R., Buchwaldt, L., Parkin, I., Whitwill, S., Coutu, C., Bekkaoui, D.,

Rimmer, S.R., 2008. Brassica napus possesses an expanded set of

polygalacturonase inhibitor protein genes that are differentially regulated in

response to Sclerotinia sclerotiorum infection, wounding and defense hormone

treatment. Planta 228, 241-253.

Hegedus, D.D., Rimmer, S.R., 2005. Sclerotinia sclerotiorum: When ‘‘to be or not to

be’’ a pathogen? FEMS Microbiology Letters 251, 177–184.

Herbers, K., Takahata, Y., Melzer, M., Mock, H.P., Hajirezaei, M., Sonnewald, U.,

2000. Regulation of carbohydrate partitioning during the interaction of potato

virus Y with tobacco. Molecular Plant Pathology 1, 51–59.

Hind, T.L., Ash, G.J., Murray, G.M., 2001. Sclerotinia minor on canola petals in New

South Wales- a possible airborne mode of infection by ascospores. Australian

Plant Pathology 30, 289-290.

Hind, T.L., Ash, G.J., Murray, G.M., 2003. Prevalence of Sclerotinia stem rot of canola

in New South Wales. Australian Journal of Experimental Agriculture 43, 163-

168.

181

Hind-Lanoiselet, T.L., Lanoiselet, V.M., Lewington, F., Ash, G.J., Murray, G.M., 2005.

Survival of Sclerotinia sclerotiorum under fire. Australasian Plant Pathology 34,

311--317.

Hind-Lanoiselet, T.L., Lewington, F., 2004. Canola concepts: managing Sclerotinia.

Agnote DPI-490, Department of Primary Industries, New South Wales, Wagga

Wagga.

Hoes, J.A., Huang, H.C., 1975. Sclerotinia sclerotiorum viability and separation of

sclerotia from soil. Phytopathology 65, 1431--1432.

Hoffman, D., Diers, B.W., Hartman, G.L., Nickell, C.D., Nelson, R.L., Pedersen, W.L.,

Cober, E.R., Graef, G.L., Steadman, J.R., Grau, C.R., Nelson, B.D., delRio,

L.E., Helms, T., Anderson, T., Poysa, V., Rajcan, I., Stienstra, W., 2002.

Selected soybean plants introductions with partial resistance to Sclerotinia

sclerotiorum. Plant Disease 86, 971-980.

Hu, X., Bidney, D.L., Yalpani, N., Duvick, J.P., Crasta, O., Folkerts, O., Lu, G., 2003.

Overexpression of a gene encoding hydrogen peroxide-generating oxalate

oxidase evokes defense responses in sunflower. Plant Physiology 133, 170-181.

Hua Li, Kuo, J., Barbetti, M.J., Sivasithamparam, K., 2007a. Differences in the

responses of stem tissues of spring-type Brassica napus cultivars with polygenic

resistance and single dominant gene-based resistance to inoculation with

Leptosphaeria maculans. Canadian Journal of Botany 85, 191-203.

Hua Li, Sivasithamparam, K., Barbetti, M.J., Kuo, J., 2004. Germination and invasion

by ascospores and pycnidiospores of Leptosphaeria maculans on spring-type

Brassica napus canola varieties with varying susceptibility to blackleg. Journal

of General Plant Pathology 70, 261–269.

Hua Li, Stone, V., Dean, N., Sivasithamparam, K., Barbetti, M.J., 2007b. Breaching by

a new strain of Leptosphaeria maculans of anatomical barriers in cotyledons of

Brassica napus cultivar Surpass 400 with resistance based on a single dominant

gene. Journal of General Plant Pathology 73, 297-303.

182

Hua, Y.W., Liu, M., Li, Z.Y., 2006. Parental genome separation and elimination of cells

and chromosomes revealed by AFLP and GISH analyses in a Brassica carinata x

Orychophragmus violaceus cross. Annals of Botany 97, 993-998.

Huang, H.C., Bremer, E., Hynes, R.K., Erickson, R.S., 2000. Foliar application of

fungal biocontrol agents for the control of white mold of dry bean caused by

Sclerotinia sclerotiorum. Biological Control 18, 270-276.

Huang, H.C., Kokko, E.G., 1992. Pod rot of dry peas due to infection by ascospores of

Scterotinia scterotiorum. Plant Disease 76, 597-600.

Huang, H.C., Kozub, G.C., 1989. A simple method for production of apothecia from

sclerotia of Sclerotinia sclerotiorum. Plant Protection Bulletin 31, 333-345.

Huang, H.C., Kozub, G.C., 1991. Temperature requirement for carpogenic germination

of sclerotia of Sclerotinia sclerotiorum isolates of different geographic origin.

Botanical Bulletin of Academia Sinica 32, 279-286.

Huang, L., Buchenauer, H., Han, Q., Zhang, X., Kang, Z., 2008. Ultrastructural and

cytochemical studies on the infection process of Sclerotinia sclerotiorum in

oilseed rape. Journal of Plant Diseases and Protection 115, 9-16.

Hunter, J.E., Steadman, J.R., Cigna, J.A., 1982. Preservation of ascospores of

Sclerotinia sclerotiorum on membrane filters. Phytopathology 72, 650-652.

Ishida, A., Ookubo, K., Ono, K., 1987. Formation of hydrogen peroxide by NAD(P)H

oxidation with isolated cell wall-associated peroxidase from cultured liverwort

cells, Marchantia polymorpha L. Plant and Cell Physiology 28, 723-726.

Jacobs, D.I., van Rijssen, M.S., van der Heijden, R., Verpoorte, R., 2001. Sequential

solubilization of proteins precipitated with trichloroacetic acid in acetone from

cultured Catharanthus roseus cells yields 52% more spots after two-dimensional

electrophoresis. Proteomics 1, 1345 - 1350.

Jamaux, I., Gelie, B., Lamarque, C., 1995 Early stages of infection of rapeseed petals

and leaves by Sclerotinia sclerotiorum revealed by scanning electron

microscopy. Plant Pathology 44, 22-30.

183

Jamaux, I., Spire, D., 1994. Development of a polyclonal antibody-based immunoassay

for the early detection of Sclerotinia sclerotiorum in rapeseed petals. Plant

Pathology 43, 847-862.

Jones, D., 1976. Infection of plant tissue by Scterotinia scterotiorum: a scanning

electron microscope study. Micron 7, 275-279.

Jones, E.E., Clarkson, J.P., Mead, A., Whipps, J.M., 2004. Effect of inoculum type and

timing of application of Coniothyrium minitans on Sclerotinia sclerotiorum:

influence on apothecial production. Plant Pathology 53, 621-628.

Joosten, M.H.A.J., Hendrickx, L.J.M., DeWit, P.J.G.M., 1990. Carbohydrate

composition of apoplastic fluids isolated from tomato leaves inoculated with

virulent or avirulent races of Cladosporium fulvum (syn. Fulvia fulva).

