Molecular characterization of non structural protiens of avian influenza virus
-
Upload
ibrahim-thabet -
Category
Documents
-
view
228 -
download
2
description
Transcript of Molecular characterization of non structural protiens of avian influenza virus
Zagazig University
Faculty of Veterinary Medicine
Department of Virology
Molecular characterization of non structural proteins of Avian Influenza
Virus Presented By
Ibrahim Mohamed Thabet Thabet Hagag
B.V.M.Sc. (Zagazig University, 2009)
Diploma of Microbiology (Zagazig University, 2011)
Under Supervision of
Dr. Ahmed Abd El-Samie H. Ali
Professor of Virology and Viral Immunology
Head of Department of Virology
Faculty of Veterinary Medicine
Zagazig University
Dr. Ali Abdel-Rasheed A. Salama
Professor of Microbiology
Department of Virology
Faculty of Veterinary Medicine
Zagazig University
Dr. Mohammed El-Bakry A. Ismaeil
Professor of Microbiology
Department of Virology
Faculty of Veterinary Medicine
Zagazig University
Dr. Shimaa Mohammed G. Mansour
Assistant Professor of Virology
Department of Virology
Faculty of Veterinary Medicine Zagazig University
A Thesis Submitted to
Zagazig University
For the degree of
Master of Veterinary Medical Sciences (Virology)
Department of Virology (2015)
Acknowledgement
First and foremost, I have to thank and give all praises to
Almighty Allah who has blessed me with so many gifts that I
continue to discover.
Thanks to my father; Mohamed Thabet Thabet Hagag and
mother; Madiha Messalm Mansour Hagag for devoting their life for
me in order to get a good education, they never hesitated to support
my education all of their life. Thanks are also continued to all
members of my family, Ahmed, Islam, Osama, Ayman, Asmaa,
Omayma.
I would like to express great gratitude to the main thesis
supervisor; Prof. Dr. Ahmed Abd EL-Samie Hassan Ali, Professor
and Head of Virology Department, Faculty of Veterinary Medicine,
Zagazig University, Egypt, for his supervision, scientific advices, and
helpful discussions and instructions as well.
Thanks are expressed also to Prof. Dr. Ali. Abd Rasheed Ali
Salama, Professor of Microbiology, Faculty of Veterinary Medicine,
Zagazig University, Egypt for his supervision during the first part of
the thesis.
Thanks to Prof. Dr. Mohamed El-Bakry Abdel-Rheim
Ismaeil, Professor of Microbiology, Faculty of Veterinary Medicine,
Zagazig University, Egypt for his continuous advices and helpful
discussions.
Thanks are also continued to Dr. Shimaa Mohammed Galal
Mansour, Assistant Professor of Virology, Faculty of Veterinary
Medicine, Zagazig University, Egypt, for her supervision, scientific
advices, and helpful discussions as well.
Thanks are continued to members of department of Virology
for helpful advices and support.
Many thanks to Prof. Dr. Mohamed Azawy for kindly
providing clinical samples that were used in this study. Thanks for
Mohammed Afifi for helpful statistical analysis.
Thanks are also extended to the Egyptian Ministry of Higher
Education (ParOwn Grant members), Egypt for funding my 6 months
training grant in USA at which most of laboratory experiments were
done.
It is my pleasure also, to thank Prof. Dr. Zheng Xing,
associate professor of Virology and Immunology, Department of
Veterinary Medical Sciences, University of Minnesota, USA for
hosting me in his laboratory during the practical work of my thesis.
He helped me in conceiving the project, performing experiments,
analysis of data, and writing as well.
Special thanks to Jan Shivers, chief of Immunohistochemistry
(IHC) laboratory, Veterinary Diagnostic laboratory, University of
Minnesota, USA for her help in performing cross section
Immunohistochemistry experiments. Thanks also for Dr. Rob Porter
for photographing of slides of IHC.
I would like to express my deepest gratitude and thankful
greetings to PLOS ONE Editorial Team for accepting publishing data
from this thesis under title of “Pathogenicity of Highly Pathogenic
Avian Virus H5N1 in Naturally Infected Poultry in Egypt”.
DEDICATION
To
“MY MOTHER, MY FATHER
ALL MEMEBERS OF MY FAMILY
AND
THOSE WHO I LEARNED FROM
THEM EVERYWHERE”
Contents
iii
CONTENTS
Subject Page
1. Introduction ……………………………… 1
2. Review of literature ……………………… 4
3. Material and methods …..………………. 39
4. Results ………………...………………... 65
5. Discussion ………………………………… 83
6. Summary and Conclusion ……………… 93
7. References …………………..….………… 97
8. Vita ……………………….......................... 125
Arabic summary …………………………… -
Contents
iv
List of Tables
No. Table description Page
1 Clinical data of chicken and duck flocks
suspected to be affected with AIV.
40
2 Sequences of the oligonucleotide primers
and probe used in the study. 46
3 Results of viral isolation, HA, RT-PCR, and
IHC of HPAIV H5N1 from infected chicken
and duck flocks.
79
4 Distribution of viral antigen NP in IHC
stained tissues and cells of HPAIV H5N1
infected chickens.
80
Contents
v
List of Figures
Descript ion Page
Figure 1: Structure of IAV virion showing
encoded viral structural and non structural
proteins.
9
Figure 2: Binding sites of cellular proteins on
the domain of the NS1 protein.
12
Figure 3: Arrangement of the NS1 and nuclear
export protein (NEP) mRNAs of the IAV.
13
Figure 4: Topology diagram (A) and
hypothetical model (B) of the C-terminus
monomer of the NS1 protein.
18
Figure 5 (A-F): Clinical picture of chickens
and ducks suspected to be infected with
HPAIV H5N1.
66
Figure 6 (A-B): Evidence of IAV in
inoculated Embryonated Chicken Eggs
(ECEs).
67
Figure 7 (A-B): Detection of IAV using rapid
HA.
67
Figure 8 (A-B): Identification and subtyping
of IAV using Reverse Transcriptase –
Polymerase Chain Reaction (RT-PCR).
69
Figure 9: Phylogenetic tree on basis of
nucleotide sequences of complete coding
region of NS gene of HPAIV H5N1.
72
Figure 10: Phylogenetic tree of H gene
nucleotide sequences at the cleavage site of
HPAIV H5N1.
73
Contents
vi
Figure 11: Detection of IAV in tissue
specimens and serum samples using real-
time RT-PCR.
76
Figure 12 (A-C): Detection of viral antigen
nucleoprotein (NP) by IHC in trachea,
brain, and lung.
81
Figure 13 (A-F): Detection of nucleoprotein
(NP) viral antigen by IHC in pancreas,
proventriculus, spleen, bursa, liver, and
testis.
82
Contents
vii
LIST OF ABBREVIATIONS
Abbreviation Full Name
AGID Agar Gel Immunodiffusion
AI Avian Influenza
AIV Avian Influenza Virus
ASP92 Aspartate 92
BHK-21 Baby Hamster Kidney-21
bp Base Pair
Cat. Catalogue
cDNA Complementary DNA
CEF Chicken Embryo Fibroblast
CEK Chicken Embryo Kidney
CPSF30 Cleavage and Polyadenylation
Specificity Factor 30
C-terminus Carboxyl Terminus
D92E Mutation of Asparate to Glutamate
dNTP Deoxy-Nucleotide Triphosphate
dsRNA Double-Stranded RNA
ECE Embryonated Chicken Egg
eIF4GI Eukaryotic Initiation Factor 4GI
EMEA European-Middle Eastern-African
GS Glycosylated Carbohydrate
H Hemagglutinin
Contents
viii
H0 Hemagglutinin zero
H1 Hemagglutinin 1
H2 Hemagglutinin 2
HA Hemagglutination Assay
HI Hemaggultination Inhibition
HN Hemagglutinin Neuraminidase
HPAIV Highly Pathogenic Avian Influenza
Virus
HRP Horse Radish Peroxidase
IFN Interferon
IgG Immunoglobulin G
IHC Immunohistochemistry
IL18 Interleukin 18
IL1β Interleukin 1β
IL6 interleukin 6
IN Intranasal
ISH In-situ Hybridization
IT Intratracheal
IV Intravenous
IVPI Intravenous Pathogenicity Index
kD Kilo Dalton
LB Luria-Bertani (Bacterial Media)
LPAIV Low Pathogenic Avian Influenza Virus
M Matrix
M1 Matrix 1
Contents
ix
M2 Matrix 2
MDCK Madin-Darby Canine Kidney
MIP-1α Macrophage Inflammatory Protein-1
alpha
N Neuraminidase
NCBI National Center for Biotechnology
Information
NLS-1 Nuclear Localization Signal-1
NP Nucleoprotein
NS Non structural
NS1 Non Structural Protein 1
NS2/NEP Non Structural Protein 2/ Nuclear
Export Protein
OIE Organization of International
Epizootics
PA Polymerase Acidic
PAB II Poly(A)-Binding Protein II
PB1 Polymerase Basic 1
PB1-F2 Polymerase Basic 1–F2
PB2 Polymerase Basic 2
PBS Phosphate Buffer Saline
PCS Proteolytic Cleavage Site
PKR Protein Kinase RNA-Regulated
Psi Pound per square
RBD Receptor Binding Domain
Contents
x
RNA Ribonucleic Acid
RRT-PCR Reverse Real Time Polymerase Chain
Reaction
RT-PCR Reverse Transcriptase Polymerase
Chain Reaction
RT-qPCR Reverse Transcriptase quantitative
polymerase chain reaction
SA Sialic Acid
SD Standard Deviation
Ser195 Serine 195
TA Thiamine Adenine
Thr197 Threonine 197
Uni-12
UV
Universal 12
Ultra Violet
vRNP
WHO
Viral Ribonucleoprotein
World Health Organization
Contents
xi
List of abbreviations and codes of Amino acids (Rules,
1969)
Three- letter code Single letter code Full Name
Ala A Alanine
Arg R Arginine
Asn N Asparagine
Asp D Aspartic acid
Cys C Cysteine
Gln Q Glutamine
Glu E Glutamic acid
Gly G Glycine
His H Histidine
Ile I Isoleucine
Leu L Leucine
Lys K Lysine
Met M Methionine
Phe F Phenylalanine
Pro P Proline
Ser S Serine
Thr T Threonine
Trp W Tryptophan
Tyr Y Tyrosine
Val V Valine
- X Unknown
INTRODUCTION
Introduction
1
1. INTRODUCTION
Avian Influenza (AI) is contagious endemic and epidemic
viral infection affecting wide variety of avian and mammalian
hosts (Irvine et al., 2007). Influenza A virus (IAV) is negative-
stranded, segmented RNA virus, classified within the genus
Influenza A viruses in the family Orthomyxoviridae (Cox and
Subbarao, 2000). IAV is classified into various subtypes
according to their hemagglutinin and neuraminidase surface
glycoprotiens and highly pathogenic (HP) or low pathogenic
(LP) viruses based on their virulence (Suarez and Schultz-
Cherry, 2000).
The segmented genome of IAV consists of 8 segments
that code 10 or 11 proteins depending on whether the 11th
protein, PB1-F2, is present or not (Chen et al., 2001). These
proteins are divided into three main categories: A) surface
proteins (hemagglutinin; H, neuraminidase; N and matrix 2;
M2), B) internal proteins (polymerase subunits; PB2, PB1, PA,
nucleoprotein; NP, matrix1; M1 and nuclear export protein;
NEP), and C) non-structural proteins (NS1 and PB1-F2)
(Webster et al., 1992; Cheung and Poon, 2008). Novel extra
protein products have been recently identified as PB1-N40, PA-
X, PA-N155, PA-N182, and M3 increasing the number of the
IAVs encoded proteins to 15 or 16 (Muramoto et al., 2013).
The non structural protein (NS1), considered a virulence
factor, is thought to play an important role in viral replication
and pathogenicity during infection by antagonizing the host
Introduction
2
interferon defense mechanism (Garcia-Sastre et al., 1998;
Bergmann et al., 2000). It has been previously reported that
mutations or deletions within the NS1 protein significantly
hampered replication of influenza viruses, both in vitro and in
vivo due to an increased interferon (IFN) response and rapid
elimination of the virus (Dankar et al., 2011; Petersen et al.,
2013).
The HPAI H5N1 viruses produce systemic infections,
morbidity and mortality as high as 100% (Spickler et al., 2008;
Swayne, 2007), cause severe agricultural and economic
burden, and pose a serious public health threat. They were
transmitted to Africa with reported outbreaks in Nigeria,
Egypt, Cameroon, and other African countries in 2006
(Enserink, 2006; Aly et al., 2008). Since then, they become
endemic only in Egypt, spreading from farms to farms,
causing several economic losses to poultry industry, and
infecting human, even under H5 vaccine induced immune
pressure, that potentially lead to continuous viral evolution
and mutations (Abdelwhab et al., 2010).
Strikingly, it has been recently reported that the Egyptian
HPAIV H5N1 viruses possess the greatest pandemic risk due to
their unique genomic fingerprints including the mutations at
H154-156, where a glycosylation site is missing, and PB2627K
(Neumann et al., 2012). Accordingly, providing more information
about the Egyptian HPAIV H5N1 recent outbreaks with
supplementary genetic, antigenic, and pathogencity data is of great
global interest, which is the main objective of this study.
Introduction
3
The objectives of this study are:
1. Isolation, identification, and subtyping of IAV caused
outbreaks in commercial chickens and backyard ducks,
Sharkia, Egypt, 2013.
2. Sequencing of Non Structural (NS) and Hemagglutinin (H)
genes to characterize molecular pathogenicity determinants
of HPAI H5N1 viruses.
3. Investigation of distribution and spread of the HPAI H5N1
viruses in different tissues of naturally infected chickens and
ducks by RT-qPCR and Immunohistochemistry (IHC).
.
REVIEW OF LITERATURE
Review of Literature
4
2. REVIEW OF LITERATURE
2.1. Avian Influenza Virus (AIV) infection: nature
and economic importance:
Avian influenza viruses can infect and causes in a large
variety of birds and mammals worldwide (Alexander, 2000).
Infections in birds can give rise to a wide variety of clinical signs
that may vary according to the host, strain of virus, the host's
immune status, ranging from respiratory manifestation and high
mortalities as high as 100% (Spickler et al., 2008; Swayne,
2007). The on-going epidemic of highly pathogenic avian
influenza (HPAI) H5N1 virus infections in poultry continues to
cause severe economic problems and threatens human health
worldwide, particularly where the infections became endemic
(Capua and Alexander, 2006; Peiris et al., 2007).
2.2. History of AIV:
AIV was firstly reported as fowl plaque or fowl pest in
1878 in Italy (Perroncito, 1878). In 1901, Centainii and
Savunozzi determined that the cause was a filterable agent. By
then it was already shown that human influenza viruses,
identified as a virus in 1933, (Smith et al., 1933). It was
recorded that avian and human influenza virus counterparts
many biological properties including the ability to grow in chick
embryos and agglutinate red blood cells (Hirst, 1941). Low
pathogenic avian influenza virus LPAI or midly pathogenic
avian influenza was reported in the middle of the 20th century
Review of Literature
5
and the oldest outbreak was winter strain of Germany isolates
in chicken in 1949 (H10N7). It was demonstrated that fowl
plague was an avian influenza virus whose genomic composition
was virtually identical to the one found in the human influenza
virus (Schafer, 1955).
The first report of HPAIV outbreak caused by H5N1 was
occurred in Scotlandin 1959. Alexander listed five substantiated
outbreaks since 1975; this occurred in many areas in the world as
USA, Australia, England and others (Alexander and Gough,
1986). By the early part of the 20th century, the disease was
reported in other areas all over the world including Egypt. The
terminology “highly pathogenic avian influenza” was officially
adopted in 1981 at the First International Symposium on Avian
Influenza to designate the highly virulent forms of avian
influenza. The Office International des Epizooties (OIE) that
codifies sanitary and health standards, has included HPAIV as a
List A reportable disease. HPAIV has been recognized for more
than 100 years it was endemic in the first third of the 20th century
in some European countries, USA and occurred regular in others,
further more the involved isolates were classified as H7N1 and
H7N7, HPAIV outbreaks have been reported about 26 times
since 1955 till 2004 (Capua and Alexander, 2004).
Since end of 2003, simultaneous HPAIV outbreaks were
recorded in domestic and wild birds in at least 48 countries in the
Middle East, Africa and European countries in addition to East
Asia. On January 2006, an outbreak of Highly Pathogenic Avian
Influenza Virus (HPAIV) was recorded in Nigeria for the first
time (Fasina et al., 2009).
Review of Literature
6
In 2006 the AIV was reported in ten African countries
including Egypt, Toga, Sudan, Benin, Niger, Nigeria, Ghana,
Cot d’Ivoir, Djibouti, Caeroon (OIE, 2008). Even without these
H5N1 outbreaks, the period 1995 to 2008 will be considered
significant in the history of HPAIV because of the vast numbers
of birds that died or were culled in three of the other ten
epizootics during this time (Belshe, 2005 and Alexander, 2008).
Egypt was the second African country, after Nigeria, to
declare infection of poultry with HPAIV H5N1 on 16 February
2006 (Aly et al., 2008). More than 30 million birds were culled
in the first wave of the outbreak in 2006 (Meleigy, 2007; Aly et
al., 2008) and 52 human fatalities out of 150 infected persons
have been reported until 6, July 2011 (WHO, 2011).
Full hemagglutinin gene sequencing was performed and
the data revealed that all Egyptian strains were very closely
related and belonging to subclade 2.2 of the H5N1 virus of
Eurasian origin, the same one circulating in the Middle East
region and introduced into Africa at the beginning of 2006 (Aly
et al., 2008). Re-emerging of H5N1 severe outbreaks in
vaccinated chickens at Sharkia Province in Egypt was observed
in October 2007 (Hussein et al., 2009). Despite intense attempts
to eradicate the virus, endemic status is reported in Egypt.
Continuous viral circulation is likely increases risks of sporadic
human infections.
In 2008, the Egyptian Government declared that H5N1
has become endemic in Egypt (Taha et al., 2010). Since that
time, active, passive and targeted surveillances were established
to elucidate the spread of H5N1 usually in poultry sectors and
Review of Literature
7
rarely in other feral birds or farm animals. More information on
surveillance, diagnosis and control activities mobilized to
confront H5N1 virus in Egypt and the major challenges
hampering the containment of the disease has been reviewed in
details by (Abdelwhab and Hafez, 2011). Recently, it was
recorded that the rate of HPAIV H5N1 in commercial poultry
was significantly lower than that in backyards and live bird
markets (El-Zoghby et al., 2013).
Two subclades of H5N1 are circulating in Egypt (Arafa
et al., 2010): ‘‘Classic’’ 2.2.1 strains are present mainly in
backyard birds and have caused the majority of human cases
(Abdelwhab et al., 2010). ‘‘Variant’’ 2.2.1 strains circulated
mainly in vaccinated commercial farms since late 2007 (Arafa
et al., 2010; Hafez et al., 2010). Viruses of this lineage represent
antigenic drift variants and limit the efficiency of the currently
used vaccines (Grund et al., 2011).
Vaccination of backyard birds using inactivated H5
vaccines was provided by the government free of charge while
the commercial sector adopted their pertained vaccination
practices with widely varying standards (Hafez et al., 2010).
However, vaccination coverage was 1-50% and increase risk of
human infection due to silent circulation of the virus in
vaccinated backyard incited the government to cesses
vaccination of birds in the backyard sector (Peyre et al., 2009;
Abdelwhab and Hafez, 2011). On the contrary, several types of
inactivated vaccines based on H5N1 and H5N2 strains are
supplied by a number of vaccine manufacturers and are
Review of Literature
8
permanently applied in the commercial sector (Abdelwhab et
al., 2009).
2.3. Taxonomy and classification of AIV:
Influenza virus A is a member of the Family
Orthomyxoviridae, this family composed of five genera,
influenza virus A, B and C viruses, Thogoto viruses and Isa
viruses. Type designation A, B and C is based on the antigenic
character of the matrix protein located in the virus envelope and
the nucleoprotein within the virus particle. The name influenza
comes from the Italian: influenza, meaning "influence",
(Latin: influentia) (Eccles, 2005).
2.4. Structure and morphology of AIV:
Influenza A viruses are enveloped, small (80 to 120 nm in
diameter), pleomorphic particles. The virions are typically spherical
to pleomorphic but can be filamentous virions (20 nm in diameter
and 200 to 300 nm long). Its genome consists of 8 segments of
linear, negative sense, single-stranded RNA that encodes 10th or
11th proteins (Fig. 1) depending on whether the 11th protein, PB1-
F2, is present or not (Chen et al., 2001). These proteins are
divided into three main categories: A) surface proteins
(hemagglutinin; H, neuraminidase; N and matrix 2; M2), B)
internal proteins (polymerase subunits; PB2, PB1, PA,
nucleoprotein; NP, matrix1; M1 and nuclear export protein;
NEP) and C) non-structural proteins (NS1 and PB1-F2)
(Webster et al., 1992; Cheung and Poon, 2008). Novel extra
protein products have been recently identified as PB1-N40, PA-
Review of Literature
9
X, PA-N155, PA-N182, and M3 increasing the number of IAV
encoded proteins to 15 or 16 (Muramoto et al., 2013).
Figure 1: Structure of Influenza A virus showing encoded
viral structural and non structural proteins.
Hemagglutinin (H) surface protein:
Hemagglutinin (H) is one of surface proteins that is
responsible for attachment and fusion of the virus with the host
cell receptors. The H is synthesized as a precursor polypeptide,
H0 then cleaved by ubiquitous proteolytic enzymes into H1 and
H2 (Steinhauer, 1999). The H monomer consists of a globular
head region mainly of H1 connected to a fibrous stalk domain
formed by the two polypeptide segments of H1 and H2. Several
structures are present on the H1 protein namely receptor binding
domain (RBD), proteolytic cleavage site (PCS), N-Linked
https://web.csblab.or.kr/116
0
Review of Literature
10
glycosylated carbohydrate (GS), antigenic sites and
immunogenic epitopes (Chen et al., 1998; Brown, 2000), while
the transmembrane domain and fusion peptide are associated
with the H2 protein (Armstrong et al., 2000).
The proximity of the globular head region harbors the
receptor-binding pocket of the virus which usually binds to α2-3
linkage sialosides abundant in the intestinal tract of birds in case
of avian influenza viruses (AIV) while human-adapted viruses
are specific for the α2-6 linkage mainly in the respiratory tract
(Parrish and Kawaoka, 2005). A switch from the α2-3 linkage
to the α2-6 linkage receptor specificity is a prerequisite for
emergence of avian viruses with pandemic potential (Stevens et
al., 2006). All influenza A viruses have PCS of an arginine (R)
residue adjacent to a conserved glycine (G) amino acid, the later
becomes the N-terminus of H2 protein (Garten and Klenk,
1983). Avian influenza of low pathogencity phenotypes has
monobasic amino acid, arginine or lysine (K) residues, in the
cleavage site while the existence of multibasic amino acids with
an R-X-K/R-R motif is a feature of high pathogenic subtypes
(Klenk and Garten, 1994).
