lab_faqs

Great information – compact format – the RAS Lab FAQS, 3rd edition

Dear Valued Customer,At Roche Applied Science, we know that time is an increasingly scarce resource these days. Relevant information, available at your fingertips at the right time and in an easily accessible format can help you perform your experiments more efficiently.Based upon requests from many different customers, Roche Applied Science has updated Lab FAQS. We hope you find this new compendium of information even more useful for your laboratory work. Think of the Lab FAQS as our way of saying “Thank you” for using our reagents, kits and systems over the years. We wish you continued success in your research projects.

Sincerely Roche Applied Science

PS: To offer comments and/or suggestions on content, structure and/or layout of this guide, please don’t hesitate to contact Bettina Kruchen (e-mail: [email protected]) or your local representative. Your cooperation in improving Lab FAQs is highly appreciated.

Acknowledgements:

We thank all contributors and editors for their diligent efforts during the proofreading and production of this book. Without their help, this project would never have been realized.

Editorial management 3rd edition: Critical reading of the manuscript:

Doris Eisel, Design and LayoutUrs W. Hoffmann-Rohrer, DKFZ , Heidelberg, Editor in ChiefBettina Kruchen, Editor in ChiefPaul Labaere, Scientific AdviceStefanie Gruenewald-Janho, Scientific AdviceOliver Seth, Scientific AdviceMichael Hoffmann, Scientific AdviceDoris Schmitt, Scientific AdviceJasmina Putnik, Scientific AdviceGudrun Tellmann, Scientific AdviceHans-Jürgen Rode, Scientific AdviceRita Rein, Scientific AdviceSimone Pitz, Scientific AdviceBrigitte Hloch, Scientific Advice

Yair Argon, University of Chicago, USAHans-Joachim Degen, RAS, GermanyIngrid Hoffmann, DKFZ, Heidelberg, GermanyJürgen Kartenbeck, DKFZ, Heidelberg, GermanyBernhard Korn, RZPD, Berlin/Heidelberg, GermanyAnnette Moritz, RAS, GermanySabine Muench-Garthoff, RAS, GermanyAttila Nemeth, University of Budapest, HungaryHanspeter Pircher, University of Freiburg, GermanyHerwig Ponstingel, DKFZ, Heidelberg, GermanyHans-Richard Rackwitz, DKFZ, Heidelberg, GermanyHanspeter Saluz, HKI, Jena, GermanyBirgit Simen, University of Chicago, USAGiulio Superti-Furga, EMBL, Heidelberg, GermanyMartin Vingron, MPI, Berlin

I

Table of contents (general overview):

1. Working with DNA. . . . . . . . . . . 11.1. Precautions for handling DNA . . . 21.2. Commonly used formulas . . . . . . . 31.3. Isolating and purifying DNA . . . . . 61.4. Analyzing DNA. . . . . . . . . . . . . . . . 91.5. Cloning of DNA . . . . . . . . . . . . . . 221.6. Labeling of DNA and

Oligonucleotides . . . . . . . . . . . . . 291.7. Amplification of DNA . . . . . . . . . 361.8. Quantitative Real-Time PCR . . . . 461.9. References . . . . . . . . . . . . . . . . . . 59

2. Working with RNA . . . . . . . . . . 592.1. Precautions for handling RNA . . . 602.2. Commonly used formulas . . . . . . . 632.3. Isolating and purifying RNA . . . . . 652.4. Analyzing RNA . . . . . . . . . . . . . . . 682.5. RT-PCR . . . . . . . . . . . . . . . . . . . . . . 702.6. Labeling of RNA . . . . . . . . . . . . . . 792.7. References . . . . . . . . . . . . . . . . . . . 81

3. Working with Proteins . . . . . . . 813.1. Precautions for

handling Proteins . . . . . . . . . . . . . 823.2. Conversion from Nucleic

Acids to Proteins . . . . . . . . . . . . . . 883.3. Analyzing Proteins . . . . . . . . . . . . 923.4. Quantification of Proteins . . . . . . 983.5. Purifying Proteins . . . . . . . . . . . . 1023.6. References . . . . . . . . . . . . . . . . . 112

Table of contents (general overview):

4. Working with Cells . . . . . . . . 1124.1. Precautions for handling Cells . 1134.2. Basic Information . . . . . . . . . . . . . 1174.3. Manipulating Cells . . . . . . . . . . . 1234.4 Analyzing Cells. . . . . . . . . . . . . . 1314.5. References . . . . . . . . . . . . . . . . . 144

5. Preparing Buffersand Media . . . . . . . . . . . . . . . 145

5.1. Buffers . . . . . . . . . . . . . . . . . . . . 1465.2. Antibiotics . . . . . . . . . . . . . . . . . 1605.3. Media for Bacteria . . . . . . . . . . . 1615.4. References . . . . . . . . . . . . . . . . . 163

6. Conversion Tables and Formulas . . . . . . . . . . . . . 163

6.1. Nucleotide ambiguity code . . . . . 1646.2. Formulas to calculate melting

temperatures . . . . . . . . . . . . . . . . 1646.3. %GC content of different

genomes . . . . . . . . . . . . . . . . . . . 1656.4. Metric prefixes . . . . . . . . . . . . . . 1656.5. Greek alphabet . . . . . . . . . . . . . . 1666.6. Properties of radioisotopes. . . . . 1666.7. Temperatures and Pressures . . . . . 1676.8. Centrifugal forces . . . . . . . . . . . . 1676.9. Periodical system of elements . . 1686.10. Hazard Symbols . . . . . . . . . . . . . . 1686.11. References . . . . . . . . . . . . . . . . . . 169

7. Addresses, Abbreviations and Index 169

7.1. Selection of useful addresses . . 1707.2. Lab Steno . . . . . . . . . . . . . . . . . . 1727.3. Abbreviations . . . . . . . . . . . . . . . 1737.4. Alphabetical Index . . . . . . . . . . . 176

II

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22NA Ligase . . . . . . . . . . . . . . . . . . . . . . . .22

n with Shrimp Alkaline Phosphatase . . . .23ends to blunt ends: 3´recessed ends . . . . . . . . . . . . . . . . . . . .24ial or complete filling of . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .25ease – for removing of ing ends . . . . . . . . . . . . . . . . . . . . . . . . . . .26. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .27bacterial strains . . . . . . . . . . . . . . . . . . . . .28 and Oligonucleotides . . . . . . . . . . . . . . 29ations . . . . . . . . . . . . . . . . . . . . . . . . . . . .29rent techniques . . . . . . . . . . . . . . . . . . . . 30ucleic Acids . . . . . . . . . . . . . . . . . . . . . . 31abeling with Klenow . . . . . . . . . . . . . . . .32ith DNA Polymerase I and DNAse I . . . .33

th Terminal Transferase . . . . . . . . . . . . . . 34th Polynucleotide Kinase . . . . . . . . . . . . .35

Table of contents (detailed overview):

1. Working with DNA . . . . . . . . . . . . . . . . . . . . 11.1. Precautions for handling DNA . . . . . . . . . . . . . . . . . . . . . . 21.2. Commonly used formulas . . . . . . . . . . . . . . . . . . . . . . . . . . 3

Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .51.3. Isolating and purifying DNA . . . . . . . . . . . . . . . . . . . . . . . .6

Perform nucleic acid isolation rapidly and efficiently . . . . . .8Sizes and weights of DNA from different organism . . . . . . .8

1.4. Analyzing DNA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9Concentration and purity via OD measurement . . . . . . . . . .9Fragment Sizes of DNA Molecular Weight Markers and recommended Types of Agarose . . . . . . . . . . . . . . . . . .10Size estimation of

– DNA fragments in Agarose MP gels . . . . . . . . . . . . . . . .11– DNA fragments in Acrylamide gels . . . . . . . . . . . . . . . . .11Restriction Enzymes:

– General Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12– Buffer System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12– Star Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .13– Reference Materials available . . . . . . . . . . . . . . . . . . . . . .13– Inactivation and removal . . . . . . . . . . . . . . . . . . . . . . . . . .14– Characteristics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .14– Cross index of recognition sequences . . . . . . . . . . . . . . .19Partial Digest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .21

1.5. Cloning of DNA Ligation with T4 DDephosphorylatioModifying sticky 5´protruding and Klenow – for part3´recessed endsMung Bean Nucl3´ and 5´ protrudMiscellaneous . . Commonly used

1.6. Labeling of DNAGeneral ConsiderOverview of diffeDig Labeling of NRandom Primed LNick Translation w3´End labeling wi5´End labeling wi

antitative Real-Time PCR . . . . . . . . . . . . . . . . . . . . . . . 46thods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46trument-based Systems . . . . . . . . . . . . . . . . . . . . . . . . . .47l-Time PCR Assay Formats . . . . . . . . . . . . . . . . . . . . . . 48uence-Independent Detection Assays . . . . . . . . . . . . . 49uence-specific Probe Binding Assays . . . . . . . . . . . . . 50er Assay formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54ciples of Quantification . . . . . . . . . . . . . . . . . . . . . . . . .57lting Curve Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . .57

erences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

rking with RNA . . . . . . . . . . . . . . . . . . . . 59cautions for handling RNA . . . . . . . . . . . . . . . . . . . . . 60

monly used formulas . . . . . . . . . . . . . . . . . . . . . . . . . 63mples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64lating and purifying RNA . . . . . . . . . . . . . . . . . . . . . . . 65A content in various cells and tissues . . . . . . . . . . . . . .67

III

1.7. Amplification of DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36Avoiding Contamination . . . . . . . . . . . . . . . . . . . . . . . . . . . .36Reaction Components:

– Template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .37– Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38– Oligonucleotides: Commonly used Formulas . . . . . . . 39

Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .40Reaction Components:

– MgCl2 concentration . . . . . . . . . . . . . . . . . . . . . . . . . . 40– dNTP concentration. . . . . . . . . . . . . . . . . . . . . . . . . . . 41– Choice of Polymerase . . . . . . . . . . . . . . . . . . . . . . . . . 41– Hot Start Techniques . . . . . . . . . . . . . . . . . . . . . . . . . . .42– Other factors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .42

Cycling Profile for standard PCR . . . . . . . . . . . . . . . . . . . . .43Standard Pipetting Scheme . . . . . . . . . . . . . . . . . . . . . . . .44Standard PCR Temperature Profile . . . . . . . . . . . . . . . . . . .45

1.8. QuMe

Ins

ReaSeq

Seq

OthPrin

Me

1.9. Ref

2. Wo2.1. Pre2.2. Com

Exa2.3. Iso

RN

ith Protein. . . . . . . . . . . . . . . . . . 81r handling Proteins . . . . . . . . . . . . . . . . . . .82otease activity . . . . . . . . . . . . . . . . . . . . . . . .83. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86om Nucleic Acids to Proteins . . . . . . . . . . 88nsfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88ode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 of Amino Acids . . . . . . . . . . . . . . . . . . . . . 90. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91teins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .92ges of proteins DS-PAGE . . . . . . . . . . . . . . . . . . . . . . . . . . .92only used markers DS-PAGE . . . . . . . . . . . . . . . . . . . . . . . . . . .92teins on denaturing SDS-PAGE gels . . . . . .93etection of proteins on membranes . . . . . . .93e via gel filtration . . . . . . . . . . . . . . . . . . . . 94ommonly used detergents: Definitions . . . 94 of detergents . . . . . . . . . . . . . . . . . . . . . . . 95tergents . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96lfate precipitation . . . . . . . . . . . . . . . . . . . . 96tion techniques . . . . . . . . . . . . . . . . . . . . . .97

2.4. Analyzing RNA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68Concentration via OD Measurement . . . . . . . . . . . . . . . . . .68Purity via OD Measurement . . . . . . . . . . . . . . . . . . . . . . . . .68Size estimation of RNA fragments . . . . . . . . . . . . . . . . . . .69

2.5. RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .70Reaction Components:

– Template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .70– Choice of reverse transcription primers . . . . . . . . . . 71– Design of reverse transcription primers . . . . . . . . . . .72– Template Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .73– Choice of enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . .75

Procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .76Reaction Components:

– Choice of enzyme for Two Step RT-PCR . . . . . . . . . . .77– Choice of enzyme for One Step RT-PCR . . . . . . . . . . .78

2.6. Labeling of RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .79Overview of different techniques . . . . . . . . . . . . . . . . . . . .79Principle of In Vitro Transcription with DNA dependent RNA Polymerases . . . . . . . . . . . . . . .79SP6, T7 and T3 Polymerases . . . . . . . . . . . . . . . . . . . . . . . .80

2.7. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .81

3. Working w3.1. Precautions fo

Inhibition of pr

Stabilization . 3.2. Conversions fr

Information tra

The Genetic C

CharacteristicsCodon Usage

3.3. Analyzing ProSeparation ranin denaturing S

Sizes of commin denaturing S

Staining of pro

Staining and dBuffer exchang

Properties of c

CharacteristicsRemoval of de

Ammonium su

Other precipita

rking with Cells . . . . . . . . . . . . . . . . . . 112autions for handling Cells . . . . . . . . . . . . . . . . . . . . . . . . 113

ue culture reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113wth areas and yields of cells in a culture vessels . . . . . . . 115oplasma Contamination . . . . . . . . . . . . . . . . . . . . . . . . . . . 116ection of Mycoplasma contamination . . . . . . . . . . . . . . . . .117ic Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .117 cal Properties

of Bacterial Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .117 of Plant Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118 of Animal Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118leic Acid

and Protein content of a bacterial cell . . . . . . . . . . . . . . . 119 content in mammalian cells . . . . . . . . . . . . . . . . . . . . . . . 119 and Protein content in human blood . . . . . . . . . . . . . . . . 120 Cycle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121sting Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122ipulating Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123sfection of mammalian cells . . . . . . . . . . . . . . . . . . . . . . . 123 influences on transfection . . . . . . . . . . . . . . . . . . . . . . . . 124

sfection protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125e course of transfection . . . . . . . . . . . . . . . . . . . . . . . . . . . 126

IV

3.4. Quantification of Proteins . . . . . . . . . . . . . . . . . . . . . . . . . .98OD Measurement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .98Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .98Concentration limits of interfering reagents for assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .100Compatibility of different buffer systems with protein quantification assays . . . . . . . . . . . . . . . . . . .100

3.5. Purifying Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .102Characteristics of different expression systems . . . . . . . .102Sources of antibodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . .102Expressing Proteins: Cell-free - Rapid Translation System . . . . . . . . . . . . . . . . .103Choices of animals for immunization . . . . . . . . . . . . . . . . .105Doses of immunogens for Rabbits . . . . . . . . . . . . . . . . . .106Routes of injections for Rabbits . . . . . . . . . . . . . . . . . . . . .106Purifying antibodies using Protein A, Protein G and Protein L . . . . . . . . . . . . . . . . . . . . . . . . . . .107Immunoprecipitation . . . . . . . . . . . . . . . . . . . . . . . . . . . . .107Ion Exchange Chromatography . . . . . . . . . . . . . . . . . . . . .109

– Experimental setup . . . . . . . . . . . . . . . . . . . . . . . . . . 110Tagging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .111

3.6. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112

4. Wo4.1. Prec

Tiss

GroMyc

Det

4.2. BasTypi

–

––

Nuc

––

–

CellArre

4.3. ManTran

DNATran

Tim

uffers and Media . . . . . . . . . . 145. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146es of commonly used buffers (at 20°C) . . 148

tions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 148. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151th desired pH . . . . . . . . . . . . . . . . . . . . . . .152s of DNA . . . . . . . . . . . . . . . . . . . . . . . . . . 154s of RNA . . . . . . . . . . . . . . . . . . . . . . . . . . .155nt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .155cleic Acids . . . . . . . . . . . . . . . . . . . . . . . . . 156s of Proteins . . . . . . . . . . . . . . . . . . . . . . . .157 for denaturing SDS – PAGE . . . . . . . . . . . 158els for denaturing SDS-PAGE . . . . . . . . . . 158ng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160

ic cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160 cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160teria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161liter . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161lates of 90 mm, ∼ 25 ml per plate) . . . . . 162. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163

Calcium phosphate-DNA coprecipitation . . . . . . . . . . . . . . . . 127Liposomal and non-liposomal Transfection Reagents . . . . . . . 127Electroporation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128Voltage Profile . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129Microinjection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Use of Selection Markers for Stable Cell Lines . . . . . . . . . . . . 130

4.4. Analyzing Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131Apoptosis/Necrosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .131Apoptosis Assay Methods . . . . . . . . . . . . . . . . . . . . . . . . . .134

– Selection Guide. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .135Cell Proliferation and Viability . . . . . . . . . . . . . . . . . . . . . . . .136Proliferation Assay Methods: Selection Guide. . . . . . . . . . . .137FACS (Fluorescence activated cell sorting). . . . . . . . . . . . . .138Reporter Gene Assays

– Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1414.5. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 144

5. Preparing B5.1. Buffers . . . . .

Definitions . . . Precautions . . Buffering rangRecipes for

– stock solu

– buffers . . – buffers wi

Electrophoresi

ElectrophoresiDEPC-treatme

Staining of Nu

ElectrophoresiResolving gels

5% stacking g

Western Blotti5.2. Antibiotics . .

Selection of

– prokaryot– eukaryotic

5.3. Media for BacRecipes for 1

– (for ∼ 40 p

5.4. References . .

dresses and Index. . . . . . . . . . . . . . . . . 169ection of useful addresses . . . . . . . . . . . . . . . . . . . . . 170 Steno . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172

breviations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173habetical Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 176

V

6. Conversion Tables and Formulars . . . . . . 1636.1. Nucleotide ambiguity code . . . . . . . . . . . . . . . . . . . . . . . 1646.2. Formulas to calculate melting temperatures . . . . . . . . . 1646.3. %GC content of different genomes . . . . . . . . . . . . . . . . 1656.4. Metric prefixes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1656.5. Greek alphabet. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1666.6. Properties of radioisotopes . . . . . . . . . . . . . . . . . . . . . . . 1666.7. Temperatures and Pressures. . . . . . . . . . . . . . . . . . . . . . 1676.8. Centrifugal forces . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1676.9. Periodical system of elements . . . . . . . . . . . . . . . . . . . . 1686.10. Hazard symbols and risk phrases . . . . . . . . . . . . . . . . . . 1686.11. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169

7. Ad7.1. Sel7.2. Lab7.3. Ab7.4. Alp

Working with DNAChapter 1

1.1. Precautions for handling DNA ........................................ 21.2. Commonly used formulas .................................................. 31.3. Isolating and purifying DNA ............................................. 61.4. Analyzing DNA ...................................................................... 91.5. Cloning of DNA ................................................................... 221.6. Labeling of DNA and Oligonucleotides ..................... 291.7. Amplification of DNA ........................................................ 361.8. Quantitative Real-Time PCR ........................................... 461.9. References ............................................................................ 59

cells and tissues, use either fresh ly frozen in liquid nitrogen and es degradation of the DNA by lim-s. stored for < 2 days at room -8°C or for < 1 month at

duction of yield of genomic DNA.g EDTA as anticoagulant, not

or inhibition of amplification

he High Pure PCR Template the heparin from the sample.

ip openings causes shearing or cially designed for genomic DNA. plasmid DNA and other small

1.1. Precautions for handling DNA

Handling fresh and stored material before extraction of DNA

For the isolation of genomic DNA from samples or samples that have been quickstored at –70°C. This procedure minimiziting the activity of endogenous nucleaseFor best results, use fresh blood or bloodtemperature. Blood stored for 7 days at 2–15 to –25°C will result in a 10 to 15% reCollect blood samples in tubes containinheparin. Heparin can cause attenuation during PCR.However, if heparin cannot be avoided, tPreparation Kit* can be used to remove

Pipetting DNA Avoid vigorous pipetting. Pipetting genomic DNA through small tnicking. Use tips with wide openings, speRegular pipette tips pose no problem forDNA molecules.

* Product available from Roche Applied Science: Cat. No. 11 796 828 001

rage at –15 to –25°C can cause shearing of

NA molecules can be stored er long term storage.n purposes at 2-8°C to avoid nicks.

ice when preparing an experiment.

NA after ethanol precipitation.

NA molecules can be air or vacuum dried.

., 10 mM Tris, pH 7.0 – pH 8.0).ully invert the tube several times after

e gently on the side. in buffer overnight at 2-8°C.

o dissolve and inactivate DNases.

2
Working with DNA1
Storage of DNA Store genomic DNA at 2-8°C, stothe DNA.Plasmid DNA and other small D● at 2-8°C for short term storag● in aliquots at –15 to –25°C foKeep plasmids for transformatioStore modified DNA at 2-8°C.

Manipulation of DNA Always keep the DNA sample on

Drying DNA Avoid overdrying of genomic DLet the DNA air dry. Plasmid DNA and other small D

Dissolving DNA Dissolve DNA in Tris buffer (e.gTo help dissolve the DNA, carefadding buffer and/or tap the tubAlternatively, let the DNA standDo not vortex genomic DNA.Heat DNA for 10 min. at 65°C t

oxynucleotide: 330 Dalton (Da)*A basepair: 660 Dalton (Da)*

epairs] x [660 Da]

basepairs) = 4 363 x 660 Da= 2.9 x 106 Da= 2.9 x 103 kDa

es] x [330 Da]

s, ssDNA form)= 7 249 x 330 Da= 2.4 x 106 Da= 2.4 x 103 kDa

to 10000 on the atomic mass scale).