Netherlands Journal of Plant Pathology 96, 103-112.

Keay, M.A., 1939. A study of certain species of the genus Sclerotinia. Annals of

Applied Biology 26, 227-246.

Kim, H.S., Hartman, G.L., Manandhar, J.B., Graef, G.L., Steadman, J.R., Diers, B.W.,

2000. Reaction of soybean cultivars to Sclerotinia stem rot in field, greenhouse,

and laboratory evaluations. Crop Science 40, 665--669.

Kim, H.S., Sneller, C.H., Diers, B.W., 1999. Evaluation of soybean cultivars for

resistance to Sclerotinia stem rot in field environment. Crop Science 39, 64-68.

Kim, K.S., Min, J.-Y., Dickman, M.B., 2008. Oxalic acid is an elicitor of plant

programmed cell death during Sclerotinia sclerotiorum disease development.

Molecular Plant-Microbe Interactions 21, 605-612.

Knott, D.R., Dvorak, J., 1976. Alien germ plasm as a source of resistance to disease.

Annual Review of Phytopathology 14, 211-235.

Kocal, N., Sonnewald, U., Sonnewald, S., 2008. Cell wall-bound invertase limits

sucrose export and is involved in symptom development and inhibition of

184

photosynthesis during compatible interaction between tomato and Xanthomonas

campestris pv vesicatoria. Plant Physiology 148, 1523–1536.

Koch, S., Dunker, S., Kleinhenz, B., Rohrig, M., von Tiedemann, A., 2007. A crop loss

- related forcasting model for Sclerotinia stem rot in winter oilseed rape.

Phytopathology 97, 1186-1194.

Kohli, Y., Morrall, R.A.A., Anderson, J.B., Kohn, L.M., 1992. Local and trans-

Canadian clonal distribution of Sclerotinia sclerotiorum on canola.

Phytopathology 82, 875-880.

Kohn, L.M., 1979. Delimitation of the economically important plant pathogenic

Sclerotinia species. Phytopathology 69, 881-886.

Kohn, L.M., Stasovski, E., Carbone, I., Royer, J., Anderson, J.B., 1991. Mycelial

incompatibility and molecular markers identify genetic variability in field

populations of Sclerotinia sclerotiorum. Phytopathology 81, 480-485.

Kora, C., McDonald, M.R., Boland, G.J., 2003. Sclerotinia rot of carrot: An example of

phonological adaptation and bicyclic development by Sclerotinia sclerotiorum.

Plant Disease 87, 456-470.

Kowalska, A., Niks, R.E., 1999. Histology of quantitative resistance in flax to the flax

rust fungus (Melampsora lini). Canadian Journal of Plant Pathology 21, 354–

360.

Krishnaswamy, S.S., Srivastava, S., Mohammadi, M., Rahman, M.H., Deyholos, M.K.,

Kav, N.N.V., 2008. Transcriptional profiling of pea ABR17 mediated changes in

gene expression in Arabidopsis thaliana. BMC Plant Biology 8, 91.

Kubo, Y., Takano, Y., Tsuji, G., Horino, O., Furusawa, I., 2000. Regulation of melanin

biosynthesis genes during appresorium formation of Colletotrichum lagenarium.

In: Host Specificity, Pathogenicity, and host Pathogen Interactions of

Colletotrichum (S. Freeman, D. Prusky & M dickman, Eds). American

Phytopathological Society Press , St Paul, MN, 99-113.

185

Kull, L.S., Pedersen, W.L., Palmquist, D., Hartman, G.L., 2004. Mycelial compatibility

grouping and aggressiveness of Sclerotinia sclerotiorum. Plant Disease 88, 325-

332.

Kull, L.S., Vuong, T.D., Powers, K.S., Eskridge, K.M., Steadman, J.R., Hartman, G.L.,

2003. Evaluation of resistance screening methods for Sclerotinia stem rot of

soybean and dry bean. Plant Disease 87, 1471-1476.

Lamb, C., Dixon, R.A., 1997. The oxidative burst in plant disease resistance. Annual

Review of Plant Physiology and Plant Molecular Biology 48, 251-275.

Lazarovits, G., Starratt, A.N., Huang, H.C., 2000. The effect of tricyclazole and culture

medium on production of the melanin precursor 1,8-dihydroxynaphthalene by

Sclerotinia sclerotiorum isolate SS7. Pesticide Biochemistry and Physiology 67,

54-62.

Lefol, C., S´eguin-Swartz, G., Morrall, R.A.A., 1997a. Resistance to Sclerotinia

sclerotiorum in a weed related to canola. Canadian Journal of Plant Pathology

19, 113 (Abstract).

Lefol, E., S´eguin-Swartz, G., Downey, R.K., 1997b. Sexual hybridisation in crosses of

cultivated Brassica species with the crucifers Erucastrum gallicum and

Raphanus raphanistrum: Potential for gene introgression. Euphytica 95, 127–

139.

Leone, G., Tonneijck, A.E.G., 1990. A rapid procedure for screening the resistance of

bean cultivars (Phaseolus vulgaris L.) to Botrytis cinerea and Sclerotinia

sclerotiorum. Euphytica 48, 87-90.

Levine, A., Tenhaken, R., Dixon, R., Lamb, C., 1994. H2O2 from the oxidative burst

orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-

593.

Li, C.X., Hua Li, Siddique, A.B., Sivasithamparam, K., Salisbury, P., Banga, S.S.,

Banga, S., Chattopadhyay, C., Kumar, A., Singh, R., Singh, D., Agnihotri, A.,

Liu, S.Y., Li, Y.C., Tu, J., Fu, T.D., Wang, Y.F., Barbetti, M.J., 2007. The

186

importance of the type and time of inoculation and assessment in the

determination of resistance in Brassia napus and B. juncea to Sclerotinia

sclerotiorum. Australian Journal of Agricultural Research 58, 1198-1203.

Li, C.X., Hua Li, Sivasithamparam, K., Fu, T.D., Li, Y.C., Liu, S.Y., Barbetti, M.J.,

2006. Expression of field resistance under Western Australian conditions to

Sclerotinia sclerotiorum in Chinese and Australian Brassica napus and Brassica

juncea germplasm and its relation with stem diameter. Australian Journal of

Agricultural Research 57, 1131-1135.

Li, C.X., Liu, S.Y., Sivasithamparam, K., Barbetti, M.J., 2008. New sources of

resistance to Sclerotinia stem rot caused by Sclerotinia sclerotiorum in Chinese

and Australian Brassica napus and Brassica juncea germplasm screened under

Western Australian conditions. Australasian Plant Pathology 38, 149-152.