Two different classes of proteases are responsible for
cleavage-activation of influenza viruses, and the distribution of
these proteases in the host appears to be the prime determinant of
tropism and pathogenicity (Klenk and Garten, 1994;
Steinhauer, 1999). The proteases that cleave non pathogenic
viruses are encountered in a limited number of cell or tissue
types, so these viruses normally cause localized infections in, for
Review of Literature
11
example, the respiratory tract of mammals or the intestinal tract
of wild birds.
On the contrary, proteases that activate pathogenic
influenza viruses are ubiquitously expressed, allowing for the
systemic spread of the virus in infected hosts (Munch et al.,
2001). Five immunogenic epitopes (denoted A – E) of recent
H5N1 hemagglutinin were mapped (Kaverin et al., 2007;
Duvvuri et al., 2009). The repertoire of immunocompetent
antibody-producing cells is directed almost against the upper
surface of the H5 H molecule (Kaverin et al., 2007). Therefore,
most of the positively selected sites were found to be within or
adjacent to the immunogenic epitopes with a higher evolution
rate which could help the virus to circumvent the host immune
response (Lee et al., 2004; Duvvuri et al., 2009).
Non structural protein 1 (NS1):
The NS1 protein is a multifunctional protein that
participates in both protein-protein and protein-RNA
interactions. It binds non-specifically to double-stranded RNA
(dsRNA) and to specific protein targets. Multifunctional proteins
usually show a modular organization, with different domains
responsible for different functions. Two important domains have
been described in this 26 kDa NS1 protein accomplishing its
multiple functions (Fig. 2). The N-terminal structural domain
(RNA-binding domain, RBD), which protects the virus against
the antiviral state induced by IFN-α/β, primarily by blocking the
activation of the 2'-5'-oligo(A) synthetase/ RNase L pathway;
and the C-terminal structural domain (effector domain), which
inhibits the maturation and exportation of the host cellular
Review of Literature
12
antiviral mRNAs by binding cleavage and polyadenylation
specificity factor (CPSF) and inhibiting poly(A)-binding protein
(PAB II) function. The effector domain is crucial for the function
of the RBD (Krug et al., 2003; Wang et al., 2002).
The influenza A virus RNA segment 8, which contains
890 nucleotides, directs the synthesis of two mRNAs in infected
cells. One is colinear with the viral RNA segment and encodes
for NS1 protein of 230 amino acids; the other is derived by
alternative splicing from the NS1 mRNA and translated into
nuclear export protein (NEP) of 121 amino acids. (Bullido et al.,
2001) (Figs. 2 and 3).
Figure 2: Binding sites of cellular proteins on the domains of
the NS1 protein (Dongzi LIN et al. 2007).
Review of Literature
13
Figure 3: Arrangement of the NS1 and nuclear export
protein (NEP) mRNAs of the influenza A virus (Dongzi LIN
et al. 2007).
Structure and function of N-terminus of the NS1 Protein:
The dsRNA-binding domain of the NS1 protein is located
at its N-terminal end. An N terminal structural domain, which
comprises the first 73 amino acids of the intact protein NS1
(1−73), possesses all of the dsRNA binding activities of the full-
length protein (Qian et al., 1995). The function of the dsRNA-
binding activity of the NS1 protein during influenza A virus
infection has not been elucidated yet. Some of the previously
held theories have been disproved by new findings. In the early
studies, NS1 protein inhibited the activation of protein kinase
RNA-regulated (PKR) by sequestering dsRNA through the
dsRNA binding domain of the NS1 protein (Bergmann et al.,
2000; Lu et al., 1995; Hatada et al., 1999).
Review of Literature
14
However, it was reported recently that the inhibition was
realized by the direct binding of NS1 protein and the N-terminal
230 amino acid region of PKR, for which the dsRNA-binding
domain is not responsible (Li et al., 2006). In another aspect,
previous studies reported that high levels of IFN-α/β and its
mRNA were produced in cells infected with a recombinant
influenza A/Wisconsin/33 (A/WSN/33) virus expressing an NS1
protein with a mutated RNA-binding domain (Donelan et al.,
2003; Wang et al., 2000).
However, a new study has shown that this mutant WSN
NS1 protein is located in the cytoplasm, rather than the nucleus
of infected cells and the phenotype of this mutant WSN virus is
due to the mislocalization of the mutant NS1A protein rather
than to the loss of NS1 dsRNA-binding activity. Mutant NS1
protein expressed by recombinant A/Udorn/72 virus could
localize in the nucleus of the infected cells for the second nuclear
localization signal. The experiment using this recombinant A/
Udorn/72 virus revealed that the RNA-binding activity of the
NS1A protein does not have a role in inhibiting the influenza A
virus-induced synthesis of IFN-β mRNA, but is required for the
protection of influenza A virus against the antiviral state induced
by IFN-β. This protection primarily involves inhibiting the IFN-
α/β-induced 2'-5'-oligo(A) synthetase/RNase L pathway (Min et
al., 2006).
Besides type I IFN, the NS1 protein is also involved in the
inhibition of other pro-inflammatory cytokines, such as tumor
necrosis factor-α, interleukin 6 (IL6), macrophage inflammatory
protein-1 alpha (MIP-1α), IL1β and IL18. NS1 protein regulates
Review of Literature
15
the production of pro-inflammatory cytokines in infected
macrophages through the function of both N and C-terminal
domains. Moreover, the N-terminal part of the NS1 protein
appeared to be crucial for the inhibition of IL1βand IL18
production, whereas the C-terminal part was important for the
regulation of IFN-β, tumor necrosis factor-α, IL6 and MIP-1α
production in influenza A virus-infected human macrophages
(Stasakova et al., 2005).
The dsRNA binding domain of the NS1 protein can also
bind to the 5'untranslated region of viral mRNAs and poly(A)
binding protein 1 (PABP1). The eukaryotic initiation factor 4GI
(eIF4GI) binding domain is located in the middle of the NS1A
protein, a region close to PABP1 interacting domain.
Accordingly, it is reasonable to infer that the NS1 interactions
with eIF4GI and PABP1, as well as with viral mRNAs, could
promote the specific recruitment of the viral mRNA translation
initiation complexes, thus enhancing the translation of the viral
mRNA (Burgui et al., 2003).
Structure and function of C-terminus of the NS1 Protein:
The C-terminus of the NS1 protein mainly contains three
functional domains: eIF4GI, the 30 kDa subunit of CPSF
(CPSF30), and the PAB II binding domain. The biophysical
study (Bornholdt et al., 2006) on the NS1 effector domain
showed that each monomer consists of seven β-strands and three
α-helixes. Six of the β-strands form an antiparallel twisted β-
sheet, but not the last one (Fig. 4). Six of the β-strands surround
a central long α-helix, which is held in place through an
extensive network of hydrophobic interactions between the
Review of Literature
16
twisted β-sheet and the α-helix. The CPSF30 binding domain is
at the base of the largest α-helix. Asp92, whose mutation to
glutamate is linked to increased virulence and cytokine
resistance in certain H5N1 strains, is located in the bottom of a
structurally dynamic cleft and is involved in strong hydrogen-
bonding interactions with Ser195 and Thr197, shown in (Figure
4).As described previously, there are binding sites for eIF4GI,
CPSF30 and PAB II in the C-terminus of the NS1 protein, and
the interaction between eIF4GI and NS1 protein is associated
with enhancement of the translation of the viral mRNA. It is also
mentioned that the dsRNA binding activity of the NS1 protein is
not related to the inhibition of the synthesis of IFN-β mRNA.
Nevertheless, the level of the IFN-β does decrease in virus-
infected cells. Why? It has already been identified that NS1
protein binds and inhibits the function of two cellular proteins
that are essential for the 3'-end processing of cellular pre-
mRNAs, CPSF30 and PAB II by way of its effector domain,
thereby inhibiting the production of mature cellular mRNAs,
including IFN-β mRNA (Noah et al., 2003).
The binding to CPSF30 and the resulting inhibition of 3'-
end processing of cellular premRNAs is mediated by amino acid
144 of the NS1 protein, as well as by amino acids 184 to 188
(the 186 region). These two regions interact with the CPSF30.
Amino acids 215 to 237 of the NS1 protein have been identified
as the binding site for PABII. Binding of NS1 and PABII, which
facilitates the elongation of oligo(A) tails during the generation
of the 3' poly(A) ends of mRNAs, prevents PAB II from
properly extending the poly-A tail of pre-mRNA within the host
Review of Literature
17
cell nucleus, and blocks these pre-mRNAs exporting from the
nucleus (Chen et al., 1999). It was also reported that another
role of the C-terminal of the NS1 protein in vivo is to stabilize
and/or facilitate formation of NS1 dimers and therefore, to
promote the RNA binding function of the NS1 N-terminal
domain (Wang et al., 2002).
The cytokine resistance conferred by the D92E mutation
might be due to the increased affinity for dsRNA with this
mutation (Li et al., 2004). Because of the proximity of Asp92 to
the dimeric interface, this mutation might alter the stability or
orientation of the RBD to affect its dsRNA binding affinity.
However, the mutation D92E might lower the efficiency of NS1
phosphorylation. It is known that NS1 phosphorylation is
required for the induction of apoptosis that allows viral
ribonucleoprotein (vRNP) exporting from the nucleus. This
mutation results in a virulent phenotype by prolonging the viral
life cycle (Bornholdt et al., 2006).
The deletion of residues 80−84 found in recent H5N1
strains could increase cytokine resistance by altering either the
orientation or the stability of the RBD, or both, as these residues
are parts of a flexible linker between the RBD and the effector
domain (Bornholdt et al., 2006).
Review of Literature
18
Figure 4: Topology diagram (A) and hypothetical model (B) of
the C-terminus monomer of the NS1 protein. The cleavage and
polyadenylation specificity factor binding site is shown in
orange, purple shows the nuclear export signal, and yellow
indicates Asp92, Ser195 and Thr197. The β-strands (blue) are
numbered 1−7, and the α-helices (red) are marked a, b and c. The
N-terminus and C-terminus are also shown. (Reproduced from
Bornholdt and Prasad) (Bornholdt et al., 2006).
Prospects of NS1 proteins:
The NS1 protein has various functions during IAV
infection through both its RNA-binding domain and effector
domain, such as protecting influenza A virus against the antiviral
state, inhibiting several kinds of pro-inflammatory cytokines,
and blocking the maturation and exportation of the host cellular
Review of Literature
19
antiviral mRNAs. The crystal structures of the NS1 RNA
binding domain and effector domain indicate that NS1 protein
functions as a dimer. In this dimer, the NS1 RNA binding
domain and effector domain form a six-helical chain fold and an
α-helix β-crescent fold, respectively, which is unique. Together
with the hereditary conservation, the NS1 protein is regarded as
an appealing specific target against influenza A virus. At present,
the vaccines and antiviral drugs used to aim directly at the
haemagglutinin (HA) and neuraminidase (NA) of influenza A
virus have rendered prevention and treatment less predictably
effective because of the viral antigenic mutation. Based on the
above-mentioned data, it is feasible to develop live attenuated
viral vaccines using the NS1-mutational viruses (Falcon et al.,
2005), and design effective antiviral drugs to directly target some
of the functional sites, such as the CPSF30 binding site (Twu et
al., 2006). It is also possible to explore the assisting function in
tumor therapy using the recombinant virus expressing truncated
NS1 protein (Efferson et al., 2006).
2.5. Physical and chemical properties of AIV:
Family Orthomyxoviridae possesses enveloped viruses
that are sensitive to acid pH values, although their retention of
infectivity is dependent on the degree of acidity that is obtained
and the virus strain (Puri et al., 1990). Furthermore, they can be
inactivated through ionizing radiation and UV rays that have a
potential application in the laboratory for sterilizing tools and for
biological reagent manufacturing. The primary target by which
radiation brings about virus inactivation is viral RNA rather than
Review of Literature
20
viral proteins and the radiation dose necessary for inactivation
tends to be correlated to the genome size (House et al., 1990).
Influenza A viruses are sensitive to temperature. Recent
studies on the effect of microwave and autoclave treatments on
Influenza A viruses demonstrated that for a human influenza A
virus, A/New Caledonia E 4020 (H1N1), from an initial titre of
105 EID50/ml on swabs, no virus could be detected after
microwave treatment for 5 s, and autoclave treatment for 20 min
was sufficient to inactivate the virus (Elhafi et al., 2004). The
effect of heat treatment on HPAIV (A/chicken/Korea/ES/2003,
H5N1 subtype) in chicken meat has also been investigated
(Swayne, 2006). Thigh and breast chicken meat, from
experimentally infected birds, was examined for virus infectivity
after exposure at 30, 40, 50, 60 and 70° C and after treatment at
70 °C for 1, 5, 10, 30 and 60 s, using the heating block of a
thermocycler as the inactivation method. The initial titres of
infected thigh and breast meat with the H5N1 strain were 106.8
and 105.6 EID50/g, respectively. After exposure at 30, 40 and 50°
C, the titre in both types of meat sample remained unchanged.
Complete inactivation was only reached after exposure at 70° C
(1 s) and at 70° C for 5 s in the breast and thigh meat,
respectively (Swayne, 2006).
On the basis of their resistance to chemical agents, viruses
can be divided into three categories (A, B, C) according to the
classification proposed by Noll and Youngner (1959). This
classification is based on the presence/ absence of lipids on the
virus and on the virus size, which appear to be the characteristics
Review of Literature
21
that most influence resistance to chemical agents. Avian
influenza viruses belong to category A, which includes all
enveloped viruses of intermediate to large size. Many authors
have reached the same conclusion regarding the susceptibility of
viruses to chemical agents, i.e. the presence of lipids is
associated with a high susceptibility to all disinfectants (Maris,
1990).
2.6. Antigenic and genetic properties of AIV:
Influenza A viruses are classified into subtypes based on
HA and NA. Previously, Influenza A viruses are classified into
various subtypes; sixteen subtypes of H gene and nine subtypes
N gene have been identified (Fouchier et al., 2005; Alexander,
2007). After the recent discovery of a new virus genome subtype
identified from bat, H17N10 (Tong et al., 2012), there are
currently 17 H subtypes (H1 to H17) and 10 N subtypes (N1 to
N10) known. More recently, there are 18 H (H1 - H18) and 11 N
(N1 – N11) subtypes, the newly extra subtypes were isolated
from bats (Tong et al., 2013).
All subtypes of influenza A virus are prevalent in wild
and domesticated birds (Webster et al., 1992). Three H subtypes
(H1, H2 and H3) and two N subtypes (N1 and N2) are usually
infecting humans. However, and recently, human infections by
the previously avian-restricted subtypes H5, H7 and H9 have
been frequently reported (Perdue and Swayne, 2005). Likewise,
swine and horses are infected with a much narrower range of
AIV subtypes (Alexander, 2000).
Review of Literature
22
Avian influenza viruses are classified according to the
pathogenicity for poultry into two main categories; low
pathogenic strains (LPAIV) result in mild or asymptomatic
infections and HPAIV causing up to 100% morbidity and
mortality (Swayne, 2009). To date, only H5 or H7 subtypes
fulfilled the defined criteria of high pathogenicity. Meanwhile,
the existence of H5 and H7 viruses of low pathogenicity were
also documented and these strains can potentially evolve into
high path subtypes (Garcia et al., 1996; Halvorson, 2002).
All H5 and H7 viruses have been listed as a “notifiable
disease” by the OIE which mandates all member countries to
report the OIE within 24 hours of confirming AIV infections
(Pearson, 2003). Therefore, the OIE defined the HPAIV as: (1)
viruses cause 75% mortality of 8 susceptible 4- to 8-week-old
chickens within a 10 days observation period or (2) viruses have
an intravenous pathogenicity index (IVPI) of greater than 1.2
upon inoculation of 10 susceptible 4- to 8-week-old chickens or
(3) H5 or H7 AIV with PCS amino acid sequence similar to any
of those that have been previously observed in HPAI viruses.
Moreover, nonpathogenic H5 and H7 in chickens that do not
posses PCS similar to any of those that have been observed in
HPAI viruses are designated as notifiable LPAI viruses while
other non-H5 or non-H7 AIV that are not virulent for chickens
are identified as LPAI viruses (OIE, 2009).
In the European Union (EU), the Council directive
2005/94/EC defined HPAIV infection in poultry or other captive
birds as: (1) infection with any influenza A virus of the subtypes
Review of Literature
23
H5 or H7; or with any influenza having an IVPI >1.2 in 6-week
old chickens and/or (2) infection with H5 or H7 AIV subtypes that
have multiple basic amino acids at the PCS (cleavage site) of the
HA similar to that observed for HPAI viruses. AIV of subtypes
that do not comply with the previously mentioned criteria were
defined as LPAIV (EC, 2005).
Constant genetic and antigenic variation of AIV is an
intriguing feature for continuous evolution of the virus in nature
(Brown, 2000). Gradual antigenic variation via incremental
acquisition of point mutations is defined as “antigenic drift”
which is commonly regarded as the driving mechanism for
influenza virus epidemics from one year to another. However,
possible “antigenic shift” of influenza virus occurs by exchange
genes from different subtypes of influenza “reassortment”
leading to a complete alteration in the antigenic structure and
emergence of new viruses with novel gene constellations
(Brown, 2000). This unpredictable process is relatively
infrequent, however it results in severe pandemics since the
human population has no prior immunity to these de-novo
surface proteins (Ferguson et al., 2003).
The H5N1 H gene has evolved into ten phylogenetically
distinct clades (designated as clade 0 – 9) (WHO/OIE/FAO,
2009). Two major phylogenetic clades are wide-spread: Clade 1
viruses in Cambodia, Thailand, and Vietnam and clade 2 viruses
spread from China and Indonesia to the Europe, Middle East and
Africa. To date, six distinct subclades of clade 2 have been
identified (WHO/OIE/FAO, 2009).
Review of Literature
24
In a previous study, genome analysis of viruses collected
from Europe, Northern Africa and the Middle East from late
2005 to 2006 in addition to Asian H5N1 revealed emergence of a
new European-Middle Eastern-African (EMA) lineage which
further was diversified into 3 distinct independently evolving
clades, designated as EMA clade 1, EMA clade 2 and EMA
clade 3. The early Egyptian strains in 2006 clustered within
EMA clade 1 (Salzberg et al., 2007). In another study, African
strains were classified into 3 sublineages denominated A – C,
where the early Egyptian strains clustered within the sublineage
B along with isolates from Southwest Nigeria and Djibouti
(Ducatez et al., 2007).
Later on, H5N1 viruses isolated from Egypt, Israel, the
Gaza Strip, Nigeria, and Europe in 2006 and 2007 were
classified as clade 2.2.1, within this clade the Egyptian viruses
further diversified to several subclades or groups
(WHO/OIE/FAO, 2009). The most recent WHO classification
allocated the Egyptian strains from human and backyard origin
within the 2.2.1/C group, meanwhile viruses from vaccinated
chickens belong to the 2.2.1/F group (WHO, 2011a).
2.8. Pathogenesis of AIV:
The mechanisms by which virulent strains of AI cause
disease and death of their hosts is not clear. Particularly, the
specific cells involved in viral replication and the mechanisms
by which these viruses injure these cells have not been defined
(Van-Campen et al., 1989).
Review of Literature
25
AIV is normally transmitted by direct contact between
infected and susceptible birds or indirect contact through aerosol
droplets or exposure to virus contaminated fomites (Easterday
et al., 1997). The H protein of avian influenza viruses initiate
infection by binding sialic acid (SA)-containing glycoproteins on
cells (Rogers and Paulson, 1983). Hemagglutinin cleavability is
dependent on its primary structure at the site where cleavage
occurs and the presence of the right proteases in target tissues
that can carry out that cleavage. In epithelial cells lining the
respiratory and intestinal tracts, the hemagglutinin of all
incoming avian influenza viruses is cleaved by host proteases,
thereby activating its fusion activity and allowing its entry;
however, in other tissues, only the hemagglutinin of virulent
viruses is cleaved, leading to systemic disease and death. This
phenomenon accounts not only for viral strain differences but
also for the susceptibility or resistance of different avian species
(Murphy et al., 1999).
The cleavage of the H precursor molecule H0 is required
to activate virus infectivity, and the distribution of activating
proteases in the host is one of the determinants of tropism and, as
such, pathogenicity. The H proteins of mammalian and
nonpathogenic avian viruses are cleaved extracellularly, which
limits their spread in hosts to tissues where the appropriate
proteases are encountered. On the other hand, the H proteins of
pathogenic viruses are cleaved intracellularly by ubiquitously
occurring proteases and therefore have the capacity to infect
Review of Literature
26
various cell types and cause systemic infections (Steinhauer,
1999).
Influenza virus enters its host cell by endocytosis. The
low pH inside the endosome triggers conformational changes in
the major viral membrane protein, hemagglutinin, leading to
fusion of the viral with the endosomal membrane (Günther-
Ausborn et al., 2000). M2 protein plays a key role in the
triggering process because it is an integral membrane protein that
allows H+ ions to enter into the virion, which causes a
conformational change of the H at the lower pH to allow the
fusion domain to become active (Pinto and Lamb, 2007). The
viral nucleocapsids are transported to the nucleus where viral
transcriptase complex synthesizes mRNA. Transcription is
initiated with 10--13 nucleotide RNA fragments generated from
host heterogenous nuclear RNA via viral endonuclease activity
of PB2. Six monocistronic mRNAs are produced in the nucleus
and transported to the cytoplasm for translation into H, N, NP,
PB1, PB2, and PA proteins. The mRNA of NS and M gene
segments undergo splicing with each producing two mRNAs
which are translated into NS1, NS2, MI. and M2 proteins. The H
and N proteins are glycosylated in the rough endoplasmic
reticulum, trimmed in the Golgi and transported to the surface
where they are embedded in the plasma membrane. The eight
viral gene segments along with internal viral proteins (NP, PBI,
PB2, PA and M2) assemble and migrate to areas of the plasma
membrane containing the integrated H, N, and M2 proteins. The
Review of Literature
27
M1 protein promotes close association with the plasma
membrane and budding of the virions (Saif et al., 2008).