1.2. Commonly used formulas

Molecular Weight of DNA, Calculation in Dalton*

Average molecular weight (MW) of a deAverage molecular weight (MW) of a DN

MW of dsDNA = [number of bas

e.g., MW of pBR322 dsDNA (4 363

MW of ssDNA = [number of bas

e.g., MW of M13mp18 (7 249 base

* 1 Da (Dalton) is a unit of mass almost equal to that of a hydrogen atom (precisely equal Named after John Dalton (1766-1844) who developed the atomic theory of matter.

ule

ule

iction endonuclease cleavage:NA) x (number of sites)) x (number of sites)] + [2 x (pmol of DNA)]

x 106 x µg (of dsDNA)

Nbp x 660 Da

0 basepairs dsDNA fragment =2 x 106 x 1

= 30.3 100 x 660

106 x µg (of ssDNA)

Nb x 330 Da

50 bases ssDNA fragment =1 x 106 x 1

= 12.12 250 x 330

3
Working with DNA1
Calculation of pmol of 5´ (or 3´) ends

pmol of ends of a dsDNA molec

pmol of ends of a ssDNA molec

pmol of ends generated by restr● circular DNA: 2 x (pmol of D● linear DNA: [2 x (pmol of DNA

Nbp = number of basepairs (dsDNA) and Nb = number of bases (ssDNA)

=

2 x 106 x µg (of dsDNA)=

2

MW (in Da)

e.g., pmol of 5́ or 3́ ends of 1 µg of a 10

=

1 x 106 x µg (of ssDNA)=

1 x

MW (in Da)

e.g., pmol of 5́ or 3́ ends of 1 µg of a 2

1 x 1 515= 15.2 pmol

100

1 pmolx

1=

µg (of ssDNA) x 3 030

330 pg Nb Nb

x 3 030= 3.03 pmol

1 000

1 pmolx

1=

µg (of dsDNA) x 1515

660 pg Nbp Nbp


Conversion of µg to pmol

e.g., 1 µg of a 100 basepairs dsDNA fragment =

pmol of ssDNA = µg (of ssDNA) x106 pg

x1 µg

e.g., 1 µg of a 1 000 bases ssDNA fragment =

1

pmol of dsDNA = µg (of dsDNA) x106 pg

x1 µg

bp x 6.6 x 10-4

A fragment = 1 x 100 x 6.6 x 10-4 = 0.066 µg

b x 3.3 x 10-4

gment = 1 x 250 x 3.3 x 10-4 = 0.0825 µg

330 pgx

1 µgx Nb =

1 pmol 106 pg

660 pgx

1 µgx Nbp =

1 pmol 106 pg

4
Working with DNA1
Conversion of pmol to µg

= pmol (of dsDNA) x N

e.g., 1 pmol of a 100 basepairs dsDN

= pmol (of ssDNA) x N

e.g., 1 pmol of a 250 bases ssDNA fra

Nbp = number of basepairs (dsDNA) and Nb = number of bases (ssDNA)

µg of ssDNA = pmol (of ssDNA) x

µg of dsDNA = pmol (of dsDNA) x

µg µg/pmolpmol of 5´ or 3´

ends/µg

0.066 30.3

0.33 6.06

0.66 3.03

0.66 6.06

0.66 9.12

1.77 –

1.77 1.14

1.77 2.28

1.77 3.42

2.88 –

2.88 0.7

2.88 1.4

2.88 2.1

1.2. Commonly used formulasExamples

* RE: restriction enzyme

Type Size Form MW (in kDa) pmol/

dsDNA fragment 100 bp Linear 66 15.2



RE* Digest, 1 site 1.52

RE* Digest, 2 sites 1.52

pUC18/19 dsDNA 2686 bp Circular 1.8 x 103 0.57




pBR322 dsDNA 4363 bp Circular 2.9 x 103 0.35




Notes

Working with DNA1 5

A (see also reference 4).

ample applied, concentration of DNA within

mendation*

re PCR Template Preparation Kit

lation Kit for Cells and Tissues

re PCR Template Preparation Kit

lation Kit for Mammalian Blood

re Plasmid Isolation Kit

re Plasmid Maxi/Midi Kits

re Viral Nucleic Acid Kit

re 16 System Viral Nucleic Acid Kit

re PCR Product Purification Kit

re 96 UF Cleanup Kit

re PCR Cleanup Micro Kit

ick Spin DNA Columns

pin Columns

Gel DNA Extraction Kit

re PCR Product Purification Kit

re PCR Cleanup Micro Kit

1.3. Isolating and purifying DNA

Use this chart to select a product according to the type and origin of DN

* The amount of DNA that can be isolated with the kits depends on variables like the amount of sthe sample, buffers systems, etc. Please refer to the next pages for a detailed overview.

Type Origin Recom

Genomic

tissue, cultured cells, bacteria, yeast High Pu

tissue, cultured cells, bacteria, yeast, mouse tail DNA Iso

human blood High Pu

mammalian/human blood DNA Iso

Plasmid propagated in E.coliHigh Pu

Genopu

Viralserum, plasma, blood, other body fluids, cell culture supernatant High Pu

serum, plasma, cell culture supernatant High Pu

DNA fragments

PCR mixture, restriction enzyme digests, labeling and modifying reactions, DIG labeled probes.

High Pu

High Pu

High Pu

removal of unincorporated nucleotides from labeled DNA moleculesMini Qu

Quick S

agarose gel slices

Agarose

High Pu

High Pu

cation in which the DNA will be used

eling/difying ctions

Clon-ing

Se-quenc-

ing

In Vitro Tran-

scription

Transfec-tion

Micro-array

spotting

●

●

● ● ● ●

●

● ● ● ●

● ● ●

● ● ●

●

● ● ●

● ● ● ● ●

6
Working with DNA1
Use this chart to select a product according to the main appli(see reference 4).

Product PCRRestriction

Enzyme Analysis

Southern Blotting

LabMoRea

DNA Isolation Kit for Cells and Tissues ● ● ●

DNA Isolation Kit for Mammalian Blood ● ● ●

High Pure Plasmid Isolation Kit ● ● ●

High Pure Viral Nucleic Acid Kit ●

High Pure 16 System Viral Nucleic Acid Kit ●

High Pure PCR Template Preparation Kit ● ● ●

High Pure 96 UF Cleanup Kit ●

High Pure PCR Product Purification Kit ● ● ●

High Pure PCR Cleanup Micro Kit ● ● ●

Mini Quick Spin DNA Columns ●

Quick Spin Columns ●

Agarose Gel DNA Extraction Kit ● ● ●

Genopure Plasmid Midi KitGenopure Plasmid Maxi Kit ● ● ●

so reference 4)

Typical Yield

Recovery:● 0.1 – 10 kb: ~ 80%● 10 kb – 100 kb: ~ 60%● Oligos > 20 bases: ~ 60%

depending on tissue type700 – 3 000 µgup to 800 µgup to 300 µg1500 – 2700 µg

350 µg570 µg

� 25 µl (� 150 bp � 40%; 1500 bp � 90%; 4500 bp � 90%;8000 bp � 80%)

12 µg3.5 µg

product detectable by PCR

product detectable by PCR

1.3. Isolating and purifying DNA

Use this chart to select a product according to its characteristics (see al

Product Quantity of starting material

Agarose Gel DNA Extraction Kit Agarose slices: 100 – 200 mg

DNA Isolation Kit for Cells and Tissues Tissue: up to 1 gCultured cells: up to 5 x 107 cellsMouse tail: up to 400 mgYeast: up to 3 x 1010 cellsGram neg. bacteria: up to 1011 cells

DNA Isolation Kit for Mammalian Blood Human whole blood: 10 mlRat and mouse whole blood: 10 ml

High Pure 96 UF Cleanup Kit 100 bp to > 10 kb20 to 300 µ.

High Pure Plasmid Isolation Kit E. coli XL1 Blue, pUC19 – 2 mlE. coli DH5α, pUC19 – 2 ml

High Pure Viral Nucleic Acid Kit 200 – 600 µl of serum, plasma, blood,cell culture supernatant

High Pure 16 System Viral Nucleic Acid Kit 200 – 600 µl of serum, plasma, blood,cell culture supernatant

Working with DNA1

Use this chart to select a product according to its characteristics (see also reference 4)

Note: For more information on nucleic acid isolation and purification please visit http://www.roche-applied-science.com/napure

Product Quantity of starting material Typical Yield

High Pure PCR Template Preparation Kit Blood: up to 300 µlCultured cells: up to 108 cellsMouse tail: 25 – 50 mgYeast: 108 cellsBacteria: 109 cells

3 – 9 µg15 – 20 µg5 – 10 µg10 – 13 µg1 – 3 µg

High Pure PCR Product Purification Kit 100 µl of a modifying, labeling or restriction enzyme digestion reaction

Recovery: > 80% of 5 – 25 µg DNA (fragments > 100 bp)

High Pure PCR Cleanup Micro Kit up to 100 µl reaction mixup to 100 mg agarose gel slice

Recovery: > 80% of 5 – 25 µg DNA (fragments > 100 bp)

Mini Quick Spin DNA Columns 20 – 75 µl labeling mixture Recovery: > 90%Exclusion limit: � 20 bp

Genopure Plasmid Midi Kit 10 – 100 ml bacterial culture(low copy plasmid)5 – 30 ml bacterial culture(high copy plasmid)

0.2 – 1 µg/ml culture (low copy plasmid)3 – 5 µg/ml culture (high copy plasmid)

Genopure Plasmid Maxi Kit 100 – 500 ml bacterial culture(low copy plasmid)30 – 150 ml bacterial culture(high copy plasmid)

0.2 – 1 µg/ml culture (low copy plasmid)3 – 5 µg/ml culture (high copy plasmid)

7

1.3. Isolating and purifying DNAPerform nucleic acid isolation rapidly and efficiently

The MagNA Pure LC Instrument allows fully automated nucleic acid isolation and PCR setup. True walk-away precision is achieved with the elimination of “hands-on“ steps such as pipetting, filtration, andcentrifugation. With the MagNA Pure LC Instruments’s proven magnetic bead technology, high quality genomic DNA, total RNA, or mRNA is obtained.

The MagNA Pure LC Instrument processes up to 32 samples in less than one hour and isolates pure nucleic acids from a variety of sample types, including:

● Whole blood ● White blood cells● Cultured cells ● Tissues

Expand the MagNA Pure LC Instrument’s flexibility and versatility with the use of various reagent kits, accessories, and software protocols:

● DNA Isolation Kits - for blood/cultured cells, tissue, and bacteria/fungi● Total Nucleic Acid Isolation Kits - for blood, plasma, and serum; also available for large volumes● RNA Isolation Kits - for whole blood, blood cells, cultured cells, and paraffin-embedded tissue● mRNA Isolation Kits - for whole blood, blood cells, and tissue

Increase your lab’s efficiency by combining the MagNA Pure LC Instrument with the LightCycler Carousel Centrifuge and the LightCycler Instrument.

Note: For more information on MagNA Pure LC please visit http://www.magnapure.com

Working with DNA1 8

Sizes and weights of DNA from different organism

Organism Size (bp) Molecular Weight (in kDa) Number of Chromosomes

pBR322, E. coli plasmid 4363 2.9 x 103

SV 40, Simian virus 5243 3.5 x 103

ΦX174, E.coli bacteriophage 5386 3.5 x 103

Adenovirus 2, human virus 35 937 23.7 x 103

Lambda, E.coli bacteriophage 48502 32.0 x 103

E.coli, bacterium 4.7 x 106 3.1 x 106

Saccharomyces cerevisiae, yeast 1.5 x 107 9.9 x 106 32 (diploid)

Dictyostelium discoideum, mold 5.4 x 107 3.6 x 107 7 (haploid)

Caenorhabditis elegans, worm 8.0 x 107 5.3 x 107 11/12 (diploid)

Drosophila melanogaster, fruitfly 1.4 x 108 9.2 x 107 8 (diploid)

Mus musculus, mouse 2.7 x 109 1.8 x 109 40 (diploid)

Xenopus leavis, frog 3.1 x 109 2.0 x 109 36 (diploid)

Homo Sapiens, human 3.3 x 109 2.2 x 109 46 (diploid)

Zea mays, maize 3.9 x 109 2.6 x 109 20 (diploid)

Nicotiana tabacum, tabacum plant 4.8 x 109 3.2 x 109 48 (diploid)

to ensure an optimal

inction coefficients of nucleic nts – and hence the above d/or solutions.

O (1+19 dilution)

50 µg/ml x 20

1 ml (= sample volume) = 44 µg

1.4. Analyzing DNAConcentration and purity via OD measurement

Concentration of DNA 1 A260 Unit of dsDNA = 50 µg/ml H2O1 A260 Unit of ssDNA = 33 µg/ml H2O

Notes OD value should range between 0.1 and 1.0 measurement.The above mentioned values are based on extacids in H2O, please note that these coefficiementioned values – differ in other buffers anExample of calculation: ● volume of dsDNA sample: 100 µl● dilution: 25 µl of this sample + 475 µl H2

● A260 of this dilution: 0.44 ● concentration of dsDNA in sample: 0.44 x

(=dilution factor) = 440 µg/ml ● amount of dsDNA in sample: 440 µg/ml x 0.

Purity of DNA Pure DNA: A260/A280 ≥ 1.8

the preparation is contaminated with s (e.g., phenol). ible contamination with RNA.out the size of the DNA.

9
Working with DNA1
Notes An A260/A280 < 1.8 indicates thatproteins and aromatic substanceAn A260/A280 > 2 indicates a possThe OD gives no information ab

Fragment Sizes of DNA Molecular Weight Markers

base pairs

70,000

10,000

1,000

100

50

–21226

–5148, 4973

–4268

–3530

–2027–1904

–1584

–1375

-947

–831

–564

–125

–19329

–7743

–5526

–4254

–3140

–2690

–2322

–1882

-1489

–1150

–925

–697

–421

–74

–587–540–504–458, 434

–267–234–213-192, 184

–124, 123–104–89, 80–64, 57, 51,21, 18, 11, 8

–2176

–1766

–1230

–1033

–653

–517–453-394

–298

–234, 220

–154

–23130

–9416

–6557

–4361

–2322

–2027

–564

–125

II III IV V VI

–8576–7427–6106

–4899

–3639

–2799

1953–1882

–1515–1482

–1164

–992

–710(718*)

–492

–359

–1114

–900

–692

–501, 489

–404

–320

–242-190

–147–124–110–67–37, 34,

26, 19

VII VIII

0.1

2-2

3.1

kbp

�D

NA

• Hind III

10 2

36

25

0 0

01

0.1

2-2

1.2

kbp

�D

NA

• Eco R

I +H

ind III

10 5

28

55

2 0

01

0.07-19

.3 kb

p�

DN

A •

pSPTB

M 20 D

NA

•Sty

I + Sau

I

11

418

00

9 0

01

8-5

87 b

ppB

R 332 D

NA

• Hae

III

10 8

21

705

00

1

0.1

5-2

.1 kb

ppB

R 328 D

NA

• BglI +

pB

R 328 D

NA

• HinI I

11

06

2 5

90

00

1

0.0

8-8

.57 kb

pS

PP I D

NA

• EcoR

I

11

20

9 2

64

00

1

0.0

19-1

.11

kbp

pUC

BM

21 • Hpa

II +

pUC

BM

21 DN

A •

Dra

I + H

indIII

11

33

6 0

45

00

1

Working with DNA1

–1353

–1078

–872

–603

–310–281, 271–234-194

–118

–72

1221611198101809162

–8144–7126–6108

–5090

-4072

–3054

–2036

–1636

– 018

–517, 506

–396–344–298

–220, 201–154, 134, 75

–2642

–750–700–650–600-550–500–450–400–350–300–250–200–150

–100–50

IX X XIII

–5000–4500–4000–3500

–3000

–2500

–2000

–1500

–1000

–500

–2642

–1500–1400–1300–1200–1100

–1000–900–800–700

–600

–500

–400

–300

–200

–100

–3000–2750–2500

–2250

–2000

–1750

–1500

–1250

–1000

–750

–500

–250

4850238412327452902726718249182201020323, 19944187801671015262, 152581418313282, 1237911848, 1120510086, 968881137601

–3574

–2392

XIV XV XVI XVII

Expand DN

Am

olecularw

eight m

arker

11

721

61

5 0

01

0.072

-1.3

5 kb

p�

X 174 • H

aeIII

11

44

9 4

60

00

1

0.07

5-1

2.2

1 kb

p1018 bp D

NA

fragment

multim

ers and pBR

322D

NA

fragments

11

49

8 0

37 0

01

100 bp ladder

11

721

93

3 0

01

50 bp ladder

11

721

92

5 0

01

250 bp ladder

11

85

5 6

38

00

1

500 bp ladder

11

85

5 6

46

00

1

■ Agarose MS 0.05 Kbp – 1.5 Kbp

■ Agarose LE 0.2 Kbp – 15 Kbp

■ Agarose MP 0.1 Kbp – 30 Kbp

10

migration of Bromophenol Blue

is a high gel strength agarose (> 1800 g/cm2; e of DNA molecules that can be separated in pes to prepare all necessary buffers.

P

.25% 1.5% 2%

1.4. Analyzing DNASize estimation of DNA fragments in Agarose MP* gels

approximate migration of Xylene Cyanol approximate * Agarose Multi Purpose (Cat. No. 11 388 983 001) – available from Roche Applied Science –

1%) permitting the use of very low and very high concentrations, resulting in a broad rangthe same type of agarose. Please refer to chapter 5 “Preparing Buffers and Media” for reci

% Agarose M

0.4% 0.8% 1% 1

Range of separation of linear ds fragment sizes

30 kbp

25 kbp

15 kbp

10 kbp

7.5 kbp

5 kbp

2.5 kbp

1 kbp

500 bp

250 bp

100 bp

0 bp

pproximate migration of Bromophenol Blue

ll necessary buffers.

de/Bisacrylamide (29:1)

12% 15% 20%

11
Working with DNA1
Size estimation of DNA fragments in Acrylamide gels

approximate migration of Xylene Cyanol a

Please refer to chapter 5 “Preparing Buffers and Media” for recipes to prepare a

% of Acrylami

3.5% 5% 8%

Efficient range of separation of linear ds fragment sizes

1000 bp

750 bp

500 bp

250 bp

100 bp

75 bp

50 bp

25 bp

5 bp

0 bp

he amount of enzyme required to 60 min. at the appropriate assay yme.ct reaction temperature and the

d in the packinserts that come page 14 table section “Sub“)

che Applied Science – contain f the enzyme is guaranteed

, susceptible to denaturation and osed to higher temperatures. glycerol solution and should be g freezer. During usage, it is or in specially developed bench-

n-enzymes.com

1.4. Analyzing DNARestriction Enzymes: General Information

Unit definition One unit of a restriction endonuclease is tcompletely digest 1 µg substrate DNA inconditions stated for each restriction enzThe type of the substrate DNA, the correspecific activity of each enzyme are statetogether with the products. (Compare to

Stability All restriction enzymes – supplied by Roexpiry dates on the label. 100% activity ountil that date.

Storage Restriction enzymes are, like all proteinscan loose their specific activity when expTherefore, the enzymes are supplied as astored at –15 to –25°C in a non-defrostinrecommended to keep the enzyme on icetop coolers.

Note: For detailed information concerning restriction enzymes please visit: www.restrictio

Working with DNA1

Restriction Enzymes: Buffer System

SuRE/Cut Buffer System* – buffers supplied as 10x concentrated solutions:

Special incubation buffers** – buffers supplied as 2x concentrated solutions:

* Buffer system available from Roche Applied Science**Products available from Roche Applied Science

Final Concentration in mM

Buffer components A B L M H

Tris Acetate 33

Tris HCl 10 10 10 50

Magnesium Acetate 10

MgCl2 5 10 10 10

Potassium Acetate 66

NaCl 100 50 100

1,4-Dithioerythritol (DTE) 1 1 1

1,4-Dithiothreitol (DTT) 0.5

2-Mercaptoethanol 1

pH at 37°C 7.9 8.0 7.5 7.5 7.5

Final Concentration in mM

Buffer components Mae I Mae II Mae III Nde II

Tris HCl 20 50 20 50

NaCl 250 220 275 75

MgCl2 6 6 6 5

2-Mercaptoethanol 7 7 7

Bovine Serum Albumin (BSA)

100µg/ml

1,4-Dithiothreitol (DTT) 0,5

pH 8.0 (45°C)

8.8 (50°C)

8.2 (55°C)

7.6 (37°C)

12

leave – under non-optimal condi-r but not identical to the recognition

activity under certain non-optimized

oR V, Hind III, Hinf I, Kpn I, I, Taq I that star activity may be a general

v).

divalent cations of buffer system.

e as recommended by its suppliers.s recommended by its suppliers.is free of organic solvents that may r purification of the DNA.

1.4. Analyzing DNARestriction Enzymes: Star Activity

Definition The ability of restriction enzymes to ctions – DNA sequences that are similasite of the enzyme.

Enzymes affected The following enzymes can exhibit starconditions:● BamH I, BssH II, Dde I, EcoR I, Ec

Mam I, Pvu II, Sal I, Sau3A I, SgrAHowever, reports (see ref. 12) suggestproperty of all restriction enzymes.

Factors causing star activity

High glycerol concentration (> 5% v/Large excess of enzyme.Non-optimal ionic strength, pH and Presence of organic solvents.

Avoiding star activity Use the optimal buffer for each enzymUse the optimal amount of enzyme aMake sure that the DNA preparation have been used during isolation and/o

Working with DNA1 13

Restriction Enzymes: Reference Materials available

Learn more about our solutions for mapping & cloning by visiting our special interest site at:www.restriction-enzymes.com

Search for the needed restriction enzyme with the easy-to-use online tool Benchmate RE Finder at:www.roche-applied-science.com/benchmate

The Restriction Enzymes FAQS and Ordering Guide supplying technical information, includ-ing troubleshooting.

The comprehensive Restriction Enzyme Poster well known as the information source for com-mercially available restriction enzymes and their recognition sequences.

The Tools for Mapping and Cloning brochure supplying so-lutions to support you in your daily research.

available from your local Roche Applied Science representative

es:

ting. Please refer to the product r enzyme specific information.

ed by adding 0.5 M EDTA M.

m and once with chloroform, ropanol.

e phenol/chloroform extraction h Pure PCR Product Purification re PCR Cleanup Micro Kit

Roche Applied Science.