Li, G.Q., Huang, H.C., Laroche, A., Acharaya, S.N., 2003. Occurrence and

characterization of hypovirulence in the tan sclerotial isolates of S10 of

Sclerotinia sclerotiorum. Mycological Research 107, 1350 -1360.

Li, Q.S., McChartney, H.A., Bao- Cheng, H.U., Heran, A., Chen, F.X., Zhao, C.S., Hou,

S., Wu, X.J., Fei, W., Sun, Y., 2005. Screening methods for resistance to

Sclerotinia sclerotiorum in rapeseed. GCIRC Bulletin 22,

http://195.101.239.21/publi/B21/chinaqiangshenglidoc.htm.

Li, R., Rimmer, R., Buchwaldt, L., Sharpe, A.G., Seguin-Swartz, G., Coutu, C.,

Hegedus, D.D., 2004a. Interaction of Sclerotinia sclerotiorum with a resistant

Brassica napus cultivar: expressed sequence tag analysis identifies genes

associated with fungal pathogenesis. Fungal Genetics and Biology 41, 735-753.

Li, R., Rimmer, R., Buchwaldt, L., Sharpe, A.G., Seguin-Swartz, G., Hegedus, D.D.,

2004b. Interaction of Sclerotinia sclerotiorum with Brassica napus: cloning and

characterization of endo- and exo-polygalacturonases expressed during

saprophytic and parasitic modes. Fungal Genetics and Biology 41, 754-765.

187

Li, Y., Chen, J., Bennett, R., Kiddle, G., Wallsgrove, R., Huang, Y., He, Y., 1999.

Breeding, Inheritance, and Biochemical studies on Brassica napus cv. Zhongyou

821: Tolerance to Sclerotinia sclerotiorum (Stem Rot). In: N, Wratten., PA,

Salisbury. (Eds.), 10th International Rapeseed Congress, Canberra, Australia, p.

61.

Liang, Y., Srivastava, S., Rahman, M.H., E, S.S., Kav, N.N.V., 2008. Proteome changes

in leaves of Brassica napus L. as a result of Sclerotinia sclerotiorum challenge.

Journal of Agricultural and Food Chemistry 56, 1963-1976.

Liang, Y., Strelkov, S.E., Kav, N.N.V., 2009. Oxalic acid-mediated responses in

Brassica napus L. Proteomics 9, 3156-3173.

Liu, J.J., Ekramoddoullah, A.K.M., 2006. The family 10 of plant pathogenesis related

proteins: their structure, regulation, and function in response to biotic and abiotic

stresses. Physiological and Molecular Plant Pathology 68, 3-13.

Liu, R., Zhao, J., Xiao, Y., Meng, J., 2005. Identification of prior candidate genes for

Sclerotinia local resistance in Brassica napus using Arabidopsis cDNA

microarray and Brassica-Arabidopsis comparative mapping. Science in China

Series C: Life Sciences 48, 460-470.

Liu, X., Huang, B., Lin, J., Fei, J., Chen, Z., Pang, Y., Sun, X., Kexuan, T., 2006b. A

novel pathogenesis-related protein (SsPR10) from Solanum surattense with

ribonucleolytic and antimicrobial activity is stress- and pathogen-inducible.

Journal of Plant Physiology 163, 546-556.

Lockwood, J.L., 1977. Fungistasis in soils Biological Reviews 52, 1-43.

Long, D.E., Fung, A.K., McGee, E.E.M., Cooke, R.C., Lewis, D.M., 1975. The activity

of invertase and its relevance to the accumulation of storage polysaccharides in

leaves infected by biotrophic fungi. New Phytologist 74, 173-182.

Loyall, L., Uchida, K., Braun, S., Furuya, M., Frohnmeyer, H., 2000. Glutathione and a

UV light–induced glutathione S-transferase are involved in signaling to chalcone

synthase in cell cultures. The Plant Cell 12, 1939–1950.

188

Lumsden, R.D., 1976. Pectolytic enzymes of Sclerotinia sclerotiorum and their

localization in infected bean. Canadian Journal of Botany 54, 2630-2641.

Lumsden, R.D., 1979. Histology and physiology of pathogenesis in plant diseases

caused by Sclerotinia species. Phytopathology 69, 890-896.

Lumsden, R.D., Dow, R.L., 1971. Histopathology of infection of bean hypocotyls by

Sclerotinia sclerotiorum. Phytopathology 60, 1301(Abstract).

Lumsden, R.D., Dow, R.L., 1973. Histopathology of Sclerotinia sclerotiorum infection

of bean. Phytopathology 63, 708-715.

Lumsden, R.D., Wergin, W.P., 1980. Scanning-electron microscopy of infection of bean

by species of Sclerotinia. Mycologia 12, 1200-1209.

Madjid, A., Honma, S., Lacy, M.L., 1983. A greenhouse method for screening lettuce

for resistance to Sclerotinia sclerotiorum Scientia Horticulturae 18, 201-206.

Magro, P., Marciano, P., Lenna, P., 1984. Oxalic aid production and its role in

pathogenesis of Sclerotinia sclerotiorum. FEMS Microbiology Letters 24, 9-12.

Makkonen, R., Pohjakallio, O., 1960. On the parasites attacking the sclerotia of some

fungi pathogenic to higher plants and on the resistance of these sclerotia to their

parasites. Acta Agriculturae Scandinavica 10, 105-126.

Maltby, A.D., Mihail, J.D., 1997. Competition among Sclerotinia sclerotiorum

genotypes within canola stems. Canadian Journal of Botany 75, 462-468.

Malvarez, G., Carbone, I., Grunwald, N.J., Subbarao, K.V., Schafer, M., Kohn, L.M.,

2007. New populations of Sclerotinia sclerotiorum from lettuce in California

and peas and lentils in Washington. Phytopathology 97, 470-483.

Marciano, P., Lenna, D., Magro, P., 1983. Oxalic acid, cell wall degrading enzymes and

ph in pathogenesis and their significance in the virulence of two Sclerotinia

sclerotiorum isolates on sunflower. Physiological Plant Pathology 22, 339-345.

189

Margis-Pinheiro, M., Metz-Boutigue, M.H., Awade, A., de Tapia, M., le Ret, M.,

Burkard, G., 1991. Isolation of a complementary DNA encoding the bean PR4

chitinase: an acidic enzyme with an amino-terminus cysteine-rich domain. Plant

Molecular Biology 17, 243-253.

Marra, R., Ambrosino, P., Carbone, V., Vinale, F., Woo, S.L., Ruocco, M., Ciliento, R.,

Lanzuise, S., Ferraioli, S., Soriente, I., Gigante, S., Turrà, D., Fogliano, V.,

Scala, F., Lorito, M., 2006. Study of the three-way interaction between

Trichoderma atroviride, plant and fungal pathogens by using a proteomic

approach Current Genetics 50, 307-321.

Marrs, K.A., 1996. The functions and regulation of glutathione S-transferases in plants.