HPAIV H5N1 isolate caused systemic infections in
chickens and quail and killed all of the birds within 2 and 4 days
of intranasal inoculation, respectively. This isolate also
replicated in multiple organs and tissues of ducks and caused
some mortality. However, lower virus titers were observed in all
corresponding tissues of ducks than in chicken and quail tissues,
and the histological lesions were restricted to the respiratory tract
(Lee et al., 2005). HPAI viruses, including HPAIV H5N1, cause
severe systemic disease in galliform species as well as in
anseriform species and bird species of other orders (Kuiken et
al., 2010).
Following IV inoculation of AI virus leads to
demonstration of intranuclear and intracytoplasmic influenza
nucleoprotein in kidney tubule epithelium verifies the kidney as
a primary site of influenza virus replication and confirms the
nephropathogenicity of influenza virus. Furthermore, the
presence of diffuse, severe renal tubule necrosis in chickens that
died suggests acute renal failure, with associated blood
electrolyte and nitrogenous waste abnormalities as the cause of
death (Swayne and Slemons, 1994).
In contrast to systemic infection following IV inoculation,
IT and IN inoculation of influenza viruses resulted in influenza
virus replication and lesions in only the local area of exposure,
i.e., the respiratory tract. The absence of mortality, the lack of
kidney lesions, and the failure to isolate influenza virus from
Review of Literature
28
kidney tissue (Slemons and Swayne 1990) following IN and IT
inoculation suggested that under defined experimental conditions
an innate barrier exists in the respiratory and immune systems
that prevents low-virulence avian-origin influenza viruses from
entering the blood stream and producing viremia and systemic
lesions. However, in chickens this innate barrier has been abated
in some experimental studies by specific test conditions or
laboratory manipulations. The predominant and severe
endothelial cell tropism or lymphocytic cellular tropism of high-
pathogenic avian influenza viruses in chickens obscured the
nephrotropic and/or nephropathogenic properties (Olander et
al., 1991 and Van Campen et al., 1989).
In addition, some avian-origin high-virulence influenza
viruses have no or minimal nephrotropism and nephropathogenic
properties (Acland et al., 1984). Finally, Swayne and Slemons,
(1994) indicated that low-virulence avian-origin influenza
viruses were nephrotropic during simulated systemic infection
(IV inoculation) and pneumotropic during simulated local
infection (IT and IN inoculation).
AIV antigen was located in the cerebrum, brain stem, and
pancreas, mainly in association with histological lesions.
Intranuclear and intracytoplasmic staining was seen in neurons
and glial cells of the cerebral gray matter and brain stem in 80%
of infected ducks. In the pancreas, immunolabeling was detected
in the nucleus and cytoplasm of necrotic acinar cells of 20% of
ducks (Vascellari et al., 2007). They found that through the
application of IHC, the localization of viral antigen was closely
correlated to clinical manifestations of disease and the histologic
Review of Literature
29
lesions detected. In some samples, viral demonstration in
necrotic pancreatic foci was not possible, presumably due to the
extensive necrosis of affected cells. In contrast, both IHC and
ISH were able to reveal viral infection in individual cells before
the development of histologic lesions. ISH was more sensitive
than IHC, revealing a small amount of viral RNA in some
samples where viral nucleoprotein has not been detected by IHC.
They concluded that AI virus showed high pathogenicity,
associated with marked CNS and pancreatic damage. IHC and
ISH detected virus spread even in cells and tissues where
histologic lesions were not present, showing the strong viral
neurotropism in ducks.
Bröjer et al., (2009) found that high number of ducks
with encephalitis, in association with high levels of virus as
detected by IHC, suggests that the virus is highly neurotropic, as
previous studies showed by (Brown et al., 2006; Keawcharoen
et al., 2008). Signs of neurologic disturbance were, in fact, the
main observed clinical signs in infected birds. It is likely that the
encephalitis, in combination with an inability to feed or drink,
was the ultimate cause of death in most of the birds.
Neurotropism of the virus was also observed in the peripheral
nervous system, with detection of virus in the submucosal and
myenteric plexa of the intestine and in ganglion cells.
Van Riel et al., (2009) found in the severely edematous
wattle skin, most endothelial cells contained virus antigen, while
in all other tissues virus antigen was only detected in a few
endothelial cells. Viral antigen IHC showed that H7N7 virus
Review of Literature
30
attached to more endothelial cells in wattle skin than in other
vascular beds. This might explain, at least partly, the tropism of
the virus and the associated severity of lesions in this tissue. Also
they found that AI antigen often associated with histologic
lesions, although virus antigen was also present in areas without
detectable lesions. Viral antigen was most commonly observed
in endothelial and mononuclear cells in all tissues. A remarkable
finding was that viral antigen was detected in many endothelial
cells in the wattle, while in all other tissues viral antigen was
only detected in a few, individual endothelial cells. Parenchymal
cells of the heart (cardiomyocytes), kidney (tubular epithelial
and glomerular cells), lung (epithelial cells), pancreas (acinar
cells), and trachea (epithelial cells) also contained viral antigen.
Although there was hepatocellular necrosis, virus antigen was
not detected in hepatocytes. In the wattle, keratinocytes of the
skin contained viral antigen in 1 focus, and a few cells in the
feather pulp of 1 feather follicle contained viral antigen.
Destruction of lymphoid tissues by A/turkey/Ont/7732/66
(H5N9) (Ty/Ont) is a characteristic of infection with this highly
virulent avian influenza virus and not of other virulent avian H5
viruses, A/tern/South Africa/1961 (H5N3) (Tern/S.A.) or
A/chicken/Pennsylvania/1370/83 (H5N2) (Ck/Penn). These three
strains vary in the cell type(s) in which viral antigen is found,
indicating that they infect and replicate in different cell types
(Van Campen et al., 1989). The striking feature of infection
with A/turkey/Ont/7732/66 (H5N9) (Ty/Ont) is the destruction
of lymphoid tissues. This could occur by virus infection that
Review of Literature
31
results in killing lymphocytes and macrophages present in large
numbers in the spleen; however, processes other than viral
replication might be involved. In investigating this possibility,
they found that Ty/Ont affected the in vitro response of avian
lymphocytes to mitogen in a dose-dependent manner. Possible
explanations for the enhanced response with low doses of
Ty/Ont include the release of lymphocyte-activating factors by
macrophages, direct activation of lymphocytes or a direct
mitogenic effect of influenza virus on lymphocytes (Van
Campen et al., 1989).
HPAIV H5N1 nucleoprotein was detected by IHC in the
nucleus and cytoplasm of neutrophils in the placental blood of a
pregnant woman. Viral RNA was detected in neutrophils by in
situ hybridization and enhanced real time polymerase chain
reaction. Therefore, neutrophils may serve as a vehicle for viral
replication and transportation in avian influenza (Zhao et al.,
2008).
2.10. Diagnosis of AIV:
The confirmation of AIV should be carried out with
appropriate laboratory tests following the OIE Manual of
Diagnostic Tests and Vaccines for Terrestrial Animals (OIE,
2009). This includes samples collection, and in the primary
outbreak in a given country virus isolation and identification and
assessment of the pathogencity.
Review of Literature
32
Isolation of AIV:
Embryonated chicken eggs (ECEs) obtained from specific
pathogen free or specific antibody negative fowls are the method
of choice for isolation and propagation of AIV (Woolcock,
2008; OIE, 2009). Inoculation of 9 -11 days old ECE via the
allantoic sac has been used for decades as a superior route for
growing of AIV. Occasionally, yolk sac or the chorioallantoic
membrane routes might be useful in isolation of non-chicken
originated AIV (Woolcock, 2008).
Allantoic fluid collected from inoculated ECE which have
hemagglutinating activity when mixed with chicken erythrocytes
could indicate presence of an AIV; however other
hemagglutinating viruses (e.g. paramyxoviruses) and
contaminating bacteria should be ruled out. Typically, an HPAIV
kills the embryo within 24-48 hours after inoculation of ECE but
further passages are required to propagate viruses of low
pathogenicity (Woolcock, 2008; OIE, 2009). High cost,
availability, less specificity and sensitivity are the main
disadvantages of ECE for AIV isolation (Suarez, 2008;
Woolcock, 2008). On the other hand, cell cultures and cell lines
were found to be as sensitive as egg inoculation in terms of virus
isolation, titration, selection and pathogenicity. Madin-Darby
canine kidney (MDCK), primary chicken embryo kidney (CEK),
primary chicken embryo fibroblast (CEF) cell cultures and baby
hamster kidney (BHK-21) cell lines are efficient systems for
growth of AIV. However, MDCK, CEK, and CEF were found
Review of Literature
33
useful and cost-effective to process a higher volume of samples
(Moresco et al., 2010).
In case of LPAIV propagation in tissue cultures, trypsin
must be added. Nevertheless, chicken kidney cells produce
trypsin-like proteases which could allow replication of LPAIV
without prior addition of trypsin (Suarez, 2008). General
speaking, virus isolation remains the only tool for providing a
live virus for further investigation (Charlton et al., 2009). Yet,
confirmation and subtyping of AIV after primary isolation is
usually done by HI, agar gel immunodiffusion assay (AGID),
commercial immunoassay kits or RT-PCR (Spackman et al.,
2008; Woolcock, 2008; OIE, 2009).
Detection of nucleic acid by RT-PCR:
Several types of RT-PCR methods have been developed
since the early 2000s for diagnosis and differentiation of AIV
which are widely employed in surveillance, monitoring of
outbreaks, and research activities. Among those methods, the
RT-qPCR was described to be of high sensitivity, high
specificity, rapid, cheap, quantitative and cost-effective method
(Spackman and Suarez, 2008). A number of RT-qPCR assays
for diagnosis and characterization of AIV have been published.
These assays target the matrix gene (Spackman et al., 2002), the
nucleoprotein gene, the neuraminidase or the hemagglutinin gene
(Hoffman et al., 2001). Using specific primers and probes,
amplification of a conserved region within the matrix gene
among all AIV subtypes followed by or simultaneously with HA
Review of Literature
34
and NA subtype-specific RT-qPCR is the common used
approach (Spackman et al., 2002).
Detection of viral antigen by Immunohistochemistry (IHC):
Reverse Transcriptase Real-time Polymerase Chain
Reaction (RT-qPCR) assays and IHC staining have been recently
developed for rapid and accurate diagnosis of the HPAIV H5N1
infections worldwide (Cattoli et al., 2004; Tsukamoto et al.,
2010; Nuovo, 2006).
IHC staining is a method to detect and locate the target
viral antigen in tissue sections (Nuovo, 2006). It has been used
to detect avian influenza virus nucleoprotein (NP) antigen. IHC
is suitable technique for a routine avian influenza diagnostic
laboratory because it does not need any sophisticated equipment
or skills (Chamnanpood et al., 2011).
Sequencing of AIV genome:
Identification of AIV genome sequence data is very
important to develop novel influenza vaccines, therapies and
diagnostics and increase our understanding for molecular
evolution, virulence-associated genetic markers and host-
pathogen interaction (Spackman et al., 2008). Genome
sequence of AIV has become relatively less expensive due to the
recent advancement in the field of automated sequencing
technology (Spackman et al., 2008).
In contrast to the standard tests for assessment of AIV
pathogenicity which is time-consuming, laborious and
Review of Literature
35
logistically complex, sequencing of the PCS motif of the H for
rapid assessment of the virulence potential of AIV could be
generated easily within 24 hours and has been considered by the
OIE as a criteria for notifiable HPAIV (Spackman et al., 2008;
OIE, 2009). Furthermore, subtyping of AIV is achievable by
direct sequencing of whole or partially amplified H and N gene
segments (Spackman et al., 2008). In addition to rapid
pathotyping and subtyping of the AIV, sequence analysis was
applied successfully in molecular epidemiology to likely identify
the possible source of infection, spectrum of susceptible species,
ecological niche and geographic range (Shi et al., 2010).
2.11. Control and prophylactic against AIV:
Although enforcement of biosecurity measures and an
eradication strategy of an infected flock should be the basic line
in any control against H5N1 virus infections (Capua and
Marangon 2007); Vaccination as a “tailored synergy” has been
implemented as a main tool to confront the disease in many of
developing countries and to mitigate the impact of the
unbearable pre-emptive culling of infected birds (Swayne,
2009). Several types of H5 vaccines are available to protect birds
against H5N1 virus infection. Conventional inactivated
heterologous LPAIV (H5N2, H5N3, H5N9) or homologous
whole HPAIV H5N1 virus after removal of the PCS by means of
reverse genetics are commonly used vaccines in the field
(Swayne, 2009). Furthermore, vaccines include recombinant
viral vectors (e.g.: adenovirus, fowl poxvirus, Newcastle disease
virus, baculovirus, turkey herpes virus and infectious
Review of Literature
36
laryngotracheitis virus) with an inserted AI H5 gene are a
recently developed promising approach (Beard et al., 1991).
Prevention of the clinical signs, mortality, reduced
shedding of the virus in the environment, increased the resistance
of birds to an infection, decreased bird-to-bird transmission and
limited decrease in the egg production are the main advantages
of the AI vaccines (Capua and Marangon 2007; Swayne,
2009). Yet, the virus is still able to infect vaccinated birds and
subsequent silent spread usually occurs (van der Goot et al.,
2007). It is worth pointing out that continuous circulation of AIV
under immune pressure in vaccinated populations for extended
period favour the antigenic drift of the field virus away from the
vaccine strain as reported in the H5N2 epidemic in Mexico (Lee
et al., 2004) and the endemic H5N1 in China (Tian et al., 2010)
as well as in Egypt (Peyre et al., 2009).
Generally, the immunity induced by vaccination is of
short duration and it is necessary to apply the vaccine several
times during one rearing period. There are little or no data
available about the frequency of vaccinations required for
keeping the breeder and layer flocks protected during the entire
production period (Hafez, 2008). Furthermore, there are several
factors which could affect the vaccine and vaccination against
HPAIV such as: subtype of the vaccinal strain, heterogeneity of
the vaccine and circulating virus, potency of the vaccine, dose,
antigen mass, adjuvant, surfactant, age of birds, species and the
breed of birds (Philippa et al., 2007).
Inappropriate storage, handling and improper
administration are further factors for vaccination failure. The
Review of Literature
37
quality of the vaccine application is crucial since all non injected
chickens are not protected, and improperly injected chicks will
be poorly protected. Using post-vaccination necropsy (residue of
oil at the site of injection) or serological testing demonstrated
that it is not uncommon to see as much as 20 – 30% or even
more of chickens that were not injected (Gardin, 2007).
Finally, continuous antigenic and genetic drift of AIV,
differentiating vaccinated from field exposed birds and
inevitable circulation of the virus in vaccinated birds “silent
infection” are considered major challenges of any AIV vaccine
(Capua and Marangon, 2007). Therefore, vaccination alone is
inadequate to eliminate H5N1 virus in endemic countries. Thus,
it is essential to incorporate a sustainable awareness campaign
and education programs about the virus and modes of
transmission for veterinarians and para-veterinarians involved in
the poultry production chain (Hafez, 2008).
2.12. Public health significance of AIV:
The world’s first cases of human infection with the
H5N1strain were documented in 1997 in Hong Kong. For the
first time, evidence showed that the H5N1 strain can infect
humans directly without prior adaptation in a mammalian host. A
striking feature of this outbreak was the presence of primary
viral pneumonia in severe cases. Usually, pneumonia that occurs
in patients with influenza is a secondary bacterial infection. In
these cases, however, pneumonia was caused directly by the
virus, it did not respond to antibiotics, and it frequently was
rapidly fatal. The outbreak, which involved 18 cases, six of
Review of Literature
38
which were fatal, coincided with outbreaks of infection of H5N1
in domestic poultry on farms and in live markets (WHO, 2005).
Although no sustained human-to-human transmission of
the H5N1 virus has occurred so far and no evidence of genetic
reassortment between human and avian influenza virus genes has
been found, the epizootic outbreak in Asia poses an important
public health risk. If the H5N1 viruses develop the ability for
efficient and sustained transmission between humans, an
influenza pandemic likely would result, with high rates of illness
and death (Ligon, 2005).
MATERIAL AND METHODS
Material and Methods
39
3. MATERIAL AND METHODS
3.1. Material:
3.1.1. Specimens:
Sampling was carried out from chickens and ducks flocks
suspected to be infected with AIV in Sharkia Province, Egypt,
2013. Specimens from tissues including (trachea, brain, lung,
pancreas, proventriculus, spleen, bursa, liver, intestine, and
testis) and sera were collected from infected birds.
Specimens were collected from 7 flocks; chicken broilers
(3), chicken layers (2), and backyard ducks (2) (Table 1). The
clinical picture of the examined birds included sudden deaths,
mortalities up to 40%, ecchymoses on the shanks and feet,
cyanosis of the comb and wattles, subcutaneous edema of head
and neck, and ecchymotic haemorrages on sterum bone for
chickens, and nervous signs (torticollis), for ducks (Figure 5).
3.1.2. Reference HPAIV H5N1:
Highly Pathogenic Avian Influenza Virus H5N1
(A/chicken/Egypt/SHAH-1403/2011, GenBank accession
number JQ927216) was kindly provided by Dr. Reham El
Bakery, Department of Avian and Rabbit Medicine, Faculty of
Veterinary Medicine, Zagazig University, Egypt. The virus
suspension was passage number 4 with titer of 5.7 log 10
EID50/ml.
Material and Methods
40
Table 1: Clinical data of chicken and duck flocks infected with AIV.
Flock
No.
Species Locality Rearing system/
breed
Age/days No. of
sampled
birds
Mortality
rates (%)
Clinical picture of
submitted birds
1 Chicken
broilers
Zagazig Commercial/Cobb
500*
32 9 22.85
Respiratory signs,
cyanosis of the head,
comb and wattles,
subcutaneous edema of
head and neck with
ecchymoses on the shanks
and feet.
2 Chicken
broilers
Abou-
Hammad
Commercial/Cobb
500*
27 9 30.32
3 Chicken
broilers
Belbis Commercial/Cobb
500*
35 9 24.19
4 Chicken
Layers
Abou-
Kebeer
Commercial/Hyline* 105 9 24.50
5 Chicken
layers
Fakous Commercial/Hyline** 101 6 0.14
6 Ducks Zagazig Backyard/Mallard 25 1 28.50 Greenish diarrhea and
nervous signs 7 Ducks Abou-
Hammad
Backyard/Muscovy 30 3 40.00
Total Chickens
Ducks
-
-
-
-
-
-
42
4
-
- -
- * Chicken broiler and layer flocks were vaccinated once with H5N1 or H5N2 inactivated vaccines.
** Chicken layer flock was vaccinated two times with H5N1 or H5N2 inactivated vaccines.
Backyard ducks were not vaccinated.
Material and Methods
41
3.1.3. Phosphate buffer saline (PBS), pH 7.4:
Sodium chloride (NaCl) 8 g
Potassium chloride (KCl) 0.2 g
Potassium dihydrogen phosphate (KH2PO4) 0.2 g
Disodium hydrogen phosphate (Na2HPO4)
12H2O
2.9 g
Distilled water (DW) up to 1000 ml
The pH was adjusted by Hcl or Sodium bicarbonate to be
7.4; it was sterilized by autoclaving and kept at 4oC till used. It
was used for preparation of samples.
3.1.4. Emryonated chicken eggs (ECE):
A total number of 150 ECE of 9-11 days were used for
isolation and propagation of HPAIV H5N1 via allantoic route.
3.1.5. Chicken erythrocytes (RBCs):
Chicken blood was collected in Na citrate 3.8 % by a
volume 1:4 and centrifuged in ordinary centrifuge at 1500
rpm/15 minutes. Chicken RBCs were collected from the
sediment and washed twice using PBS and then prepared as 10%
suspensions in PBS for rapid hemagglutination test.
3.1.6. Antibiotic mixture:
Pen Strept: (Gibco, Invitrogen, Code, 4512)
- Penicillin 10.000 IU/ml
- Streptomycin 10.000 µg/ml
Material and Methods
42
The antibiotic mixture was added to sample supernatants to get a
final concentration of 1000 IU/ml Penicillin and 1000 µg/ml
Streptomycin.
3.1.7. Reagents used for conventional RT-PCR:
3.1.7.1 Reagents for RNA extraction:
Blood/Liquid sample Total RNA Rapid Extraction Kit
(Spin-Column) (Bioteke Corporation, China) (Cat. #: RP4001)
were used for total RNA extraction from 250 µl of HA-positive
allantoic fluids according to manufacturer's instructions.
3.1.7.2. Reagents for synthesis of cDNA and PCR reactions:
3.1.7.2.1. RT-PCR (cDNA synthesis) Kit:
The cDNA Diastar™ RT Kit with RNase inhibitor (Cat.#.
DR22-R10k, Solegent Co. Itd., Korea) was used for synthesis of
cDNA stand using random primer.
3.1.7.2.2. Master Mix:
The 2X Taq PCR master Mix (Bioteke Corporation, China)
was used in PCR.
3.1.7.2.3. Primers:
Two sets of primer (Table 2) were used in PCR reaction
for subtyping of AIV isolates (H5 and N1 forward and reverse
primers) to yield bands of ~317 and ~245 bp for H and N genes
respectively.
Material and Methods
43
3.1.7.3. Reagents for agarose gel electrophoresis:
3.1.7.3.1. Tris-Acetate EDTA (TAE) buffer:
It is 50X stock solution (Fermentas). It was used as 1x
buffer solution for preparation of agarose and for gel
electrophoresis.
3.1.7.3.2. Agarose (Molecular Biology Grade):
It was used in concentration of 1.5% in TAE
Agarose 0.75 g
1x TAE buffer up to 50 ml
It was heated in microwave and used for agarose gel
electrophoresis of PCR products.
3.1.7.3.3. Ethidium Bromide:
A stock solution of ethidium bromide (Fluka) was prepared
as the following:
Ethidium bromide 5 mg
RNase free water 10 ml
It was used for staining the agarose gel electrophoresis
DNA by adding 50µl from stock solution to 50 ml 1.5%
melted agarose to give a final concentration of 0.5 µg/ ml.
3.1.7.3.4. Molecular weight marker: GeneRulerTM, 100 bp
plus DNA Ladder, Ready-to-use (Fermentas)
It is composed of fourteen chromatography-purified
individual DNA fragments (in base pairs): 3000, 2000, 1500,
1200, 1000, 900, 800, 700, 600, 500, 400, 300, 200, and 100 bp.
Material and Methods
44
It contains two reference bands (1000 and 500 bp) for easy
orientation. It was added in volume of 5µl per lane.
3.1.8. Reagents for cloning and sequencing of NS gene:
3.1.8.1 Reagents for TA cloning:
3.1.8.1.1. RT-PCR (cDNA synthesis) Kit:
SuperScriptTM III RT-Kit (InvitrogenTM, USA)
(Cat.#:18080-093) was used for reverse transcription of the
extracted RNA according to manufacturer's instructions using
uni-12 primer (Table 2).