1.4. Analyzing DNARestriction Enzymes: Inactivation and removal

The following procedures can be applied to inactivate restriction enzym

Inactivation By heat treatment: Certain enzymes can be inactivated by heacharacteristics tables on the next pages foBy EDTA treatment:Alternatively, the enzyme can be inactivat(pH 8.0) to a final concentration of 10 m

Removal By phenol/chloroform extraction:Extract the sample with phenol/chloroforprecipitate the DNA with ethanol or iso-pBy silica absorption:Alternatively, the tedious and cumbersomprocedure can be omitted by using the HigKit (Cat. No. 11 732 668 001) or High Pu(Cat. No. 04 983 955 001) – available from

ed in bold.

ted buffer)

ted buffer)

ted buffer)

ted buffer)

ted buffer)

e “classical” 37°C

5°C unless otherwise stated)vious page for alternative procedures)

n

experiments

Cl, pH 8.3 at 20°C, 50 mM KCl, 1.5 mM MgCl2, final volume of 100 µl)

M VII / number of cleavage sites

14
Working with DNA1
Restriction Enzymes: Characteristics

Abbreviations and icons used in the tables:

Enzymes available from Roche Applied Science in dual concentrations are indicat

A Percentage activity of enzyme in SuRE/Cut buffer A (100% in bold prin

B Percentage activity of enzyme in SuRE/Cut buffer B (100% in bold prin

L Percentage activity of enzyme in SuRE/Cut buffer L (100% in bold prin

M Percentage activity of enzyme in SuRE/Cut buffer M (100% in bold prin

H Percentage activity of enzyme in SuRE/Cut buffer H (100% in bold prin

Incubation temperature of enzyme, temperatures in bold differ from th

HI Heat inactivation of enzyme:● Y: Indicates that the enzyme can be inactivated by heat (15 min at 6● N: Indicates that the enzyme cannot be inactivated by heat (see pre

MS Indicates sensitivity of enzyme for methylation● dcm+ : indicates that the enzyme is blocked by dcm methylation● dam+ : indicates that the enzyme is blocked by dam methylation● CG+ : indicates that the enzyme is blocked by eukaryotic methylatio● No indication: the enzyme is not sensitive to any form of methylation

PFGE Function tested for Pulse Field Gradient Electrophoreses● : the enzyme is function tested by Roche Applied Science for PFGE● No indication: the enzyme is not function tested

PCR Percentage of enzyme activity in a standard PCR Mix (= 10 mM Tris Hλ-substrate DNA, 200 µM dNTP’s and 2.5 U Taq DNA Polymerase in a

Sub Test substrate: λ = phage Lambda; P = pBR332, A = Adeno 2, M = MW

age 14)

HI MS PFGE PCR Sub

37 Y CG+ 25% λ / 10

37 N CG+ < 5% P/2

50 Ya λ / 58

50 N λ /40

37 N 20% λ / 20

37 Y 100% λ / 143

37 N P/3

30 Y dcm+, CG+ 100% λ / 1

37 N λ / 2

37 N 10% λ / 24

37 N dcm+ 100% λ / 2

37 Y λ / 9

37 Y CG+ 20% λ / 8

37 Y dcm+, CG+ < 5% λ / 35

37 N 30% λ / 15

37 N 100% λ / 5

37 Y λ / 7

37 N 100% λ / 3

1.4. Analyzing DNARestriction Enzymes: Characteristics (for abbreviations, see p

Sequence A B L M H

Aat II GACGT C 100 0–10 0–10 10–25 0–10

Acc I GT (A,C)(T,G)AC 100 0–10 10–25 0–10 0–10

Acs I (A,G) AATT(T,C) 50–75 100 0–10 75–100 50–75

Acy I G(A,G) CG(C,T)C 10–25 100 10–25 50–75 25–50

Afl III A C(A,G) (T,C)GT 50–75 75–100 50–75 75–100 100

Alu I AG CT 100 50–75 25–50 25–50 0–10

Alw44 I G TGCAC 100 25–50 75–100 100 10–25

Apa I GGGCC C 100 10–25 50–75 50–75 0–10

Asp I GACN NNGTC 50–75 100 25–50 75–100 75–100

Asp700 GAANN NNTTC 50–75 100 10–25 50–75 0–10

Asp718 I G GTACC 75–100 100 0–10 25–50 50–75

AspE I GACNNN NNGTC 10–25 10–25 100 25–50 0–10

Ava I C (T,C)CG(A,G)G 100 100 10–25 50–75 10–25

Ava II G G(A,T)CC 100 50–75 75–100 100 10–25

Avi II TGC GCA 50–75 75–100 10–25 50–75 100

BamH I G GATCC 100 100 75–100 100 25–50

Ban II G(A,G)GC(T,C) C 75–100 100 50–75 50–75 25–50

BbrP I CAC GTG 75–100 100 75–100 75–100 25–50

0 100 50 N dam+ λ / 8

0 25–50 37 Y 100% λ / 3

0 100 37 Y 30% λ / 29

0 100 37 N λ / 6

0 100 37 N λ / 2

0 50–75 37 N λ / 24

75 25–50 55 N λ / 24

00 100 55 Ya CG+ M/1

0 25–50 55 N λ / 176

0 100 65 N λ /46

75 100 48 N λ / 2

0 75–100 50 N CG+ 100% λ / 6

0 100 37 N CG+ λ / 3

75 50–75 60 N 100% λ / 13

25 100 45 N λ / 13

0 100 37 N λ / 6

75 25–50 37 N 100% λ / 215

H HI MS PFGE PCR Sub

15
Working with DNA1
Bcl I T GATCA 100 100 25–50 10

Bfr I C TTAAG 25–50 25–50 75–100 10

Bgl I GCC(N)4 NGGC 25–50 50–75 10–25 25–5

Bgl II A GATCT 100 100 25–50 10

Bln I C CTAGG 25–50 50–75 0–10 25–5

BpuA I GAAGAC(N)2/6 10–25 100 25–50 25–5

BseA I T CCGGA 75–100 100 0–10 50–

BsiW I C GTACG 25–50 100 10–25 75–1

BsiY I CCNNNNN NNGG 100 100 50–75 10

Bsm I GAATGCN N 0–10 50–75 0–10 25–5

BspLU11 I A CATGT 100 100 25–50 50–

BssH II G CGCGC 100 100 75–100 10

Bst1107 I GTA TAC 25–50 50–75 0–10 25–5

BstE II G GTNACC 75–100 100 25–50 50–

BstX I CCA(N)5 NTGG 10–25 100 0–10 10–

Cel II GC TNAGC 25–50 50–75 25–50 25–5

Cfo I GCG C 75–100 50–75 100 50–

Sequence A B L M

a Inactivation by heating to 75°C for 1 hour

Cla I 7 N CG+, dam+ 100% λ / 15

Dde I 7 N 40% λ / 104

Dpn I 7 N 100% P/22

Dra I 7 Y 100% λ / 13

Dra II 7 Y dcm+ P /4

Dra III 7 N 50% λ / 10

Eae I 7 Y CG+, dcm+ λ / 39

EclX I 7 N λ / 2

Eco47 II 7 Y CG+ λ / 2

EcoR I 7 Y 50% λ / 5

EcoR II 7 Y dcm+ A/136

EcoR V 7 N 10% λ / 21

Fok I 7 Y P /12

Hae II 7 N CG+ λ /48

Hae III 7 N 100% λ / 149

Hind II 7 Y 100% λ / 35

Hind III 7 Y 10% λ / 6

Hinf I 7 N 50% λ / 148

HI MS PFGE PCR Sub

1.4.ions, see page 14)

AT CGAT 100 100 75–100 100 100 3

C TNAG 50–75 75–100 25–50 25–50 100 3

GA TC 100 75–100 50–75 75–100 75–100 3

TTT AAA 100 75–100 100 100 50–75 3

(A,G)G GNCC(T,C) 100 50–75 100 50–75 0–10 3

CACNNN GTG 50–75 75–100 50–75 75–100 100 3

(T,C) GGCC(A,G) 100 25–50 75–100 50–75 10–25 3

C GGCCG 25–50 100 25–50 25–50 50–75 3

I AGC GCT 25–50 50–75 0–10 25–50 100 3

G AATTC 100 100 25–50 50–75 100 3

CC(A,T)GG 50–75 75–100 0–25 50–75 100 3

GAT ATC 25–50 100 0–10 25–50 50–75 3

GGATG(N)9/13 100 50–75 75–100 100 25–50 3

(A,G)GCGC (T,C) 100 50–75 25–50 50–75 10–25 3

GG CC 50–75 50–75 75–100 100 25–50 3

GT(T,C) (A,G)AC 100 100 25–50 100 50–75 3

A AGCTT 50–75 100 25–50 100 50–75 3

G ANTC 100 100 50–75 75–100 100 3

Sequence A B L M H

Analyzing DNARestriction Enzymes: Characteristics (continued) (for abbreviat

75 25–50 37 N CG+ 100% λ / 14

75 10–25 37 Y CG+ 40% λ / 328

0 100 37 Y λ / 380

50 0–10 37 N 50% λ / 2

0 0–10 37 N λ / 34

50 0–10 37 N λ /4

0 10–25 45 N λ/ 14***

50 75–100 50 N CG+ λ / 143

0 10–25 55 N λ / 156

00 100 37 Y dam+ 20% λ / 22

25 100 37 N CG+ < 5% λ / 7

25 0–10 37 Y λ / 18

75 0–10 37 N λ / 24

0 50–75 37 Y 40% λ / 328

0 10–25 37 N λ / 8

50 100 37 N λ / 71

0 10–25 37 N 30% λ / 157


16

hich are supplied with each enzyme

Working with DNA1

Hpa I GTT AAC 100 25–50 25–50 50–

Hpa II C CGG 50–75 25–50 100 50–

Ita I GC NGC 0–10 25–50 0–10 0–1

Kpn I* GGTAC C 75–100 10–25 100 25–

Ksp I CCGC GG 0–10 0–10 100 0–1

Ksp632 I CTCTTC(N)1/4 100 0–10 25–50 25–

Mae I** C TAG 25–50 25–50 0–10 0–1

Mae II** A CGT 0–10 25–50 0–10 25–

Mae III** GTNAC 0–10 10–25 0–10 0–1

Mam I GATNN NNATC 75–100 75–100 75–100 75–1

Mlu I A CGCGT 10–25 25–50 0–10 10–

MluN I TGG CCA 100 0–10 10–25 10–

Mro I T CCGGA 100 0–10 50–75 50–

Msp I C CGG 100 100 100 10

Mun I C AATTG 50–75 0–10 100 10

Mva I CC (A,T)GG 100 50–75 25–50 25–

Mvn I CG CG 50–75 0–10 50–75 10

Sequence A B L M

* Requires addition of bovine serum albumin, 100 µg/ml** Mae I, Mae II, Mae III and Nde II require special incubation buffers w*** referred to λcl 857Sam7

Nae I 7 Y CG+ P / 4

Nar I 7 Y CG+ A/ 20

Nco I 7 Y 50% λ / 4

Nde I 7 Y λ / 7

Nde II** 7 N dam+ λ / 116

Nhe I 7 Y CG+ 100% λ / 1

Not I 7 Y A/7

Nru I 7 Y dam+, CG+ 75% λ / 5

Nsi I 7 Y 100% λ / 14

Nsp I 7 N λ / 32

PinA I 7 Y λ / 13

Pst I 7 N 90% λ / 28

Pvu I 7 N CG+ < 5% λ / 3

Pvu II 7 N CG+ 100% λ / 15

Rca I 7 Y λ / 8

Rsa I 7 Y CG+ 100% λ / 113

Rsr II 7 N CG+ λ / 5

Sac I 7 Y 100% λ / 2

HI MS PFGE PCR Sub

1.4.ions, see page 14)

GCC GGC 100 0–10 100 0–10 0–10 3

GG CGCC 100 75–100 75–100 50–75 0–10 3

C CATGG 50–75 50–75 50–75 50–75 100 3

CA TATG 25–50 75–100 10–25 50–75 100 3

GATC 10–25 10–25 0–10 0–10 10–25 3

G CTAGC 100 25–50 100 100 10–25 3

GC GGCCGC 10–25 50–75 0–10 25–50 100 3

TCG CGA 10–25 100 0–10 10–25 75–100 3

ATGCA T 50–75 100 10–25 50–75 100 3

(A,G)CATG (T,C) 25–50 50–75 75–100 100 0–10 3

A CCGGT 100 100 10–25 50–75 50–75 3

CTGCA G 25–50 25–50 10–25 25–50 100 3

CGAT CG 50–75 75–100 25–50 50–75 100 3

CAG CTG 25–50 25–50 25–50 100 25–50 3

T CATGA 75–100 100 25–50 50–75 25–50 3

GT AC 100 50–75 100 50–75 0–10 3

CG G(A,T)CCG 75–100 10–25 100 75–100 0–10 3

GAGCT C 100 0–10 100 50–75 0–10 3

Sequence A B L M H

Analyzing DNARestriction Enzymes: Characteristics (continued) (for abbreviat

25 100 37 Y CG+ λ / 2

00 0–10 37 N CG+ 100% λ / 116

0 25–50 37 N dcm+, CG+ λ / 74

00 100 37 N < 5% λ / 5

25 50–75 37 Y dcm+ λ / 185

75 25–50 37 Y dcm+ λ / 5

0 25–50 50 N 10% A/ 3

0 100 37 N λ / 7

25 0–10 37 N λ / 6

0 0–10 25 Y CG+ 100% λ / 3

0 10–25 37 N CG+ 50% λ / 1

0 100 37 Y A/ 3

0 75–100 37 Y < 5% λ / 6

00 100 37 Y λ / 20

00 50–75 37 Y dcm+ 30% λ / 6

00 100 37 Y < 5% λ / 10


17

ich are supplied with each enzyme

Working with DNA1

Sal I G TCGAC 0–10 25–50 0–10 10–

Sau3A I GATC 100 25–50 25–50 75–1

Sau96 I G GNCC 100 50–75 25–50 25–5

Sca I AGT ACT 0–10 100 0–10 75–1

ScrF I CC NGG 10–25 100 10–25 10–

SexA I A CC(A,T)GGT 100 100 50–75 50–

Sfi I GGCC(N)4 NGGCC 25–50 25–50 75–100 10

Sfu I TT CGAA 25–50 50–75 10–25 25–5

SgrA I C(A,G) CCGG(T,C)G 100 0–10 100 10–

Sma I CCC GGG 100 0–10 0–10 0–1

SnaB I TAC GTA 75–100 25–50 100 10

Spe I A CTAGT 75–100 75–100 75–100 10

Sph I GCATG C 50–75 75–100 25–50 10

Ssp I AAT ATT 75–100 75–100 10–25 75–1

Stu I AGG CCT 100 100 100 75–1

Sty I C C(A,T)(A,T)GG 50–75 100 10–25 75–1

Sequence A B L M

b Inactivation by heating to 75°C for 15 min** Mae I, Mae II, Mae III and Nde II require special incubation buffers wh

Please n nchmate tool athttp://w

Swa I N A/ 1

Taq I N dam+ 100% λ / 121

Tru9 I N λ / 195

Van91 I Y λ / 14

Xba I N dam+ 60% λ / 1

Xho I N CG+ < 5% λ / 1

Xho II N P / 8

XmaC I N λ / 3

HI MS PFGE PCR Sub

1.4.s, see page 14)

ote: For detailed information concerning restriction enzymes, please consult our Beww.roche-applied-science.com/benchmate

ATTT AAAT 0–10 10–25 0–10 0–10 100 25

T CGA 50–75 100 25–50 50–75 50–75 65

T TAA 100 25–50 100 100 25–50 65

CCA(N)4 NTGG 25–50 100 0–10 25–50 0–10 37

T CTAGA 100 75–100 75–100 75–100 100 37

C TCGAG 25–50 75–100 10–25 25–50 100 37

(A,G) GATC(T,C) 50–75 25–50 100 75–100 0–10 37

C CCGGG 50–75 0–10 100 75–100 0–10 37

Sequence A B L M H

Analyzing DNARestriction Enzymes: Characteristics (continued) (for abbreviation

CC GTAC TATA TCGA TGCA TTAA

Csp6 I Taq I Tru9 I

e IIIviJ I Rsa I CviR I

1.4. Analyzing DNARestriction Enzymes: Cross index of recognition sequences

Palindromic tetra nucleotide sequences:

Sequences are written in 5´ to 3´direction, arrows indicate the point of cleavageEnzymes in blue recognize only 1 sequence, enzymes in black recognize multiple sequences

AATT ACGT AGCT ATAT CATG CCGG CGCG CTAG GATC GCGC GG

▼ Tsp509 IDpn IINde II

Sau3A I

▼ Mae II Msp IHpa II Mae I HinP1 I

▼ Alu ICviJ I

Mvn IFnuD II Dpn I Ha

C

▼ Cfo I

▼ Tai I Nla III Cha I

sequences

GC GC GG CC GT AC TA TA TC GA TG CA TT AA

Mae III

Sau96 I

Ita I

Fmu I

Tse I Ava II

Tsp45 I

19
Working with DNA1
Palindromic penta nucleotide sequences:

Sequences are written in 5´ to 3´direction, arrows indicate the point of cleavageEnzymes in blue recognize only 1 sequence, enzymes in black recognize multiple

AA TT AC GT AG CT AT AT CA TG CC GG CG CG CT AG GA TC▼ N BssK I

▼ N Dde I Hinf I▼N ScrF I

N▼ Tsp4C I

N ▼

N ▼

A▼ T EcoR II

A▼ T Tfi I

A▼T Mva I

AT▼

AT ▼

AT ▼

G▼ C

G▼ C

G▼C Nci I

GC▼

GC ▼

GC ▼

ntinued)

GTAC TATA TCGA TGCA TTAA

Asp718Ban I Sal I Alw44 I

Acc I Acc I

Bst1107 I Hinc II Hpa IHind II

Kpn I Bsp1286 IAsp HI

SspB I

Sfu I

Dra I

1.4. Analyzing DNARestriction Enzymes: Cross index of recognition sequences (co

Palindromic hexa nucleotide sequences:

Sequences are written in 5´ to 3´direction, arrows indicate the point of cleavageEnzymes in blue recognize only 1 sequence, enzymes in black recognize multiple sequences

AATT ACGT AGCT ATAT CATG CCGG CGCG CTAG GATC GCGC GGCC

G▼ C EcoR IAcs I

NgoM IVCfr10 I BssH II Nhe I BamH I

Xho IIKas IBan I Bsp120 I

G ▼ C Acy I Nar IAcy I

G ▼ C Ecl136 II EcoR V Nae I Sfo I

G ▼ C

G ▼C Aat II

Sac IBan IIAspH I

Bsp1286 I

Sph INsp I

Bbe IHae II

Apa IBan II

Bsp1286 I

T▼ A Rca IBseA IMro I

BsaW IXba I Bcl I Eae I

T ▼ A

T ▼ A SnaB IBsaA I Nru I Avi II MluN I

T ▼ A

T ▼A

uences

GC GGCC GTAC TATA TCGA TGCA TTAA

Cla IBspD I Asn I

47 III Stu I Sca I

e II Nsi I

EclX IEae I BsiW I Sfc I

Xho IAva I

BsoB ISml I

Sfc I Bfr ISml I

BsiE I

Pst I

20
Working with DNA1
Palindromic hexa nucleotide sequences:

Sequences are written in 5´ to 3´direction, arrows indicate the point of cleavageEnzymes in blue recognize only 1 sequence, enzymes in black recognize multiple seq

AATT ACGT AGCT ATAT CATG CCGG CGCG CTAG GATC GC

A▼ T Acs I Hind III BspLU11 IAfl III

PinA ICfr10 IBsaW I

Mlu IAfl III Spe I Bgl II

Xho II

A ▼ T Psp1406 I

A ▼ T Ssp I Eco

A ▼ T

A ▼T Nsp I Ha

C▼ G Mun INco ISty IDsa I

XmaC IAva I

BsoB IDsa I Bln I

Sty I

C ▼ G Nde I

C ▼ G BbrP IBsaA I

Pvu IIMspA1 I Sma I MspA1 I

C ▼ G Ksp I Pvu IBsiE I

C ▼G

usefulness because the number of possible as the number of restriction sites increases.

A module:

1 2 3 4 5 6

0 2 5 9 14 20

rtial-digestion products (F) of a linear DNA striction sites is given by the formula

1.4. Analyzing DNAPartial Digest

Please keep in mind that this method could be of limited partial digestion products quickly becomes unmanageable

For example, in a linear DN

number of restriction sites

number of possible partial-digestion products

In general, the number of pamolecule that contains N re

FN+1 = N2 + 3N

2

nto dsDNA thereby reducing enzymatic nucleases and resulting in a partial diges-

digest

Eppendorf tubes containing ethidium of 0, 0.02, 0.01, 0.002, 0.005 mg per ml

21
Working with DNA1
Principle Ethidium bromide intercalates iactivity of most restriction endotion of DNA.Pipetting scheme for RestrictionTotal reaction volume 50.0 µlplasmid DNA 2.0-5.0 µgRestriction enzyme 5 UnitsDistribute reaction mixture in 5bromide to final concentrationsIncubate at 37 °C for 20 minLoad on gel

onds between adjacent

0 mM ATP, pH 7.5 at 20°C.uots.ntrations of ATP negatively tion buffer, store at – 20°C

(Cat. No. 04 898 117 001) s fast and efficient dephospho- DNA fragments. The conven- and dephosphorylation in 10

sed – without further rmation of bacteria via

imilar in length: a molar recommended.

1.5. Cloning of DNALigation with T4 DNA Ligase*

Properties Catalyzes the formation of phosphodiester b3´-OH and 5´-P ends in dsDNA. Closes single-stranded nicks in dsDNA.Needs ATP as co-factor.

Ligation buffer, 10 x 660 mM Tris, 50 mM MgCl2, 50 mM DTT, 1Buffer is stable at –15 to –25°C, store in aliqNote: ATP is not stable and decreased conceinfluence the ligation efficiency: aliquot Ligaand add to ligation mix before use.

Tip The new Rapid DNA Dephos & Ligation Kitavailable from Roche Applied Science enablerylation and ligation of sticky- or blunt-endient kit enables ligation of DNA in 5 minutesminutes.Note: this kit contains PEG and cannot be upurification of the ligation mix – for transfoelectroporation.

Molar ratio of vector and fragment DNA

Sticky ends:● when vector DNA and insert DNA are ~ s

ratio of 1:3 (vector versus insert DNA) is

DNA are not similar in length: a molar sus insert DNA) is recommended. DNA to insert DNA of 1:5 is recommended.

A fragments:

is ligated, depending on type and

s ligated, depending on type and

ely inactivated by a 10 min incubation d only be applied if the ligation reaction other than transformation assays. Other-tor 20) transformants is possible.

U; Cat. No. 10 716 359 001 → 500 U)

nds Blunt ends

g digested DNA up to 1 µg digested DNA

3 µl

ts 1 – 5 units

o 30 µl Add up to 30 µl

, overnight 16 to 25°C, overnight

22
Working with DNA1
● when vector DNA and insert ratio of 1:1 or 1:2 (vector ver

Blunt ends: a molar ratio of vector

Application and typical results

Standard Assay: Ligation of DN

Sticky ends: > 95% of the DNA quality of restriction enzyme. Blunt ends: > 80% of the DNA iquality of restriction enzyme.

Inactivation of enzyme T4 DNA Ligase* can be completat 65°C. Heat inactivation shoulmixture is used in experiments wise, a drastic decrease of (> fac

* Product available from Roche Applied Science (Cat. No. 10 481 220 001→ 1000

Components Sticky e

Template DNA up to 1 µ

10 x Ligation buffer 3 µl

T4 DNA Ligase 1 – 5 uni

H2O Add up t

Incubation 4 to 16°C

otruding, 5 -́recessive and A and dsRNA. dephosphorylation of 5' phos-

, and proteins. erefore, restriction enzyme diges-ation, ligation, or 5'-end labeling teps.

C.