Annual Review of Plant Physiology and Plant Molecular Biology 47, 127-158.

Martel, M.B., Letoublon, R., Fevre, M., 1998. Purification and characterization of two

endopolygalacturonases secreted during the early stages of the saprophytic

growth of Sclerotinia sclerotiorum. FEMS Microbiology Letters 158, 133–138.

Mauch, F., Dudler, R., 1993. Differential induction of distinct glutathione-S-transferases

of wheat by xenobiotics and by pathogen attack. Plant Physiology 102, 1193-

1201.

McCartney, H.A., Lacey, M.E., Li, Q., Heran, A., 1999. Airborne ascospore

concentration and the infection of oilseed rape and sunflowers by Sclerotinia

sclerotiorum. In: Wratten, N., Salisbury, P. (Eds.), Proceedings of the 10th

International Rapeseed Congress. Groupe Consultatif International de Recherche

sur le Colza, Paris, France., Canberra, Australia, p. 132.

McDonald, M.R., Boland, G.J., 2004. Forecasting Sclerotinia diseases in eastern

Canada: fact or fiction? Canadian Journal of Plant Pathology 26, 480-488.

Mehta, A., Brasileiro, A.C.M., Souza, D.S.L., Romano, E., Campos, M.A., Grossi-de-

Sá, M.F., Silva, M.S., Franco, O.L., Fragoso, R.R., Bevitori, R., Rocha, T.L.,

2008. Plant-pathogen interaction: what is proteomics telling us? The FEBS

Journal 275, 3731-3746.

190

Melzer, M.S., Boland, G.J., 1996. Transmissible hypovirulence in Sclerotinia minor.

Canadian Journal of Plant Pathology 18, 19-28.

Micic, Z., Hahn, V., Bauer, E., Melchinger, A.E., Knapp, S.J., Tang, S., Schon, C.C.,

2005. Identification and validation of QTL for Sclerotinia midstalk rot resistance

in sunflower by selective genotyping. Theoretical and Applied Genetics 111,

233-242.

Mila, A.L., Yang, X.B., 2008. Effects of fluctuating soil temperature and water potential

on sclerotia germination and apothecial production of Sclerotinia sclerotiorum.

Plant Disease 92, 78-82.

Minarcic, P., Janitor, A., 1994. Changes of starch content in above-ground part of barley

plants infected by powdery mildew (Erysiphe graminis). Bulletin Slovenskej

Botanickej Spoločnosti 49, 77-82.

Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends in Plants

Science 7, 405-410.

Mondolot-Cosson, L., Andary, C., 1994. Resistance factors of a wild species of

sunflower, Helianthus resinosus, to Sclerotinia sclerotiorum. In: Geibel, M.,

Treutter, D., Feucht, W. (Eds.), ISHS Acta Horticulturae 381:International

Symposium on Natural Phenols in Plant Resistance, Weihenstephan, Germany.

Morrall, R.A.A., 1977. A preliminary study of the influence of water potential on

sclerotium germination in Sclerotinia sclerotiorum. Canadian journal of Botany

55, 8-11.

Morrall, R.A.A., Duczek, L.J., Sheard, J.W., 1972. Variation and correlations within

and between morphology, pathogenicity, and pectolytic enzyme activity in

Sclerotinia from Saskatchewan. Canadian journal of Botany 50, 767-786.

Movahedi, S., Heale, J.B., 1990. The roles of aspartic proteinase and endo-pectin lyase

enzymes in the primary stages of infection and pathogenesis of various host

tissues by different isolates of Botrytis cinerea Pers. ex Pers. Physiological and

Molecular Plant Pathology 36, 303-324.

191

Mueller, D.S., Dorrance, A.E., Derksen, R.C., Ozkan, E., Kurle, J.E., Grau, C.R.,

Gaska, J.M., Hartman, G.L., Bradley, C.A., Pedersen, W.L., 2002. Efficacy of

fungicides on Sclerotinia sclerotiorum and their potential for control of

Sclerotinia stem rot on soybean. Plant Disease 86, 26-31.

Mylchreest, S.J., Wheeler, B.E.J., 1987. A method for inducing apothecia from sclerotia

of Sclerotinia sclerotiorum. Plant Pathology 36, 16-20.

Neill, S.J., Desikan, R., Clarke, A., Hurst, R.D., Hancock, J.T., 2002. Hydrogen

peroxide and nitric oxide as signalling molecules in plants. Journal of

Experimental Botany 53, 1237-1242.

Nelson, B., Duval, D., Wu, H., 1988. An in vitro technique for large-scale production of

sclerotia of Sclerotinia sclerotiorum. Phytopathology 78, 1470 -1472.

Nelson, B.D., Helms, T.C., Olson, M.A., 1991. Comparison of laboratory and field

evaluation of resistance in soybean to Sclerotinia sclerotiorum. Plant Disease 75,

662--665.

Newton, H.C., Sequeira, L., 1972. Ascospores as the primary infection propagule of

Sclerotinia sclerotiorum in Wisconsin. Plant Disease Report 56, 798-802.

Noctor, G., Foyer, C.H., 1998. Ascorbate and glutathione: Keeping active oxygen under

control. Annual Review of Plant Physiology and Plant Molecular Biology 49,

249-279.

Noji, M., Saito, M., Nakamura, M., Aono, M., Saji, H., Saito, K., 2001. Cysteine

synthase overexpression in tobacco confers tolerance to sulfur-containing

environmental pollutants Plant Physiology 973-980.

Noyes, R.D., Hancock, J.G., 1981. Role of oxalic acid in the secretion wilt of sunflower.

Physiological Plant Pathology 18, 123-132.

O’Brien, T.P., McCully, M.E., 1981. The study of plant structure: principles and

selected methods., Termarcarphi Pty. Ltd., Melbourne, Australia.

192

Osmark, P., Boyle, B., Brisson, N., 1998. Sequential and structural homology between

intracellular pathogenesis-related proteins and a group of latex proteins. Plant

Molecular Biology 38, 1243-1246.

Otto-Hansona, L., Eskridgeb, K.M., Steadmana, J.R., Madisac, G., 2009. The

Sensitivity Ratio: A Superior Method to Compare Plant and Pathogen Screening

Tests. Crop Science 49, 153-160.

Park, C.J., Kim, K.J., Shin, R., Park, J.M., Shin, Y.C., Paek, K.H., 2004. Pathogenesis-

related protein 10 isolated from hot pepper functions as a ribonuclease in an

antiviral pathway. The Plant Journal 37, 186-198.

Peleman, J., Boerjan, W., Engler, G., Seurinck, J., Botterman, J., Alliotte, T., Van

Montagu, M., Inze, D., 1989. Strong cellular preference in the expression of a

housekeeping gene of Arabidopsis thaliana encoding S-Adenosylmethionine

synthetase. The Plant Cell 1, 81-93.