3.1.8.1.2. Amplification kit:
Taq. DNA polymerase enzyme (Takara Bio Inc., Japan),
was used for ampliphication of (cDNA) using specific sets of
primers for both ends of segment eight of H5N1 influenza virus
(NS segment) (Table 2).
3.1.8.1.3. PCR purification combo kits:
Specific bands of NS segment at the expected size (890+29
bp) on gel were excised and purified using PureLinkTM quick gel
extraction and PCR purification combo kit (InvitrogenTM,
USA)(Cat#: K2200-01) following manufacturer's instructions.
3.1.8.1.4. TA cloning® kits:
TA cloning® kit, with pCRTM 2.1 vector without competent
cells (Cat.#: K2020-20), subcloning efficiency TM DH5α TM
competent cells (Cat.# 18265-017) and PureLinkTM quick
plasmid miniprep kit (Cat.# K2100-10) were used For cloning of
NS (segment 8) following manufacturer's instructions.
Material and Methods
45
3.1.8.2. Reagents for sequencing of NS gene:
Reagents for sequencing were performed by ACGT
sequencing company, Ilionos, Chicago, USA.
3.1.9. Reagents for purification and sequencing of amplified
H gene:
3.1.9.1. Reagents for purification of PCR product (DNA)
The gene JETTM Gel extraction Kit (Cat.# K0691,
Fermentus) was used according to manufacturer’s instructions.
3.1.9.2. Reagents for sequencing of H gene:
Reagents for sequencing were performed by Sigma
sequencing company, Cairo, Egypt.
3.1.10. Reagents for real-time RT-PCR:
3.1.10.1. Reagents for RNA extraction:
Blood/Liquid sample Total RNA Rapid Extraction Kit
(Spin-Column) (Bioteke Corporation, China) (Cat. #: RP4001)
were used for total RNA extraction different tissue specimens
according to manufacturer's instructions.
3.1.10.2. Real-time RT-PCR kit:
Ambion AgPath-IDTM one step RT-RealTime PCR kit
(Applied Biosystems®, USA) was used for TaqMan-based real-
time RT-PCR (Applied Biosystems) to measure viral M gene
transcripts in these tissues according to manufacturer's
instructions using sets of M gene specific primers and probe
(Table 2).
Material and Methods
46
Table 2: Sequences of the oligonucleotide primers and probe used in the study
Target
gene
Primer Forward (5’>3’) Primer Reverse (5`>3`) Product
size (bp)
Application References
H5 H5-kha-1
CCTCCAGARTATGCMTAYAAAATTGTC
H5-kha-3
TACCAACCGTCTACCATKCC
YTG
~345 Subtyping and
Sequencing of AIV
H gene
Njouom et
al., 2008
N1 N1-54F
TCARTCTGYATGRYAAYTGG N1-298R
GGRCARAGAGAKGAATTGCC
~245 Subtyping of AIV N
gene Tsukamoto
et al., 2009
NS Bm-NS-1
TATTCGTCTCAGGGAGCAAAAGCAGGGT
G
Bm-NS-890R
ATATCGTCTCGTATTAGTAGA
AACAAGG
890+29 Cloning of NS gene Hoffman et
al., 2001
M M+25F
AGATGAGTCTTCTAACCGAG
GTCG
M-124R
TGCAAAAACATCTTCAAGTC
TCTG
- Real-time RT-PCR Spackman et
al., 2002
M gene
probe
M+64probe*
FAM-TCAGGCCCCCTCAAAGCCGA-TAMRA - Real-time RT-PCR Spackman et
al., 2002
* FAM: 6-Carboxyfluorescein
* TAMARA: Tetramethylerhodamine
* Y, K, M, R: codes for mixed base positions
Material and Methods
47
3.1.11. Reagents for Immunohistochemistry (IHC):
3.1.11.1. Neutral buffered formalin 10%:
Ten percent neutral buffered formalin was used for fixation of
tissues as a preparatory step for (IHC). It was prepared by adding
10 ml formalin to 90 ml phosphate buffer saline.
3.1.11.2. Citrisolv clearing agent (deparaffinizing solutions):
Different series of ethanol's solutions (100% ethanol: 95%
Ethanol; 70% Ethanol; 50% Ethanol) and distilled water were
used.
3.1.11.3. Target retrieval solution (Dako; cat. # S1699)
3.1.11.4. Hydrogen peroxide (H2O2), 3%
3.1.11.5. 0.05 M Tris Buffered Saline, PH 7.6 with 0.05%
Tween 20
3.1.11.6. Normal goat serum, 1:10 (Sigma)
Goat serum was used as concentration 1:10 in Tris buffered
saline (TBS) as blocking solution.
3.1.11.7. Primary antibody:
Primary rabbit anti-influenza A nucleoprotein (NP) polyclonal
antibody (Cat.#: 9382; LifeSpan Biosciences, Inc.USA) was
used for detection of influenza A virus in tissues of chickens and
ducks.
Material and Methods
48
3.1.11.8. Secondary antibody:
The EnVision+/HRP goat anti-rabbit IgG, (Dako; Ready-to-use;
cat.#: K3469).
3.1.11.9. Substrate:
Chromomgen-3-Amino-9-Ethylecarbazole+; AEC+ (Dako;
Ready-to-use; cat. #: K3469) was used in IHC staining.
3.1.11.10. Counter stain
Mayer's Hematoxylin stain was used as counter stain.
3.1.11.11. Aqueous mounting medium (Riedel-deHäen)
3.1.11.12. Positive and negative controls:
Positive control was known IAV positive tissue while negative
control was rabbit immunoglobulin fraction (Dako; cat. #
X0903).
Material and Methods
49
3.2. Methods:
3.2.1. Preparation of collected samples:
3.2.1.1. Preparation of tissue samples for virus isolation:
Tissue homogenates 10% suspension was prepared by
mixing 0.5g of tissue to 5ml of sterile PBS then centrifuged at
2000rpm for 20 minutes at 4oC. Antibiotics were added to the
supernatant fluids to get a final concentration of 1000IU penicillin
and 1000µg streptomycin/ml, and then left for one hour at
refrigerator. The supernatant was aliquoted into sterile 1.5ml
eppendorffs, labeled and used for inoculation of SPF-ECE for
virus isolation.
3.2.1.2. Preparation of serum samples:
Blood samples were collected from chickens and ducks
and allowed to clot at room temperature then centrifuged at
2000rpm for 10 minutes for serum separation. The supernatant
sera were aspirated into small cryovials aliquots and stored at -
20°C until used for RNA extraction.
3.2.2. Isolation of AIV using ECE:
The embryonated chicken eggs of 9-11 days old were
inoculated via allantoic cavity route with 0.2ml of sample
(trachea and lung tissue homogenates pooled together). Each
sample was inoculated into 3 eggs. The inoculated eggs were
sealed melted wax. Additionally, three fertile eggs were
inoculated with reference AIV subtype H5N1 virus and another
three eggs were kept without inoculation as negative control.
Material and Methods
50
These eggs were incubated at 37°C for 5 days, embryonic death
was monitored twice daily. The removed ECEs were chilled at
4˚C for 4 hours and then examined. The eggs were cleaned by
cotton piece soaked in 70% ethanol. At least three successive
embryo passages were applied for each sample to be negative.
Allantoic fluids were collected and preserved at (-20C) until
tested for hemagglutination activity using washed chicken RBCs
10% (OIE, 2012).
3.2.3. Detection of AIV using rapid HA:
Using clean glass slides, 50 µL of allantoic fluid from
each sample were mixed with 50 µL of washed chicken RBCs
10% and incubated at room temperature for 3-5 minutes. Tested
allantoic fluids which showed agglutination in form of
aggregation of RBCs were considered HA positive and subjected
to RT-PCR for subtyping AI viruses.
3.2.4. Detection, identification and subtyping of AIV isolates
using RT-PCR:
3.2.4.1. Extraction of RNA:
Viral RNA was extracted directly from 250µl of HA-
positive allantoic fluids, positive and negative controls were
included as well. RNA extraction step were done using
Blood/Liquid sample Total RNA Rapid Extraction Kit (Bioteke
Corporation, China) according to Manufacturer’s instructions. A
750µl of Lysis buffer were added to 250µl allantoic fluid in one
microcentrifuge tube followed by vortexing for 2 minutes.
Microcentrifuge tube was incubated for 10 minutes at room
Material and Methods
51
temperature followed by adding 150µl chloroform and shaking
for 15 seconds, and then incubation for 3 minutes at room
temperature. After then, Samples were centrifuged at 12,000
rpm/10 minutes where the mixture was separated into 3 phases.
The upper aqueous phase was transferred to a fresh tube where
we added 500μl 70% ethanol. The alcohol-aqueous mixture was
transferred to the spin-column followed by centrifugation at
10,000 rpm and two steps of washing using washing buffers.
Finally, the spin column was placed into RNase-free centrifuge
tube and 60µl was added to the center of the column to elute
extracted RNA from silica membrane of spin-column.
3.2.4.2. Synthesis of cDNA:
The extracted viral RNAs from allantoic fluids were
reverse transcribed to cDNA using cDNA DiaStarTM RT Kit
(Solgent Co. ltd. Korea) according to Manufacturer’s
instructions. In a PCR tube, 5µl of extracted RNA was mixed
with 1µl of random primer. The mixture was heated to 56oC for
5 minutes and cooled immediately on ice. This was followed by
preparation of a mixture with the following condition:
Material and Methods
52
Mix Volume (µl)/ one
reaction
Pre-heating product (RNA + random
primer)
6
5x RT Reaction buffer (RT
enzyme+10Mm dNTP mix)
4
8mM DTT (act as enhancer) 1
DiaStar™ RTase (RNase inhibitor) 1
RNase free water 8
Total 20
The mixture was mixed properly, incubated at 50oC for 60
minutes. The reaction was inactivated by heating at 95oC to stop
the action of RT enzyme. Pure cDNA was produced and ready
for amplification.
3.2.4.3. PCR reaction using H and N primers:
A total volume of 25µl in a sterile 0.2 ml RNase free PCR
tube using 2X power PCR master Mix (Bioteke Corporation,
China). The solution phase PCRs contain the following contents:
Mix Volume (µl)/ one
reaction
Master mix (including DNA polymerase +
10mM dNTP mix)
12.5
Forward primer H/or N (100 pMole) 0.25
Reverse primer H/or N (100 pMole) 0.25
Nuclease free water 9
Template (cDNA) 3
Total 25
Material and Methods
53
The optimized PCR cyclic reaction conditions for H gene
were performed in MWG-Biotech thermal cycler as described as
followings:
Step Temp Time No of cycles
Initial Denaturation 95oC 3 minutes 1 cycle
Denaturation 95oC 30 seconds
30 cycles Annealing 53oC 30 seconds
Extension 72oC 30 seconds
Final extension 72oC 10 minutes 1 cycle
Cooling 4oC Forever
The optimized PCR cyclic reaction conditions for N gene
were performed in Biotech thermal cycler as described as
followings:
Step Temp Time No. of cycles
Initial Denaturation 95oC 3 minutes 1 cycle
Denaturation 94oC 30 seconds
30 cycles Annealing 55oC 30 seconds
Extension 72oC 30 seconds
Final extension 72oC 10 minutes 1 cycle
Cooling 4oC Forever
3.2.4.4. Agarose gel electrophoresis of RT-PCR products of
both H and N genes:
Fifty ml from 1.5% agarose was prepared in 1x TAE
buffer by heating and melting in microwave. The melted agarose
left till cool to about 45oC then 50µl from ethidium bromide
Material and Methods
54
(stock=0.5 mg/ml) was added to give a final concentration of 0.5
µg/ml. The gel was poured, left for solidification, and the comb
was removed then 1X TAE buffer was added. Five µl of the PCR
products and 5 µl molecular weight marker were added into the
marked wells formed in gel. Electrophoresis was done at 100
volts for 40 min then the gel was viewed and photographed on
the UV transilluminator.
3.2.5. Cloning and sequencing of NS gene (Segment 8)
3.2.5.1. Synthesis of cDNA:
The extracted RNA from Allantoic fluid was reverse
transcribed to cDNA using SuperScriptTM III RT-Kit
(InvitrogenTM, USA)(Cat.#:18080-093) according to
manufacturer's instructions. Seven μl of extracted RNA, 0.5μl
uni-12 primer and 2.5μl RNase free water were added together in
one PCR tube and incubated at 70°C for 5 minutes, this was
called part #1. In another PCR tube, 1μl dNTPs (Takara 10 mM),
4μl Invitrogen 5X 1st strain buffer, 1μl Invitrogen M-MLV
polymerase, 1μl RNase inhibitor, 2μl of 0.1mM DTT and 1μl of
H2O were mixed together in one PCR tube, this was called part
#2. Part #1 was added to part #2 and transferred to thermocycler
under optimized cyclic reaction as followings: (25°C/15 minutes,
42°C/1.5 hour, 75°C/10 minutes and 4°C forever). The Reverse
Transcription product (cDNA) was used as template for the
amplification reaction.
Material and Methods
55
3.2.5.2. Amplification reaction:
One microliter of (uni-12) RT-product was used as a
template for PCR using 2.5μl (10X) buffer, 1 μl dNTP, 0.5 μl
Taq. DNA polymerase enzyme (Takara Bio Inc., Japan), 19 μl
Nuclease free water and 0.5 μl from both forward and reverse
primer for NS segment.
The optimized PCR cyclic reaction conditions for NS
gene were as described as followings:
Step Temp Time No. of cycles
Initial Denaturation 94oC 4 minutes 1 cycle
Denaturation 94oC 20 seconds
30 cycles Annealing 58oC 30 seconds
Extension 72oC 7 minutes
Final extension 72oC 7 minutes 1 cycle
Cooling 4oC Forever
3.2.5.3. Agarose gel electrophoresis of RT-PCR product of
NS:
Agar gel electrophoresis was prepared as previously
described in H and N genes.
3.2.5.4. Purification of specific PCR amplicons from agarose
gel:
The PCR amplicons (~890 +29bp) were considered
specific bands for non structural (NS) segment of HPAIV H5N1
(Hoffman et al., 2001). Specific bands were excised using gel
cutter. About 300-450µl of gel solublizing buffer (InvitrogenTM,
USA) were added to excised gel slice in one eppendorff,
Material and Methods
56
incubated in water bath 45°C until the gel slice was solubilized.
The solubilized solution was transferred to silica column
followed by two steps of washing according to manufacturer's
instructions (PureLinkTM quick gel extraction and PCR
purification combo kit, InvitrogenTM, USA). Finally, 40µl Tris-
HCL was used as ellution buffer.
3.2.5.5. Ligation of purified specific PCR amplicons into
cloning vector:
Purified PCR fragments were ligated into pCRTM 2.1
vector by adding 3µl from purified fragment to 0.5µl ligation
buffer, 0.5µl ligase and 1.0µl pCR 2.1 plasmid vector in one
eppendorf, then, incubated at 14°C/overnight.
3.2.5.6. Transformation of ligated plasmids into bacteria:
Transformation process was done using chemically
competent E. coli that has modified cell membrane and can
accept entry of plasmid vector (Subcloning efficiency TM DH5α
TM competent cells, InvitrogenTM, USA). This process was held
through the following successive steps:
Ice incubation: 3µl ligated plasmid were added to 35µl
competent bacteria followed by good gentle mixing and ice
incubation for about 40 minutes.
Heat shock: Sudden moving to water bath (42°C) for one
minute.
Recovery of bacteria: adding 150µl pre-warmed antibiotic free
LB medium to the eppendorf that contains 3µl ligated plasmid
and 35µl competent bacteria.
Material and Methods
57
Incubation with shaking: Incubating recovered bacteria in
shaker incubator (37°C/250rpm) for 30 minutes and not more
than 60 minutes.
Staining of transformed bacteria by X-gal substrate: Adding
20-40μl X-gal substrate of blue color to the transformed
competent bacteria.
Plating on petry dishes: Streaking of the X-gal stained
transformed bacteria into LB semi-solid agar that contain
Ampicillin followed by incubation of plates in inverted direction.
Picking up successively transformed bacteria: Only white
bacterial colonies were picked up and transferred to eppendorfs
that contain LB fluid media. Only white colonies were picked up
because white color means that these bacterial colonies have our
cloned NS gene because this gene will stimulate beta-
galactosidase enzyme to change color of X-gal from blue to
white color. Picked up white colonies were subjected to hybrid
cloned plasmid extraction step.
3.2.5.7. Extraction of hybrid cloned plasmids from
transformed bacteria:
This step was done by adding 1.5ml of the bacterial
culture to 2ml eppedorfs followed by centrifugation at 4000rpm
for 2 minutes. Supernatants were discarded and 100µl of
resuspension buffer were added followed by vortexing to
resuspend bacteria. For lysis of bacterial cell wall, 200µl of lysis
buffer were added to resuspended bacteria. For neutralization of
basic pH that caused by lysis buffer, 150µl of neutralizing buffer
Material and Methods
58
were added followed by vigorous mixing and centrifugation at
maximum speed for 2 minutes. Then, the harvested supernatants
that contain protein and nucleic acids were transferred to clean
eppendorf followed by addition of 200µl phenol and 200µl
chloroform and vigorous shaking to obtain nucleic acids free in
supernatants and get rid of proteins after centrifugation at
maximum speed for 2 minutes. 1ml of Ethyl alcohol was added
to the harvested supernatants followed by centrifugation at
maximum speed for 2 minutes. Finally, extracted plasmid pellets
were left to dry on bench until next step (plasmid digestion) was
started.
3.2.5.8. Purification of hybrid cloned plasmids:
Purification of white plasmid pellets was an essential step
before sending plasmids for sequencing. It was done using
PureLinkTM quick plasmid miniprep kits following manfacturer's
instruction. The steps were similar to that previously mentioned
for purification of PCR amplicons from gel slices.
3.2.6. Full length sequencing of NS gene (segment 8):
Purified hybrid cloned plasmids were sent for sequencing
(ACGT sequencing company, Ilionos, Chicago, USA).
Sequences were obtained using an ABI Big Dye Terminator
v.1.1 sequencing kit and run on a 3730 XL DNA Analyzer
(Applied Biosystems, Foster City, CA). The NS nucleotide
sequences of our isolates are available on GenBank database
under the accession numbers (KJ192204, KJ192205 and
KJ192206).
Material and Methods
59
3.2.7. Partial sequencing of H gene:
The PCR products of the predicted molecular size (~345)
were purified using GeneJETTM Gel Extraction Kit (Fermentus)
as recommended by the manufacturer. Purified PCR products
were sent for sequencing (Sigma sequencing company, Cairo,
Egypt). The H nucleotide sequences of our isolates are available
on GenBank database under the accession numbers (KP311329
and KP311330).
3.2.8. Phylogenetic analysis of sequences of NS and H genes:
Phylogenetic analysis of the NS and H genes was based
on nucleotides 39–704 (666 bases) of NS and 791-1100 (309
bases) of H genes. All gene sequence data of known H5N1
strains were collected from the National Center for
Biotechnology Information (NCBI) flu database. Multiple
alignments were constructed using ClustalW Multiple alignment
using the MegAlign module of DNAStar software (Lasergene
version 7.2 (DNASTAR, Madison, WI, USA). The neighbour-
joining method with Kimura two-parameter distances was used
for constructing the phylogenetic tree using the Mega 4.1
(Kimura, 1980). The tree was rooted to the
A/goose/Guangdong/1/1996 virus sequence. The reliability of
the internal branches was assessed by the p-distance substitution
model and 1000 bootstrap replications. The NS and H genotypes
were determined using the Influenza A Virus FluGenome web
server, (http://www.flugenome.org/) (Lu et al, 2007).
Material and Methods
60
3.2.9. Deduced amino acid sequence analysis of NS and H
genes:
The amino acid sequences of NS1, NS2 and H cleavage
site were deduced from the nucleotide sequences. The multi-
sequence alignment tool available in the flu database was used to
compare the deduced amino acid sequences of the Egyptian
H5N1 strain under study with other H5N1 lineages circulated in
Egypt, Middle East and worldwide in order to screen amino acid
residues that were identified as pathogenic determinants of
highly pathogenic avian influenza viruses.
3.2.10. Detection of AIV in tissue specimens and serum
samples using real-time RT-PCR:
3.2.10.1. Extraction of RNA:
Tissue homogenates from birds previously screened as
RT-PCR H5N1 positive were subjected to RNA extraction using
Blood/Liquid sample Total RNA Rapid Extraction Kit (Bioteke
Corporation, China) according to Manufacturer’s instructions.
Positive and negative controls were included as well.
3.2.10.2. Real time RT-PCR reaction:
The extracted viral RNA from different tissues was used for
TaqMan-based real-time RT-PCR to measure viral M gene
transcripts in tissues using sets of M gene specific primers and
probe (Table 2). Reaction conditions were optimized in accordance
with national veterinary service laboratory (Spackman, 2005,
USDA, USA) using the Ambion AgPath-IDTM one step RT-PCR
kit (Applied Biosystem®, USA). The experiments were held in
Material and Methods
61
three successive times and positive and negative controls were
included along with the tested samples as well.
The solution phase PCRs contain the following
contents:
Mix Volume (µl)/ one reaction
2X Buffer 12.5
M+25F (20 µMole) 0.25
M-124R (20 µMole) 0.25
Probe (6µ Mole) 0.25
25X TaqMan Enzyme Mix 1
Detection Enhancer 1.67
Nuclease Free Water 1.08
Template (RNA) 8
Total 25
The Thermal Cycler Profile for M gene was performed
using the following machine (Applied Biosystems 7500 Real-
Time PCR System) as described as followings:
Thermal Cycler Profile for M gene
Stage Temperature Time Repetitions
1 45.0oC 10 minutes 1
2 95.0oC 10 minutes 1
3 94.0oC 15 seconds 45
60.0oC 45 seconds 30 seconds
Material and Methods
62
3.2.11. Detection of AIV Nucleoprotein (NP) antigen in
different tissues using IHC (Key et al., 2006):
The collected tissues were fixed in 10% neutral buffered
formalin, routinely processed. Paraffin blocks were sectioned
and immunohistochemically stained.
3.2.11.1. Tissue deparaffization and rehydration:
The slides were placed at slides rack and then placed in
oven (58-62 °C) for 30 minutes to warm and melt paraffin in
formalin-fixed, paraffin-embedded tissues sections.
Deparaffinization were done through 4 changes of citrissolv
clearing agent (3 minutes/each solution) inside a fume hood.
Tissues were rehydrated through a graded ethanol series (100%,
95%, 70%, and 50%) and distilled water (3 minutes/each) inside
a fume hood.