Alkaline Phosphatase is rapidly, y heat treatment for two minutes rnative to Shrimp Alkaline Phos-

enzyme digestion, dephosphoryl-an be performed in one single

apid DNA Dephos & Ligation Kit

1.5. Cloning of DNADephosphorylation with rAPid Alkaline Phosphatase

Properties Catalyzes the dephosphorylation of 5 -́pr5´ blunt ends from ssDNA, dsDNA, ssRNrAPid Alkaline Phosphatase catalyzes thephates from DNA and RNA, nucleotidesIs active in restriction enzyme buffers; thtion, dephosphorylation, enzyme inactivcan be performed without purification s

Dephosphorylation buffer, 10 x

0.5 M Tris, 50 mM MgCl2, pH 8.5 at 20°Buffer is stable at –15 to –25°C.

Inactivation of enzyme

Unlike calf intestinal phosphatase, rAPidcompletely, and irreversibly inactivated bat +75°C. It is therefore an excellent altephatase.The total procedure including restrictionation, enzyme inactivation and ligation ctube by using Roche Applied Science’s R(Cat. No. 04 898 117 001)

tion of 5´ends of dsDNA fragments or DNA prior to the insertion of DNA

ive or protruding ends blunt ends

0.2 pmol

2 µl

1 unit

to 20 µl Add up to 20 µl

at 37°C 30 min at 37°C

23
Working with DNA1

Standard Assay: Dephosphorylato prevent self-annealing of vectfragments.

Components recess

Template DNA 1 pmol

10 x rAPid Alkaline Phosphatase buffer, 10x conc.

2 µl

rAPid Alkaline Phosphatase 1 unit

H2O Add up

Incubation 10 min

essed ends:

C A G A A T T 3ÓH

G T C T T A A 5´P

C A G 3ÓH

G T C 5´P

A Polymerase Mung Bean Nuclease

1.5. Cloning of DNAModifying sticky ends to blunt ends: 5´protruding and 3´rec

5´P C A G 3ÓH 5´P

3ÓH G T C T T A A 5´P 3ÓH

5´P C A G 3ÓH 5´P

3ÓH G T C T T A A G 5´P 3ÓH

Klenow T4 DNA Polymerase T7 DN

Fill-in 3´recessed ends

Remove 5´protruding ends

essed ends:

A G C T G C A 3ÓH

T C G A C G T 5´P

A C G 3ÓH

T C G 5´P

T7 DNA Polymerase Mung Bean Nuclease

24
Working with DNA1
Modifying sticky ends to blunt ends: 3´protruding and 5´rec

5´P A G C T G C A 3ÓH 5´P

3ÓH T C G 5´P 3ÓH

5´P A G C T G C A 3ÓH 5´P

3ÓH T C G 5´P 3ÓH

Klenow T4 DNA Polymerase

Fill-in 5´recessed ends

Remove 3´protruding ends

-5éxonuclease activity catalyzing NTPs to the 3ÓH terminus of a

0 mM DTT, 500 µg/ml BSA.aliquots.

A T T 3ÓH

T A A 5´P

G C T 3ÓH

C G A 5´P

3ÓH

A G 5´P

1.5. Cloning of DNAKlenow* – for partial or complete filling of 3´recessed ends

Properties DNA dependent 5´-3´polymerase with 3´the addition of mononucleotides from dprimer/template DNA.

Filling buffer, 10 x 500 mM Tris (pH 7.5), 100 mM MgCl2, 1Buffer is stable at –15 to –25°C, store in

5´P G 3ÓH 5´P G A

3ÓH C T T A A 5´P 3ÓH C T

5´P A 3ÓH 5´P A A

3ÓH T T C G A 5´P 3ÓH T T

5´P 3ÓH 5´P G A

3ÓH C T A G 5´P 3ÓH C T

dATPdTTP

dNTP

dATPdGTP

lete filling of 3´recessed ends.

at to 65°C for 10 min.

01→ 500 U; Cat. No. 11 008 404 001→ 100 U; No. 03 622 614 001→ 4 x 1,250 µl (125 µmol).

e.

illing Partial filling

1 µg DNA

ireda dNTPs each 1 mM of desireda dNTPs each

2 µl

1 unit

0 µl Add up to 20 µl

°C 15 min at 37°C

25
Working with DNA1

Standard Assay: Partial or comp

Inactivation of enzyme Add 2 µl 0.2 M EDTA and/or he

* Products available from Roche Applied Science (Klenow: Cat. No. 11 008 412 0Set of dNTPs, PCR-Grade: Cat. No. 11 969 064 001→ 4 x 250 µl (25 µmol); Cat.

a Note: Please only add the desired dNTPs as needed according to the sequenc

Components Complete f

Template DNA 1 µg DNA

Nucleotides*, final concentration

1 mM of des

10 x Filling buffer 2 µl

Klenow* 1 unit

H2O Add up to 2

Incubation 15 min at 37

ends

5´-phosphoryl oligo- and

are relatively resistant to the

NaCl, 10 mM zinc acetate,

aliquots

3ÓH

5´P

3ÓH

5´P

1.5. Cloning of DNAMung Bean Nuclease – for removing of 3ánd 5´protruding

Properties Degrades ssRNA and ssDNA to produce mononucleotides.dsDNA, dsRNA and DNA: RNA hybrids enzyme.

Nuclease buffer, 10x 300 mM sodium acetate, pH 4.6, 500 mM0.01% Triton X-100.Buffer is stable at –15 to –25°C, store in

5´P A A T T C 3ÓH 5´P

3ÓH C T T A A 5´P 3ÓH

5´P T G C A 3ÓH 5´P

3ÓH A C G T 5´P 3ÓH

nds of DNA creating blunt ends.

ion of 1 mM or SDS to a final

Removing ends

1 µg DNA

10 µl

5 units

Add up to 100 µl

1 hour at 25°C

26
Working with DNA1

Standard Assay: Removing 5´ and 3´protruding e

Inactivation of enzyme Add EDTA to a final concentratconcentration of 0.01%.

Components

Template DNA

10 x Nuclease buffer

Mung Bean Nuclease

H2O

Incubation

res, please refer to

ith plasmids.

other bacteria.

a-competent Escherichia coli. 75–76le from different suppliers

ms and kits are available from

ms: 001): for cloning blunt-end PCR

392 001): for cloning blunt-end

1.5. Cloning of DNAMiscellaneous

Competent cells and transformation

For an overview of the different procedu● Hanahan, D. (1983)

Studies on transformation of E. coli wJ. Mol. Biol. 166, 557–579

● Hanahan, D. et al. (1991) Plasmid tranformation of E. coli and Methods in Enzymology 204, 63–113

● Hengen, P. N. (1996) Methods and reagents, Preparing ultrTrends in Biochemical Sciences 21(2),

Ready-to-use competent cells are availabcommercially.

Commercially available cloning kits

A wide variety of different cloning systedifferent suppliers.Roche Applied Science offers three syste● PCR Cloning Kit (Cat. No. 11 939 645

products up to 10 kb● Expand Cloning Kit (Cat. No. 11 940

PCR products from 7 to 36 kb

n Kit (Cat. No. 04 898 117 001): enabling nd fragments within 5 minutes. 175–191) for a complete overview.

(rB- mB-) gal

. Mol. Biol., 189, 113.)

uB6 lacY1 tonA21; . Biol. 166, 557.)

ZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1; . Biol. 166, 557.)

14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1; l. Biol. 166, 557.)

7 gyrA96 relA1 thi Δ(lac-proAB); 985) Gene 33, 103.)

7 gyrA96 relA1 thi Δ(lac-proAB) F’[traD36proAB+, erron, C. et al., (1985) Gene 33, 103.)

galK galT ara tonA tsx dam dcm supE44 Δ (lac-proAB)

M15];

985) Gene 33, 103.)

27
Working with DNA1
● Rapid DNA Dephos & Ligatioligation of sticky and blunt-e

Please refer to reference 6 (page

Commonly used bacterial strains

Strain Genotype

BL21 E. coli B F- dcm ompT hsdS

(Studier, F.W. et al (1986) J

C600e supE44 hsdR2 thi-1 thr-1 le

(Hanahan, D. (1983) J. Mol

DH5α supE44 Δ(lacU169 (φ80dlac

(Hanahan, D. (1983) J. Mol

HB101 supE44 hsdS20 recA13 ara-

(Hanahan, D., (1983) J. Mo

JM108 recA1 supE44 endA1 hsdR1

(Yanisch-Perron, C. et al., (1

JM109 recA1 supE44 endA1 hsdR1

lacIq lacZΔM15]; (Yanisch-P

JM110 rpsL (Strr) thr leu thi-l lacY

F’[traD36proAB+, laclq lacZΔ(Yanisch-Perron, C. et al., (1

s and references of the most r to “Molecular Biology LABFAX, lishers, ISBN 1 872748 00 7”.

notype

(1986) Proc.Natl. Acad.Sci USA, 83, 9070.;.)r) lac, Δ(hsdRMS)B+ lacIq lacZΔM15 Tn10 (tetr);

proAB+, lacIq lacZΔM15];ridge University, U.K.)

i relA1 lac F’[proAB+,t al., (1987) BioTechniques, 5, 376.)

1.5. Cloning of DNACommonly used bacterial strains (continued)

Commonly used E. coli strains

For a detailed overview on the genotypecommonly used E. coli strains, please refeedited by T.A. Brown, Bios scientific pub

Strain Ge

K802 supE hsdR gal metB; (Raleigh, E. et al.,Wood, W.B. (1966) J. Mol. Biol., 16,118

SUREr recB recJ sbc C201 uvrC umuC:Tn5(kan

endA1 gyrA96 thi relA1 supE44 F’[proA(Greener, A. (1990) Strategies, 3, 5.)

TG1 supE hsd Δ5 thi Δ(lac-proAB) F’[traD36

(Gibson, T.J. (1984) PhD Theses. Camb

XL1-Bluer supE44 hsdR17 recA1 endA1 gyrA46 th

lacIq lacZΔM15 Tn10 (tetr) ]; (Bullock e

Notes


, the better the labeling efficiency.od, it is critical that the template ed prior to the labeling reaction.

:Dot Blot, …)rt, oligonucleotide, …)py gene detection, …) the different methods n.

d be removed from the

igh Pure PCR Product 01→ up to 250 purifications) or Cat. No. 04 983 955 001→ up to tation.nol precipitation with glycogen* s*.n of the incorporated label experiments.

1.6. Labeling of DNA and OligonucleotidesGeneral Considerations

Template The higher the purity of the DNA templateFor the random primed DNA labeling methis linearized and completely heat-denatur

Choice of labeling method

The choice of labeling method depends on● the type of application (e.g., Southern, ● the available template (e.g., cloned inse● the requested sensitivity (e.g., single coThe table on page 30 gives an overview ofand their sensitivity for a given applicatio

Purification of labeled probe

Unincorporated labeled nucleotides shoullabeling mix:● removal from DNA fragments via the H

Purification Kit* (Cat. No. 11 732 676 0the High Pure PCR Cleanup Micro Kit (50 purifications) or via ethanol precipi

● removal from oligonucleotides: via etha(20 µg/reaction) or Quick Spin column

This enables a more accurate quantificatioand reduces background in hybridization

* Products available from Roche Applied Science

s have been developed. The use of these fluorescein, …) offer several advantages:ghly sensitive faster (in minutes rather than in hours or

er period of time compared to radioactive

e reused several timesoactive systems available from fer to reference 3, 10 and 14.

A please visit:

29
Working with DNA1
Type of label Several non-radioactive methodlabels (e.g., digoxigenin, biotin, ● The technology is safe and hi● Results can be achieved much

days)● Probes can be stored for a long

probes● Hybridization solutions can bFor an overview of the non-radiRoche Applied Science, please re

Note: For detailed information concerning labeling and detection of DNA and RNhttp://www.roche-applied-science.com/dig

es

Relative sensitivity

eling +++

+++

++

++

eling +++

+++

+++

+++

1.6. Labeling of DNA and OligonucleotidOverview of different techniques

Application Labeling Methods

Southern Blotting

Northern Blotting

Random Primed Lab

PCR labeling

5´ End labeling

3´ End labeling

Dot/Slot Blotting Random Primed Lab

PCR labeling

5´ End labeling

3´ End labeling

+++

+++

+++

+++

+++

++

++

++


30
Working with DNA1
Colony/Plaque hybridisation Random Primed Labeling

PCR labeling

5´ End labeling

3´ End labeling

In Situ Hybridisation PCR labeling

5´ End labeling

Nick Translation

3´ End labeling

Application Labeling Methods

No

te: RN

A probes are recom

mended for

detecting low-abundance m

RN

A.

RN

AD

NA

RN

AR

NA

Is your TAR

GET

DN

A or R

NA

?

Is your PRO

BE

DN

A, R

NA

, or OLIG

O?

Is your PRO

BE

DN

A, R

NA

, or OLIG

O?

DIG

No

rthern

Starter K

it*C

at. No. 12 039 672 910

DIG

RN

A Lab

eling

Kit (S

P6

/T7)

Cat. N

o. 11 175 025 910

DIG

RN

A Lab

eling

Mix

Cat. N

o. 11 277 073 910

DN

AD

NA

YES

OLIG

O(R

ecomm

ended only forabundant targets)

OLIG

O(R

ecomm

ended only forabundant targets)

PCR

RPL

PCR

RPL

Do you w

ant to use PCR

orR

andom Prim

ed Labeling?

Do you w

ant to use PCR

orR

andom Prim

ed Labeling?

Is the Oligonucleotide

already synthesized?

DIG

Olig

on

ucleo

tide 3

´-En

d Lab

eling

Kit, 2

nd

gen

eration

Cat. N

o. 03 353 575 910

DIG

Olig

on

ucleo

tide

Tailing

Kit, 2

nd

gen

eration

Cat. N

o. 03 353 583 910

PC

R D

IG P

rob

e Syn

thesis K

itC

at. No. 11 636 090 910

DIG

-Hig

h P

rime D

NA

Labelin

gan

d D

etection

Starter K

it II*C

at. No. 11 585 614 910

DIG

-Hig

h P

rime

Cat. N

o. 11 585 606 910

DIG

DN

A Lab

eling

Kit

Cat. N

o. 11 175 033 910

*Note: Th

ese kits inclu

de lab

eling

reagen

ts and

detection

sub

strate.

1.6. Labeling of DNA and OligonucleotidesDIG Labeling of Nucleic Acids

Chem

iluminescent

Colorim

etric

Kits

Reagents

Reagents

Kits

CD

P-S

tar, ready-to

-use

Cat. N

o. 12 041 677 001

CS

DP, read

y-to-u

seC

at. No. 11 755 633 001

NB

T/BC

IP S

tock S

olu

tion

Cat. N

o. 11 681 451 001

NB

T/BC

IP, read

y-to-u

se Tablets

Cat. N

o. 11 697 471 001

Do you w

antindividual reagents or

convenient detection kits?

Do you w

antindividual reagents or

convenient detection kits?

Do you w

ant chemilum

inescentor colorim

etric visualization?

31
Working with DNA1*N
ote: These kits in

clud

e labelin

greag

ents an

d d

etection su

bstrate.

DIG

Nu

cleic Acid

Detectio

n K

it,C

olo

rimetric

Cat. N

o. 11 175 041 910

DIG

-Hig

h P

rime D

NA

Labelin

gan

d D

etection

Starter K

it I*C

at. No. 11 745 832 910

DIG

Lum

inescen

t Detectio

n K

itC

at. No. 11 363 514 910

DIG

-Hig

h P

rime D

NA

Labelin

gan

d D

etection

Starter K

it II*C

at. No. 11 585 614 910

DIG

No

rthern

Starter K

it*C

at. No. 12 039 672 910

For a complete overview

, please refer to references 3, 10 and 14 thus visit:http://w

ww

.roche-applied-science.com/dig

ture of all possible hexa-that needs to be labeled.m the 3ÓH termini of the erase activity of Klenow

DTT and 2 mg/ml BSAuots.

5°C and immediately

3ÓH5´P

nneal random hexanucleotides

3ÓH

5´P

nzyme + dNTP*

3ÓH

5´P

1.6. Labeling of DNA and OligonucleotidesRandom Primed Labeling with Klenow

Principle Based on the random hybridization of a mixnucleotides to the ssDNA form of the DNA The complementary strand is synthesized frohexanucleotide primers using the 5´-3´polym

Labeling buffer, 10 x 500 mM Tris (pH 7.2), 100 mM MgCl2, 1 mMBuffer is stable at –15 to –25°C, store in aliq


DNA is denatured by heating for 10 min at 9put on ice

5´P3ÓH ➩

Denature, a

5´P

3ÓH➩

Klenow E

5´P

3ÓH

* Incorporation of 1. Non-radioactive nucleotides: digoxigenin, biotin, fluorochromes2. Radioactive nucleotides: [32P], [35S], [3H]

mix on ice :

ed: from 200 up to 50,000 bp.ges from 80 – 200 bp.

nd/or heat to 65°C for 10 minutes.

labeled in buffers containing EDTA

med DNA Labeling Kit lable from Roche Applied Science.

ve Radioactive*

NA 10 ng – 2 µg DNA

, dCTP, dGTP each, 25 µM of dATP, dGTP, dTTP each

otin- or ** UTP

[α32P]dCTP (3,000 Ci/mmol), 50 µCi (1.85 MBq)

2 µl

2 units

2 µl

l Add up to 20 µl

at 37°C 30 min at 37°C

32
Working with DNA1
Standard assay – prepare reaction

Size of DNA fragment to be labelSize of labeled DNA fragment ran

Inactivation of enzyme Add 2 µl 0.2 M EDTA (pH 8.0) a

Tip Do not solubilize the DNA to be since EDTA inhibits the reaction.Optimized kits (e.g., Random PriCat. No. 11 004 760 001) are avai

** For a complete overview, please refer to references 10 and 14.

Components Non-radioacti

Template DNA 10 ng – 3 µg D

Nucleotides, final concentration

100 µM of dATP65 µM dTTP

Labeled nucleotide, final concentration

35 µM DIG-, BiFluorochrome-d

10 x Hexanucleotide mix (62.5 A260 units/ml)

2 µl

Klenow enzyme 2 units

10 x Labeling buffer 2 µl

H2O Add up to 20 µ

Incubation at least 60 min

uce random nicks in dsDNA at esence of Mg2+.s DNA complementary to the the 3ÓH termini of the nicks as the enzyme simultaneously re-thesis that are replaced by nucleo-

0 mM DTT, 500 µg/ml BSA.aliquots.

5´P

3ÓH

3ÓH

5´P

▼

nickMoving of the nick towards the 3 -́terminus

3ÓH

5´P

1.6. Labeling of DNA and OligonucleotidesNick Translation with DNA Polymerase I and DNAse I

Principle Based on the ability of DNAse I to introdlow enzyme concentrations and in the prThe E. coli DNA Polymerase I synthesizeintact strand in the 5´-3´direction using primers. The 5´-3éxonuclease activity ofmoves nucleotides in the direction of syntides supplemented to the reaction.

NT Buffer, 10 x 500 mM Tris (pH 7.4), 100 mM MgCl2, 1Buffer is stable at –15 to –25°C, store in

* Incorporation of 1. Non-radioactive nucleotides: digoxigenin, biotin, fluorochromes2. Radioactive nucleotides: [32P], [35S], [3H]

5´P

3ÓH

3ÓH

5´P

First nucleotide on the 5 -́phosphate side of the nick has been removed

5´P

3ÓH

3ÓH

5´P

▼

A nick with a 3´-OH terminus

Replacement of removed nucleo-tide by labeled dNTP*

5´P

3ÓH

▼

nick

n mix on ice:

m/µg) is obtained after 30 min. I determines the efficiency of the reaction. Roche Applied Science.

led: from 400 bp to 800 bp.

and/or heat to 65°C for 10 minutes.

e.g., Cat. No. 11 745 808 910) and different kit ) are available from Roche Applied Science.

ive Radioactive*30 ng – 2 µg

, dCTP, dGTP each, 20 µM of dATP, dGTP, dTTP each

iotin- or **UTP

[α32P]dCTP (3,000 Ci/mmol), 20 µCi (0.74 MBq)2 µl

2 µll Add up to 20 µl

30 min at 15°C

33
Working with DNA1

Standard Assay – prepare reactio

* An incorporation rate of > 65% (~3 x 108 dpa The ratio of DNA Polymerase I versus DNAse

A special optimized mixture is available from

Size of DNA fragment to be labe

Inactivation of enzyme Add 2 µl 0.2 M EDTA (pH 8.0)

Tip Premixed Nick Translation mixes (systems (Cat. No. 10 976 776 001

** For a complete overview, please refer to references 10 and 14.

Components Non-radioactTemplate DNA 30 ng – 2 µgNucleotides, final concentration

100 µM of dATP60 µM dTTP


40 µM DIG-, Bfluorochrome-d

Mixture of DNA Poly-merase I and DNAse Ia

2 µl

10 x NT buffer 2 µlH2O Add up to 20 µIncubation 90 min at 15°C

tion of dNTPs or ddNTPs to onucleotides.

— pNpNpN3́ OH

— pN3́ H

5́ P pNpNpN3́ OHpNpN 5́ P

5́ P pN3́ H3́ HpN 5́ P

enin, biotin, fluorochromes

2.5 mg/ml BSA, pH 6.6 at 25°C.aliquots.

1.6. Labeling of DNA and Oligonucleotides3Énd labeling with Terminal Transferase

Principle Catalyzes the template independent addithe 3ÓH ends of ds and ssDNA and olig

5́ P ——

5́ P ——— 3́ OH

5́ P ——

3ÓHpN5́ P 3́ OH

3́ OH 5́ P

incorporation of– Non-radioactive deoxy- or dideoxynucleotides: digoxig– Radioactive deoxy- or dideoxynucleotides: [32P]

Transferase buffer, 10 x

2 M potassium cacodylate, 250 mM Tris,Buffer is stable at –15 to –25°C, store in

ddNTP

dNTP

ddNTP

dNTP

mix on ice:

ease refer to reference 10.

d/or heat to 75°C for 10 minutes.

ing kits are available from Roche Applied

(Cat. No. 03 333 574 001→ 24,000 U;

Ps 3´ End labeling with ddNTPs

´ends 10 to 100 pmol 3´ends

0 Ci/mmol), 50 µCi [α32P]ddNTP (3000 Ci/mmol), 50 µCi (1.85 MBq)

tin or fluorochrome th 500 µM dATP*P or dTTP*

or dCTP*

50 µM Dig, Biotin or fluorochrome dUTP

M mM

5 mM

400 units

2 µl

Add up to 20 µl

15 min at 37°C

34
Working with DNA1

Standard Assay – prepare reaction

* For more information on length of tail, type of tail (homo- or heteropolymeric), pl

Inactivation of enzyme Add 2 µl 0.2 M EDTA (pH 8.0) an

Tip DIG Tailing and DIG 3’End LabelScience.