Pernas, M., Lopez-Solanilla, E., Sanchez-Monge, R., Salcedo, G., Rodriguez-

Palenzuela, P., 1999. Antifungal Activity of a Plant Cystatin. Molecular Plant-

Microbe Interactions 12, 624-627.

Phillips, A.J.L., 1986. Carpogenic germination of sclerotia of Sclerotinia sclerotiorum

after periods of conditioing in soil. Journal of Phytopathology 116, 247-258.

Phillips, A.J.L., 1987. Carpogenic germination of sclerotia of Sclerotinia sclerotiorum:

A review. Phytophylactica 19, 279-283.

Phillips, D.V., Carbone, I., Gold, S.E., Kohn, L.M., 2002. Phylogeography and

genotype-symptom associations in early and late season infections of canola by

Sclerotinia sclerotiorum. Phytopathology 92, 785-793.

Phillips, D.V., Raymer, P.L., Auld, D.L., 1990. Apparent resistance to Sclerotinia stem

rot in oilseed Brassica. Phytopathology 80, 1039 [Abstract].

Porter, L.D., Hoheisel, G., Coffman, V.A., 2009. Resistance of peas to Sclerotinia

sclerotiorum in the Pisum core collection. Plant Pathology 58, 52-60.

193

Poussereau, N., Gente, S., Rascle, C., Billon-Grand, G., Fevre, M., 2001. aspS encoding

an unusual aspartyl protease from Sclerotinia sclerotiorum is expressed during

phytopathogenesis. FEMS Microbiology Letters 194, 27-32.

Pratt, R.G., Rowe, D.E., 1991. Differential responses of alfalfa genotypes to stem

inoculations with Sclerotinia sclerotiorum and S. trifoliorum. Plant Disease 75,

188-191.

Pratt, R.G., Rowe, D.E., 1995. Comparative pathogenicity of isolates of Sclerotinia

trifoliorum and S. sclerotiorum on alfalfa cultivars. Plant Disease 79, 474-477.

Pratt, R.G., Rowe, D.E., 1998. Evaluation of simplified leaf inoculation procedures for

identification of quantitative resistance to Sclerotinia trifoliorum in alfalfa

seedlings. Plant Disease 82, 1161--1164.

Price, K., Colhoun, J., 1975. Pathogenicity of isolates of Sclerotinia sclerotiorum (Lib.)

de Bary to several hosts. Phytopathology Z. 83, 232-238.

Prior, G.D., Owen, J.H., 1964. Pathological anatomy of Sclerotinia trifoliorum on

clover and alfalfa. Phytopathology 54, 784-787.

Punja, Z.K., Huang, J.S., Jenkins, S.F., 1985. Relationship of mycelial growth and

production of oxalic-acid and cell-wall degrading enzymes to virulence in

Sclerotium rolfsii. Canadian Journal of Plant Pathology 7, 109-117.

Purdy, L.H., 1958. Some factors affecting penetration and infection by Sclerotinia

sclerotiorum. Phytopathology 48, 605-609.

Purdy, L.H., 1979. Sclerotinia sclerotiorum: history, diseases and symptomatology, host

range, geographic distribution and impact. Phytopathology 69, 875-880.

Purdy, L.H., Bardin, R., 1953. Mode of infection of tomato plants by the ascospores of

Sclerotinia scterotiorum. Plant Disease Reporter 37, 361-362.

194

Qiu, L., Jicheng, Y., Dechun, F., 2001. Studies on the toxin from Sclerotinia

sclerotiorum. Journal of Shenyang Agricultural University (China); Shenyang

Nongye Daxue Xuebao (China) 32, 422-425.

Ramsey, G.B., 1925. Sclerotinia species causing decay of vegetables under transit and

market conditions. Journal of Agricultural Research 31, 597-632.

Rasmussen, U., Bojsen, K., Collinge, D.B., 1992. Cloning and characterization of a

pathogen-induced chitinase in Brassica napus. Plant Molecular Biology 20, 277-

287.

Ravanel, S., Gakiere, B., Job, D., Douce, R., 1998. The specific features of methionine

biosynthesis and metabolism in plants. Proceedings of the National Academy of

Sciences of the United States of America 95, 7805-7812.

Ray, S., Anderson, J.M., Urmeev, F.I., Goodwin, S.B., 2003. Rapid induction of a

protein disulfide isomerase and defense-related genes in wheat in response to the

hemibiotrophic fungal pathogen Mycosphaerella graminicola. Plant Molecular

Biology 53, 741-754.

Restrepo, S., Myers, K.L., del Pozo, O., Martin, G.B., Hart, A.L., Buell, C.R., Fry,

W.E., Smart, C.D., 2005. Gene profiling of a compatible interaction between

Phytophthora infestans and Solanum tuberosum suggests a role for carbonic

anhydrase. Molecular Plant-Microbe Interactions 18, 913-922.

Rice-Evans, C.A., Miller, N.J., Paganga, G., 1997. Antioxidant properties of phenolic

compounds. Trends in Plant Science 2, 152-159.

Riddle, G.E., Burpee, L.L., Boland, G.J., 1991. Virulence of Sclerotinia sclerotiorum

and S. minor on dandelion (Taraxacum officinale). Weed Science 39, 109-118.

Riou, C., Freyssinet, G., Fevre, M., 1991. Production of cell wall degrading enzymes by

the phytopathogenic fungus Sclerotinia sclerotiorum. Applied and

Environmental Microbiology 57, 1478-1484.

195

Rodriguez, M.A., Venedikian, N., Bazzalo, M.E., Godeas, A., 2004. Histopathology of

Sclerotinia sclerotiorum attack on flower parts of Helianthus annus heads in

tolerant and susceptible varieties. Mycopathologia 157, 291-302.

Roitsch, T., Balibrea, M.E., Hofmann, M., Proels, R., Sinha, A.K., 2003. Extracellular

invertase: key metabolic enzyme and PR protein. Journal of Experimental

Botany 54, 513–524.

Ronicke, S., Hahn, V., Horn, R., Grone, I., Brahm, L., Schnabl, H., Friedt, W., 2004.

Interspecific hybrids of sunflower as a source of Sclerotinia resistance. Plant

Breeding 123, 152-157.

Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for

biologist programmers. In: Krawetz , S., Misener, S. (Eds.), Bioinformatics

Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa,

NJ, pp. 365-386.

S´eguin-Swartz, G., Lefol, C., 1999. Sclerotinia Stem rot resistance in crucifers. 10th

International Rapeseed Congress, Canberra, Australia, p. 153.

Saharan, G.S., Mehta, N., 2008. Sclerotinia diseases of crop plants: Biology, ecology

and disease management. Springer, LXII, 485.

Saito, I., 1973. Initiation and development of apothecial stipe primordia in sclerotia of

Sclerotinia sclerotiorum. Transactions of the Mycological Society of Japan 28,

343-351.