3.2.11.2. Antigen retrieval:
The bottom of decloaker was firstly filled with 500 ml of
distilled water. Plastic slide racks were filled with antigen
retrieval solution and then were set inside decloaker. Plastic
racks with blank slides were set inside decloaker as well.
Decloaker was tightly closed and set to start heating/pressurizing
process up to 120°C/17-24 psi. Once temp/pressure was reached,
slides were held at that point for 30 seconds, after then, stop
button was pushed. Once decloaker reaches 85°C/10 seconds and
pressure was zero psi, decloaker lid was opened. Slide racks
were cooled immediately by placing them in two changes of 0.05
Material and Methods
63
MTBS, PH 7.6, within tween 20 added (0.05% per volume) for 5
minutes/each.
3.2.11.3. IHC staining:
Endogenous peroxidase was firstly blocked with 3%
H2O2 for 15 minutes followed by rinsing slides in TBS/Tween
20 for 5 minutes. Non specific binding sites were blocked with
normal goat serum, 1:10 in TBS, for 15 minutes. Slides were
incubated with primary antibody overnight at 4°C followed by
rinsing in TBS/Tween 20 for 5 minutes and incubation with
EnVision+/HRP goat anti-rabbit IgG for 60 minutes. After
rinsing slides in TBS/Tween 20 for 5 minutes, immunoreactivity
was detected by adding substrate (3-Amino-9-Ethylocarbazole).
Positive staining development time was 10 minutes, after which
slides were rinsed with distilled water and placed in a glass dish
for running tap water for 5 minutes.
Finally, slides were counterstained with Mayer's
Hematoxylin for 5 minutes then rinsed in water followed by
covering slide by cover slip using aqueous mounting medium.
Two unstained sections per case block, one to be incubated with
primary antibody and one to be used as negative control
(incubated with negative control rabbit IgG fraction). All
previous steps were done at room temperature except the
primary antibody step, which was done at 4°C overnight.
Material and Methods
64
3.2.12. Statistical Analysis
Data were collected and continuous variables were
analyzed using one-way analysis of variance (ANOVA), then
comparison of means was carried out with Duncan’s multiple
range tests (DMRT) and summarized as mean ± standard
deviation.
RESULTS
65
4. RESULTS
4.1. Isolation of IAV using ECE:
Inoculated embryos died within 48-72 hours post
inoculations with diffuse hemorrhages after three successive
passages were considered as positive samples (Fig. 6B).
4.2. Detection of IAV using rapid HA:
Allantoic fluids were tested for hemagglutination
reactivity using rapid hemagglutination assay (HA) and positive
reactions were detected (Fig. 7B). Hemagglutinating viruses
were detected in 34 birds out of 46 birds with a percentage of
73.9 % with 30 of 42 (71.4%) in chickens and 4 of 4 (100%) in
ducks, respectively (Table 3).
66
Figure 5: Clinical picture of chickens and ducks suspected to
be infected with HPAIV H5N1.A. Chicken Broilers:
Ecchymosis on shanks and feet; B. Chicken Broilers: cyanosis
of comb and wattles; C. Chicken Broilers: fascial oedema
(arrow); D. Chicken Layers: Hemorrhages on sternum bone
(arrow); E. Backyard Ducks: Nervous signs, torticollus (arrow);
F. Backyard Ducks: Liver necrotic lesions (arrow).
67
Figure 6: Evidence of IAV in inoculated ECEs. (A) Normal
control negative chicken embryo inoculated with PBS with
antibiotic mixture. (B) Chicken embryo inoculated with
supernatants of homogenized testicular tissue of naturally
infected chicken layers showing dead embryos within 48h with
severe congestion and hemorrhages after the first passage
(arrow).
Figure 7: Detection of IAV using rapid HA. (A) Normal
control negative washed chicken RBCs (10%). (B) Positive
reactions of tested allantoic fluids by rapid HA using 10%
washed chicken RBCs in form of aggregation or agglutination
(arrow).
68
4.3. Detection, identification and subtyping of IAV using
RT-PCR:
Allantoic fluids which showed positive reactions with
rapid HA assay were submitted to RT-PCR for subtyping of viral
isolates using specific primers for H and N genes. Reference
AIV subtype H5N1 and positive samples produced bands at
~345 bp (Fig. 7A) and ~245 bp (Fig. 7B) specific to AIV
subtype H5N1using H5 and N1 primers respectively. AIV H5N1
was detected in 34 birds out of 46 sampled birds with a
percentage of 73.9 % that distributed between chickens and
ducks by 30 of 42 (71.4%) and 4 of 4 (100%) respectively
(Table 3).
69
Figure 8: Detection, identification and subtyping of IAV
isolates using RT-PCR. (A) PCR amplification for H gene
showing band size of ~345 bp (arrow), First lane: Molecular
marker of 100 bp, Lane 1-7: Positive samples, Ctrl +ve:
Positive AIV subtype H5N1, Ctrl -ve: Negative control
(allantoic fluid of non inoculated ECE). (B) PCR amplification
for N gene showing band size of ~245 bp (arrow), First lane:
Molecular marker of 100bp, Lane 1-5: Positive samples, Ctrl
+ve: Positive AIV subtype H5N1, Ctrl -ve: Negative control
(allantoic fluid of non inoculated ECE).
70
4.3. Cloning and sequencing of NS gene (segment 8):
The NS genomic segments (segment 8) of the Egyptian
H5N1 isolates in this study were completely sequenced. The
results showed that the lengths of the RNA region coding NS1
and NS2 proteins were 822 bp. All NS1 and NS2/NEP genes
shared the first 30 nucleotides of the coding region. The percent
of identity of nucleotide sequences of the NS segments of our
isolates was 99 %. The sequences showed homology of 99%
with those of the HPAIV H5N1 viruses circulating in Egypt at
the time of this investigation, and confirmed that our isolates
belongs to genotype (NS1E) upon using the Influenza A Virus
FluGenome web server, (http://www.flugenome.org/) (Lu et al,
2007).
4.4. Partial sequencing of H gene:
The H gene (segment 4) of our isolates was also partially
sequenced at the coding region of amino acids motifs at H
cleavage site. The results showed that the percent of identity of
nucleotide sequences of H gene of our isolates was 99 %. The
sequences showed identity of 98-99% with those of HPAIV
H5N1 viruses circulating in Egypt at the time of this
investigation, and confirmed that our isolates belongs to
genotype (5J), using the same IAV FluGenome web server (Lu
et al, 2007). Interestingly, we noticed that the surface H protein
of the HPAIV H5N1 currently circulating in Egypt belongs to
genotype (5J), a different genotype from the genotypes of the
viral strains used in some available commercial vaccines (Fig. 9)
71
4.5. Phylogenetic analysis of sequences of NS and H
genes:
Several nucleotide sequences of NS gene (segment 8) of
known HPAIV H5N1 strains were collected from NCBI
Influenza Data base and were used for phylogenetic analysis.
The phylogenetic analysis, based on complete coding region of
NS gene, showed that our isolates formed a uniform cluster,
together with highly pathogenic H5N1 viruses isolated from
Egypt in (2010, 2011, 2012 and 2013), however, this cluster was
far from other viruses isolated from Egypt in 2006, 2007, 2008
(Fig. 8).
Several nucleotide sequences of H gene (segment 4) of
known HPAIV H5N1 strains were also retrieved from NCBI
Influenza Data base and were aligned for further use in
construction of phylogenetic tree. The phylogenetic analysis,
based on partial coding region of H gene, showed that our
isolates formed a uniform cluster, together with the HPAI H5N1
viruses from Egypt isolated in 2009, 2010, 2011, 2012, and
2013; however, this cluster was not identical to the HPAIV H5
strains used for commercial vaccine development in Egypt, and
was also phylogenetically distant from the viruses isolated from
Egypt in 2006, 2007, and 2008 (Fig. 9).
72
Figure 9: Phylogenetic tree on basis of nucleotide sequences
of complete coding region of NS gene of HPAIV H5N1. The
tree was constructed using Neighborhood joining method with
bootstrap values calculated for 1,000 replicates and cut off value
50%. Sequences from this study are marked with solid triangle.
73
Figure 10: Phylogenetic tree of the H gene nucleotide
sequences at the cleavage site of HPAIV H5N1. Vaccine H5
strains were included in the tree and marked with solid circles.
The tree was constructed with multiple alignment of a 309 base-
nucleotide sequence of HA genes using the Neighborhood-
joining method in MEGA4. The tree topology was evaluated by
1,000 bootstrap analyses.
74
4.5. Deduced Amino Acid Sequences Analysis of NS and
H genes:
The percent of identities of amino acid sequences among
NS1 and NS2 proteins of our isolates were more than 99%. The
NS1 proteins of the two Egyptian H5N1 isolates did not differ
from each other, but differed significantly when compared with
those of the low pathogenic avian influenza (LPAIV) isolates
retrieved from Gene bank (NCBI). In the current study, the
molecular determinants of HPAIV strains were identified within
NS1 protein of our H5N1 isolates, including 225 amino acids in
length, deleted 80TMASV84 motif, Glutamate at position 92
(92E), and C-terminus E-S-E-V motif. The following residues
(T5, P31, D34, R38, K41, G45, R46 and T49) were identified in
the RNA binding domain of NS1 protein. The NS2 protein of our
H5N1 isolates contained 121 amino acids residues with
tryptophan at position 78. The nuclear export signal (NES) motif
was identified in its N-terminus region to be
12ILVRMSKMQL21.
The percent of H amino acid sequence identities of our
sequenced isolates was 99%. We found that the HA of our
isolates encodes a multibasic amino acid motif, 321-
PQGERRRKKR*GLF-333, at the H cleavage site, which is a
characteristic feature of all HPAIV H5N1 strains. Interestingly,
we found that one of our isolates has a substitution of amino acid
(R325K) at this cleavage site, to make it PQGEKRRKKR*GLF.
75
4.6. Detection of IAV in tissue specimens and serum
samples using real-time RT-PCR:
Chicken and duck tissues including trachea, lung, liver,
spleen, intestine, brain, testis, and serum were collected from
birds that showed positive results by viral isolation, HA assay,
and RT-PCR. These tissues were subjected to total RNA
extraction and real-time RT-PCR with primers specific to M
gene to examine viral RNA in each organ type.
By real-time RT-PCR, viral RNA of the HPAIV H5N1 M
gene was detected in all tissues tested both in chickens and
ducks, with an exception to testis which was only positive for
chicken layers (Fig.10). Higher levels of viral RNA were in
general detected in tissues of chicken broilers and layers,
including trachea, lung, spleen, intestine, brain, and serum, than
in those of ducks (Fig.10). In chicken broilers, higher viral RNA
levels appeared in brain, trachea, and serum samples with
significance difference with those in chicken layers (Fig.10). No
significant differences in viral RNA levels were observed in
various tissues of ducks, except for higher levels detected in
trachea, lung, and liver tissues that were significant different
from those of chickens (Fig.10). However, these samples from
different birds cannot be emphatically compared because they
came from natural outbreaks with uncertain timing of the course
of infection.
76
Figure 11: Detection of IAV in tissue specimens and serum
samples using real-time RT-PCR. The tests were performed in
triplicates for each sample and the Ct numbers are average with
3times ± SD (error bar), (* P<0.05).Results were expressed as Ct
values. Ct values lower than (35) were considered positive while
values greater than (35) were considered negative. Strong
positive tissues included Ct values between 15 and 25, moderate
positive tissues included Ct values between 25 and 30, and weak
positive tissues included Ct values between 30 and 35.
77
4.7. Detection of IAV antigen (Nucleoprotein) in
different tissues using IHC:
Chickens and ducks tissues included trachea, lung, brain,
spleen, bursa, pancreas, liver, proventriculus, and testis were
collected from birds that showed positive results by real-time
RT-PCR. These tissues were prepared for cross-section IHC
using specific antiserum against influenza A virus nucleoprotein
(NP) to evaluate viral tissue tropism in tissues of chickens and
ducks naturally infected with HPAI H5N1 virus. The viral NP
antigen was observed in all tested tissues included trachea, lung,
brain, spleen and bursa, pancreas, proventriculus, liver, and testis
(Figs. 11 and 12).
Nucleoprotein viral antigen was clearly detected in
endothelial and epithelial cells of trachea (Fig. 11A), Neurons,
glial cells of Perkinji cell layer, and endothelial cells of brain
(Fig. 11B), mononuclear cells of lung (Fig. 11C). acinar
epithelium of pancreas (Fig. 12A), glandular epithelium of
proventriculus (Fig. 12B), lymphocytes and mononuclear cells
of spleen (Fig. 12C), lymphocytes of follicular layer of bursa
(Fig. 12D), and VanKuppfer cells of liver in between liver
sinusoids (Fig. 12E).
Strikingly, viral NP antigen was detected between
seminephrous tubules of testicular tissue and even sticking to
heads of sperms inside these tubules (Fig. 12F)
Staining of most tissues shared a common characteristic
feature which was detection of viral antigen in their endothelial
78
and mononuclear cells, which suggest that viral pathogenesis of
the HPAIV H5N1 may be associated with endothelial invasion,
and that the virus could be carried by infected monocytes.
A summary of viral antigen staining in various tissues that
were examined is shown in (Table 4).
It worse mention, that we prepared samples from duck
tissues and performed the same IHC staining on duck tissues as
chicken tissues. However, we could not detect viral NP in all
tissues examined (data not shown). This could be attributed to
the preparation of samples, since they were collected from dead
ducks in the field. Although viral RNA was still present and live
virus isolated and subtyped by RT-PCR successfully (Figs. 6, 7,
and 10), no sufficient viral antigen existed in the tissues due to
prolonged exposure at ambient temperature and/or prolonged
preservation in formalin before doing IHC staining.
79
Table 3: Results of viral isolation, HA, RT-PCR, and IHC of HPAIV H5N1 from infected
chicken and duck flocks.
Flock
No.
Species Rearing system/ breed No. of
samples
No. of
+ve
samples
Results of HPAIV H5N1
infected flocks
Viral
Isolation
Rapid
HA
assay
RT-
PCR
IHC
1 Chicken broilers Commercial/Cobb 500* 9 9 9/9 9/9 9/9 9/9
2 Chicken broilers Commercial/Cobb 500* 9 6 6/9 6/9 6/9 6/9
3 Chicken broilers Commercial/Cobb 500* 9 3 3/9 3/9 3/9 N/A*
4 Chicken Layers Commercial/Hyline* 9 9 9/9 9/9 9/9 9/9
5 Chicken layers Commercial/Hyline** 6 3 3/6 3/6 3/6 3/6
6 Ducks Backyard/Mallard 1 1 1/1 1/1 1/1 -ve
7 Ducks Backyard/Muscovy 3 3 3/3 3/3 3/3 N/A
Total Chickens
Ducks
-
-
42
4
30
4
* Chicken broiler and layer flocks were vaccinated once with H5N1 or H5N2 inactivated vaccines.
** Chicken layer flock was vaccinated two times with H5N1 or H5N2 inactivated vaccine.
Backyard ducks were not vaccinated. N/A Not applied
80
Table 4: Distribution of viral antigen NP in IHC stained
tissues and cells of HPAIV H5N1 infected chickens.
Tissue IHC
score
Type of cells expressing virus antigen
Trachea +++ Endothelial cells and epithelial cells
Lung + Macrophages, Lymphocytes
Brain +++ Endothelial cells, neurons and glial cells
especially in perkinji cell layer
Spleen + Lymphocytes, Endothelial mononuclear cells
Bursa + Lymphocytes inside Follicular layer, endothelial
cells
Pancreas +++ Pancreatic acinar epithelium, macrophages and
endothelial cells
Liver + Liver sinusoids (inside Van kupffer cells)
Proventriculus + Glandular epithelium
Testis ++ Inter-seminephrous space, intra seminephrous
tubules sticking to sperms
IHC scoring system: (+) few viral antigen distribution; (++) moderate
viral antigen distribution; (+++) strong viral antigen distribution.
81
Figure 12 (A-C): Detection of viral antigen nucleoprotein (NP) in HPAIV H5N1 infected birds by IHC. (A)
Trachea; (A-1) Trachea of control HPAIV H5N1 non infected birds (X=50μm); (A-2) Trachea of control HPAI H5N1
none infected birds (X=20μm); (A-3) Viral antigen in endothelial cells of trachea (arrow) (X=20μm); (A-4) Viral
antigen in epithelial cells of trachea (arrow) (X=20μm). (B) Brain; (B-1) Brain of control HPAIV H5N1 none infected
birds (X=50μm); (B-2) Brain of control HPAIV H5N1 none infected birds (X=20μm); (B-3) Viral antigen in endothelial
cells, neurons, and glia cells of brain (arrow) (X=20μm), (B-4) Viral antigen in endothelial cells of brain (arrow)
(X=20μm). (C) Lung; (C-1) Lung of control HPAIV H5N1 none infected birds (X=50μm); (C-2) Viral antigen in
mononuclear cells of lung (arrow) (X=50μm), (C-3) Viral antigen in mononuclear cells of lung (arrow) (X=20μm).
82
Figure 13 (A-F): Detection of nucleoprotein (NP) viral antigen in HPAIV H5N1 infected birds by IHC. (A)
Pancreas; (A-1) Viral antigen in acinar epithelium of pancreas (arrow) (X=50μm); (A-2) Viral antigen in acinar
epithelium of pancreas (arrow) (X=20μm). (B) Proventriculus; (B-1) Viral antigen in glandular epithelium of
proventriculus (X=50μm); (B-2) Viral antigen in glandular epithelium of proventriculus (arrow) (X=20μm). (C) Spleen;
(C-1) Viral antigen in lymphocytes of spleen (X=50μm); (C-2) Viral antigen in lymphocytes of spleen (arrow)
(X=20μm). (D) Bursa; (D-1) Viral antigen in lymphocytes of follicular layer of bursa (X=50μm); (D-2) Viral antigen in
lymphocytes of follicular layer of bursa (arrow) (X=20μm). (E) Liver; Viral antigen in VanKupffer cells of liver
(arrow) (X=50μm). (F) Testis; Viral antigen in-between seminephrous tubules of testicular tissue (arrow) (X=20μm).
DISCUSSION
Discussion
83
5. DISCUSSION
HPAIV H5N1 is still circulating and causing outbreaks
with significant mortality to both commercial chickens and
domestic backyard ducks in Egypt. Our data showed that
vaccination with H5N1 and H5N2 vaccines may provide partial
protection, especially to layers which were vaccinated twice. For
both broilers and layers in commercial farms, they appeared to
be protected with even one-time vaccination when compared to a
mortality of over 70% in non-vaccinated chickens (Grund et al.,
2011).Unfortunately, we did not perform serological evaluation
of the immunological status or vaccine efficacy in chickens,
therefore are unable to assess how well the mortality is
correlated to the vaccination. Therefore, we cannot conclude
emphatically that the much lower mortality in the layers, which
were vaccinated twice, was absolutely attributed to the boosted
immunity.
Vaccine efficacy may best be assessed in the setting of
natural outbreaks, which apparently differs from that designed
experimentally. In naturally infected free-living birds, the
clinical and pathologic manifestations of an HPAIV infection
may be influenced by multiple factors including the age of the
bird, the dosage of virus and routes of viral exposure, the
presence of concomitant infections, and the levels of immunity
acquired from vaccination or during previous exposure to
influenza viruses (Keawcharoen et al., 2008, Bröjer et al.,
2009), which could be significantly different from trials with
Discussion
84
experimental challenges. Data about vaccine protection and
efficacy from natural outbreaks may be more valuable when case
studies are carefully planned and serological survey is
thoroughly performed and assessed. Even though the mortalities
were lowered, the pathogenicity of the infection appeared to be
severe, and the virus was highly virulent in sick chickens as
shown in Fig. 5 and Table 1.
Laboratory diagnosis of Influenza A virus infections is
performed by viral isolation and identification followed by
subtyping using hemagglutination-inhibtion test and/or RT-PCR
(OIE, 2005). In this study, using viral isolation (Fig. 6), RT-
PCR (Fig. 7), and sequencing, we identified that the IAV that
caused an outbreak in commercial chickens and backyard ducks
in Sharkia province, Egypt, was of H5N1 subtype.
Complete genotype nomenclature is essential to describe
gene segment reassortment (Lu et al, 2007). The reassortment of
NS gene segments between different AI viruses, particularly the
H5N1 subtype has been previously reported (Munir et al.,
2013). Nucleotide sequences analysis of NS and H genes of our
isolates showed homology of 98-99% with those of the H5N1
viruses circulating in Egypt at the time of this investigation.
Genotyping tool (Lu et al, 2007), confirmed that our isolates
belongs to genotypes NS1E and 5J for NS and H genes
respectively which indicates that the current circulating H5N1
viruses in Egypt did not undergo reassortment of NS gene
segments till time of investigation. Moreover, they harbor a
different H genotype (5J) from the commercial vaccinal strains
Discussion
85
genotypes (Fig. 9), which may illustrate why vaccination failure
commonly occurs, but confirming this hypothesis need further
studies. Phylogenetic analysis of NS and H genes, showed that
our isolates were phylogenetically distant from the H5N1 viruses
isolated from Egypt in 2006, 2007, 2008, indicating the Egyptian
H5N1 strain has dramatically evolved from the parental strain
that hit Egypt in 2006 (Figs. 8 and 9).The phylogenetic analysis
of H gene, showed that our isolates formed a uniform cluster that
was not identical to the HPAIV H5 strains used for commercial
vaccine development in Egypt, which may also elucidate why
vaccination failure occurs, but further studies are crucial to
confirm this assumption (Fig. 9).
AIV pathogenicity can be determined by calculating the
intravenous pathogenicity index or by characterizing the
molecular pathogenicity markers such as multiple basic amino
acids located at the cleavage site of the H protein (OIE manual,
2005). Analysis of H gene amino acids sequences at cleavage
site revealed that our isolates encodes a multibasic amino acid
motif, 321-PQGERRRKKR*GLF-333, at the H protein cleavage
site, which is a characteristic feature of all HPAIV H5N1 strains.
Interestingly, we found that one of our isolates has a substitution
of amino acid (R325K) at this cleavage site, to make it
PQGEKRRKKR*GLF, whether this mutation could or could not
have a role in the increased pathogenicity of the isolated strains,
this may need further studies.