Product available from Roche Applied Science: Terminal Transferase, recombinant Cat. No. 03 333 566 001→ 8,000 U)

Components Tailing with dNT

Template DNA 10 to 100 pmol 3

Radioactive nucleotides, final concentration

[α32P]dNTP (300(1.85 MBq)

Non-radioactive nucleotides, final concentration

– 50 µM Dig, Bio dUTP mixed wi

– 6.25 µM of dAT– 5 µM of dGTP

CoCl2 A or T Tails: 1.5 mG or C Tails: 0.75

Terminal Transferase* 400 units

10 x transferase buffer 2 µl

H2O Add up to 20 µl

Incubation 15 min at 37°C

osphate group of ATP to the .

roups of ds and ssDNA and RNA.ps from the 3´termini of ds and

—— 3́ OH

—— 3́ OH

—— 3́ OH

TA, 50 mM dithiothreitol,

aliquots.

, 1 mM EDTA, 50 mM ADP, pH 6.6 at 25°C.aliquots.

1.6. Labeling of DNA and Oligonucleotides5´End labeling with Polynucleotide Kinase

Principle Catalyzes the transfer of the terminal ph5´OH termini of ds and ssDNA and RNACatalyzes the exchange of terminal 5´P gCatalyzes the removal of phosphate groussDNA and RNA.

5́ OH ——— 3́ OH 5́ P —

5́ P ——— 3́ OH 5́ P —

5́ P ——— 3́ P 5́ P —

Phosphorylation buffer,10 x

500 mM Tris, 100 mM MgCl2, 1 mM ED1 mM spermidine, pH 8.2 at 25°C. Buffer is stable at –15 to –25°C, store in

Exchange buffer, 10 x 500 mM Imidazole-HCl, 100 mM MgCl2

dithiothreitol, 1 mM spermidine, 3 mM Buffer is stable at –15 to –25°C, store in

A–P–P

A–P–P–P

n mix on ice:

of [32P] from [γ32P]ATP is incorporated.P] from [γ32P]ATP is incorporated.

nge reaction by putting the sample on ice.

, lacking the 3´phosphatase activity is ience (Cat. No. 10 709 557 001→ 200 U;0 U).

5´OH groups Exchange of 5´P groups

20 pmol of 5´P termini

40 pmol [γ32P]ATP

10 units

n buffer,10 x 2 µl, Exchange buffer, 10 x

Add up to 20 µl

30 min at 37°C

35
Working with DNA1

Standard Assay – prepare reactio

Phosphorylation: More than 30%Exchange: More than 10% of [32

Inactivation of enzyme Stop phosphorylation and excha

Tip A special Polynucleotide Kinaseavailable from Roche Applied ScCat. No. 10 838 292 001 → 1,00

Components Phosporylation of

Template DNA 20 pmol 5´OH ends

nucleotides, final concentration

20 pmol [γ32P]ATP

Polynucleotide Kinase

10 units

buffer 2 µl, Phosphorylatio

H2O Add up to 20 µl

Incubation 30 min at 37°C

tting devices can be contaminated DNA or by purified restriction

uring isolation of nucleic acids.ons.

esh gloves. re, plasticware and pipettes to NA.

ration through a 0.22 µm filter.s and solutions and use them only n small aliquots.mponents without DNA) and

een successfully used in previous

1.7. Amplification of DNAAvoiding Contamination

Sources Laboratory benches, equipment and pipeby previous DNA preparations, plasmid enzyme fragments.Cross-contaminations between samples dProducts from previous PCR amplificati

Sample handling Use sterile techniques and always wear frAlways use new and/or sterilized glasswaprepare the PCR reagents and template DSterilize all reagents and solutions by filtHave your own private set of PCR reagentfor PCR reactions. Store these reagents iAlways include a negative (all reaction coa positive control (e.g., a PCR that has bexperiments).

ing places for

ipettes, micro-centrifuges and disposable

.ume hood (with UV light).

36
Working with DNA1
Laboratory facilities Set up physically separated work● template preparation ● setting up PCR reactions ● post-PCR analysisUse dedicated (PCR use only) pgloves.Use aerosol resistant pipette tipsSet up a PCR reaction under a f

nces the outcome of the PCR. chelate Mg2+ and reduce the yield

s (organic substances: phenol, fficiency of the reaction.r procedure specially designed to 7).

lar weight., run an aliquot on an agarose gel.

ongly influences the performance

or a standard PCR isDNA

on the application and the allowed lower the amount of template, the e probability for errors within the

1.7. Amplification of DNAReaction Components: Template

Purity The purity of the template largely influeLarge amounts of RNA in the sample canof the PCR. Impure templates may contain inhibitorchloroform, ethanol) that decrease the eAlways use a purification product and/opurify DNA for PCR reactions (see page

Integrity Template DNA should be of high molecuTo check the size and integrity of the DNA

Amount The amount of template in a reaction strof the PCR. The recommended amount of template f● maximum 500 ng of human genomic ● 1 – 10 ng of bacterial DNA● 0.1 – 500 ng of plasmid DNAThe optimal amount of template depends error rate within the amplified DNA: the higher the cycle number and the higher thamplified DNA.

equire specific reaction modifications like ign of primers, etc.

clude a positive control with primers that ame size and produce a good yield. TE buffer since EDTA chelates Mg2+.

r water to dissolve the template.

37
Working with DNA1
Lower amounts of template will rchanges in cycle numbers, redes

Tip When testing a new template, inamplify a product of about the sAvoid to dissolve the template inUse 5–10 mM Tris (pH 7 – 8) o

istribution of G/C and A/T rich

.the 3´ends to avoid primer-dimer

[4°C x (number of G and C bases)] culate melting temperature) for

to 10°C lower than the Tm values d empirically. g temperature of 55 – 65°C is mperatures of 62 – 72°C.

1.7. Amplification of DNAReaction Components: Primers

General Length: 18 to 24 nucleotides.GC content: 40 – 60%, with a balanced ddomains.Contain no internal secondary structureAre not complementary to each other at forming.

Melting temperature Estimation of melting temperature Tm:Tm = [2°C x (number of A and T bases)] + see page 164 (Chapter 6.2. Formulas to calmore information.Design primers with similar Tm values.

Annealing temperature Optimal annealing temperatures are ~ 5 of the primers and have to be determineDesign primers as such that an annealinallowed, for maximum specificity, use te

0.6 µM are generally optimal.values into pmol values of primers.

ote mispriming and accumulation

hausted before the reaction is completed, esired product.

ized primers in a small volume of 5 mM –25°C.ated freezing and thawing, prepare small at –15 to –25°C.

de a positive control reaction with n PCR.

38
Working with DNA1
Concentrations of primers

Concentrations between 0.1 andRefer to page 39 to convert µM Higher concentrations may promof non-specific products.Lower concentrations may be exresulting in lower yields of the d

Storage Stock solutions: dissolve lyophilTris, pH 7.5 and store at –15 to Working solution: to avoid repealiquots of 10 pmol/µl and store

Tip When testing new primers, inclua template that has been tested i

ormulas

0 µg/ml H2O

C x 288.2) + (NT x 303.2) + Pcleotide in the oligonucleotide

leotideucleotide

g

olx

1=

µg (of oligo) x 3,030

pg N N

gx N =

pg

1.7. Amplification of DNAReaction Components: Oligonucleotides: Commonly used F

Concentration 1 A260 Unit of an Oligonucleotide: 20 – 3

Molecular Weight (in Dalton)

MW = (NA x 312.2) + (NG x 328.2) + (NNX = number of residues of respective nu

P = + 17 for phosphorylated oligonucP = – 61 for dephosphorylated oligon


e.g., 1 µg of a 20 bases oligo = 151.5 pmol


= pmol (of oligo) x N x 3.3 x 10-4

e.g., 1 pmol of a 20 bases oligo = 0.0066 µ

N = number of bases

pmol of oligo = µg (of oligo) x106 pg

x1 pm

1 µg 330

µg of oligo = pmol (of oligo) x330 pg

x1 µ

1 pmol 106

39

= X pmol primers

µM for experiment: 2 pmol

ution = 2.5 pmol

ion = X µM primers

mol/µl for experiment: 5 µM

r solution = 20 µM primers

Working with DNA1

Conversion of µM to pmol

1 µl of a X µM primer solution example:● Question:

– given primer solution: 2.5 – amount of primers needed

● Answer: – 1 µl of a 2.5 µM primer sol– 2 pmol = 0.8 µl

Conversion of pmol to µM

1 µl of a X pmol/µl primer solutexample:● Question:

– given primer solution: 20 p– amount of primers needed

● Answer: – 1 µl of a 20 pmol/µl prime– 5 µM = 0.25 µl

des tutorials, lectures and tips on

ft.comelibrary.com

CR.htmprimer: d-science.com/benchmate

lidating any list of “useful” sites.

1.7. Amplification of DNASoftware

Software* Sample of web sites that proviprimer design:● Primer design software:

– http://www.premierbioso– http://www.universalprob– http://molbiol-tools.ca/P

● Calculating Tm for a given – http://www.roche-applie

* Web sites continually appear, disappear and change addresses, quickly invaAll of the web sites given here were operating in May, 2007.

with dNTPs and template DNA to he polymerase recognizes.

s depends on the concentrations of com-hates (PPi) and EDTA (e.g. from to the ions via their negative charges.

2+ should always be higher than the con-

ould be determined empirically and

oncentration is 1.5 mM, with a dNTP

rease non-specific primer binding and nd of the reaction.result in a lower yield of the desired

11 636 138 001) – available from easy and straightforward optimization of

40
Working with DNA1
Reaction Components: MgCl2 concentration

Function of Mg2+ ions Mg2+ ions form soluble complexes produce the actual substrate that t

Concentration of Mg2+ ions

The concentration of free Mg2+ ionpounds like dNTPs, free pyrophospTE buffer). These compounds bindTherefore, the concentration of Mgcentration of these compounds.The most optimal concentration shmay vary from 1 mM to 5 mM.The most commonly used MgCl2 cconcentration of 200 µM each.Excess Mg2+ in the reaction can incincrease the non-specific backgrouToo little Mg2+ in the reaction can product.

Tip A PCR Optimization Kit (Cat. No.Roche Applied Science – allows an this reaction component

four dNTPs to minimize the error rate. TP should be between 50 and 500 µM, ation is 200 µM.en increasing the concentration of rations reduces the concentration of he activity of the polymerase enzyme. substituted by dUTP. A three times , 600 µM) compared with the other od amplification. ique, please refer to reference 6.

C.ture of 10 mM of each nucleotide)

vailable from Roche Applied Science – ensure optimal results and maximum

1.7. Amplification of DNAReaction Components: dNTP concentration

Concentration of dNTP

Always use balanced solutions of allThe final concentration of each dNthe most commonly used concentrIncrease concentration of Mg2+ whdNTPs. Increases in dNTP concentfree Mg2+ thereby interfering with tFor carry-over prevention, dTTP ishigher concentration of dUTP (e.g.nucleotides normally results in a goFor more information on this techn

Storage Store stock solutions at –15 to –25°Working solutions (e.g., 100 µl mixare also stored at –15 to –25°C.

Tip Special PCR grade nucleotides* – aare specially purified and tested to sensitivity in all PCR applications.

* see reference 7.

e 6)

ong Range PCR

3 x 2 x

no no

no no

pand Long

Template

CR System

Expand 20kbPLUS

PCR System

41
Working with DNA1
Reaction Components: Choice of Polymerase (see also referenc

High Fidelity PCR LBasic PCR

Diffi cult Template PCR

Hot Start PCR

Specifi city

Sensitivity

Robustness

Accurracy* 1 x 4 x 3 x 18 x 6 x

Carryover Prevention

yes yes yes no no yes

Master Mix available

yes yes no no yes yes

Taq DNA

Polymerase

FastStart Taq

DNA

Polymerase

FastStart

High Fidelity

PCR System

GC-RICH

PCR System

Pwo

SuperYield DNA

Polymerase

Expand High

FidelityPLUS

PCR System

Ex

P

35 kb

30 kb

25 kb

20 kb

15 kb

10 kb

5 kb3 kb1 kb

Length

* compared to Taq DNA Polymerase

1.7. Amplification of DNAReaction Components: Hot Start Techniques

Principle Taq DNA Polymerase has a low activity at temperatures used to mix the dif-ferent reaction components (e.g., at room temperature or at 4 °C).At these temperatures, the primers may anneal non-specifically and the polymerase may elongate these primers prior to the initial cycle resulting in a series of non-specific amplification products.The hot start technique prevents these non-specific products.

Techniques Manual: 1 component – such as the polymerase or Mg2+ - is only added to the reaction tube after the temperature is > 70 °C.Polymerase Antibodies: The polymerase is inactivated by a heat-sensitive antibody. As the temperature rises in the tube, the antibody is inactivated, setting the active polymerase free.Chemical Modification of Polymerases: Addition of heat-labile blocking groups to some amino acids renders the Taq DNA Polymerase inactive at room temperature. At higher temperatures, these blocking groups are

removed and the enzyme is activated (e.g., FastStart Taq DNA Polymerase (Cat. No. 12 032 937 001) available from Roche Applied Science).

Working with DNA1

Reaction Components: Other factors

Concentration of Polymerase

For most assays, the optimal amount of thermostable DNA Polymerase – or blend of polymerases – is between 0.5 and 3.5 units per 50 µl reaction volume.Increased enzyme concentrations sometimes lead to decreased specificity.

pH In general, the pH of the reaction buffers supplied with the corresponding thermostable DNA Polymerase (pH 8.3 – 9.0) gives optimal results.For some systems, raising the pH may stabilize the template and improve the reaction.

Reaction additives In some cases, the following compounds can enhance the specificity and/or efficiency of a PCR:● Betaine (0.5 – 2 M)● Bovine Serum Albumin (100 ng/50 µl reaction mix)● Dimethylsulfoxide (2 – 10%, v/v)● Glycerol (1 – 5%, v/v)● Pyrophosphatase (0.001 – 0.1 units/reaction)● Spermidine, Detergents, Gelatine, T4 Gene 32 protein● Formamide (2 – 10%)

42

late DNA completely by initial eating for 2 minutes at 94 – 95°C DNA.tured, it will tend to “snap-back”

primer annealing and extension, ad to false positive results.

econds is usually sufficient but nd tubes being used.w, the incompletely melted DNA annealing and extension.r denaturation temperature for

an absolutely required, reases the activity of the

erature is a very critical factor for most purposes – has to be

ing occurs.

1.7. Amplification of DNACycling Profile for standard PCR

Initial denaturation It is very important to denature the tempheating of the PCR mixture. Normally, his enough to denature complex genomicIf the template DNA is only partially denavery quickly thereby preventing efficientor leading to “self-priming” which can le

Denaturation during cycling

Denaturation at 94 – 95°C for 20 to 30 smust be adapted for the thermal cycler aIf the denaturation temperature is too lo“snaps back”, preventing efficient primerUse a longer denaturation time or higheGC rich template DNA.Never use a longer denaturation time thunnecessary long denaturation times decpolymerase.

Primer annealing The choice of the primer annealing tempin designing a high specificity PCR and –optimized empirically (see page 38).If the temperature is too high, no anneal

n-specific annealing will increase

ry bases, primer – dimer effects will occur.

r extension is carried out at 72°C. oximately 60 bases per second at 72°C.nt for fragments up to 1 kb.

o 3 kb, allow about 45 seconds per kb. justed for specific templates.xtension feature of the cycler:nsion time (e.g., 45 seconds for a 1 kb

tension time by 2 – 5 seconds per cycle 55 seconds for cycle 12, ...)time to do its job because, as PCR plate to amplify and less active enzyme rotein during the prolonged high PCR extension.

43
Working with DNA1
If the temperature is too low, nodramatically.If the primers have complementa

Primer extension For fragments up to 3 kb, primeTaq DNA Polymerase adds apprA 45 second extension is sufficieFor extension of fragments up tHowever, this may need to be adTo improve yield, use the cycle e● first 10 cycles: a constant exte

product)● next 20 cycles: increase the ex

(e.g., 50 seconds for cycle 11,● this allows the enzyme more

progresses, there is more tem(due to denaturation of the ptemperatures) to perform the

late molecules can be amplified able by gel electrophoresis.cycles.products can accumulate.

tubes are held at 72°C for f partial extension products and tary products.t the samples on ice or store

1.7. Amplification of DNACycling Profile for standard PCR (continued)

Cycle number In an optimal reaction less than 10 tempin less than 40 cycles to a product detectMost PCR’s should only include 25 – 35 As cycle number increases, non-specific

Final extension Usually, after the last cycle, the reaction 5 – 15 minutes to promote completion oannealing of single-stranded complemenAfter the final extension, immediately puat 4°C.

Working with DNA1

1.7. Amplification of DNAStandard Pipetting Scheme

Mix 1 (for 1 reaction): Mix 2 (for 1 reaction):

Combine mix 1 and 2 in a thin-walled PCR tube. Gently vortex the mixture to produce a homogenous reaction, then centrifuge briefly to collect the sample at the bottom of the tube. Standard pipetting scheme applies for enzymes like Taq DNA Polymerase, and Tth DNA Polymerase, and Pwo SuperYield DNA Polymerase.

Reagent Final concentration

H20 variable

10 mM PCR Nucleotide Mix 1 µl Each dNTP, 200 µM

Upstream and downstream

primer

variable 0.1 – 0.6 µM each

Template DNA variable 0.1 – 0.25 µg

Volume 25 µl

Reagent Taq PCR Final concentration

H20 19.75 µl

Enzyme buffer, 10 x conc

5 µl 1 x

Enzyme (5U/µl) 0.25 µl 1.25 units

Volume 25 µl

44

Standard PCR Temperature Profile

Profile A: Profile B*:

a The exact annealing temperature depends on the melting temperature of the primers* This profile ensures a higher yield of amplification products

Temperature TimeCycle

number

Initial denaturation 94°C 2 min

DenaturationAnnealingElongation

94°C50 – 65°Ca

72°C

15 – 30 s30 – 60 s

45 s – 3 min25 – 30

Final elongation 72°C 7 min

Temperature TimeCycle

number

Initial denaturation

94°C 2 min


94°C50 – 65°Ca

72°C

15 – 30 s30 s

45 s – 3 min10


94°C50 – 65°Ca

72°C

15 – 30 s30 s*

45 s – 3 min +5 added seconds/cycle

15 – 20

Final elongation

72°C 7 min

Notes


e, PCR is the ideal technique to

en nucleic acid of interest was de-ve PCR, PCR ELISA, limiting dilu-

nt analysis and have several

mplified molecules mplification cycles

1.8. Quantitative Real-Time PCRMethods

Introduction Due to its sensitivity and dynamic rangquantify nucleic acids. Traditionally, the quantification of a givtermined by methods such as: competitition PCR, radioactive methods. These methods are based upon end-poilimitations.

End-point analysis

N: number of an: number of a

lification curves. Each curve has 3 seg-

ase

ble for quantitative PCR because it is done e the reaction no longer follows exponen-ion can no longer be described by a math-ssible to directly correlate the end-point

unt or target copy number. Further, in the ases steadily, because reaction compounds are accumulating. These effects vary fromrent end-point signals.

ive method for both qualitative and quan-lysis allows the amplification and fluores-ed by a single instrument in a single tube

l-time PCR instrument measures the accu-g amplification with fluorescent dyes.

ction of PCR products occur in the same lso called "homogeneous PCR".

46
Working with DNA1
The figure above shows typical ampments:

Background phase. Exponential - or log-linear - phPlateau phase

End-point analysis is not very suitain the "plateau phase" of PCR whertial kinetics. In this phase, the reactematical formula. Thus, it is not posignal with the initial template amoplateau phase, PCR efficiency decreare being consumed and inhibitorssample to sample, resulting in diffe

Real-Time PCR Real-time PCR offers an alternattitative analysis. This type of anacent detection steps to be performwith data recorded online. A reamulation of PCR products durinBecause PCR itself and the detereaction (vessel), this set-up is a

n of specific nucleic acid sequenc-lers.

everal features that make it the ide-CR as well as mutation analysis in

eagents, technical support, and ap-

e from Roche Applied Science:l-Time PCR System (LightCycler®

201).ptimized for two fluorescence de-ybProbe probes. In addition, the f other fluorescence detection for-e probes, hydrolysis probes, and scence resonance energy transfer).

1.8. Quantitative Real-Time PCRInstrument-based Systems

Principles of Real-Time PCR

Simultaneous amplification and detectioes via fluorescence-detecting thermocyc

LightCycler® System The LightCycler® System incorporates sal tool for qualitative and quantitative Pgeneral laboratory applications.It includes instrumentation, software, rplication-specific kits.Two real-time PCR systems are availabl● The Carousel-based LightCycler® Rea

2.0 Instrument, Cat. No.: 03 531 414● The LightCycler® 2.0 Instrument is o

tection formats: SYBR Green I and Hinstrument supports a wide variety omats, such as monocolor SimpleProbother formats based on FRET (fluore

l block cycler for either 96- or 384-well ument, Cat. No.: 04 640 268 001 96 well,

4 well).setup enables the use of all current generic , High Resolution Melting dye) and probes be probes, Hydrolysis probes).

nt, reagents and software please refer to www. lightcycler480.com.

47
Working with DNA1
● The LightCycler® 480 thermaplates (LightCycler® 480 InstrCat. No.: 04 545 885 001 38The LightCycler® 480 System DNA dyes (e.g., SYBR Green I(HybProbe probes, SimplePro

For details concerning instrumehttp://www.lightcycler.com and

this fluorescence signal to the r detecting and evaluating PCR methods fall into two classes, se-ding assays. Each has its uses and

ting dye.

product is quantitatively recorded

EX, or VIC.

1.8. Quantitative Real-Time PCRReal-Time PCR Assay Formats

All real-time PCR systems detect a fluorescent dye, and then correlateamount of PCR product in the reaction. There are several methods foproducts fluorimetrically. The most commonly used fluorescent assayquence-independent detection assays and sequence-specific probe binits limitations.

SYBR Green I Double stranded [ds] - specific intercala

Hybridization Probes The presence of a specific amplification by an increase in fluorescence.

SimpleProbe Probes Single-label probe with fluorescein.