Saito, I., 1977. Studies on the maturation and germination of sclerotia of Sclerotinia

sclerotiorum (Lib.) de Bary, a casual fungus of bean stem rot. Report of

Hokkaido Prefectural Agricultural Experimental station Bulletin, p. 106.

Sakihama, Y., Mano, J., Sano, S., Asada, K., Yamasaki, H., 2000. Reduction of

phenoxyl radicals mediated by monodehydroascorbate reductase. Biochemical

and Biophysical Research Communications 279, 949-954.

196

Sanogo, S., Puppala, N., 2007. Characterization of darkly pigmented mycelial isolates

of Sclerotinia sclerotiorum on Valencia peanut in New Mexico. Plant dis 91,

1077-1082.

Sansford, C.E., Coley-Smith, J.R., 1992. Production and germination of sclerotia of

Sclerotinia sclerotiorum. Plant Pathology 41, 154-156.

Schwartz, H.F., Otto, K., Terán, H., Lema, M., Singh, S.P., 2006. Inheritance of white

mold resistance in Phaseolus vulgaris × P. coccineus crosses. Plant Disease 90,

1167-1170.

Scott, M.R., 1954. The biology of Sclerotium cepivorum Berk. University of

Birmingham.

Sedun, F.S., Brown, J.F., 1987. Infection of sunflower leaves by ascospores of

Sclerotinia sclerotiorum. Annals of Applied Biology 110, 275-284.

Seiler, G.J., 1992. Utilization of wild sunflower species for the improvement of

cultivated sunflower. Field Crops Research 30, 195-230.

Sexton, A.C., Minic, Z., Cozijnsen, A.J., Pedras, M.S.C., Howlett, B.J., 2009. Cloning,

purification and characterisation of brassinin glucosyltransferase, a phytoalexin-

detoxifying enzyme from the plant pathogen Sclerotinia sclerotiorum. Fungal

Genetics and Biology 46, 201-209.

Sexton, A.C., Whitten, A.R., Howlett, B.J., 2006. Population structure of Sclerotinia

sclerotiorum in an Australian canola field at flowering and stem-infection stages

of the disease cycle. Genome 49, 1408-1415.

Sharma, N., Hotte, N., Rahman, M.H., Mohammadi, M., Deyholos, M.K., Kav, N.N.V.,

2008. Towards identifying Brassica proteins involved in mediating resistance to

Leptosphaeria maculans: A proteomics-based approach. Proteomics 8, 3516-

3535.

Shigyo, M., Iino, M., Ino, H., Tashiro, Y., 1999. Transmission rates of extra

chromosomes in alien monosomic addition lines of Japanese bunching onion

197

with extra chromosomes from shallot. Journal of the Japanese Society for

Horticultural Science 68, 18-22.

Shinshi, H., Neuhaus, J.-M., Ryals, J., Meins, F., 1990. Structure of a tobacco

endochitinase gene: evidence that different chitinase genes can arise by

transposition of sequences encoding a cysteine-rich domain. Plant Molecular

Biology 14, 357-368.

Singh, R., Singh, D., Li, H., Sivasithamparam, S., Yadav, N.R., Salisbury, P., Barbetti,

M.J., 2008. Management of Sclerotinia rot of oilseed Brassicas - a focus on

India. Brassica 10, 1-27.

Singh, S.P., Teran, H., Schwartz, H.F., Otto, K., Lema, M., 2009. White mold - resistant

interspecific common bean germplasm lines VCW 54 and VCW 55. Journal of

Plant Registrations 3, 191-197.

Sivasithamparam, K., 1993. Ecology of root infecting pathogenic fungi in

mediterranean environments. In: Andrews, J.H., Tommerup, I.C. (Eds.),

Advances in Plant Pathology. Academic Press, London, UK., pp. 245-279.

Slaymaker, D.H., Navarre, D.A., Clark, D., del Pozo, O., Martin, G.B., Klessig, D.F.,

2002. The tobacco salicylic acid-binding protein 3 (SABP3) is the chloroplast

carbonic anhydrase, which exhibits antioxidant activity and plays a role in the

hypersensitive defense response. Proceedings of the National Academy of

Sciences of the United States of America 99, 11640–11645.

Smith, E.A., Boland, G.J., 1989. A reliable method for the production and maintenance

of germinated sclerotia of Sclerotinia sclerotiorum. Canadian Journal of Plant

Pathology 11, 45-48.

Smith, S.N., Prince, M., Whipps, J.M., 2008. Characterization of Sclerotinia and

mycoparasite Coniothyrium minitans interaction by microscale co-culture.

Letters in Applied Microbiology 47, 128-133.

198

Smith, V.L., Punja, Z.K., Jenkins, S.F., 1986. A histological study of infection of host

tissue by Sclerotium rolfsii. Phytopathology 76, 755-759.

Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., Levine, A., 1999. The

involvement of cysteine proteases and protease inhibitor genes in the regulation

of programmed cell death in plants. The Plant Cell 11, 431-443.

Sprague, S., Stewart-Wade, S., 2002. Sclerotinia in canola—results from petal and

disease surveys across Victoria in 2001. Grains Research and Development

Corporation Research Update—southern region, Australia, Grains Research and

Development Corporation, Victoria.

Sproston, T., Pease, D.C., 1957. Thermoperiods and production of apothecial initials in

the fungus Sclerotinia trifoliorum Erik. Science 125, 559-560.

Steadman, J.R., Cooke, G.E., 1974. A simple method for collecting ascospores of

Whetzelinia sclerotiorum. The Plant Disease Reporter 58, 190.

Steadman, J.R., Nickerson, K.W., 1975. Differential inhibition of sclerotial germination

in Whetzelinia sclerotiorum. Mycopathologia 57, 165-170.

Subramanian, B., Bansal, V.K., Kav, N.N., 2005 Proteome-level investigation of

Brassica carinata-derived resistance to Leptosphaeria maculans. Journal of

Agricultural and Food Chemistry 53, 313-324.

Sun, C., 1995. Comparison of methods for evaluating oilseed cultivars for resistance to

Sclerotinia sclerotiorum in Brassica napus L. Acta Agriculture Shanghai 11, 17-

-22.

Sun, J.M., Irzykowski, W., Jedryczka, M., Han, F.X., 2005. Analysis of the genetic

structure of Sclerotinia sclerotiorum (Lib.) de Bary populations from different

regions and host plants by random amplified polymorphic DNA markers.

Journal of Integrative Plant Biology 47, 385-395.

Sun, P., Yang, X.B., 2000. Light, temperature and moisture effects on apothecium

production of Sclerotinia sclerotiorum. Plant Disease 84, 1287-1293.

199

Sun, W.Q., 2002. Solutions for controlled dehydration and rehydration: Appendix In:

Black, M., Pritchard, H.W. (Eds.), Desiccation and Survival in Plants: Drying

Without Dying. CAB International, Wallingford, UK, pp. 84-91.