The nonstructural protein 1 (NS1), considered the main
modulator of host immunity and a virulence factor, is a
Discussion
86
multifunctional protein that protect IAV against the antiviral
state (Falcon et al., 2005). In this study, we found that NS1
protein of our isolates carries molecular pathogenicity
determinants of HPAIV H5N1 strains including deleted
80TMASV84 motif, Glutamate at position 92 (D92E), and C-
terminus E-S-E-V motif (Seo et al., 2002, Obenauer et al,
2006) which provide another evidence that our isolates were of
high pathogenicity. Glutamate at position 92 (D92E) is
associated with Interferons (IFNs) down regulation and cytokine
resistance (Seo et al., 2002). The NS1 protein shares in both
protein-protein and protein-RNA interactions by two important
domains, the N-terminal structural domain (RNA-binding
domain, RBD) and the C-terminal structural domain (effector
domain). In the RNA binding domain of NS1, the bases
responsible for its functions were characterized as following;
Thr5, Pro31, Asp34, Arg35, Arg38, Lys41, Gly45, Arg46, Thr49
(Wang et al., 1999). For keeping the RNA-binding activity of
the NS1 protein Arg38 and Lys41 are necessary. Locations of
Arg38 and Lys41 are highly preservative characteristic for the
avian influenza virus strains. Our isolates possess arginin and
lysine at positions 38 and 41 respectively. The NS2/NEP protein
function depends on the nuclear export signal (NES) motif in its
N terminus region. The amino acid sequence in this region is
highly conserved. The amino acid sequence of NES and the
NS2/NEP sequence in the A/WSN/33 viruses have previously
been identified to be 12ILMRMSKMQL21 (Iwatsuki Horimoto
et al, 2004). The NES sequence of the NS2/NEP H5N1 samples
Discussion
87
in this study was identified to be 12ILVRMSKMQL21.
Tryptophan at position 78 (Trp78) is necessary for export of
ribonucleoprotein complexes from nucleus (Akarsu et al.,
2003). In our studied strains tryptophan was located in position
78. Taken together, full deduced amino acids analysis of NS1
and NS2 proteins of the Egyptian HPAI H5N1 viruses isolated in
2013 indicated that no substitutions, deletion and/ or insertion
have been yet occurred at the mostly important amino acid
residues of these two proteins.
Pathogenicity of infection by HPAIV H5N1 has been
studied experimentally in chickens and domestic ducks. Vietnam
HPAIV H5N1 caused high mortality in two- and four-week-old
SPF White Leghorn chickens (G. gallusdomesticus) (48/48,
100%) with mean death times (MDT) from 36 to 48 hrs, and
two- and five-week-old Pekinwhite ducks (Anasplatyrhynchus)
(63/64, 98.4%) with MDTs from 2.7 to 4.4 days (Pfeiffer et al.,
2009). Pathogenicity of the Egyptian HPAIV H5N1 have been
tested experimentally only in domestic ducks (Wasilenko et al.,
2011). While A/ck/Egypt/08 killed 8/8 (100%) with an MDT of
4.1 days, A/ck/Egypt/07 killed 4/8 (50%) with an MDT of 7
days, indicating that HPAIV H5N1 isolates differ in their
virulence. Although these two isolates are considered to have
evolved from the same origin (Wasilenko et al., 2011), they are
far apart within the clade 2.2 in the phylogenetic tree and have
evolved different pathogenicity since the HPAIV H5N1 of clade
2.2 was introduced into Egypt. On the other hand, pathogenicity
observed in these experimental challenges cannot be directly
Discussion
88
compared with that in natural outbreaks. Apparent differences
exist between SPF birds with a certain age group infected
experimentally by the intranasal route (IN) and poultry of
various ages in commercial farms by natural exposure. The
mortality rates in our report were lower in duck and even much
lower in once- and twice-vaccinated chickens during the
outbreaks. However, sick birds expressed severe systemic
symptoms included nervous disorders in both chickens and
ducks, and infection was confirmed by detection of IAV viral
antigen NP.
The isolated HPAI H5N1 viruses, A/chicken/Egypt/IT-
1/2013 and A/chicken/Egypt/IT-2/2013, clearly demonstrate
their pantropism in tissues of H5N1 infected chickens. The viral
RNA and NP antigen were detected in multiple tissues, including
trachea, lung, brain, liver, spleen, pancreas, intestines,
proventriculus, bursa of fabricius, and testis in infected chickens,
similar to those observed in chickens infected with the
Vietnamese H5N1 virus (Pfeiffer et al., 2009). We could
conclude that even though vaccination may lower mortality
rates, it does not change pantropism of HPAIV H5N1 in sick
birds.
Our study showed that high levels of viral RNA were
detected in the brains of infected chickens (Fig. 10) and that viral
NP antigen was observed in the nuclei of neurons and glial cells
of the brain (Fig. 11B), clear signs of virus replication in brain,
in agreement with (Brown et al., 2009; Pantin-Jackwood et al.,
2009; Tang et al., 2009; Goletic et al., 2010) who previously
Discussion
89
described neurotropism of HPAIV H5N1 strains. Different
pathways have been proposed by which the HPAI H5N1 virus
infects the central nervous system (CNS) in chickens. It has been
hypothesized that the virus could reach the CNS through the
olfactory nerves (Majde et al., 2007), the peripheral nervous
system (Tanaka et al., 2003; Matsuda et al., 2004), or even the
bloodstream (Mori et al., 1995). Interestingly, we observed the
viral NP antigen in endothelial cells of brain, which provides
direct evidence that the HPAIV H5N1 likely invades the CNS by
replicating in blood vessels in the brain, and contributes to the
development of severe nervous symptoms. Based on our
evidence, we consider this to be one of the routes for HPAIV
H5N1 to invade CNS. Severe CNS disorders in birds are
probably one of the main causes for mortality when neurons are
infected; massive edema due to virus infection-induced altered
vascular permeability and multi-organ failure are commonly
blamed for high mortality in HPAIV infected birds.
Mechanisms for viral penetration of the blood-brain
barrier in the brain have been investigated previously. The virus
may invade neurons through the opening of endothelial cell
junctional complexes (para-cellular route) (Lossinsky &
Shivers, 2004), or through vesiculo-tubular structures (trans-
cellular route) (Liu et al., 2002). It could reach the vessels in the
brain through the bloodstream, or via a “Trojan horse
mechanism” where viral particles are transported through
infection of leukocytes and/or mononuclear cells (Verma et al.,
2009). In our study, viral RNA or antigen was detected in blood
Discussion
90
or sera and infected macrophages and monocytes, which
suggests that the endothelial cells may play a crucial role in viral
penetration of the blood-brain barrier, leading to severe
necrotizing encephalopathy and death. Our finding that
endothelial cells of the cerebellum were also strongly positive in
viral NP antigen supports this hypothesis (Fig. 11B4).
The viral antigen was strongly expressed in the acinar
epithelium of pancreas, giving rise to the possibility of a
potential role of the pancreas in viral pathogenesis. Evidence
showed that the virus also replicated in lymphocytes of follicular
layer of the bursa, which may be significant in inducing
immunity against the virus, a key process for recovery of sick
birds from infection. A remarkable isolation of virus from
testicular tissue samples explained the severe embryonic
hemorrhages, congestion, and deaths within 48hrs post-infection
(Fig. 6A). Moreover, high viral RNA levels were detected from
testicular tissue (Fig. 10), with viral NP antigen expressed in
between or inside seminephrous tubules or even sticking to
sperms (Fig. 12F). However, sexual transmission for apparently
healthy cocks to spread HPAIV H5N1 during the incubation
period is probably a scenario of low or unlikely probability. It is
likely that sperm collected from infected cocks with healthy
appearance could disseminate virus to both uninfected birds, and
farm handlers and workers either via natural insemination or
during application of artificial insemination.
In conclusion, this study, firstly, identified that the
outbreak that appeared in commercial chickens and backyard
Discussion
91
ducks in Sharkia province, Egypt, 2013 was attributed to HPAIV
H5N1infection. Secondly, genetic and amino acid analysis of H
gene at cleavage site indicated that they carry molecular
determinants of HPAIV strains. Moreover, H protein of our
isolates belongs to genotype (5J) which is different genotype
from those strains used in some available commercial vaccines
currently used in Egypt. Thirdly, genetic and amino acid analysis
NS gene of viral isolates indicated that they belong to genotype
NS1E with no reassortment between H5N1 subtype and other
subtypes currently circulating in Egypt. The amino acids
residues of NS-1 and NS-2 proteins of our strain did not show
progressive evolution as we did not detect amino acids
substitution, deletion and or insertion at the most important
motifs of the NS1 protein. Fourthly, by IHC we confirmed the
pan-tropism of the Egyptian HPAIV H5N1 in naturally infected
chickens where endothelial cells, mononuclear cells, and
testicular tissues expressed obvious viral antigen. Detection of
viral antigen in endothelial and mononuclear cells reflects that
the virus may have disseminated in all birds tissues via these
cells. Moreover, expression of viral antigen in brain tissues
suggests that severe necrotizing encephalopathy may be at least
one of the possible causes of death of birds, if not the only cause.
By end of this study, we recommend further studies on
continued subtyping and full genome characterization of IA
viruses currently circulating in the Egyptian poultry field and
also, functional characterization of NS1protien to identify its
specific role in virulence of HPAI viruses. Vaccine efficacy
Discussion
92
studies, possibility of sexual transmission of IAV viruses, and
pathogenicity of HPAIV in naturally infected ducks are also
necessary studies.
SUMMARY
Summary
93
6-SUMMARY
Highly pathogenic avian influenza virus (HPAIV) H5N1
has been endemic in Egypt since 2006 and raised concern
recently for its potential to evolve and be of highly transmissible
among humans. Infection of HPAIV H5N1 has been described in
experimentally challenged birds. However, pathogenicity of
HPAIV H5N1, isolated in Egypt, has not been reported in
naturally infected chickens and ducks, which could be unique
due to distinct transmission routes and dosage of infection. Here
we report a recent outbreak of HPAIV H5N1 in 2013, in
commercial poultry farms in Sharkia Province, Egypt. The main
symptoms were ecchymoses on the shanks and feet, cyanosis of
the comb and wattles and subcutaneous edema of head and neck
for chickens, and nervous signs (torticollis) for ducks. Within
48-72 hrs of the onset of illness, the average mortality rates were
22.8-30% and 28.5-40% in vaccinated chickens and non-
vaccinated ducks, respectively. Tissue samples of chickens and
ducks were collected for cross-section immunohistochemistry
and realtime RT-PCR for specific viral RNA transcripts. Higher
viral RNA transcripts were detected in tissues of chicken broilers
and layers, including trachea, lung, spleen, intestine, brain, and
serum, than those of ducks which have only viral RNA
transcripts in trachea, lung, and liver tissues. In chickens, the
highest viral RNA levels appeared to be in brain, trachea, and
serum with significant differences detected between chicken
Summary
94
broilers and layers in theses tissues in particular. Significant
differences of the viral RNA were observed in trachea, lung, and
liver tissues of ducks than those of chickens, indicating that
HPAI H5N1 replicates with distinct tissue tropism between
chickens and ducks. However, these samples from different birds
cannot be compared because they came from natural outbreaks
with uncertain timing of the course of infection. While the viral
RNA was nearly detected in all tissues and serum collected
indicating viral pan-tropism, the viral antigen was detected
almost ubiquitously accordingly in all tissues including testicular
tissues. Interestingly, viral antigen was also observed in
endothelial cells of the most organs, and seen clearly in trachea
and brain in particular as well as in mononuclear cells of various
tissues particularly lungs. We performed phylogenetic analyses
and compared the genomic sequences of the surface
hemagglutinin (H) and non structural protein 1(NS1) among the
isolated viruses, the HPAI H5N1 viruses circulated in Egypt in
the past and currently, and some available commercial vaccinal
strains. Analysis of deduced amino acids of both HA and NS1
revealed that our isolates carry molecular determinants of HPAI
viruses, including the multibasic amino acids at the cleavage site
in HA and glutamate at position 92 (D92E), C – terminus E-S-E-
V motif, and the deletion at position 80-84 in NS1 protein.
Taken together, this is the first study about pathogenicity of the
HPAIV H5N1 strain, currently circulating in Egypt, from
naturally infected poultry, which provides unique understanding
Summary
95
of the viral pathogenesis in HPAIV H5N1 infected chickens and
ducks.
In conclusion, this study, firstly, identified that the
outbreak that appeared in commercial chickens and backyard
ducks in Sharkia province, Egypt, 2013 was attributed to HPAIV
H5N1infection. Secondly, genetic and amino acid analysis of H
gene at cleavage site indicated that they carry molecular
determinants of HPAIV strains. Moreover, H protein of our
isolates belongs to genotype (5J) which is different genotype
from those strains used in some available commercial vaccines
currently used in Egypt. Thirdly, genetic and amino acid analysis
NS gene of viral isolates indicated that they belong to genotype
NS1E with no reassortment between H5N1 subtype and other
subtypes currently circulating in Egypt. The amino acids
residues of NS-1 and NS-2 proteins of our strain did not show
progressive evolution as we did not detect amino acids
substitution, deletion and or insertion at the most important
motifs of the NS1 protein. Fourthly, by IHC we confirmed the
pan-tropism of the Egyptian HPAIV H5N1 in naturally infected
chickens where endothelial cells, mononuclear cells, and
testicular tissues expressed obvious viral antigen. Detection of
viral antigen in endothelial and mononuclear cells reflects that
the virus may have disseminated in all birds tissues via these
cells. Moreover, expression of viral antigen in brain tissues
suggests that severe necrotizing encephalopathy may be at least
one of the possible causes of death of birds, if not the only cause.
Summary
96
Last but not least, this study gives insights into pathogenesis of
HPAIV in naturally infected birds which may be different from
that obtained from experimentally infected birds due to distinct
viral dosage and route of infection, distinct age and immunity of
birds, and possibility of presence of contaminant infection. Thus
it can serve as an augmentation to and in comparison with
experimental studies. This study is also important to the
veterinarians to perform accurate diagnosis on the actual field
samples.
By end of this study, we recommend further studies on
continued subtyping and full genome characterization of IA
viruses currently circulating in the Egyptian poultry field and
also, functional characterization of NS1protien to identify its
specific role in virulence of HPAI viruses. Vaccine efficacy
studies, possibility of sexual transmission of IAV viruses, and
pathogenicity of HPAIV in naturally infected ducks are also
necessary studies.
140
REFERENCES
References
97
7. REFERENCES
Abdelwhab, E. M. & Hafez, H. M. (2011). An overview of the
epidemic of highly pathogenic H5N1 avian influenza
virus in Egypt: epidemiology and control challenges.
Epidemiology and Infection, 139(05), 647-657.7
Abdelwhab, E. M., Arafa, A., Selim, A., Samaha, H., Kilany,
W. H., Shereen, G., Hassan, M. K., Aly, M. M. and
Hafez, H. M. (2009). Highly pathogenic avian influenza
in H5N1 in Egypt: Current situation and challenges. In:
Proceedings of the 5thInternational Meeting of the
Working Group 10 (Turkey) of WPSA (Ed. Hafez, H.M).
28th – 30th May, Berlin. Berlin. Mensch & Buch Verlag
pp. 308 – 316.
Abdelwhab, E. M., Selim A. A., Arafa, A., Galal, S., Kilany,
W. H., Hassan, M. K., … & Hafez, M. H. (2010).
Circulation of avian influenza H5N1 in live bird markets
in Egypt. Avian diseases 54 (2), 911-914.
Aclandl, H. M., Silverman-Bachin, L. A. and Eckroade, R. J.
(1984). Lesions in broiler and layer chickens in an
outbreak of highly pathogenic avian influenza virus
infection. Veterinary Pathology, 21: 564-569.
Akarsu, H., Burmeister, W. P., Petosa, C., Petit, I., Müller,
C. W., Ruigrok, R. W., & Baudin, F. (2003). Crystal
structure of the M1 protein‐binding domain of the
References
98
influenza A virus nuclear export protein (NEP/NS2). The
EMBO journal, 22(18), 4646-4655.
Alexander, D. J. (2000). A review of avian influenza in
different bird species. Veterinary Microbiology, 74:3-13.
Alexander, D. J. (2008). Orthomyxoviridae – avian influenza
Poultry Diseases. Chapter 26, (Sixth Edition), Pages 317-
332.
Alexander, D.J. (2007). An overview of the epidemiology of
Avian Influenza. Vaccine; 25: 5637- 5644.
Alexander, D.J. and Gough, R.E. (1986). Isolations of avian
influenza virus from birds in great Britain. Veterinary
Record, 118:535-538.
Aly, M., Arafa, A., Hassan, M., (2008). Epidemiological
findings of outbreaks of disease caused by highly
pathogenic H5N1 avian influenza virus in poultry in
Egypt during 2006. Avian diseases, 52: 269-277.
amplification. Ann. Diagn. Pathol. 10, 117–131.
Arafa, A., Suarez, D.L., Hassan, M. K. and Aly, M. M. (2010):
Phylogenetic analysis of hemagglutinin and neuraminidase
genes of highly pathogenic avian influenza H5N1 Egyptian
strains isolated from 2006 to 2008 indicates heterogeneity
with multiple distinct sublineages. Avian Diseases, 54:345-
349.
Armstrong, R.T., Kushnir, A. S., White, J. M. (2000). The
transmembrane domain of influenza hemagglutinin
References
99
exhibits a stringent length requirement to support the
hemifusion to fusion transition. Journal of Cell Biology,
151:425-437.
Beard, C. W., Schnitzlein, W. M., Tripathy, D. N. (1991).
Protection ofchickens against highly pathogenic avian
influenza virus (H5N2) by recombinant fowlpox viruses.
Avian Diseases, 35:356-359.
Belshe, R.B. (2005). The origins of pandemic influenza -lessons
from the 1918 virus. N Engl J Med., 353: 2209-11.
Bergmann, M., Garcia-Sastre, A., Carnero, E., Pehamberger,
H., Wolff, K., Palese, P., Muster, T., (2000). Influenza
virus NS1 protein counteracts PKR mediated inhibition of
replication. Journal of Virology, 74: 6203-6206.
Bornholdt, Z. A., Prasad, B., V. (2006). X-ray structure of
influenza virus NS1 effector domain. Nat Struct Mol Biol,
2006, 13: 559−560.
Bröjer, C., Ågren, E. O., Uhlhorn, H., Bernodt, K., Mörner,
T., Désirée, Jansson, S., Mattsson, R., Zohari, S.,
Thorén, P., Berg, M. and Gavier-Widén, D. (2009).
Pathology of Natural Highly Pathogenic Avian Influenza
H5N1 Infection in Wild Tufted Ducks (AythyaFuligula).
Journal of Veterinary Diagnostic Investigation, 21:579–
587.
Brown, E. G. (2000). Influenza virus genetics. Biomedecine &
Pharmacotherapy, 54:196-209.
References
100
Brown, J. D., Stallknecht, D. E., Beck, J. R., Suarez, D. L.
and Swayne, D. E. (2006). Susceptibility of North
American ducks and gulls to H5N1 highly pathogenic
avian influenza viruses. Emerging Infectious Diseases,
12: 1663-1670.
Brown, J. D., Stallknecht, D. E., Berghaus, R. D., & Swayne,
D. E. (2009). Infectious and lethal doses of H5N1 highly
pathogenic avian influenza virus for house sparrows
(Passer domesticus) and rock pigeons (Columbia livia).
Journal of veterinary diagnostic investigation, 21(4), 437-
445.
Bullido, R., Gomez-Puertas, P., Saiz, M. J., Portela, A.
(2001). Influenza A virus NEP (NS2 protein) down-
regulates RNA synthesis of model template RNAs. J
Virol 2001, 75: 4912−4917.
Burgui, I., Aragon, T., Ortin, J., Nieto, A. (2003). PABP1 and
eIF4GI associate with influenza virus NS1 protein in viral
mRNA translation initiation complexes. Journal of
General Virology, 2003, 84: 3263−3274.
Capua, I. and Alexander, D.J. (2004). Avian influenza: recent
developments. Avian Pathology, 33, 393–404.
Capua, I., Alexander, D.J., (2006). The challenge of avian
influenza to the veterinary community. Avian Pathology,
35, 189-205.
References
101
Capua, I., and Marangon, S. (2007). The challenge of
controlling notifiable avian influenza by means of
vaccination. Avian Diseases, 51:317-322.
Cattoli, G., Drago, A., Maniero, S., Toffan, A., Bertoli, E.,
Fassina, S., Terregino, C., Robbi, C., Vicenzoni, G.,
Capua, I. (2004). Comparison of three rapid detection
systems for type A influenza virus on tracheal swabs of
experimentally and naturally infected birds. Avian
Patholology, 33:432-437.
Centanni, E. and Savonuzzi, E. (1901). La peste aviaria I&II,
Communicazione fatta all’accademia delle scienze
mediche enaturali de Ferrara. Reported by Alexander,
D.J. and Brown, I.H. (2009). History of highly pathogenic
avian influenza. Rev. sci. tech. Off. int. Epiz., 28 (1), 19-
38.
Chamnanpood, C., Sanguansermsri, D., Pongcharoen, S., &
Sanguansermsri, P. (2011). Detection of distribution of
avian influenza H5N1 virus by immunohistochemistry,
chromogenic in situ hybridization and real-time PCR
techniques in experimentally infected chickens. Southeast
Asian Journal of Tropical Medicineand Public Health,
42(2), 303.
Charlton, B., Crossley, B., Hietala, S. (2009). Conventional
and future diagnostics for avian influenza. Comparative
Immunology & Microbiology Infection Diseases, 32:341-
350.
References
102
Chen, J., Lee, K. H., Steinhauer, D. A., Stevens, D. J., Skehel,
J. J., Wiley, D. C. (1998). Structure of the hemagglutinin
precursor cleavage site, a determinant of influenza
pathogenicity and the origin of the labile conformation.
Cell, 95:409-417.
Chen, W., Calvo, P. A., Malide, D., Gibbs, J., Schubert, U.,
Bacik, I., ... & Yewdell, J. W. (2001). A novel influenza
A virus mitochondrial protein that induces cell
death. Nature medicine, 7(12), 1306-1312.
Chen, Z., Li, Y., & Krug, R. M. (1999). Influenza A virus NS1
protein targetspoly (A)‐binding protein II of the cellular
3′‐end processing machinery. The EMBO journal, 18(8),
2273-2283.
Cheung, T. K. W. and Poon, L. L. M. (2008). Biology of
Influenza A Virus. Annals NY Acad Sci, 1102:1-25.
Cox, N. J., & Subbarao, K. (2000). Global epidemiology of
influenza: past and present. Annual review of
medicine, 51(1), 407-421.
Dankar, S. K., Wang, S., Ping, J., Forbes, N. E., Keleta, L.,
Li, Y., & Brown, E. G. (2011). Influenza A virus NS1
gene mutations F103L and M106I increase replication
and virulence. Virol J, 8(1), 13.
Donelan, N. R., Basler, C. F., Garcia-Sastre, A. (2003). A
recombinant influenza A virus expressing an RNA-
binding-defective NS1 protein induces high levels of beta
References
103
interferon and is attenuated in mice. J Virol 2003, 77:
13257−13266.