Hydrolysis Probes TaqMan® technology using, e.g., FAM, H

48

Notes

Working with DNA1

een I) that bind to all double-

greatly increases. During the dif-ending on the amount of dsDNA

A

B

1.8. Quantitative Real-Time PCRSequence-Independent Detection Assays

SYBR Green I FormatSequence-independent assays rely on fluorophores (typically SYBR Grstranded DNA molecules regardless of sequence.When the SYBR Green I dye intercalates into dsDNA, its fluorescence ferent stages of PCR, the intensity of the fluorescent signal will vary, depthat is present.

During annealing, PCR primers hybridize to the target and form small regionsof dsDNA where SYBR Green I intercalates; the fluorescent signalslightly increases.

In the elongation phase, more dsDNA is formed and more SYBR Green I dyecan intercalate; higher fluorescent signal.

ed andence is

C

49
Working with DNA1
At the end of the elongation phase, all DNA has become double-strandthe maximum amount of SYBR Green I is intercalated. The fluorescmeasured (530 nm) at the end of each elongation phase.

to their complementary sequence ommonly used probe formats are gle-labeled probes (e.g., SimpleP-ured by the real-time PCR instru-s frequently used.f fluorescence resonance energy

r involves transfer of energy from e donor and the acceptor are in

nor by blue light results in energy light of a longer wave-length. Ex-erlap fluorescence emission spec-

quantitative PCR and mutation lly designed oligonucleotides that uence of an amplified fragment

1.8. Quantitative Real-Time PCRSequence-Specific Probe Binding Assays

FRET PrincipleSequence-specific assays rely on oligonucleotide probes that hybridize in the target PCR product and thus only detect this specific product. Chydrolysis probes, hybridization probes (e.g., HybProbe probes) or sinrobe probes). The probes are coupled to fluorophores that can be measment. Several other detection formats are available as well, but are lesThe unique LightCycler® HybProbe format is based on the principle otransfer (FRET).

FRET Fluorescence Resonance Energy Transfea donor to an acceptor fluorophore. If thvery close proximity, excitation of the dotransfer to the acceptor, which can emit citation spectrum of the acceptor must ovtrum of the donor (see figure below).

HybProbe Format The HybProbe format is suitable for both(SNP) detection assays. It uses two speciahybridize, side by side, to an internal seqduring the annealing phase of PCR.

ceptor-n doesistance

A frag- by theergy toluores-scence

placedrandedT to oc-

A

B

C

50
Working with DNA1
The donor-dye probe is labeled with fluorescein at the 3´ end and the acdye probe is labeled with LightCycler® Red at the 5´ end. Hybridizationot take place during the denaturation phase of PCR and, thus, the dbetween the dyes is too large to allow energy transfer to occur.

During the annealing phase, the probes hybridize to the amplified DNment in a close head-to-tail arrangement. When fluorescein is excitedlight from the LED, it emits green fluorescent light, transferring the enLightCycler® Red, which then emits red fluorescent light. This red fcence is measured at the end of each annealing step, when the fluoreintensity is highest.

After annealing, the temperature is raised and the HybProbe probe is disduring elongation. At the end of this step, the PCR product is double-stand the displaced HybProbe probes are again too far apart to allow FREcur.

t altered during PCR. At the end equent melting curve experiment

htCycler® System Roche Applied

ffer from HybProbe probes in one robe is needed. This single probe terest. Once hybridized, the Sim-is not hybridized to its target. As on status of the probe.

A

1.8. Quantitative Real-Time PCRSequence-Specific Probe Binding Assays (continued)

One of the advantages of the detection format is that the probes are noof amplification, both probes are still intact and may be used in a subs(e.g., for mutation detection or SNP analysis).For the design of primers and hybridization probes for use with the LigScience offers the LightCycler® Probe Design Software.For more details please refer to www.lightcycler.com

SimpleProbe FormatSimpleProbe probes are a special type of hybridization probes. They diimportant way: instead of two probes working together, only a single phybridizes specifically to a target sequence that contains the SNP of inpleProbe probe emits a greater fluorescent signal than it does when it a result, changes in fluorescent signal depend solely on the hybridizati

During the denaturation phase no hybridization takes place, thus, only a lowfluorescence background is detected at 530 nm.

y at

aced.

and the

B

C

D

51
Working with DNA1
During the annealing phase, the probe hybridizes to the amplified DNAfragment and is no longer quenched. Fluorescein, when excited by theLightCycler® LED, emits green fluorescent light which is measured onlthe end of each annealing step at maximum intensity.

During the subsequent elongation step, the SimpleProbe probe is displ

At the end of the elongation step, the PCR product is double stranded displaced SimpleProbe probe is again quenched.

hnically be described as homoge-be, which is cleaved during PCR NA sequence. This single probe

r, in close proximity to each other. rter dye to suppress the reporter

ng PCR, the 5´nuclease activity of d quencher. In the cleaved probe,

when excited.

A


Hydrolysis Probe FormatHydrolysis probe assays, conventionally called "TaqMan"assays, can tecnous 5´nuclease assays, since a single 3´ non-extendable Hydrolysis proamplification, is used to detect the accumulation of a specific target Dcontains two labels, a fluorescence reporter and a fluorescence quencheWhen the probe is intact, the quencher dye is close enough to the repofluorescent signal (fluorescence quenching takes place via FRET). Durithe polymerase cleaves the Hydrolysis probe, separating the reporter anthe reporter is no longer quenched and can emit a fluorescence signal

The probe carries two fluorescent dyes in close proximity, with the quencherdye suppressing the reporter fluorescence signal. The 3' end of the Hydrolysisprobe is dephosphorylated, so it cannot be extended during PCR. During dena-turation the target double-stranded DNA is separated.

g PCR. Thus, these probes cannot be used equires a different experimental approach

l to the

e. Theity, dis-rize the

ore cantCyclerdirectly

B

C

D

52
Working with DNA1
Unlike HybProbe probes, hydrolysis probes are digested durinin a subsequent melting curve experiment. This type of assay rfor detecting a mutation or SNP.

In the annealing phase of PCR, primers and probes specifically anneatarget sequence.

As the DNA polymerase extends the primer, it encounters the probpolymerase then cleaves the probe with its inherent 5´ nuclease activplaces the probe fragments from the target, and continues to polymenew amplicon.

In the cleaved probe, the reporter dye is no longer quenched and therefemit fluorescent light that can be measured by one channel of the Lighoptical unit, Thus, the increase in fluorescence from the reporter dye correlates to the accumulation of PCR products.

ysis probe format is the Universal e. The Universal ProbeLibrary

d, real-time PCR probes that can ipt in the transcriptomes of hu-

. elegans, and Arabidopsis.ProbeLibrary Sets can detect 95-

. This almost universal coverage s) of the Universal ProbeLibrary classic, 25- to 35-nucleotide hy-ity, Tm and assay compatibility plex-stabilizing DNA analogue n the sequence of each probe.ibrary probe can bind to around

s detected by around 16 different ed in a given PCR assay, a specifi-hosen.ibrary probe and specific PCR a simple two-step procedure that is available online at the Assay

belibrary.com).


Universal ProbeLibrary A sophisticated application of the hydrolProbeLibrary from Roche Applied Scienccontains 165 prevalidated, double-labelebe used to quantify virtually any transcrmans, mice, rats, primates, Drosophila, CEach of the organism-specific Universal 99% of all transcripts from that organismis due to the length (only 8-9 nucleotideprobes. Each probe is much shorter thandrolysis probes. To maintain the specificthat hybridization probes require, the duLNA (Locked Nucleic Acid) is included iBecause it is short, each Universal ProbeL7,000 transcripts, while each transcript iprobes. Yet, only one transcript is detectcity ensured by the set of PCR primers cSelection of the correct Universal ProbeLprimers for a given real-time PCR assay isinvolves the ProbeFinder Software, whichDesign Center (http://www.universalpro

e compatible with all instruments capable AM and/or SYBR Green I. Universal sed successfully on the LightCycler® tCycler® 480 System and other real-time

uppliers.

niversal ProbeLibrary, and the Transcrip-y you design and perform real-time qPCR

dye choose in addition the new FastStart For two-step real-time RT-PCR using the s Master. be ideally combined on the 4 991 885 001).

53
Working with DNA1
Universal ProbeLibrary assays arof detecting fluorescein, FITC, FProbeLibrary assays have been uCarousel-Based System, the LighPCR instruments from several s

The powerful combination of the ProbeFinder Software, the Utor First Strand cDNA Synthesis Kit, can revolutionize the waassays.For instruments requiring normalization with Rox reference Universal Probe Master (Rox) from Roche Applied Science. LightCycler® Instruments choose the LightCycler® 480 ProbeFor One-Step RT-PCR, the Universal ProbeLibrary probes canLightCycler® 480 System Master Hydrolysis probes (Cat.No, 0

ith an internally quenched fluor-hen they bind to a target nucleic to the middle of the expected am-ealing temperature of the PCR.lecularbeacons.com

with an integral tail which is used er thus containing a fluorophore

arated from the PCR primer by a ces to be copied during PCR. Dur-rls back to hybridize to the target f the scorpion and the PCR prod-NA, a fluorescence signal is

1.8.Quantitative Real-Time PCROther Assay Formats

Molecular beacons Hairpin-shaped oligonucleotides oligos wophore whose fluorescence is restored wacid. The loop portion is complementaryplicon and the stem is formed at the annFor more details refer to http://www.mo

Scorpions Technology based on a stemloop primer to probe an extension product of the primand a quencher. The stemloop tail is sepstopper which prevents stemloop sequening the annealing step the Scorpion tail cusequence in the PCR product. As the tail ouct are now part of the same strand of Dgenerated.

54

Notes

Working with DNA1

asic types, absolute and relative es differently.

centration of the target molecule pies, µg/µl, etc.). Absolute quan-calculated from external standard rmine the concentration of the n absolute quantification assay standards and the unknowns are iciency.ery suitable for applications in vi- to determine the copy number of of absolute gene copy numbers.

ation can be combined with inter- results.

et concentration is expressed as a me sample, rather than an abso-

gulated nucleic acid that is found

1.8. Quantitative Real-Time PCRPrinciples of Quantification

Quantification analysis in real-time PCR can be subdivided into two bquantification. Each type uses the experimentally determined CP valu

Absolute quantification In absolute quantification assays, the conis expressed as an absolute value (e.g., cotification methods use a standard curve, samples of known concentration, to detetarget molecule in the unknown. Thus, asystem produces valid results only if the amplified and detected with the same effApplication: Absolute Quantification is vrology and microbiology where you needa specific target, or for the determinationIn a dual-color set-up, absolute quantificnal standards to detect any false negative

Relative quantification In relative quantification assays, the targratio of target-to-reference gene in the salute value. The reference gene is an unreat constant copy number in all samples.

correct the sample for differences in qual-n initial sample amount, cDNA synthesis etting errors. Because the quantity of a nction only of the PCR efficiency and the ys do not require a standard curve in each

RNA expression levels or determination

of calibrator-normalized relative all real-time PCR systems from

hods, visit www.lightcycler.com.

55
Working with DNA1
Relative quantification methodsity and quantity like variations iefficiency, or sample loading/piptarget and a reference gene is a fusample crossing point, these assaanalysis run.Application: Quantification of mof gene dosis values.

Relative Quantification software, which enables performance quantification with PCR efficiency correction, is available forRoche Applied Science.

For more detailed and up-to-date descriptions of quantitative real-time PCR met

xternal andards thout a librator

Without efficiency correction

Calibrator normalized

relative quantification

Relative Quantification

With efficiency correction

1.8. Quantitative Real-Time PCRPrinciples of Quantification (continued)

EStwica

External Standards

with internal control (dual color

detection)

External Standards

(mono color detection)

Absolute Quantification

Notes


s (including the LightCycler® Car-ence changes during temperature

s to be followed in real-time. This yes (e.g., SYBR Green I) or se- probes), and can be added at the

I is used for product characteriza-d PCR product is free of nonspe-haracterized by melting curve NA molecule has a characteristic of the DNA is double-stranded uring a melting curve run, the re-which causes dsDNA to melt. A nce occurs when the temperature t in the reaction. with Rox reference dye choose the aster (Rox) from Roche Applied

1.8. Quantitative Real-Time PCRMelting Curve Analysis

Besides monitoring the PCR process online, real-time PCR instrumentousel-Based System and LightCycler® 480 System) can monitor fluoresctransitions. This allows the annealing and denaturation of nucleic acidprocedure, called melting curve analysis, uses either dsDNA-specific dquence-specific oligonucleotide probes (e.g., HybProbe or SimpleProbeend of PCR.

Melting Curve Analysis with SYBR Green I

Melting curve analysis with SYBR Green tion, i.e. to determine whether the desirecific by-products. PCR products can be canalysis because each double-stranded Dmelting temperature (Tm), at which 50%and 50% is melted, i.e. single-stranded. Daction mixture is slowly heated to 95°C, sharp decrease in SYBR Green I fluorescereaches the Tm of a PCR product presenFor instruments requiring normalizationnew FastStart Universal SYBR Green MScience.

h HybProbe probes, one HybProbe oligo-f the target sequence that is not mutated; r. The other HybProbe oligonucleotide

pans the mutation site and has a Tm ap-the anchor probe. As the temperature in-obe dissociates first. When this happens, and the fluorescence signal decreases. Be-ybrid depends not only on the length and also on the degree of homology in the hy-arate at a higher Tm than those that are

tabilizing mismatch.

l-Based System and LightCycler® 480 Sys-abeled probes as they melt off a target se-

elting of short duplexes, such as hybrids ay can identify even single base alterations gle Nucleotide Polymorphisms (SNPs) or

57
Working with DNA1
Genotyping with Hyb-Probe and SimpleProbe Probes and SNP Detec-tion

In a genotyping experiment witnucleotide hybridizes to a part othis probe functions as an ancho(mutation or detection probe) sprox. 5°C lower than the Tm of creases, the shorter mutation prthe two dyes are no longer closecause the Tm of a probe-target hthe GC content of the probe, butbrid, perfectly bound probes sepbound to DNA containing a des

The precise temperature control of the LightCycler® Carousetem allow these instruments to monitor specific fluorescent-lquence. When melting curve analysis is used to monitor the mbetween HybProbe or SimpleProbe probes and target, the assin the amplicon. Thus, this is an ideal tool for detection of Singenotyping.

A dyes (e.g., LightCycler® 480 NA Sequence in a saturating

, sharp signals during melting tics can be used to detect subtle (e.g., SNPs, mutations), or within lex from homoduplex DNA to

a plate and its optical system, the uisition and analysis of melting er® 480 High Resolution Melting d. Sequence variants resulting in

tected using LightCycler® 480 3 908 001).hods supported on the figure below.

1.8. Quantitative Real-Time PCRMelting Curve Analysis (continued)

High resolution melting curve analysis

A new class of non-sequence specific DNResoLight dye)bind to double-stranded Dmanner and therefore give very uniformcurve analysis. These binding characterisdifferences in sequence between samples a sample (e.g., to differentiate heterodupidentify heterozygotes). Due to its uniform thermal profile acrossLightCycler® 480 System enables the acqcurves at high resolution. The LightCyclMaster is available to support this methodifferent melting curve shapes can be deGene Scanning Software (Cat. No. 05 10An overview of melting curve-based metLightCycler® 480 System is shown in the

om.

58

canningFluorescence labeled Probes for Genotyping

Working with DNA1

For up-to-date information on genotyping methods, visit www.lightcycler480.c

High Resolution Melting Dye for Gene SSYBR Green I for Product Identification

1.9. References

1. Ausubel, F. M. et al., (1991) In: Current Protocols in Molecular Biology. John Wiley and Sons, New York2. Brown, T. A. (1991) In: Molecular Biology LabFax. Bios Scientific Publishers, Academic Press3. Nonradioactive In Situ Hybridisation Application Manual (2002) Roche Applied Science4. Nucleic Acid Isolation and Purification Manual (2002) Roche Applied Science5. Roche Applied Science, Technical Data Sheets6. PCR Application Manual (2006) Roche Applied Science7. PCR Grade Deoxynucleotides (2001) Roche Applied Science8. Rolfs, A. et al., (1992) PCR Clinical Diagnostics and Research. New York: Springer Verlag9. Sambrook. J., Fritsch, E. J. and Maniatis, T. (1989) In: Molecular Cloning, A Laboratory Manual, 2nd edition.

Cold Spring Harbor Laboratory Press10. The DIG Application Manual for Filter Hybridisation (2001) Roche Applied Science11. Molecular Weight Markers for Nucleic Acids (2000) Roche Applied Science12. Nasri, M. et al., (1986) Nucleic Acid Research 14, 81113. Frey, B. et al., (1995) Biochemica 2, 8 – 914. DIG Product Selection Guide (2007) Roche Applied Science15. LightCycler® System (2004) Roche Applied Science

Working with RNAChapter 2

2.1. Precautions for handling RNA ....................................... 602.2. Commonly used formulas ................................................ 632.3. Isolating and purifying RNA ........................................... 652.4. Analyzing RNA .................................................................... 682.5. RT-PCR ................................................................................... 702.6. Labeling of RNA .................................................................. 792.7. References ............................................................................ 81

han working with DNA, because d the ubiquitous presence of

l ion co-factors and can maintain utoclaving. taken when working with RNA.

NA. aces and equipment to avoid ated material.

nly. ith commercially available

s with 100% ethanol.

an be cleaned with 1% SDS, te ethanol and finally soaked in EPC-treated H2O before use.

2.1. Precautions for handling RNA

General Information Working with RNA is more demanding tof the chemical instability of the RNA anRNases. Unlike DNases, RNases do not need metaactivity even after prolonged boiling or aTherefore special precautions should be

Gloves and contact Always wear gloves when working with RAfter putting on gloves, don’t touch surfreintroduction of RNases to decontamin

Workspace and working surfaces

Designate a special area for RNA work oTreat surfaces of benches and glassware wRNase inactivating agents. Clean benche

Equipment and disposable items

Use sterile, disposable plasticware.Electrophoresis tanks for RNA analysis crinsed with H2O, then rinsed with absolu3% H2O2 for 10 min. Rinse tanks with D

° – 200°C for at least 4 hours. icient to eliminate RNases.e free plasticware.oak (2 h, 37°C) in 0.1 M NaOH/1 mM 1% SDS), rinsed with DEPC treated min.th DEPC treated H2O overnight at room 0 min. to destroy unreacted DEPC.

, 5 min in 1 M NaOH, and rinse with

60
Working with RNA2
Glass and plasticware Glassware should be baked at 180Autoclaving glassware is not suffUse commercially available RNasIf plasticware should be reused, sEDTA (or absolute ethanol with H2O and heated to 100°C for 15 Corex tubes should be treated witemperature, then autoclave for 3

Cleaning of pH electrodes

Incubate for 30 s in 70% ethanolDEPC-treated H2O.

DEPC = diethylpyrocarbonate

.only: Wear gloves, use baked eigh paper.-treated H2O (see page 155).

obtaining samples. or samples that have been red at – 70°C. This procedure limiting the activity of

stabilized with commercial

ice.

), available from Roche Applied Science


Reagents Purchase reagents that are free of RNasesReserve separate reagents for RNA work spatulas and untouched weigh boats or wAll solutions should be made with DEPC

Handling fresh and stored material before extraction of RNA

Extract RNA as quickly as possible after For best results, use either fresh samplesquickly frozen in liquid nitrogen and stominimizes degradation of crude RNA byendogenous RNases.Blood and bone marrow samples can be available stabilization reagentsa.All required reagents should be kept on

a e.g., RNA/DNA Stabilization Reagent for Blood and Bone Marrow (Cat. No. 11 934 317 001

protect RNA from degradation during all downstream applications.tor is a eukaryotic protein that inactivates ersible binding.tive during cDNA synthesis and can e Inhibitor which is active up to 60°C.d solutions with strong denaturing tain reducing conditions (1 mM DTT) 65°C.d and vanadyl-ribonucleoside complexes.

or isopropanol at – 70°C. Most RNA is re.y centrifugation and resuspend in

r.

ice when preparing an experiment.

hanol precipitation. oom temperature in a clean space.

o. 03 335 399 001→ 2000 U;

61
Working with RNA2
RNase inhibitors RNase inhibitors* can be used toisolation and purification and inThe most commonly used inhibiRNases, via a non-covalent and revUse an RNase Inhibitor that is acprotect RNA, like Protector RNasTo keep the inhibitor active, avoiagents such as SDS or urea, mainand hold the temperature below Other inhibitors include macaloi

Storage of RNA Store RNA, aliquoted in ethanol relatively stable at this temperatuRemove ethanol or isopropanol bthe appropriate RNase-free buffeStore cDNA if possible.

Manipulation of RNA Always keep the RNA sample on

Drying RNA Avoid overdrying of RNA after etDry in vacuum or for 15 min at r

* Product available from Roche Applied Science: Protector RNase Inhibitor (Cat. NCat. No. 03 335 402 001→ 10000 U)

er or H2O and incubate the tube e or vortex with care.

tips.

es, therefore, avoid high ect the integrity of the RNA. to 65°C for 15 min.


Dissolving RNA Dissolve RNA by adding RNase-free buffon ice for 15 minutes. Gently tap the tub

Pipetting RNA Use RNase-free tips or autoclave regular Keep pipettes clean.

Temperature sensitivity RNA is not stable at elevated temperaturtemperatures (> 65°C) since this will affTo melt secondary structures, heat RNA in the presence of denaturing buffers.

Notes

Working with RNA2 62

onucleotide: 340 Dalton (Da)f bases] x [340 Da]

= 25.5 x 103 Da = 25.5 kDa

lso represents the pmoles of

to pmol

pmolx

1=

µg (of ssRNA) x 2,941

40 pg Nb Nb

,941= 29.4 pmol

0


Calculation of Molecular Weightsin Dalton

Average molecular weight (MW) of a ribMW of ssRNA = [number o

e.g., MW of tRNA from E. coli (75 bases)


The value calculated with this formula a5´ or 3´ ends.