Sutton, D.C., Deverall, B.J., 1983 Studies on infection of bean (Phaseolus vulgaris) and

soybean (Glycine max) by ascospores of Sclerotinia sclerotiorum. Plant

Pathology 32, 251-261.

Sylvester-Bradley, R., Makepeace, R.J., 1984. A code for stages of development in

oilseed rape (Brassica napus L.). Aspects of Applied Biology (Agronomy,

Physiology, Plant breeding and Crop protection of Oilseed Rape) 6, 399-419.

Tahara, E.B., Barros, M.H., Oliveira, G.A., Netto, L.E.S., Kowaltowski, A.J., 2007.

Dihydrolipoyl dehydrogenase as a source of reactive oxygen species inhibited by

caloric restriction and involved in Saccharomyces cerevisiae aging. The FASEB

Journal 21, 274-283.

Talburt, D.E., Johnson, G.T., 1965. Plasmoptysis of filamentous fungi. Mycologia 57,

660-662.

Tariq, V.N., Jeffries, P., 1984. Appressorium formation by Scterotinia scterotiorum:

scanning electron microscopy. Transactions of British Mycotogicat Society 82,

645-651.

Tariq, V.N., Jeffries, P., 1986. Ultrastructure of penetration of Phaseolus spp. by

Sclerotinia sclerotiorum. Canadian Journal of Botany 64, 2909-2915.

Teo, B.K., Morrall, R.A.A., Verma, P.R., 1989. Influence of soil moisture, seeding date

and canola cultivars (Tobin and Westar) on the germination and rotting of

sclerotia of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology 11,

393--399.

Terras, F.R.G., Eggermont, K., Kovaleva, V., Raikhel, N.V., Osborn, R.W., Kester, A.,

Rees, S.R., Torrekemd, S., Leuven, F.V., Vanderleyden, J., Cammue, B.P.A.,

Broekaert, W.F., 1995. Small cysteine-rich antifungal proteins from radish: their

role in host defense. The Plant Cell 7, 573-588.

200

Thaning, C., Nilsson, H.E., 2000. A narrow range of wavelengths active in regulating

apothecial development in Sclerotinia sclerotiorum Journal of Phytopathology

148, 627-631.

Thompson, C., Dunwell, J.M., Johnstone, C.E., Lay, V., Ray, J., Schmitt, M., Watson,

H., Nisbet, G., 1995. Degradation of oxalic acid by transgenic oilseed rape

plants expressing oxalate oxidase. Euphytica 85, 169-172.

Tieu, A., 2000. The interaction of burial, heat and smoke in the alleviation of seed

dormancy in selected south western Australian plant species. Ph. D Thesis, The

University of Western Australia.

Tieu, A., Dixon, K.W., Meney, K.A., Sivasithamparam, K., 2001. Interaction of soil

burial and smoke on germination patterns in seeds of selected Australian native

plants. Seed Science Research 11, 69-76.

Tsuji, J., Jackson, E.P., Gage, D.A., Hammerschmidt, R., Somerville, S.C., 1992.

Phytoalexin accumulation in Arabidopsis thaliana during the hypersensitive

reaction to Pseudomonas syringae pv syringae. Plant Physiology 98, 1304-1309.

Tu, J.C., 1997. An integrated control of white mold (Sclerotinia sclerotiorum) of beans,

with emphasis on recent advances in biological control. Botanical Bulletin of

Academia Sinica 38, 73-76.

Turkington, T.K., Morrall, R.A.A., 1993. Use of petal infestation to forecast Sclerotinia

stem rot of canola: The influence of inoculum variation over the flowering

period and canopy density. Phytopathology 83, 682-689.

Upadhyay, R.S., Jayaswal, R.K., 1992. Pseudomonas cepacia causes mycelial

deformities and inhibition of conidiation in phytopathogenic fungi. Current

Microbiology 24, 181-187.

201

van Loon, L.C., Rep, M., Pieterse, C.M.J., 2006. Significance of inducible defense-

related proteins in infected plants. Annual Review of Phytopathology 44, 135-

162.

Vuong, T.D., Hoffmann, D.D., Diers, B.W., Millers, J.F., Steadman, J.R., Hartman,

G.L., 2004. Evaluation of soybean, dry bean and sunflower for resistance to

Sclerotinia sclerotiorum. Crop Science 44, 777--783.

Waksman, G., Keon, J.P., Turner, G., 1991. Purification and characterization of two

endopolygalacturonases from Sclerotinia sclerotiorum. Biochimica et

Biophysica Acta 1073, 43-48.

Walz, A., Zingen-Sell, I., Loeffler, M., Sauer, M., 2008. Expression of an oxalate

oxidase gene in tomato and severity of disease caused by Botrytis cinerea and

Sclerotinia sclerotiorum. Plant Pathology 57, 453-458.

Wang, W., Vinocur, B., Shoseyov, O., Altman, A., 2004. Role of plant heat-shock

proteins and molecular chaprones in the abiotic stress response. Trends in Plant

Science 9, 244-252.

Wegulo, S.N., Yang, X.B., Martinson, C.A., 1998. Soybean cultivar responses to

Sclerotinia sclerotiorum in field and controlled environment studies. Plant

Disease 82, 1264-1270.

Whipps, J.M., Budge, S.P., McClement, S., Pink, D.A.C., 2002. A glasshouse cropping

method for screening lettuce lines for resistance to Sclerotinia Sclerotiorum.

European Journal of Plant Pathology 108, 373-378.

Willetts, H.J., Wong, J.A.L., 1980. The biology of Sclerotinia sclerotiorum, S.

trifoliorum and S. minor with emphasis on specific nomenclature. The Botanical

Review 46, 101-165.

Williams, G.H., Western, J.H., 1965. The biology of Sclerotinia trifoliorum Erikss. and

other species of sclerotium-forming fungi. I. Apothecium formation from

sclerotia. Annals of Applied Biology 56, 253-260.

202

Williams, J.R., Stelfox, D., 1980. Influence of farming practices in Alberta on

germination and apothecium production of sclerotia of Sclerotinia sclerotiorum.

Canadian Journal of Plant Pathology 2, 169-172.

Wingate, V.P.M., Lawton, M.A., Lamb, C.J., 1988. Glutathione causes a massive and

selective induction of plant defense genes. Plant Physiology 87, 206-210.

Wirtz, M., Berkowitz, O., Droux, M., Hell, R.d., 2001. The cysteine synthase complex

from plants. European Journal of Biochemistry 268, 686-693.

Wright, D.P., Baldwin, B.C., Shephard, M.C., Scholes, J.D., 1995. Source-sink

relationships in wheat leaves infected with powdery mildew. I. Alterations in

carbohydrate metabolism. Physiological and Molecular Plant Pathology 47, 237-

253.