Ducatez, M. F., Olinger, C. M., Owoade, A. A., Tarnagda, Z.,
Tahita, M. C., Sow, A., De Landtsheer, S.,
Ammerlaan, W., Ouedraogo, J. B., Osterhaus, A.D.,
Fouchier, R. A., Muller, C. P. (2007). Molecular and
antigenic evolution and geographical spread of H5N1
highly pathogenic avian influenza viruses in western
Africa. J Gen Virol, 88:2297-2306.
Duvvuri, V. R., Duvvuri, B., Cuff, W. R., Wu, G. E., Wu, J.
(2009). Role of positive selection pressure on the
evolution of H5N1 hemagglutinin. Genomics Proteomics
Bioinformatics, 7:47-56.
Easterday, B.C; Hinshaw, V.S and Halvorson, D.A. (1997).
Avian influenza in diseases of poultry. (eds) Dis. Of
poultry, 10th ed. Iowa State University Press: Ames, 583-
605.
Efferson, C., Kawano, K., Sellappan, S., Yu, D., Babaian, R.,
Palese, P., ... & Murray, J. (2004). Prostate Tumor Cells
Infected with a Recombinant Influenza Virus with
Truncated NS1 Gene NS1 (1-126) Activate Cytolytic
CD8+ Cells Which Recognize Non-Infected
Tumors. Journal of Immunotherapy, 27(6), S53.
Elhafi, G., C. J. Naylor, C. E. Savage, and R. C. Jones,
(2004). Microwave or autoclave treatments destroy the
References
104
infectivity of infectious bronchitis virus and avian
Pneumovirus but allow detection by reverse transcriptase-
polymerase chain reaction. Avian Pathology, 33, 303–
306.
El-Zoghby, E. F., Aly, M. M., Nasef, S. A., Hassan, M. K.,
Arafa, A. S., Selim, A. A., ... & Hafez, H. M. (2013).
Surveillance on A/H5N1 virus in domestic poultry and
wild birds in Egypt. Virol J, 10, 203.
Enserink, M. (2006). H5N1 moves into Africa, European
Union, deepening global crisis. Science, 311: 932-932.
Erica Spackman (March 2005). Real-Time Reverse
Transcriptase-Polymerase Chain Reaction for the
Detection of Type A Influenza and the Avian H5 and H7
HA subtypes in tracheal and cloacal samples. Cepheid
Smart Cycler Protocol, USDA, National Veterinary
Science Laboratory.
Falcon, A. M., Fernandez-Sesma, A., Nakaya, Y., Moran, T.
M., Ortin, J., GarciaSastre, A. (2005). Attenuation and
immunogenicity in mice of temperature-sensitive
influenza viruses expressing truncated NS1 proteins. J
Gen Virol, 2005, 86: 2817−2821.
Falcón, A. M., Fernandez-Sesma, A., Nakaya, Y., Moran, T.
M., Ortín, J., & García-Sastre, A. (2005). Attenuation
and immunogenicity in mice of temperature-sensitive
References
105
influenza viruses expressing truncated NS1 proteins.
Journal of general virology, 86(10), 2817-2821.
Fasina, F. O., Bisschop, S. P. R., Joannis, T.M., Lombin, L.H.
and Abolnik, C. (2009). Molecular characterization and
epidemiology of the highly pathogenic avian influenza
H5N1 in Nigeria. Epidemiol. Infect, 137: 456–463.
Ferguson, N. M., Galvani, A. P., Bush, R. M. (2003).
Ecological and immunological determinants of influenza
evolution. Nature, 422:428-433.
Fouchier, R. A., Munster, V., Wallensten, A., Bestebroer, T.
N., Herfst, S., Smith, D., Rimmelzwaan, G. F., Olsen,
B., Osterhaus, A. D. (2005). Characterization of a novel
influenza A virus hemagglutinin subtype (H16) obtained
from black-headed gulls. J Virol, 79:2814-2822.
Garcia, M., Crawford, J. M., Latimer, J. W., Rivera-Cruz,
E., Perdue, M. L. (1996). Heterogeneity in the
haemagglutinin gene and emergence of the highly
pathogenic phenotype among recent H5N2 avian
influenza viruses from Mexico. J Gen Virol, 77:1493 -
1504.
Garcia-Sastre, A., Egorov, A., Matassov, D., Brandt, S.,
Levy, D.E., Durbin, J.E., Palese, P., Muster, T., (1998).
Influenza A virus lacking the NS1 gene replicates in
interferon-deficient systems. Virology, 252: 324-330.
References
106
Gardin, Y. (2007). Vaccination against H5N1 highly pathogenic
avian influenza: some questions to be addressed. In:
Proceedings of the 56th Western Poultry Diseases
Conference, Las Vegas, Nv, USA.
Garten, W. and Klenk, H. D. (1983). Characterization of the
carboxypeptidase involved in the proteolytic cleavage of
the influenza haemagglutinin. J Gen Virol, 64:2127-2137.
Goletic, T., Gagic, A., Rešidbegovic, E., Kustura, A.,
Kavazovic, A., Savic, V., ... & Prašovic, S. (2010).
Highly pathogenic avian influenza virus subtype H5N1 in
mute swans (Cygnus olor) in central Bosnia. Avian
diseases, 54(s1), 496-501.
Grund, C., Abdelwhab, E. S. M., Arafa, A. S., Ziller, M.,
Hassan, M. K., Aly, M. M., ... & Beer, M. (2011).
Highly pathogenic avian influenza virus H5N1 from
Egypt escapes vaccine-induced immunity but confers
clinical protection against a heterologous clade 2.2. 1
Egyptian isolate. Vaccine, 29(33), 5567-5573.
Günther-Ausborn, S., Schoen, P., Bartoldus, I., Wilschut, J.
and Stegmann, T. (2000). Role of Hemagglutinin
Surface Density in the Initial Stages of Influenza Virus
Fusion: Lack of Evidence for Cooperativity. Journal of
Virology, 74(6): 2714–2720.
Hafez, H. M. (2008). Respiratory diseases of poultry:diagnosis
and control. In: Proceedings of the 8th Scientific
References
107
Conference of the Egyptian Veterinary Poultry
Association, Cairo, pp 174–186.
Hafez, M. H., Arafa, A., Abdelwhab, E. M., Selim, A.,
Khoulosy, S. G., Hassan, M. K., Aly, M. M. (2010).
Avian influenza H5N1 infections in vaccinated
commercial poultry and backyard birds in Egypt. Poultry
Science, 89:1609-1613.
Halvorson, D. A. (2002). The control ofH5 or H7 mildly
pathogenic avian influenza: a role for inactivated vaccine.
Avian Pathol, 31:5-12.
Hatada, E., Saito, S., Fukuda, R. (1999). Mutant influenza
viruses with a defective NS1protein cannot block the
activation of PKR in infected cells. J Virol, 1999, 73:
2425−2433.
Hirst, G. K. (1941). The agglutination of red cells by allantoic
fluid of chick embryos infected with influenza virus.
Science, 94, 22-23.
Hoffmann, E., Stech, J., Guan, Y., Webster, R. G., & Perez,
D. R. (2001). Universal primer set for the full-length
amplification of all influenza A viruses. Archives of
virology, 146(12), 2275-2289.
House, C., House, J. A., & Yedloutschnig, R. J. (1990).
Inactivation of viral agents in bovine serum by gamma
irradiation. Canadian journal of microbiology, 36(10),
737-740.
References
108
Hussein, H.A., Sultan, H.A., El-Deeb, A.H. and EL-Sanousi,
A.A. (2009). Possible Causes of Re- Emerging outbreaks
of H5N1 Avian Influenza Virus in Vaccinated Chickens in
Sharkia Governorate in Egypt. International Journal of
Virology, 5 (1): 36-43.
Irvine, R. M., Banks, J., Londt, B. Z., Lister, S. A., Manvell,
R. J., Outtrim, L., ... & Brown, I. H. (2007). Outbreak
of highly pathogenic avian influenza caused by Asian
lineage H5N1 virus in turkeys in Great Britain in January
2007.Veterinary record, 161(3), 100-101.
Iwatsuki-Horimoto, K., Horimoto, T., Fujii, Y., & Kawaoka,
Y. (2004). Generation of influenza A virus NS2 (NEP)
mutants with an altered nuclear export signal
sequence. Journal of virology, 78(18), 10149-10155.
Kaverin, N. V., Rudneva, I. A., Govorkova, E. A.,
Timofeeva, T. A., Shilov, A. A., Kochergin-Nikitsky,
K. S., Krylov, P. S., Webster, R. G. (2007). Epitope
mapping of the hemagglutinin molecule of a highly
pathogenic H5N1 influenza virus by using monoclonal
antibodies. J Virol, 81:12911-12917.
Keawcharoen, J., Van Riel, D., van Amerongen, G.,
Bestebroer, T., Beyer, W. E., Van Lavieren, R., ... &
Kuiken, T. (2008). Wild ducks as long-distance vectors
of highly pathogenic avian influenza virus
(H5N1). Emerging infectious diseases, 14(4), 600.
References
109
Key, M. (2006). Immunohistochemistry Staining Methods.
Education Guide Immunohistochemical Staining Methods
Fourth Edition, 47.
Kimura, M. (1980). A simple method for estimating
evolutionary rates of base substitutions through
comparative studies of nucleotide sequences. Journal of
molecular evolution, 16(2), 111-120.
Klenk, H. D. and Garten, W. (1994). Host cell proteases
controlling virus pathogenicity. Trends Microbiol, 2:39-
43.
Krug, R. M., Yuan, W., Noah, D. L., Latham, A. G. (2003).
Intracellular warfare between human influenza viruses
and human cells: The roles of the viral NS1 protein.
Virology 2003, 309: 181−189.
Kuiken, T., van den Brand, J., van Riel, D., Pantin-
Jackwood, M. and Swayne, D. E. (2010). Comparative
pathology of select agent influenza a virus infections. Vet
Pathology, 47(5):893-914.
Lee, C. W. and Suarez, D. L. (2004). Application of real time
RT-PCR for the quantification and competitive replication
study of H5&H7 subtype avian influenza virus. Journal of
Virological Methods, 119: 151-158.
Lee, C. W., Senne, D. A., Suarez, D. L. (2004). Effect of
vaccine use in the evolution of Mexican lineage H5N2
avian virus. J Virol, 78:8372-8331.
References
110
Lee, C., Suarez, D. L., Tumpey, T. M., Sung, H., Kwon, Y.,
Lee, Y., Choi, J., Joh, S., Kim, M., Lee, E., Park, J.,
Lu, X., Katz, J. M., Spackman, E., Swayne, D. E. and
Kim, J. (2005). Characterization of Highly Pathogenic
H5N1 Avian Influenza A Viruses Isolated from South
Korea. Journal of virology, 79(6): 3692–3702.
Li, S., Min, J. Y., Krug, R. M., Sen, G. C. (2006). Binding of
the influenza A virus NS1 protein to PKR mediates the
inhibition of its activation by either PACT or double-
stranded RNA. Virology 2006, 349: 13−21.
Li, W. X., Li, H., Lu, R., Li, F., Dus, M., Atkinson, P., ... &
Ding, S. W. (2004). Interferon antagonist proteins of
influenza and vaccinia viruses are suppressors of RNA
silencing. Proceedings of the National Academy of
Sciences of the United States of America, 101(5), 1350-
1355.
Ligon, B. L. (2005). Avian influenza virus H5N1: a review of its
history and information regarding its potential to cause
the next pandemic. In Seminars in Pediatric Infectious
Diseases (Vol. 16, No. 4, pp. 326-335). WB Saunders.
Lin, D., Lan, J., & Zhang, Z. (2007). Structure and function of
the NS1 protein of influenza A virus. Acta biochimica et
biophysica Sinica, 39(3), 155-162.
Liu, N. Q., Lossinsky, A. S., Popik, W., Li, X., Gujuluva, C.,
Kriederman, B., ... & Fiala, M. (2002). Human
immunodeficiency virus type 1 enters brain microvascular
References
111
endothelia by macropinocytosis dependent on lipid rafts
and the mitogen-activated protein kinase signaling
pathway. Journal of virology, 76(13), 6689-6700.
Lossinsky, A. S., & Shivers, R. R. (2004). Structural pathways
for macromolecular and cellular transport across the
blood-brain barrier during inflammatory conditions.
Review. Histology and histopathology, 19(2), 535-564.
Lu, G., Rowley, T., Garten, R., & Donis, R. O. (2007).
FluGenome: a web tool for genotyping influenza A
virus. Nucleic acids research, 35(suppl 2), W275-W279.
Lu, Y., Wambach, M., Katze, M. G., Krug, R. M. (1995).
Binding of the influenza virus NS1 protein to double-
stranded RNA inhibits the activation of the protein kinase
that phosphorylates the elF-2 translation initiation factor.
Virology 1995, 214: 222−228.
Majde, J. A., Bohnet, S. G., Ellis, G. A., Churchill, L., Leyva-
Grado, V., Wu, M., ... & Krueger, J. M. (2007).
Detection of mouse-adapted human influenza virus in the
olfactory bulbs of mice within hours after intranasal
infection.Journal of neurovirology, 13(5), 399-409.
Maris, P. (1990). Efficacite´ virucide de huit de´sinfectants
contre le pneumovirus, coronavirus et parvovirus. Ann.
Rech. Vet., 21, 275–279.
Matsuda, K., Park, C. H., Sunden, Y., Kimura, T., Ochiai,
K., Kida, H., & Umemura, T. (2004). The vagus nerve
References
112
is one route of transneural invasion for intranasally
inoculated influenza A virus in mice. Veterinary
Pathology Online,41(2), 101-107.
Meleigy, M. (2007). Egypt battles with avian influenza. Lancet,
370:553-554.
Min, J. Y., Krug, R. M. (2006). The primary function of RNA
binding by the influenza A virus NS1 protein in infected
cells: Inhibiting the 2'−5'oligo (A) synthetase/ RNase L
pathway. Proc Natl Acad Sci USA 2006, 103: 7100−7105.
Moresco, K. A., Stallknecht, D. E., Swayne, D. E. (2010).
Evaluation and attempted optimization of avian embryos
and cell culture methods for efficient isolation and
propagation of low pathogenicity avian influenza viruses.
Avian Dis, 54:622-626.
Mori, I., Komatsu, T., Takeuchi, K., Nakakuki, K., Sudo, M.,
& Kimura, Y. (1995). Viremia induced by influenza
virus. Microbial pathogenesis, 19(4), 237-244.
Munch, M., Nielsen, L. P., Handberg, K. J., Jørgensen, P. H.
(2001). Detection and subtyping (H5 and H7) of avian
type A influenza virus by reverse transcription-PCR and
PCR-ELISA. Arch Virol, 146:87-97.
Muramoto, Y., Noda, T., Kawakami, E., Akkina, R., &
Kawaoka, Y. (2013). Identification of novel influenza A
virus proteins translated from PA mRNA. Journal of
virology, 87(5), 2455-2462.
References
113
Murphy, F. A., Gibbs, E. P. J., Horzinek, M. C. and
Studdert, M. J. (1999).Veterinary Virology, 3rd edition.
Academic Press, 459-468.
Neumann, G., Macken, C. A., Karasin, A. I., Fouchier, R. A.,
& Kawaoka, Y. (2012). Egyptian H5N1 Influenza
Viruses—Cause for Concern?. PLoS pathogens, 8(11),
e1002932.
Njouom, R., Aubin, J. T., Bella, A. L., Demsa, B. M.,
Rouquet, P., Gake, B., ... & Rousset, D. (2008). Highly
pathogenic avian influenza virus subtype H5N1 in ducks
in the Northern part of Cameroon. Veterinary
Microbiology, 130(3), 380-384.
Noah, D. L., Twu, K. Y., Krug, R. M. (2003). Cellular antiviral
responses against influenza A virus are countered at the
posttranscriptional level by the viral NS1A protein via its
binding to a cellular protein required for the 3'end
processing of cellular pre-mRNAs. Virology 2003, 307:
386−395.
NOLL, H., & Youngner, J. S. (1959). Virus-lipid interactions.
II. The mechanism of adsorption of lipophilic viruses to
water-insoluble polar lipids. Virology, 8(3), 319-343.
Nuovo, G. J. (2006). The surgical and cytopathology of viral
infections: utility of immunohistochemistry, in situ
hybridization, and in situ polymerase chain reaction
amplification. Annals of diagnostic pathology, 10(2), 117-
131.
References
114
Obenauer, J. C., Denson, J., Mehta, P. K., Su, X., Mukatira,
S., Finkelstein, D. B., ... & Naeve, C. W. (2006). Large-
scale sequence analysis of avian influenza isolates.
Science, 311(5767), 1576-1580.
OIE (2005). OIE manual of diagnostic tests and vaccines for
terrestrial animals. Chapter, 2, 12.
OIE (2008). Update on highly pathogenic avian influenza in
animals (type H5 and H7).
OIE (2009). Office International des Epizoties.Chapter 2.3.4.
Avian Influenza. Manual of Diagnostic Tests and
Vaccines for Terrestrial Animals. http: //www. oie. int/
fileadmin/ Home/ eng/ Health_standards/tahm
2.03.04_AI.pdf. (Accessed 7th July 2011).
Olander, H. J., Brown, C. C. and Senne, D. (1991).
Immunohistochemical demonstration of the distribution
of avian influenza virus subtype H5N2 in mature chickens
after experimental exposure. Proceeding Annual Meeting
Am. Coll. Veterinary Pathology, 42: 19.
Pantin-Jackwood, M. J., & Swayne, D. E. (2009).
Pathogenesis and pathobiology of avian influenza virus
infection in birds. Revue scientifique et technique
(International Office of Epizootics), 28(1), 113-136.
Parrish, C. R. and Kawaoka, Y. (2005). The origins ofnew
pandemic viruses: the acquisition of new host ranges by
References
115
canine parvovirus and influenza A viruses. Annu Rev
Microbiol, 59:553-586.
Pearson, J. E. (2003). International standards for the control of
avian influenza. Avian Dis, 47:972-975.
Peiris, J.S.M., de Jong, M.D., Guan, Y., (2007). Avian
influenza virus (H5N1): a threat to human health. Clin.
Microbiol. Rev., 20, 243–267.
Perdue, M. L. and Swayne, D. E. (2005). Public healthrisk
from avian influenza viruses. Avian Dis, 49:317-327.
Perroncito, E. (1878). Epizoozia tifoide neigalliancei. Annali
della Academia d'agricoltora di Torino 21, 87-126.
Petersen, H., Wang, Z., Lenz, E., Pleschka, S., &
Rautenschlein, S. (2013). Reassortment of NS segments
modifies highly pathogenic avian influenza virus
interaction with avian hosts and host cells. Journal of
virology, 87(10), 5362-5371.
Peyre, M., Samaha, H., Makonnen, Y. J., Saad, A., Abd-
Elnabi, A., Galal, S., Ettel, T., Dauphin, G., Lubroth,
J., Roger, F., Domenech, J. (2009). Avian influenza
vaccination in Egypt: Limitations of the current strategy.
J Mol Genet Med, 3:198-204.
Pfeiffer, J., Pantin-Jackwood, M., To, T. L., Nguyen, T., &
Suarez, D. L. (2009). Phylogenetic and biological
characterization of highly pathogenic H5N1 avian
References
116
influenza viruses (Vietnam 2005) in chickens and
ducks. Virus research,142(1), 108-120.
Philippa, J., Baas, C., Beyer, W., Bestebroer, T., Fouchier,
R., Smith, D., Schaftenaar, W., Osterhaus, A. (2007).
Vaccination against highly pathogenic avian influenza
H5N1 virus in zoos using an adjuvanted inactivated H5N2
vaccine. Vaccine, 25:3800-3808.
Pinto, L. H. and Lamb, R. A. (2007). Controlling influenza
virus replication by inhibiting its proton channel.
Molecular Biosystems, 3: 18–23.
Puri, A., F. P. Booy, R. W. Doms, J. M. White, and R.
Blumenthal, (1990). Conformational changes and fusion
activity of influenza virus haemagglutinin of the H2 and
H3 subtypes: effects of acid pre-treatment. J. Virol., 8,
3824– 3832.
Qian, X. Y., Chien, C. Y., Lu, Y., Montelione, G. T., Krug, R.
M. (1995). An amino-terminal polypeptide fragment of
the influenza virus NS1 protein possesses specific RNA-
binding activity and largely helical backbone structure.
RNA, 1995, 1: 948−956.
Rogers, G. N. and Paulson, J. C. (1983). Receptor determinants
of human and animal influenza virus isolates: differences
in receptor specificity of the H3 hemagglutinin based on
species of origin. Virology, 127: 361-373.
References
117
Rules, I. I. T. (1969). A one letter notation for amino acid
sequence. Biochem. J, 113, 1-4.
Saif, Y. M., Barnes, H. J., Fadly, A. M., Glisson, J. R.,
McDougald, L. R. and Swayne, D. E. (2008). Influenza
in DISEASES OF POULTRY, 12th ed. D.E. Swayne and
D. A. Halvorson, eds. Black Well Publishing, 153-184.
Salzberg, S. L., Kingsford, C., Cattoli, G., Spiro, D. J.,
Janies, D. A., Aly, M. M., ... & Capua, I. (2007).
Genome analysis linking recent European and African
influenza (H5N1) viruses. Emerging infectious
diseases, 13(5), 713.
Schafer, W. (1955). Vergleichende sero-immunologische
untersuchungen uber die viren der influenza unf
klassichen geflugelpest. Z Naturforsch 10B, 81-91.
Seo, S. H., Hoffmann, E., & Webster, R. G. (2002). Lethal
H5N1 influenza viruses escape host anti-viral cytokine
responses. Nature medicine, 8(9), 950-954.
Shi, W., Lei, F., Zhu, C., Sievers, F., Higgins, D. G. (2010). A
complete analysis of HA and NA genes of influenza A
viruses. PLoS One, 5(12):e14454.
Slemons, R. D. and Swayne, D. E. (1990). Experimental
evidence for kidney tropism properties among waterfowl-
origin avian influenza viruses. Proceeding American
Veterinary Medical Association, 127: 107.
References
118
Smith, W., Andrewes, C. H., and Laidlaw, P. P. (1933). A
virus obtained from influenza patients. Lancet II, 66-68.
Spackman, E., and Suarez, D. L. (2008). Detection and
Identification of the H5 Hemagglutinin Subtype by Real-
Time RT-PCR. In E. Spackman (Ed.). Avian Influenza
Virus. 1st edn. Humana Press, Totowa, NJ. pp. 27 33.
Spackman, E., Senne, D. A., Myers, T. J., Bulaga, L. L.,
Garber, L. P., Perdue, M. L., ... & Suarez, D. L.