Calculation of pmol of 5´ (or 3´) ends

see above calculation of conversion of µg

Nb = number of bases

pmol of ssRNA = µg (of ssRNA) x 106 pg

x 1

1 µg 3

e.g., 1 µg of a 100 base ssRNA molecule =1 x 2

10

b x 3.4 x 10-4

cule = 0.085 µg

40 pgx

1 µgx Nb pmol 106 pg

63
Working with RNA2

= pmol (of ssRNA) x N

e.g., 1 pmol of a 250 base ssRNA mole

Nb = number of bases

µg of ssRNA = pmol (of ssRNA) x3

1

s) MW (in kDa)

2641523987

6721.3 x 103

6351.6 x 103

6351.7 x 103

8042.15 x 103

2.2. Commonly used formulasExamples

Organism Type Length (in base

E. coli, gram negative bacterium

tRNA5S rRNA16S rRNA23S rRNA

75120

1 5412 904

Drosophila melanogaster, fruitfly

18S rRNA28S rRNA

1 9763 898

Mus musculus, mouse 18S rRNA28S rRNA

1 8694 712

Homo sapiens, human 18S rRNA28S rRNA

1 8685 025

Oryctolagus cuniculus, rabbit 18S rRNA28S rRNA

2 3666 333

Notes


NA (see also reference 3).

e the amount of sample applied, detailed overview.

commendation*

NA Isolation Kit

NA Capture Kit

NA Isolation Kit for Blood/Bone marrow

gh Pure RNA Isolation Kit

gh Pure RNA Tissue Kit

Pure Isolation Reagent

gh Pure RNA Paraffin Kit

gh Pure FFPE RNA Micro Kit

gh Pure Viral RNA Kit

ick Spin Columns

ini Quick Spin Columns

2.3. Isolating and purifying RNA

Use this chart to select a product according to the type and origin of R

* The amount of RNA that can be isolated with the kits depends on a variety of variables likconcentration of RNA within the sample, buffer systems, etc. Please refer to page 66 for a

Type Origin Re

mRNA

Cultured cells, tissues, total RNA mR

mR

Human whole blood/bone marrow mR

total RNA

Cultured cells, bacteria, yeast, blood Hi

Tissue Hi

Cultured cells, tissues, bacteria, yeast, blood Tri

Formalin-fixed, paraffin-embedded tissue, fresh-frozen tissue samples

Hi

Formalin-fixed, paraffin-embedded tissue Hi

Viral RNA Serum, plasma, other body fluids, cell culture supernatant Hi

RNA fragments Removal of unincorporated nucleotides from labeled RNA moleculesQu

M

cation in which the RNA will be used

A SynthesisNorthern Blotting

RNase protection

In Vitro Translation

● ● ● ●

●

●

● ● ● ●

● ● ● ●

● ● ● ●

● ● ● ●

●

●

65
Working with RNA2
Use this chart to select a product according to the main appli(see reference 3).

* DD = differential display

Product RT-PCR DD*-RT-PCR cDN

High Pure RNA Tissue Kit ● ●

High Pure RNA Paraffin Kit ●

High Pure FFPE RNA Micro Kit ● ●

High Pure RNA Isolation Kit ● ●

High Pure Viral RNA Kit ●

mRNA Isolation Kit for Blood/Bone Marrow ●

mRNA Isolation Kit ●

mRNA Capture Kit ●

TriPure Isolation Reagent ● ●

mini Quick Spin RNA Columns

Quick Spin Columns

lso reference 3).

Typical Yield

0.5 – 3.0 µg/mga

for 10 RT-PCR Reactions20 µgb

20 µg35 – 50 µg

ulture Product detectable by RT-PCR

tion 0.3 to 1.5 µg/5 µm section2 – 6 µg/20 mg tissue

1.5 – 3.5 µg/5 µm

2.3. Isolating and purifying RNA

Use this chart to select a product according to its characteristics (see a

a depends on type of tissueb depends on type of cells


High Pure RNA Tissue Kit Tissue: 1 – 10 mg

High Pure RNA Isolation Kit Blood: 200 – 500 µlCultured cells: 106 cellsYeast: 108 cellsBacteria: 109 cells

High Pure Viral RNA Kit 200 – 600 µl of serum, plasma, urine, cell csupernatant

High Pure RNA Paraffin Kit up to 20 µm FFPE fresh-frozen tissue sec

High Pure FFPE RNA Micro Kit 1 – 10 µm FFPE tissue sections

ics (see also reference 3).

t http://www.roche-applied-science.com/napure

Yield

7 – 14 µg/100 mg tissuea

0.3 – 25 µg/107 cellsb

1 – 5 µg/100 µg total RNA

Product detectable by RT-PCR

06 – 1076 – 10 µg/mg tissuea

8 – 15 µg/106 cellsb

> 80%Exclusion limit: � 20 bp

> 80%

66
Working with RNA2
Use this chart to select a product according to its characterist

a depends on type of tissueb depends on type of cells

Note: For more information on nucleic acid isolation and purification please visi


mRNA Isolation Kit Tissue: 50 mg – 1 gCells: 2 x 105 – 108

total RNA: 250 µg – 2.5 mg

mRNA Capture Kit Tissue: up to 20 mgCells: up to 5 x 105

total RNA: up to 40 µg

TriPure Isolation Reagent RNA from liver, spleen: 50 mg – 1 gCultured epithelial cells, fibroblasts: 1

mini Quick Spin RNA Columns 20 – 75 µl labeling mixture

Quick Spin Columns 50 µl labeling mixture

3)

Liver Lung Spleen

~400 ~130 ~350

~14 ~6 ~7

2.3. Isolating and purifying RNARNA content in various cells and tissues (see also reference

107 cells 3T3 Hela COS

total RNA (µg) ~120 ~150 ~350

mRNA (µg) ~3 ~3 ~5

mouse tissue (100 mg) Brain Heart Intestine Kidney

total RNA (µg) ~120 ~120 ~150 ~350

mRNA (µg) ~5 ~6 ~2 ~9

Notes


1.0 to ensure an optimal measure-

he extinction coefficient of

nce the above mentioned value – ons.

ng RNA”, page 60)

H2O (1/20 dilution)

6 x 40 µg/ml x 20

) = 44.8 µg

2.4. Analyzing RNAConcentration via OD Measurement

Concentration of RNA

1 A260 Unit of ssRNA = 40 µg/ml H2O

Notes OD value should range between 0.1 and ment.The above mentioned value is based on tRNA in H2O.Please note that this coefficient – and hemay differ in other buffers and/or solutiCuvettes should be RNase free (see chapter 2.1. “Precautions for handliExample of calculation: ● volume of ssRNA sample: 100 µl● dilution: 25 µl of this sample + 475 µl● A260 of this dilution: 0.56 ● concentration of ssRNA in sample: 0.5

(= dilution factor) = 448 µg/ml ● amount of ssRNA in sample:

448 µg/ml x 0.1 ml (= sample volume

accurate values than water since by pH. Therefore, it is recommended to uffer.1 in a 10 mM Tris buffer. eans that the preparation is contaminated tances (e.g., phenol). In this case, it is (again) before using it in subsequent

n about the size of the RNA.

68
Working with RNA2
Purity via OD Measurement

Purity of RNA Pure RNA: A260/A280 � 2.0

Notes Buffered solutions provide morethe A260/A280 ratio is influencedmeasure the ratio in a low salt bPure RNA has a ratio of 1.9 – 2.An A260/A280 smaller than 2.0 mwith proteins and aromatic subsrecommended to purify the RNAapplications.The OD value gives no indicatio

els (or variations between 0.8 and 1.2%) ules. ial for the resolution ragments in a given gel.

NA molecules:ide (29/1): 750 – 2,000ide (29/1): 200 – 1,000ide (29/1): 50 – 400

eight markers are available from Science offers:r I, DIG-labeled (0.3 – 6.9 kb),

9, 1517, 1821, 2661, 4742, 6948 basesr II, DIG-labeled (1.5 – 6.9 kb),

4742, 6948 bases

2.4. Analyzing RNASize estimation of RNA fragments

Agarose Electrophoresis

In most cases, 1% Agarose MP** gare used to separate ssRNA molecDenaturing conditions*** are crucand visualization of the different f

Acrylamide Electrophoresis

Efficient range of separation of ssR● 3.5% of Acrylamide/Bisacrylam● 5.0% of Acrylamide/Bisacrylam● 8.0% of Acrylamide/Bisacrylam

Size Markers A variety of different molecular wdifferent suppliers. Roche Applied● RNA Molecular Weight Marke

Cat. No. 11 526 529 9109 fragments: 310, 438, 575, 104

● RNA Molecular Weight MarkeCat. No. 11 526 537 9105 fragments: 1517, 1821, 2661,

with RNA

A Molecular Weight Marker III, DIG-labeled (0.3 – 1.5 kb), t. No. 11 373 099 910

fragments: 310, 438, 575, 1049, 1517 basesmore information please refer to reference 10)rial 23S* (~ 2,900 b) and/or 16S* (~1,550 b) ribosomal RNA’s can e used as size markers.

nce

oche Applied Science (Cat. No. 11 388 983 001 – 100 g; Cat. No. 11 388 991 001 – 500 g) – m2: 1%) permitting the use of very low and very high concentrations, resulting in a broad range rated in the same type of agarose. This agarose is also function tested for the absence of

rs and Media” for recipes to prepare the necessary buffers.

69
Working2
● RNCa5

(For Bactealso b

* Products available from Roche Applied Sie

** Agarose Multi Purpose – available from Ris a high gel strength agarose (> 1,800 g/cof linear RNA molecules that can be sepaDNases and RNases.

*** Please refer to chapter 5 “Preparing Buffe

f DNA: Avoiding contamina-ossible contaminations before to most optimally avoid them.

te rather than total RNA. e the likelihood of successful rtion of mRNAs in a total RNAtal RNA for a mammalian cell).

rial is available, the integrityresis before using it in a RT-PCR. en 500 bp and 8 kb. Most of

.

released during cell lysis, r use methods (ref. 6 and 7) vate RNases.

2.5. RT-PCRReaction Components: Template

Avoiding contamination

Please refer to chapter 1.7. “Amplification otion” (page 36) for the different sources of pand during amplification reactions and how

Type If possible, use purified mRNA as a templaStarting with poly (A+) mRNA will improvamplification of rare mRNA’s since the propopreparation is very low (typically 1 – 5% of to

Integrity If a mRNA template is used and enough mateof the mRNA can be checked by gel electrophoThe mRNA should appear as a smear betwethe mRNA should be between 1.5 and 2 kb

Avoiding RNase contamination

To minimize the activity of RNases that areinclude RNase inhibitors* in the lysis mix othat simultaneously disrupt cells and inacti

utions for handling RNA” (pages 60 – 62) w to avoid RNase contamination.tor is a eukaryotic protein that inactivatesversible binding.

o. 03 335 399 001→ 2000 U;

70
Working with RNA2
Please refer to chapter 2.1. “Precafor a comprehensive overview hoThe most commonly used inhibiRNases, via a non-covalent and re

* Product available from Roche Applied Science: Protector RNase Inhibitor (Cat. NCat. No. 03 335 402 001→ 10000 U)

ers

pecificity of the cDNA produced. advantages:

e primer may bind these and lead

he poly(A) tail.

step RT-PCR applications.t Strand cDNA Synthesis Kit.*

NA sequences in mRNA.As that don't contain a poly(A)

RNA in the RT reaction controls ample: A high ratio will generate e the chances of copying the com-

y to overcome difficulties presen-

2.5. RT-PCRReaction Components: Choice of reverse transcription prim

The primer used for reverse transcription affects both the size and the sFour kinds of primers are commonly used in RT-PCR and each has its

Oligo(dT)N Generates full-length cDNAs.If template contains oligo(A) stretches, thto mispriming.

Anchored oligo(dT)N Prevents priming from internal sites of tGenerates full-length cDNA.Preferred priming method for most two-Available as part of the Transcriptor Firs

Random hexamers* Provides uniform representation of all RCan prime cDNA transcription from RNtail.Adjusting the ratio of random primers tothe average length of cDNAs formed. Exrelatively short cDNAs, which will increasplete target sequence.Short cDNA transcripts may be ideal wated by RNA secondary structures.

., for diagnostic purposes.of the RT-PCR.e used for one-step applications.

Synthesis Kit, 001→ 1 kit (100 rxns); 04 897 030 001→ 1 kit (200 rxns);

71
Working with RNA2
Sequence-specific Selects for a particular RNA, e.gGreatly increases the specificity Only type of priming that can b

* Product available from Roche Applied Science: Transcriptor First Strand cDNA Cat. No: 04 379 012 001→ 1 kit (50 rxns, including 10 control rxns); 04 896 866Primer ”random“, Cat. No: 11 034 731 001.

ers

R primers that are specific for on between the amplified product

ic DNA. There are two different

ces in exons on both sides of an ct amplified from genomic DNA plified from intronless mRNA.

oundaries on the mRNA. mic DNA.

2.5. RT-PCRReaction Components: Design of reverse transcription prim

RT-PCR amplification of a particular mRNA sequence requires two PCthat mRNA sequence. The primer design should also allow differentiatiof cDNA and an amplified product derived from contaminating genomstrategies to design the required primersa:

Strategy 1 See panel 1 on next page:● Design primers that anneal to sequen

intron. With these primers, any produwill be much larger than a product am

Strategy 2 See panel 2 on next page:● Design primers that span exon/exon b

Such primers should not amplify geno

a Please also refer to reference 4.

72
Working with RNA2

le

d mRNA as template, rather than a total RNA preparation is quite ood of successfully amplifying

is specifically designed for RNA tion products available from Ro-

ty of the mRNA by gel electropho-ar between 500 bp and 8 kb. Most nd 2 kb.

eck the integrity of the total RNA dominated by ribosomal RNA, ar as clear bands.

2.5. RT-PCRReaction Components: Template Design

Purity of template Start with the purest RNA template possib

If your target is mRNA, start with purifietotal RNA. (The proportion of mRNA inlow.) This will greatly increase the likelihrare mRNAs.Use a template preparation product thatpurification. For details on RNA purificache Applied Sciences, see page 65.If your target is mRNA, check the integriresis. The mRNA should appear as a smeof the mRNA should be between 1.5 kb aIf your target is eukaryotic total RNA, chby gel electrophoresis. The total RNA is so the 18S and 28S rRNA should be appe

mplate preparation.

cipitate the RNA using ethanol, then wash re to remove all traces of ethanol before n.ed for RNA purification to prepare the

p eliminate potential inhibitors during purification products available from

e 65.

utions to prevent RNase contamination

ltaneously disrupt cells and inactivate idine).

ould be present at a particular step, act as

rotector RNase Inhibitor*) in non-denatu-

ase-free plastic disposables (pipette tips,

73
Working with RNA2
Quality of template Eliminate RT inhibitors from the te

Before using it as a template, preit once with 70% ethanol. Be suusing the RNA in the RT reactioUse a product specifically designtemplate. Such products can helpurification. For details on RNARoche Applied Sciences, see pag

Intactness of template Take rigorous and repeated preca

during cell lysis Use isolation methods that simuRNases (by adding SDS or guan

during the purificati-on procedure

Even if you don't think RNases cthough they are present.Include RNase inhibitors (e.g., Pring purification steps.Use only sterile, RNase- and DNetc.).

s can be present on non-sterile

ion process. (Skin is a rich source

tep in the isolation process by gel s still RNase-free.

A template at +2 to +8°C

A template at -70°C. than RNA.

399 001→ 2000 U;

2.5. RT-PCRReaction Components: Template Design

Sterilize all glassware before use. (RNaseglassware.).Always wear gloves throughout the isolatof RNases.).If necessary, analyze the product of each selectrophoresis to ensure that the RNA i

after purification Short-term storage: Store the purified RNuntil use.Long-term storage: Store the purified RNIf possible, store cDNA, it is more stable

* Product available from Roche Applied Science: Protector RNase Inhibitor (Cat. No. 03 335 Cat. No. 03 335 402 001→ 10000 U)

Notes


minate problems of template

ty of reverse transcription by

can be incubated at higher to produce accurate copies of igh GC content.secondary structures at 55°C - Reverse Transcriptase* or s Kit*

ent ions for activity.uce more accurate cDNA copies

versely affects the fidelity of the

ity to copy smaller amounts able in this chapter, page 78).

: 03 531 317 001→ 250 U, sis Kit (Cat. No: 04 379 012 001→ 1 kit

kit (200 rxns)).

2.5. RT-PCRReaction Components: Choice of enzymes

Temperature optima Higher incubation temperatures help elisecondary structures.High temperature improves the specificidecreasing false priming.Thermoactive reverse trancriptases that temperatures (50 – 70°C) are more likelymRNA, especially if the template has a hTranscribe GC-rich templates with high 65°C with the thermostable TranscriptorTranscriptor First Strand cDNA Synthesi

Divalent ion requirement

Most reverse transcriptases require divalEnzymes that use Mg2+ are likely to prodthan those that use Mn2+ since Mn2+ adDNA synthesis.

Sensitivity Reverse transcriptases have different abilof template (see product characteristics t

* Product available from Roche Applied Science: Transcriptor Reverse Transcriptase (Cat. No03 531 295 001→ 500 U, 03 531 287 001→ 2,000 U); Transcriptor First Strand cDNA Synthe(50 rxns, including 10 control rxns); 04 896 866 001→ 1 kit (100 rxns); 04 897 030 001→ 1

heir ability to transcribe RNA secondary ct characteristics table in this chapter,

tase – DNA polymerase combinationsertain target length.

75
Working with RNA2
Specificity Reverse transcriptases differ in tstructures accurately (see produpage 78).

Reverse Transcriptase – DNA polymerase combinations

Using different reverse transcripwill allow to optimally amplify c

rocedure

is and PCR amplification are performed r and site-specific primers, eliminating e reaction tube between the RT and PCR

2.5. RT-PCRProcedures

Two Step procedure One tube One Step p

Two tube, two step procedure:● In the first tube, the first strand cDNA synthesis is performed

under optimal conditions.● An aliquot of this RT reaction is then transferred to another

tube containing all reagents for the subsequent PCR.

One tube, two step procedure:● In the first step, the reverse transcriptase produces first-

strand cDNA synthesis in the presence of Mg2+ ions, high concentrations of dNTP’s and primers.

● Following this reaction, PCR buffer (without Mg2+ ions), a thermostable DNA Polymerase and specific primers are added to the tube and the PCR is performed.

Both cDNA syntheswith the same buffethe need to open thsteps

ne tube One Step procedure

required: reaction has fewer pipetting steps than the ction, thereby significantly reducing the time he experiment and eliminating pipetting errors.

for contamination:ne step reaction takes place in a single tube sfers required and no need to open the reaction where contamination can occur).

sitivity and specificity:stics of the one step reaction provide increased ency:action is performed at a high temperature nating problems with secondary RNA

NA sample is used as template for the PCR.e-specific primers enhance specificity and

76
Working with RNA2
Advantages of Two Step procedure Advantages of O

Optimal reaction conditions:● The two step format allows both reverse transcription and

PCR to be performed under optimal conditions ensuring an efficient and accurate amplification.

Flexibility:● Two step procedures allow the product of a single cDNA

synthesis reaction to be used in several PCR reactions for analysis of multiple transcripts.

● Allows choice of primers (oligo (dT), anchored oligo (dT), random hexamer or sequence-specific primers).

● Allows a wider choice of RT and PCR enzymes.

Amplifies long sequences:● With the right combination of reverse transcriptases and

thermostable DNA polymerases, two step RT-PCR can amplify RNA sequences up to 14 kb long.

Minimal time ● The one step

two step reaneeded for t

Reduced risks● The entire o

with no trantube. (steps

Improved senTwo characteriyield and effici● the cDNA re

thereby elimistructures.

● the entire cDUse of sequencsensitivity.

12 kb

9 kb

6 kb

3 kb

Product SizeTwo-Step RT-PCR One-Step RT-PCR

Yield

Sensitivity

Diffi cult Templates

Reaction Temperature 42 — 65°C 42 — 65°C 40 — 60°C 60 — 70°C

Full-Length cDNATranscriptor Reverse

Transcriptase

Transcriptor First Strand cDNA

Synthesis Kit

Titan One Tube RT-PCR

System / Kit

C. therm One Step RT-PCR

System

2.5. RT-PCRReaction Components: Choice of enzyme for One-Step and Two-Step PCR

CR.

se

riptase

ers

ll kinds of templatesplates

77
Working with RNA2
Reaction Components: Choice of enzyme for Two-Step RT-P

Transcriptor Reverse Transcripta

Enzyme component A new recombinant Reverse Transc

Product size Up to 14 kb

Priming Oligo d(T), Specific, random hexam

Reaction temperature 42°C - 65°C

RNase H activity Yes

Sensitivity ++++

Ability to transcribe difficult templates ++++

Full length cDNA ++++

Incorporation of modified nucleotides Yes

Product configuration EnzymeReaction buffer

Intended use Robust reverse transcription of aSpecially usefull for difficult temGeneration of full length cDNA´s

Titan One Step RT-PCR System

DNA Blend of AMV Reverse Trans-criptase, Taq DNA Polymerase and a Proofreading Polymerase

Up to 6 kb

Specific

45°C - 60°C

Yes

+++

+

++

Yes

–

Reaction Components: Choice of enzyme for One-Step RT-PCR.

Tth DNA PolymeraseC. Therm One Step RT-PCR System

Enzyme component Thermostable DNA polymerase with intrinsic reverse transcripase activity

Blend of C. therm and TaqPolymerase

Product size Up to 1 kb Up to 3 kb

Priming Specific Specific

Reaction temperature 55°C - 70°C 60°C - 70°C

RNase H activity No No

Sensitivity + ++

Ability to transcribe difficult templates

+ +++

Full length cDNA – +

Incorporation of modified nucleotides

Yes Yes

Carry-over prevention + ++

nscriptases, to find the best possible pro-

assays, by using well characterized reverse f different applications.

nd ffertion

Enzyme BlendReaction BufferMgCl2 solutionPCR grade WaterDTT solution

T-PCR of difficult h) templates

One-Step RT-PCR for fragments up to 6 kb, with high sensivitySynthesis of full length cDNA´s

Step m

Titan One Step RT-PCR System

78
Working with RNA2
Benefit from the availability of a broad range of reverse traduct for your application.

Get the most out of your precious RNA samples and your transcriptases that are function tested over a broad range o

Product configuration EnzymePCR reaction bufferRT-PCR reaction bufferMn(OAc)2 solution

Enzyme BleReaction BuDMSO soluDTT solution

Intended use One-Step RT-PCR of short nor-mal templates

One-Step R(e.g. GC-ric

Tth DNA PolymeraseC. Therm OneRT-PCR Syste

of nucleic acids.


+++++++

+++++++

+++++++

2.6. Labeling of RNAOverview of different techniques

* Note: Please refer references 8, 9, 11 for an overview and a selection help for DIG labeling

Application Labeling Method

Northern BlottingSouthern Blotting

Labeling RNA by in vitro Transcription5'End labeling*3'End labeling*

Dot/Slot Blotting Labeling RNA by in vitro Transcription5'End labeling*3'End labeling *

In Situ Hybridisation Labeling RNA by in vitro Transcription5'End labeling*3'End labeling*

Polymerases

'OH5'P

79

T7 RNA Polymerase promotor sequenceSP6 RNA Polymerase promotor sequence

CATGCATGAATTCGTACGTACTTAAG

CAUGCAUGAAUUC

Transcription with SP6 Polymerase

P6 RNA Polymerase

3'OH3'OH 5'P

5'P 3'OH

esizedA

and

nversion of nucleic acid to proteins.