Wu, B.M., Subbarao, K.V., 2008. Effects of soil temperature, moisture, and burial

depths on carpogenic germination of Sclerotinia sclerotiorum and S. minor.

Phytopathology 98, 1144-1152.

Yajima, W., Kav, N.N.V., 2006. The proteome of the phytopathogenic fungus

Sclerotinia sclerotiorum. Proteomics 6, 5995-6007.

Yang, B., Rahman, M.H., Liang, Y., Shah, S., Kav, N.N.V., 2009. Characterization of

defence signaling pathways of Brassica napus and Brassica carinata in response

to Sclerotinia sclerotiorum challenge. Plant Molecular Biology Reporter DOI

10.1007/s11105-009-0149-5.

Yang, B., Srivastava, S., Deyholos, M.K., Kav, N.N.V., 2007. Transcriptional profiling

of canola (Brassica napus L.) responses to the fungal pathogen Sclerotinia

sclerotiorum. Plant Science 173, 156-171.

Yang, S.F., Hoffman, N.E., 1984. Ethylene biosynthesis and its regulation in higher

plants. Annual Review of Phytopathology 35, 155-189.

Yasue, T., 1969. Histochemical identification of calcium oxalate. Acta Histochemica et

Cytochemica 2, 83-95.

203

Young, C.S., Clarkson, J.P., Smith, E.A., Watling, M., Phelps, K., Whipps, J.M., 2004.

Environmental conditions influencing Sclerotinia sclerotiorum infection and

disease development in lettuce. Plant Pathology 53, 387-397.

Young, J.F., 1967. Humidity control in the laboratory using salt solutions - A review.

Journal of Applied Chemistry 17, 241-245.

Young, N., Ashford, A.E., 1996. The effects of rind damage and regeneration on

permeability of the apoplast in sclerotia of Sclerotinia minor. New Phytologist

134, 13-24.

Zhao, J., Buchwaldt, L., Rimmer, S.R., Sharpe, A., Mcgregori, L., Bekkaoui, D.,

Hegedus, D.D., 2009. Patterns of differential gene expression in Brassica napus

cultivars infected with Sclerotinia sclerotiorum. Molecular Plant Pathology 10,

635-649.

Zhao, J., Meng, J., 2003. Genetic analysis of loci associated with partial resistance to

Sclerotinia sclerotiorum in rapeseed (Brassica napus L.). Theoretical and

Applied Genetics 106, 759-764.

Zhao, J., Peltier, A.J., Meng, J., Osborn, T.C., Grau, C.R., 2004. Evaluation of

Sclerotinia stem rot resistance in oilseed Brassica napus using a petiole

inoculation technique under green house conditions. Plant Disease 88, 1033-

1039.

Zhao, J., Udall, J.A., Quijada, P.A., Grau, C.R., Meng, J., Osborn, T.C., 2006.

Quantitative trait loci for resistance to Sclerotinia sclerotiorum and its

association with a homeologous non-reciprocal transposition in Brassica napus

L. Theoretical and Applied Genetics 112, 509-516.

Zhao, J., Wang, J., An , L., Doerge , R., Chen, Z., Grau, C., Meng, J., Osborn, T.C.,

2007. Analysis of gene expression profiles in response to Sclerotinia

sclerotiorum in Brassica napus. Planta 227, 13-24.

204

Zhao, Y., Wang, M.L., 2004. Inheritance and agronomic performance of an apetalous

flower mutant in Brassica napus L. Euphytica 137, 381-386.

Zhou, T., Boland, G.J., 1999. Mycelial growth and production of oxalic acid by virulent

and hypovirulent isolates of Sclerotinia sclerotiorum. Canadian Journal of Plant

Pathology 21, 93-99.

Ziman, L., Jedryczka, M., Srobarova, A., 1998. Relationship between morphological

and biochemical characteristics of Sclerotinia sclerotiorum isolates and their

aggressivity. Journal of Plant Diseases and Protection 105, 283-288.

Zook, M., Hammerschmidt, R., 1997. Origin of the thiazole ring of camalexin, a

phytoalexin from Arabidopsis thaliana. Plant Physiology 113, 463-468.

Zuppini, A., Navazio, L., Sella, L., Castiglioni, C., Favaron, F., Mariani, P., 2005. An

endopolygalacturonase from Sclerotinia sclerotiorum induces calcium-mediated

signalling and programmed cell death in soybean cells. Moleular Plant-Microbe

Interactions 18, 849-855.

205

APPENDIX 1

Oral presentations from this thesis

206

2009 Presented the talk “High level of resistance to Sclerotinia

sclerotiorum in introgressed lines derived from wild Brassica

species” at Rottnest Island summer school, organized by school of

Plant Biology, UWA, proceedings available at

http://www.plants.uwa.edu.au/studentnet/?a=99971 , page 22

2008 Awarded best presentation prize by Fisher Biotech for the talk

“Screening Brassica napus genotypes against Sclerotinia

sclerotiorum using a novel cotyledon assay” in Plant Health

Research Symposium, organised by Australasian Plant Pathology,

WA, October

2008 Presented the talk “ Mechanism of resistance against S. sclerotiorum

in oilseed Brassicas” in “Frontiers in agriculture”, postgraduate

showcase, organised by Institute of agriculture, UWA June, 2008,

Information available at

http://www.ioa.uwa.edu.au/papers/showcase

2007 Presented the talk “Resistance in oilseed Brassica species to

Sclerotinia sclerotiorum” at Rottnest Island summer school,

organized by school of Plant Biology, UWA

207

APPENDIX 2

208

Erratum to Chapter 3: Pathogenicity of morphologically different isolates of

Sclerotinia sclerotiorum with Brassica napus and B. juncea genotypes. European

Journal of Plant Pathology 126: 305-315.

On page 37 of thesis (page no. 307 of the published format), There is a typographical

error in the line “All cultures were incubated at 20oC and colony diameter measured

after 24 and 48 days of incubation” under the heading “Comparison of colony

characteristics”.

The corrected text is “All cultures were incubated at 20oC and colony diameter

measured after 24 and 48 hour of incubation”.

209

APPENDIX 3

Infection processes of S. sclerotiorum on the

resistant Charlton

210

Fig 1. Light micrographs showing histology of resistant (Brassica napus, Charlton)

genotype in response to Sclerotinia sclerotiorum infection (A) Sample cleared in acetic

acid: ethanol: water (2:2:1), stained with 1 % cotton blue, and photographed using a

Zeiss Axioplan 2 microscope photograph system. (B) 2 µm thick sections obtained and

photographed using the same photograph system. A. Vacoulation of hyphae mainly on

resistant Charlton with mycelial inoculum. B. Auto-fluorescence around the lesion of

the section in the resistant Charlton indicative of deposition of lignin (using ascosporic

inoculum)