(2002). Development of a real-time reverse transcriptase
PCR assay for type A influenza virus and the avian H5
and H7 hemagglutinin subtypes. Journal of clinical
microbiology, 40(9), 3256-3260.
Spickler, A. R., Trampel, D. W. & Roth, J. A. (2008). The
onset of virus shedding and clinical signs in chickens
infected with high-pathogenicity and low-pathogenicity
avian influenza viruses. Avian Pathol, 37, 555–577.
Stasakova, J., Ferko, B., Kittel, C., Sereinig, S., Romanova,
J., Katinger, H., Egorov, A. (2005). Influenza A mutant
viruses with altered NS1 protein function provoke
caspase-1 activation in primary human macrophages,
resulting in fast apoptosis and release of high levels of
interleukins 1βand 18. J Gen Virol 2005, 86: 185−195.
Steinhauer, D. A. (1999). Role of hemagglutinin cleavage for
the pathogenicity of influenza virus. Virology, 258(1): 1-
20.
References
119
Stevens, J., Blixt, O., Paulson, J. C., Wilson, I. A. (2006).
Glycan microarray technologies: tools to survey host
specificity of influenza viruses. Nat Rev Microbiol, 4:857-
864.
Suarez, D. L. (2008). Influenza A virus. In: Swayne, D.E. (Ed.).
Avian influenza virus. Ames, IA: Blackwell. pp. 3-22.
Suarez, D. L., & Schultz-Cherry, S. (2000). Immunology of
avian influenza virus: a review. Developmental &
Comparative Immunology.
Swayne, D. E. (2007). Understanding the complex pathobiology
of high pathogenicity avian influenza viruses in birds.
Avian Dis, 51, 242–249.
Swayne, D. E. (2009). Avian influenza vaccines and therapies
for poultry. Comp Immunol Microbiol Infect Dis, 32:351-
363.
Swayne, D. E. and Slemons, R. D. (1994). Comparative
Pathology of a Chicken-origin and Two Duck-origin
Influenza Virus Isolates in Chickens: The Effect of Route
of Inoculation. Veterinary Pathology, 31: 237-245.
Swayne, D. E., (2006). Microassay for measuring thermal
inactivation of H5N1 high pathogenicity avian influenza
virus in naturally infected chicken meat. Int. J. Food.
Microbiol., 108, 268–271.
References
120
Taha, S.H., Mehrez, M.A., Sitohy, M.Z., Abou Dawood,
A.G.I., Abd-El Hamid, M.M. and Kilany, W.H. (2010).
Effectiveness of esterified whey proteins fractions against
Egyptian Lethal Avian Influenza A (H5N1). Virology
Journal, vol. 7, p. 330.
Tanaka, H., Park, C. H., Ninomiya, A., Ozaki, H., Takada,
A., Umemura, T., & Kida, H. (2003). Neurotropism of
the 1997 Hong Kong H5N1 influenza virus in
mice. Veterinary microbiology, 95(1), 1-13.
Tang, Y., Wu, P., Peng, D., Wang, X., Wan, H., Zhang, P., ...
& Liu, X. (2009). Characterization of duck H5N1
influenza viruses with differing pathogenicity in mallard
(Anas platyrhynchos) ducks. Avian Pathology, 38(6),
457-467.
Tian, G., Zeng, X., Li, Y., Shi, J. and Chen, H. (2010).
Protective Efficacy of the H5 Inactivated Vaccine against
Different Highly Pathogenic H5N1 Avian Influenza
Viruses Isolated in China and Vietnam. Avian Diseases,
54(s1):287-289.
Tong, S., Li, Y., Rivailler, P., Conrardy, C., Castillo, D. A.
A., Chen, L. M., ... & Donis, R. O. (2012). A distinct
lineage of influenza A virus from bats. Proceedings of the
National Academy of Sciences, 109(11), 4269-4274.
Tong, S., Zhu, X., Li, Y., Shi, M., Zhang, J., Bourgeois, M., ...
& Donis, R. O. (2013). New world bats harbor diverse
influenza a viruses. PLoS pathogens, 9(10), e1003657.
References
121
Tsukamoto, K., Ashizawa, T., Nakanishi, K., Kaji, N.,
Suzuki, K., Shishido, M., ... & Mase, M. (2009). Use of
reverse transcriptase PCR to subtype N1 to N9
neuraminidase genes of avian influenza viruses. Journal
of clinical microbiology, 47(7), 2301-2303.
Tsukamoto, K., Noguchi, D., Suzuki, K., Shishido, M.,
Ashizawa, T., Kim, M. C., Lee, Y. J., Tada, T. (2010).
Broad detection of diverse H5 and H7 hemagglutinin
genes of avian influenza viruses by real-time reverse
transcription-PCR using primer and probe sets containing
mixed bases. Journal of Clinical Microbiology, 48:4275-
4278.
Twu, K. Y., Noah, D. L., Rao, P., Kuo, R. L., Krug, R. M.
(2006). The CPSF30 binding site on the NS1A protein of
influenza A virus is a potential antiviral target. J Virol
2006, 80: 3957−3965.
Van Campen, H., Easterday, B. C. and Hinshaw, V. S.
(1989). Destruction of lymphocytes by a virulent avian
influenza A virus. Journal of General Virology, 70: 467-
472.
Van der Goot, J. A., Van Boven, M., de Jong, M. C. M., &
Koch, G. (2007). Effect of vaccination on transmission of
HPAI H5N1: the effect of a single vaccination dose on
transmission of highly pathogenic avian influenza H5N1
in Peking ducks. Avian diseases, 51(s1), 323-324.
References
122
Van Riel, D., Van Den Brand, J. M. A., Munster, V. J.,
Besteboer, T. M., Fouchier, R. A. M., Osterhaus, A. D.
M. E., & Kuiken, T. (2009). Pathology and virus
distribution in chickens naturally infected with highly
pathogenic avian influenza A virus (H7N7) during the
2003 outbreak in The Netherlands. Veterinary Pathology
Online, 46(5), 971-976.
Vascellari, M., Granato, A., Trevisan, L., Basilicata, L.,
Toffan, A., Milani, A. and Mutinelli, F. (2007).
Pathologic findings of highly pathogenic avian influenza
virus A/duck/Vietnam/12/05 (H5N1) in experimentally
infected Pekin ducks, based on immunohistochemistry
and in situ hybridization. Veterinary Pathology, 44,
635_642.
Verma, S., Lo, Y., Chapagain, M., Lum, S., Kumar, M.,
Gurjav, U., ... & Nerurkar, V. R. (2009). West Nile
virus infection modulates human brain microvascular
endothelial cells tight junction proteins and cell adhesion
molecules: Transmigration across the< i> in vitro</i>
blood-brain barrier.Virology, 385(2), 425-433.
Wang, W. E. I. R. O. N. G., Riedel, K. E. L. L. Y., Lynch, P.
A. T. R. I. C. I. A., Chien, C. Y., Montelione, G. T., &
Krug, R. M. (1999). RNA binding by the novel helical
domain of the influenza virus NS1 protein requires its
dimer structure and a small number of specific basic
amino acids. Rna, 5(2), 195-205.
References
123
Wang, X., Basler, C. F., Williams, B. R., Silverman, R. H.,
Palese, P., Garcia-Sastre, A. (2002). Functional
replacement of the carboxy-terminal two-thirds of the
influenza A virus NS1 protein with short heterologous
dimerization domains. J Virol 2002, 76: 12951−12962.
Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A.
A., Garcia-Sastre, A. (2000). Influenza A virus NS1
protein prevents activation of NF-κB and induction of
alpha/beta interferon. J Virol 2000, 74: 11566−11573.
Wasilenko, J. L., Arafa, A. M., Selim, A. A., Hassan, M. K.,
Aly, M. M., Ali, A., ... & Pantin-Jackwood, M. J.
(2011). Pathogenicity of two Egyptian H5N1 highly
pathogenic avian influenza viruses in domestic
ducks. Archives of virology, 156(1), 37-51.
Webster, R. G., Bean, W. J., Gorman, O. T., Chambers, T.
M., & Kawaoka, Y. (1992). Evolution and ecology of
influenza A viruses. Microbiological reviews, 56(1), 152-
179.
WHO (2005). Avian influenza (“bird flu”) and the significance
of transmission to humans. Available at: http:// www.
who. int/ mediacentre/ factsheets avian_influenza/en.
WHO (2005). Avian influenza: assessing the pandemic
threat.WHO/CDS/2005.29.
WHO (2011a). World Health Organization. Antigenicand
genetic characteristics of influenza A (H5N1) and
References
124
influenza A(H9N2) viruses for the development of
candidate vaccine viruses for pandemic preparedness.
http:// www. who. int/ csr/ disease/ avian_influenza/
guidelines h5n1 virus/en/index.html (accessed 6th July
2011).
WHO (2011b). World Health Organization. Situation updates—
avian influenzahttp: //www. who.int/csr/ disease/ avian_
influenza / updates/en/index.html (accessed 6 th July
2011).
WHO/OIE/FAO (2009). World Health Organization/World
Organization for Animal Health/Food and Agriculture
Organization H5N1 Evolution Working Group.
Continuing progress towards a unified nomenclature for
the highly pathogenic H5N1 avian influenza viruses:
divergence of clade 2.2 viruses. Influenza Other Respi
Viruses 3:59-62.
Woolcock, P. R. (2008). Avian influenza virus isolation and
propagation in chicken eggs. In E. Spackman (Ed.). Avian
Influenza Virus. 1st edn. Humana Press, Totowa, NJ. pp.
35-46.
Zhao, Y., Lu, M., Lau, L. T., Lu, J., Gao, Z., Liu, J., ... & Gu,
J. (2008). Neutrophils may be a vehicle for viral
replication and dissemination in human H5N1 avian
influenza. Clinical infectious diseases, 47(12), 1575-
1578.
148
VITA
125
VITA
The author was born on June 1987 in Abou-Hammad –
Sharkia - Egypt.
His primary education was completed in El-Gamhouriya
Primary School and graduated in 1998.
His preparatory education was completed in El-Sadat
Preparatory School for boys and graduated in 2001.
His secondary education was completed in Abou-Hammad
secondary School for boys and graduated in 2004.
His undergraduate professional education was completed in
the college of Veterinary Medicine, Zagazig University from
which he received Bachelor Degree of Veterinary Medical
Sciences (BVSc) on 2009 with grade Very Good.
He worked as a teaching assistant at the Department of
Virology, Faculty of Veterinary Medicine, Zagazig University
in 2010.
He received a Post Graduate Diploma of Microbiology on
December 2011.
He has been registered for the degree of Master of Veterinary
Medical Sciences (Virology) since March 2012.
He worked as a Visiting Scholar in Veterinary & Biomedical
Sciences Department, College of Veterinary Medicine,
University of Minnesota, USA, from May, 2013 till
November, 2013.
نبذه عن حياه الباحث
نبذة عن حياة الباحث
محافظة الشرقية -مدينة أبوحماد -1987الباحث من مواليد يونيه–
جمهورية مصر العربية.
حصل الباحث على الشهادة االبتدائية من مدرسة الجمهورية االبتدائية عام
1998.
حصل الباحث على الشهادة االعدادية من مدرسة السادات االعدادية بنين
.2001عام
ل الباحث على شهادة الثانوية العامة من مدرسة أبوحماد الثانوية بنين حص
.2004عام
أتم الباحث شهادته الجامعية في كلية الطب البيطرى جامعة الزقازيق
بتقدير عام 2009وحصل على بكالوريوس العلوم الطبية البيطرية عام
جيد جدا.
جامعة -الطب البيطرى كلية -كلف الباحث للعمل كمعيد بقسم الفيرولوجيا
.2010الزقازيق عام
حصل الباحث على دبلوم الدراسات العليا فى تخصص الميكروبيولوجيا فى
.2011ديسمبر
سجل الباحث للحصول على درجة الماجستير فى العلوم الطبية البيطرية
.2012)تخصص الفيرولوجيا( في مارس
المتحدة األمريكية ابتداء عمل كباحث زائر في جامعة مينيسوتا بالواليات
. 2013حتى سبتمبر 2013من مايو
نبذه عن حياه الباحث
ARABIC SUMMARY
1
الملخص العربىمستوطنا فى H5N1لقد أصبح فيروس انفلونزا الطيور عالى الضراوة
وأثار اهتماما مؤخرا الحتمال تحوره وانتقاله 2006جمهورية مصر العربية منذ عام وس انفلونزا الطيور عالى الضراوة بين البشر. لقد تم قبل ذلك توصيف العدوى بفير
H5N1 فى الطيور المصابة تجريبيا. على أى حال, القدرة االمراضية لفيروسانفلونزا الطيور عالى الضراوة المعزول من مصر, لم يتم توصيفها قبل ذلك فى الدجاج والبط المصابة طبيعيا والتى من الممكن أن تصبح فريدة نظرا الختالف طرق
رعة العدوى. فى هذه الدراسة قمنا بعزل وتعريف وتوصيف فيروس االصابة وجانفلونزا الطيور عالى الضراوة والذى ظهر فى قطعان الدجاج التجارية المحصن مرة واحدة اومرتين والبط المتسأنس والغير محصن. األعراض األساسية التى ظهرت على
العرف والداليات وتجمع الدجاج التجارى كانت تبقع دموى على االرجل وزرقان فى مائى تحت الجلد فى منطقة الرأس والرقبة بينما التى ظهرت على البط المستأنس
-48كانت أعراض عصبية خاصة التفاف الرقبة. أثناء تجميع العينات وفى خالل فى قطعان % 30 – 22.8ساعة بعد ظهور المرض, وصلت نسبة النفوق الى 72
فى قطعان % 40 – 28.5واحدة بينما وصلت الى الدجاج التجارى المحصن مرة البط المتسأنس والغير محصن. تم تجميع عينات االنسجة من الدجاج والبط لعمل اختبارات المناعة الكيميائية للنسيج وتفاعل البلمرة المتسلسل الكمى المسبوق بانزيم
تعقب النسخ العكسى الختبار كمية الحامض النووى الفيروسى فى النسيج. تم الحامض النووى الفيروسى فى جميع أنسجة دجاج التسمين والبياض تقريبا شاملة أنسجة الخصية على عكس نظيرتها فى البط والتى لم تحتوى على الحامض النووى الفيروسى فيما عدا أنسجة القصبة الهوائية والرئتين والكبد والتى كانت على أى حال
لفة. ظهرت أعلى مستويات من الحامض النووى أقل مستوى من الدجاج وبأهمية مختالفيروسى فى الدجاج فى أنسجة المخ والقصبة الهوائية والدم مع وجودأهمية مختلفة
2
ما بين قطعان التسمين والبياض فى نسبة الحامض النووى فى هذه االنسجة خاصة.. ما يوضح بينما تم تعقب الحامض النووى الفيروسى تقريبا فى كل االنسجة والدم م
التكاثر الفيروسى الشامل فى كل األانسجة والدم فانه أيضا تم تعقب األنتجين الفيروسى بكثرة فى كل االنسجة متضمنة النسيج الخصوى وفى مالحظة مثيرة لالهتمام فانه تم تعقب األنتجين الفيروسى فى الخاليا المبطنة لجدار األاوعية الدموية
قصبة الهوائية والمخ وكذلك أيضا تم تعقبه فى ألغلب األنسجة خاصة أنسجة ال الخاليا البالعة أحادية النواة فى معظم األنسجة خاصة النسيج الرئوى.
Hوفى هذه الدراسة أيضا قمنا بمقارنة التتابع الوراثى للبروتين السطحى ما بين الفيروسات المعزولة فى هذه الدراسة NS1والبروتين الغير هيكلي األول
الدائرة فى مصر االن وفى H5N1وسات انفلونزا الطيور عالية الضراوة وفير الماضى باالضافة الى بعض السالالت المستخدمة فى التحصينات التجارية فى
Hمصر. اضافة التحليل المطروح لألحماض األامينية أظهر ان البروتين السطحىالطيور عالية الضراوة يحتوى على البصمات الجزيئية الخاصة بفيروسات انفلونزا
والتى تشمل العديد من األحماض األمينية األساسية فى موقع االنشطار بينما أيضا هذه البصمات الجزيئية والتى يحمل NS1البروتين الغير هيكلى االول
, الذراع الكاربوكسيلى النهاية 92فى الموقع Glutamateتشمل الحامض االمينى E-S-E-V عند اخذ كل هذه 84-80ينية المزالة فى الموقع و األحماض األم .
المعلومات معا فان هذه الدراسة تعد االولى عن توصيف القدرة االمراضية لفيروس فى الطيور المصابة طبيعيا مما يوفر فهم H5N1انفلونزا الطيور عالى الضراوة
لفيروس. فريد للمسار المرضى الفيروسى فى قطعان الدجاج والبط المصابة بهذا ا
3
االستنتاج وفى النهاية فان هذه الدراسة استنتجت التالى:
اوال: ان الوباء الذى ظهر فى قطعان الدجاج التجارية والبط المستأنس فى عام فى جمهورية مصر العربية كان بسبب العدوى بفيروس انفلونزا الطيور 2013
. H5N1عالى الضراوة عند موقع Hالسطحي ليل األحماض األمينية للبروتينثانيا: أن التحليل الجزيئى وتح
االنشطار والبروتين الغير هيكلي للمعزوالت الفيروسية فى هذه الدراسة أوضح انها تحمل البصمات الجزيئية لفيروسات انفونزا الطيور عالية الضراوة مما يؤكد بما ال يدع مجاال للشك أن هذه المرضية التى ظهرت على الطيور كانت بسبب فيروس انفلونزا الطيور عالى الضراوة وليس منخفض الضراوة.
فى موقع (R325K)باالضافة الى ذلك أوضحت وجود طفرة احاللية فى أحد الفيروسات المعزولة من قطعان Hاالنشطارفى البروتين السطحى
والتى تختلف عن , (5J)وأن هذه البروتين ينتمى للعائلة , التسمين التجاريةئالت التى تنتمى لها بعض السالالت المستخدمة فى التحصينات التجارية العا
هذه االونة فى مصر.. ثالثا: أن التحليل الجزيئى وتحليل األحماض األمينية للبروتين الغير هيكلي للمعزوالت الفيروسية فى هذه الدراسة أوضح انها تحمل البصمات الجزيئية لفيروسات
ضراوة. كما أوضح أن هذا البروتين الغير هيكلى ينتمى انفونزا الطيور عالية البدون أى احتمال لوجود خلط جزيئى بين فيروس االنفلونزا من NS1Eللعائلة
واى أنواع أخرى والتى تعتبر مستوطنة االن فى مصر. كما H5N1النوعاستنتجت أيضا ان األحماض األمينية للبروتينات الغير هيكلية األول والثانى
تظهر اى تطور جزيئى شامال احالل, ازالة او اضافة. لم
4
والمستوطن حاليا فى H5N1رابعا: أن فيروس انفلونزا الطيور عالى الضرواة مصر يتكاثروينتشر تقريبا فى جميع أنسجة قطعان الدجاج التسمين والبياض التجارية على عكس طبيعة تكاثره وانتشاره فى قطعان البط المستأنس وذلك
ستخدام اختبارات المناعة الكيمائية للنسيج وتفاعل انزيم البلمرة المتسلسل باالكمى المسبوق بانزيم النسخ العكسى. كما اوضحت ايضا ان الفيروس يوجد بشكل حاسم فى الخاليا المبطنة لجدار االوعية الدموية لمعظم االنسجة
احادية النواة لمعظم خاصة نسيجا القصبة الهوائية والمخ وأيضا الخاليا البالعةاألانسجة خاصة النسيج الرئوى باالضافة الى تتبع الفيروس فى نسيج الخصية. وجود األنتيجن الفيروسى بشكل حاسم فى الخاليا المبطنة لجداراألوعية الدموية والخاليا البالعة أحادية النواة يوضح احتمالية انتشار
يا. عالوة على ذلك فان الفيروس فى جميع األنسجة عن طريق هذه الخالوجود األنتجين الفيروسى فى أنسجة المخ والخاليا العصبية يوضح أن مرضية أنسجة المخ يمكن أن تكون أحد األسباب الرئيسية لنفوق الطيور ان لم تكن
السبب األوحد.وعليه فأن هذه الدراسة تعطى رؤية أوضح لمرضية فيروس انفلونزا الطيور
القطعان المصابة طبيعيا والتى تختلف بالضرورة عن القطعان عالى الضراواة فى المصابة تجريبيا نظرا الختالف جرعة الفيروس وطريقة دخوله باالضافة الختالف عمر الطائر ومناعته واحتمالية وجود عدوى مصاحبة فى جسم الطائر ولذلك فانه
ن هذه الدراسة تقدم يمكن مقارنتها بالدراسات التجريبية لتعزيز النتائج. كما امعلومات عن االصابات الحقلية بالفيروس وطرق تشخيصها مما يمكن استغاللها من قبل األطباء البيطرين لكى يقوموا بالتشخيص الدقيق للعينات الفيروسية المعزولة من
الحقل.
5
جامعه الزقازيق كلية الطب البيطرى يةقسم الكيمياء الحيو
بسم هللا الرحمن الرحيم
الهذين آمنوا )) يرفع اللهمنكم والهذين أوتوا العلم
((درجات صدق هللا العظيم
[11االية :المجادلة]
6
جامعة الزقازيق كلية الطب البيطرى
لوجياقسم الفريو التوصيف الجزيئى للبروتينات غير الهيكلية
نفلونزا الطيورإلفيروس ـة مقدمــــــة منرســـالــ
براهيم محمد ثابت ثابت حجاجإط.ب/
(2009جامعة الزقازيق ) – بكالوريوس العلوم الطبية البيطرية
(2011جامعة الزقازيق ) – دبلوم الميكروبيولوجيا
حتت إ رشإف
ورــكتالد على عبد الرشيد على سالمة
)رحمه هللا( أستاذ الميكروبيولوجيا المتفرغ
قسم الفيرولوجيا
كلية الطب البيطرى-
الزقازيق جامعة
ورـــالدكت محد عبدالسميع حسن عليأ الفيروسات والمناعة الفيروسية أستاذ
ارئيس قسم الفيرولوجي
كلية الطب البيطرى
جامعة الزقازيق
ورــالدكت شيماء حممد جالل حممد منصور
أستاذ مساعد الفيرولوجيا
قسم الفيرولوجيا
كلية الطب البيطرى
الزقازيق جامعة
ورـــالدكت مساعيلإحممد البكرى عبدالرحيم
الميكروبيولوجيا المتفرغأستاذ
قسم الفيرولوجيا
كلية الطب البيطرى
معة الزقازيقجا
ىلإمقدمـة ة الزقازيقــجامع
ا(ــ)الفريولوجي بية البيطرية ىف العلوم الط املاجستريللحصول على درجة قسم الفريولوجيا
2015