Working with RNA2

Principle of In Vitro Transcription with DNA dependent RNA

DNA Template 5'P GAATTCATGCATG 33'OH CTTAAGTACGTAC

S

5'P

SynthRN

str

Transcription with T7 Polymerase

T7 RNA Polymerase

5'P 3'OH3'OH 5'P

5'P 3'OH

GAATTCATGCATGCTTAAGTACGTAC

GAAUUCAUGCAUG

SynthesizedRNA

strand

Please refer to pages 88– 91 for further information on the co

ific for their corresponding

00 mM DTT, 20 mM spermidine 5 to – 25°C, store in aliquots.

stranded RNA molecules as

n-radioactive nucleotides be incorporated.

2.6. Labeling of RNASP6, T7 and T3 Polymerases

Properties DNA dependent RNA Polymerases, specpromotor.

10 x Transcription buffer

400 mM Tris (pH 8.0), 60 mM MgCl2, 1Buffer without nucleotides is stable at – 1


Generate homogeneously labeled single probes for hybridisation experiments.Radioactive nucleotides (32P, 35S) and no(biotin, digoxigenin, fluorochromes) can

> 50% of the input radioactivity

t to 65°C for 10 min.

Non-radioactive* Cold (without label)

1 µg 1 µg

ATP, GTP, CTP, each 1 mM final UTP 0.65 mM final

ATP, GTP, CTP, UTP each 1 mM final

i DIG, Biotin or fluoro-chrome UTP, 0.35 mM final

2 µl 2 µl

40 units 40 units

20 units 20 units

Add H2O to 20 µl Add H2O to 20 µl

2 hours/37°C 2 hours/37°C

80
Working with RNA2
Standard Assay:

This standard assay incorporates

Inactivation of enzyme Add 2 µl 0.2 M EDTA and/or hea

* For a complete overview, please refer to references 8 and 9.

Components Radioactive

Template DNA 0.5 µg

Nucleotides, final concentration

ATP, GTP, UTP each 0.5 mM final


[α32P] CTP (400 Ci/mmol), 50 µC(1.85 MBq/mmol)

10 x transcription buffer

2 µl

RNA Polymerase 20 units

RNase Inhibitor 20 units

H2O Add H2O to 20 µl

Incubation 20 min/37°C

hn Wiley and Sons, New Yorkers, Academic Pressience

Springer Verlag A Laboratory Manual, 2nd edition.

ied Science

Applied Science

2.7. References

1. Ausubel, F. M. et al., (1991) In: Current Protocols in Molecular Biology. Jo2. Brown, T. A. (1991) In: Molecular Biology LabFax. Bios Scientific Publish3. Nucleic Acid Isolation and Purification Manual (2007), Roche Applied Sc4. PCR Application Manual (2006), Roche Applied Science 5. Roche Applied Science, Technical Data Sheets6. Rolfs, A. et al., (1992) PCR Clinical Diagnositcs and Research, New York:7. Sambrook. J., Fritsch, E. J. and Maniatis, T. (1989) In: Molecular Cloning,

Cold Spring Harbor Laboratory Press8. The DIG Application Manual for Filter Hybridisation (2001) Roche Appl9. DIG Product Selection Guide (2007) Roche Applied Science

10. Tools for Mapping and Cloning (2006) Roche Applied Science11. Nonradioactive In Situ Hybridization Application Manual (2002) Roche

Working with ProteinsChapter 3

3.1. Precautions for handling Proteins ................................ 823.2. Conversion from Nucleic Acids to Proteins .............. 883.3. Analyzing Proteins .............................................................. 923.4. Quantification of Proteins ................................................ 983.5. Purifying Proteins ............................................................ 1023.6. References ......................................................................... 112

proteins from biological extracts, he procedure.separate from proteins.are present, inhibit early and tion, please refer to page 83

ses and pathways is accomplished ate esters.

ully balanced by an interplay of

ttern is important to get an accu-osphorylation status (for more

e 84).

fferent temperatures and in the protein to find out the most

ilization reagent – is often vity of proteins.

3.1. Precautions for handling Proteins

Avoiding degradation of proteins

For successful isolation or purification ofinclude protease inhibitors throughout tProteases are ubiquitous and difficult to As a general rule: assume that proteases inhibit often (for more detailed informaand/or reference 1).

Avoiding dephosphorylation of proteins

The regulation of many biological procesby the formation and cleavage of phosphThe phosphorylation of proteins is carefprotein kinases and phosphatases.Phosphatases are ubiquitous.A preservation of the phosphorylation parate view about the general or specific phdetailed information, please refer to pag

Storage of proteins

Aliquot protein solutions and store at didifferent buffer systems. Test activity of optimal storage condition.Refrigeration – with the appropriate stabsufficient to maintain the biological acti

s

50%, v/v) or suspensions in ammonium e avoided, because of the cold

aring and denaturation of proteins. ing of enzyme solutions. If the enzyme is all portions.id nitrogen and long term storage can be 20% glycerol.

n ice during experiments.mple that has to be removed from the

the parent vial.ntamination with other proteins and

etting of protein solutions to minimize

periment – dust contains approximately

s in small volumes to avoid ly as possible.

82
Working with Protein3
For protein solutions in glycerol (sulfate (3.2 M), freezing should bdenaturation effect.Ice crystals can cause physical sheAvoid repeated freezing and thawto be stored frozen, store it in smShock freezing of proteins in liquperformed after addition of 10 –

Manipulation of proteins

Always keep the protein sample oUse a fresh pipette tip for each saparent vial.Never return unused material to Always wear gloves to prevent coproteases.Avoid vigorous vortexing and pipdenaturation.Avoid dust forming during the ex60% ceratines (approx. 60 kD).Always work with small quantitiecontamination and work as quick

t the time of cell lysis, proteasesoteins in the extract. During iso-an affect functionality and reduce n against a multitude of proteases

blets* eliminate the time-consu-tors.extracts from almost any tissue or t, bacteria, and fungi (for ex-om/proteaseinhibitor). multitude of protease classes, ases, and metalloproteases.

n the stability of metal-dependent techniques (i.e., IMAC [immobi- isolation of Poly-His-tagged

ze 20 tablets (each for 50 ml); cpmplete,

seinhibitor

3.1. Precautions for handling ProteinsInhibition of protease activity

Proteases are ubiquitous in all living cells. Aare released and can quickly degrade any prlation and purification, proteolytic damage cyields of protein. To get a complete protectiodifferent protease inhibitors are needed.

cpmplete Protease Inhibitor Cocktail Taming search for the right protease inhibicpmplete inhibits proteolytic activity in cell type, including animals, plants, yeasamples, see www.roche-applied-science.cThe non-toxic cpmplete tablets inhibit aincluding serine proteases, cysteine protecpmplete as EDTA-free* version maintaiproteins and effectiveness of purificationlized metal affinity chromatography] forproteins)

* Product available from Roche Applied Science, cpmplete Cat. No. 04 693 116 001, Pack siEDTA-free Cat. No. 04 693 132 001, Pack size 20 tablets (each for 50 ml). For other pack sizes and more information visit: www.roche-applied-science.com/proteaCOMPLETE is a trademark of Roche.

Notes

Working with Proteins3 83

ence between an active and an in-ge during protein purification or r a cocktail against a broad range

ail Tablets* eliminate the time-ase inhibitors. ein(s) against dephosphorylation. d spectrum of phosphatases such /threonine phosphatase classes sphatase (PTP), and dual-specific

ety of sample materials including pP is also well-suited for buffers

ation of paraffin-embedded

y-to-use and can be combined ail Tablets to simultaneously pro-and proteolytic degradation.

3.1. Precautions for handling ProteinsInhibition of phosphatase activity

The phosphorylation states can be the differactive protein. To avoid that this states chananalysis individual phosphatase inhibitors oof phophatases can be used.

PhosSTpP Phosphatase Inhibitor Cocktconsuming search for the right phosphatPhosSTpP protects phosphorylated protIt shows an effective inhibition of a broaas acid and alkaline phosphatases, serine(e.g., PP1, PP2A and PP2B), tyrosine phophosphatases.The tablets inhibit phosphatases in a varimammalian, insect, or plant cells. PhosSTcontaining formalin for the formalin-fix(FFPE) tissue sections.The non-toxic PhosSTpP tablets are easwith cpmplete Protease Inhibitor Cockttect proteins against dephosphorylation

ins 84

10 tablets (each for 10 ml). Cat. No. 04906837001 Pack

bitor

Working with Prote3

* Product available from Roche Applied Science, Cat. No. 04906845001 Pack sizesize 20 tablets (each for 10 ml)

For more information visit: www.roche-applied-science.com/phoshataseinhiPHOSSTOP is a trademark of Roche.

n.

Aspartic proteasesd

Pepstatin

tidases

3.1. Precautions for handling ProteinsInhibition of protease activity (see reference 1)

General Inhibitors for Classes of Proteases:

High-efficiency protease Inhibition

a Contain serine and histidine in the active centerb Contain cysteine (thiol, SH-) in the active centerc Contain metal ions (e.g., Zn2+, Ca2+, Mn2+) in the active centerd Contain aspartic (acidic) group in the active center+ Inhibits serine and cysteine proteases with trypsin-like specificity.* When extractions or single-step isolations are necessary in the acidic pH range,

include Pepstatin along with cpmplete Tablets to ensure aspartic (acid) protease inhibitio

Serine proteasesa Cysteine proteasesb Metalloproteasesc

PMSF EDTA

Pefabloc SC E-64 Phosphoramidon

Pefabloc SC PLUS Bestatin (aminopep

Aprotinin

Leupeptin+

�2-Macroglobulin

cpmplete, EDTA-free Protease Inhibitor Cocktail Tablets*

cpmplete, Protease Inhibitor Cocktail Tablets*

ins 85
Working with Prote3
3.1. Precautions for handling ProteinsInhibition of protease activity (continued)

Protease-Specific Inhibitors:

Product for the Inhibition of:

Antipain dihydrochloride Papain, Trypsin (Plasmin)

Calpain Inhibitor I Calpain I > Calpain II

Calpain Inhibitor II Calpain II > Calpain I

Chymostatin Chymotrypsin

TLCK Trypsin, other serine and cysteine proteases (e.g., Bromelain, Ficin, Papain)

Trypsin-Inhibitor(chicken egg white, soybean)

Trypsin

s glycerol or sucrose can help

sing these reagents since of interest: e. g. sucrose and bilizers for invertase, but have

nificantly stabilize proteins in

ions 2):

> Mg2+ > Ca2+ > Ba2+

– > ClO4– > SCN–

agent ammonium sulfate zing ions: NH4

+ and SO42–.

3.1. Precautions for handling ProteinsStabilization

General Low molecular weight substances such astabilizing proteins. However, care has to be taken when choothey can alter the activity of the protein Poly Ethylene Glycol (PEG) are good stadenaturing effects on lysozyme.

Addition of salts Certain salts (anions and cations) can sigsolution. Effectiveness of the stabilization effect of(according to Hofmeister, see reference 1

(CH3)4N+ > NH4+ > K+ > Na+

SO42– > Cl– > Br– > NO3

Note that the widely used stabilization recontains two of the most effective stabili

e generally unstable. e, other proteins (e.g., BSA, up to ~1%) le.

harides, neutral polymers and amino- may not affect enzyme activity. ohols and sugars are 10 – 40% (w/v). onding sugar alcohols (e.g., glycerol, teins by reaction between amino

l, PEG) in a concentration range of gle phase solvents and help prevent

ne and alanine) can act as stabilizers 00 mM. Related compounds such as trimethylamine N-oxide (TMAO) can mM.

86
Working with Proteins3
Addition of proteins Highly diluted protein solutions arIf rapid concentration is not possiblmay be added to stabilize the samp

Addition of osmolytes Poly-alcohols, Mono- and Polysaccacids are not strongly charged andTypical concentrations for poly-alcUse non-reducing sugars or correspxylitol) to avoid inactivation of progroups and reducing sugars.Polymers (e.g., Poly Ethylene Glyco1–15% increase the viscosity of sinaggregation. Amino acids without charge (glyciin a concentration range of 20 to 5γ-amino butyric acid (GABA) and also be used in a range of 20 to 500

or competitive inhibitors to abilizing effects. The protein n thereby reducing the tendency

le to proteolytic degradation. oid carryover effects of the s removed from storage for use ctivity is desired.

d – as a result – the oxidation

.g., EDTA leads to stabilization

roups of cysteine can also such as β-mercaptoethanol

3.1. Precautions for handling ProteinsStabilization (continued)

Addition of substrates and specific ligands

Addition of specific substrates, cofactorspurified proteins often results in good stadopts a more tightly folded conformatioto unfold and rendering it less susceptibNote that dialysis may be necessary to avsubstrate or inhibitor when the protein iin particular situations where maximal a

Addition of reducing agents

Metal ions activate molecular oxygen anof thiol groups of cysteine residues.Complexation of these metal ions with eof proteins.Destructive oxidative reactions of thiol gbe prevented by adding reducing agents or dithiotreitol.

ins

ation of 5 – 20 mM and keep – if possible nditions (e.g., via an inert gas). β-ME

th thiol groups of proteins leading to on. At pH 6.5 and 20°C, the half-life of . At pH 8.5 and 20°C, the half-life

centrations ranging from 0.5 –1 mM. t exceed 1 mM, because it can act as rations and is not soluble in high salt. rnal disulfide bridges resulting in terfere with protein molecules. At pH 6.5

is 40 hours. At pH 8.5 and 20°C, ours.

87
Working with Prote3
β-Mercaptoethanol (β-ME): ● Add β-ME to a final concentr

– solution under anaerobic cocan form disulfide bridges wiaggregation and/or inactivatiβ-ME is more than 100 hoursdecreases to 4 hours.

Dithiotreitol (DTT):● DTT is effective at lower con

The concentration should nodenaturant at higher concentOxidation of DTT forms intedeactivation, but does not inand 20°C, the half-life of DTTthe half-life decreases to 1.4 h

acids plus some stop codons, s, at maximum 6 in the cases (“Wobble hypothesis”). The code ncoded amino acids is shown

3.2. Conversion from Nucleic Acids to ProteinsInformation transfer (see reference 2)

Since there are 43 = 64 possible nucleotide triplets, but only 20 aminomost amino acids are encoded by several nucleotide triplets (synonymof Arg, Leu and Ser). Most variants occur in the 3rd position of the codeis therefore called degenerate. The relationship between triplets and ein the figure on the next page.

Notes


let sequence is read from the utwards. The mRNA nucleotide logy is shown.

nucleotide sequences, replace . Basic amino acids are shown in dic amino acids in red, neutral ids in black and amino acids with

ed, polar residues in orange.

3.2. Conversion from Nucleic Acids to ProteinsThe Genetic Code (see reference 2)

The tripcenter oterminoFor DNAU with Tblue, aciamino acuncharg

ins

iving species, several exceptions in UGA codes for Trp, while in some ciliated ln and UGA specifies Cys instead.

with special functions:

Start Codons Stop Codons

AUG (codes also for Met) UAG, UAA, UGA (amber, ochre, opal)

AUG (codes also for Met), CUG (rare), ACG (rare), GUG (rare)

UAG, UAA, UGA

AUG, GUG, UUG (rare) UAG, UAA, UGA

AUA (codes also for Met), AUG

AGA, AGG (mammals)

89
Working with Prote3
Although the code has been assumed to be universal among lmitochondria have been found. Furthermore, in mycoplasma,protozoa, the normal “stop” codons UAG and UAA specify G

Codon differences in Mitochondria: Codons

UGA AUA CU(A,C,G,U) AG(A,G) CGG

General Code Stop Ile Leu Arg Arg General

code

Mito-chondria

Eukarya

Mammals Trp Met/start

Stop Bacteria

Drosophila Trp Met/start

Ser(AGA only)

Mito-chondria

Protozoa Trp

Higher Plants Trp

S. cerevisiae Trp Met/start

Thr

k and amino acids with uncharged,

Genetic codeGCA GCG

CGA CGG AGA AGG

GGA GGG

AUA

CUA CUG UUA UUG

CCA CCG

UCA UCG AGU AGC

ACA ACG

GUA GUG

3.2. Conversion from Nucleic Acids to ProteinsCharacteristics of Amino Acids

Basic amino acids are shown in blue, acidic amino acids in red, neutral amino acids in blacpolar residues in yellow. Average molecular weight of amino acid: 110 Daltons.

Amino acid Symbol MW (in Da) Side groupAlanine A – Ala 89 -CH3 GCU GCC

Arginine R – Arg 174 -(CH2)3-NH-CNH-NH2 CGU CGC

Asparagine N – Asn 132 -CH2-CONH2 AAU AAC

Aspartic acid D – Asp 133 -CH2-COOH GAU GAC

Cysteine C – Cys 121 -CH2-SH UGU UGC

Glutamine Q – Gln 146 -CH2-CH2-CONH2 CAA CAG

Glutamic acid E – Glu 147 -CH2-CH2-COOH GAA GAG

Glycine G – Gly 75 -H GGU GGC

Histidine H – His 155 -C3N2H3 CAU CAC

Isoleucine I – Ile 131 -CH(CH3)-CH2-CH3 AUU AUC

Leucine L – Leu 131 -CH2-CH(CH3)2 CUU CUC

Lysine K – Lys 146 -(CH2)4-NH2 AAA AAG

Methionine M – Met 149 -CH2-CH2-S-CH3 AUG

Phenylalanine F – Phe 165 -CH2-C6H5 UUU UUC

Proline P – Pro 115 -C3H6 CCU CCC

Serine S – Ser 105 -CH2-OH UCU UCC

Threonine T – Thr 119 -CH(CH3)-OH ACU ACC

Tryptophan W – Trp 204 -C8NH6 UGG

Tyrosine Y – Tyr 181 -CH2-C6H4-OH UAU UAC

Valine V – Val 117 -CH-(CH3)2 GUU GUC

Notes


untered. gene bank database can be found

bold to help identify a codon rginine codons AGG and AGA

therefore be combined. However, uld be addressed individually.

3.2. Conversion from Nucleic Acids to ProteinsCodon Usage

Rarest codons (from E.coli) preferred by selected organisms:

Codon frequencies are expressed as codons used per 1000 codons encoA complete compilation of codon usage of the sequences placed in theat http://www.kazusa.or.jp/codon/Codon frequencies of more than 15 codons/1000 codons are shown inbias that may cause problems for high level expression in E. coli. The aare recognized by the same tRNA (product of argU gene) and should regardless of the origin of the coding region of interest, each gene sho

ins

GAinine

CUAleucine

AUAisoleucine

CCCproline

.1 3.2 4.1 4.3

.1 6.5 6.9 20.3

7.6 7.2 8.3 18.6

1.5 7.9 9.8 4.3

.0 13.4 17.8 6.8

.5 15.2 33.2 8.5

.8 6.0 52.5 1.0

.4 3.2 2.0 43.0

.0 9.8 12.6 5.2

91
Working with Prote3
AGGarginine

AGAarginine

Carg

Escherichia coli 1.4 2.1 3

Homo sapiens 11.0 11.3 6

Drosophila melanogaster 4.7 5.7

Caenorhabditis elegans 3.8 15.6 1

Saccharomyces cerevisiae 21.3 9.3 3

Plasmodium falciparium 26.6 20.2 0

Clostridium pasteurianum 2.4 32.8 0

Thermus aquaticus 13.7 1.4 1

Arabidopsis thaliana 10.9 18.4 6

repare denaturing SDS PAGE gels.

12% 15%

3.3. Analyzing ProteinsSeparation ranges of proteins in denaturing SDS-PAGE*

* Glycin buffer** Molar ratio of acrylamide:bisacrylamide is 29:1.

Please refer to chapter 5 “Preparing Buffers and Media” for recipes to p

% Acrylamide**

6% 8% 10%

Range of separation of proteins

200 kDa

100 kDa

90 kDa

80 kDa

70 kDa

60 kDa

50 kDa

40 kDa

30 kDa

20 kDa

10 kDa

0 kDa

ins 92

Molecular Weight (in kDa)

205

116

97.4

85.2

66.2

55.6

39.2

26.6

28.0

20.1

14.3

12.5

6.5

3.4

Working with Prote3

Sizes of commonly used markers in denaturing SDS-PAGE

Marker

Myosin heavy chain (rabbit muscle)

β-Galactosidase (E.coli)

Phosphorylase b (rabbit muscle)

Fructose 6 phosphate kinase (rabbit muscle)

Bovine Serum Albumin

Glutamate dehydrogenase (bovine liver)

Aldolase (rabbit muscle)

Triose phosphate isomerase (rabbit muscle)

Trypsin inhibitor (hen egg white)

Trypsin inhibitor (soybean)

Lysozyme (hen egg white)

Cytochrome c (horse heart)

Aprotinin

Insulin chain B

age 649 – 654” for the recipes

nd

for 0.5 mm gels 1 mm gels

3.3. Analyzing ProteinsStaining of proteins on denaturing SDS-PAGE gels

Please refer to “Harlow and Lane: Antibodies, a Laboratory Manual, pof these staining techniques.

Method Detection limit

Coomassie Brilliant Blue R 250 Staining – Standard Method

300 – 1,000 ng per ba

Coomassie Brilliant Blue R 250 Staining – Maximal Sensitivity

50 – 100 ng per band

Silver Staining– Neutral Silver Staining


Silver Staining– Ammonium Silver Staining


Copper Staining 10 – 100 ng per band1,000 ng per band for

Staining with colloidal gold 3 ng per band

Staining with SYPRO fluorescent dyes 1 – 2 ng per band

ins

Destaining Immunodetection

VDF NC PVDF NC PVDF

93
Working with Prote3
Staining and detection of proteins on membranes*

NC = nitrocellulosePVDF = polyvinylidene difluoride* Products available from Roche Applied Science

Staining

Method Detection limit NC Nylon P

Amido Black ~ 2,000 ng

Ponceau S 1,000 – 2,000 ng

Coomassie Blue R 250500 – 1,000 ng

300 – 500 ng

India Ink 10 – 20 ng

Colloidal Gold 3 ng

Separation range in kDa (for globular proteins)

1 – 5

1.5 – 30

3 – 80

10 – 4,000

60 – 20,000

70 – 40,000

0 – 10

3 – 70

10 – 600

1 – 100

5 – 250

10 – 1,500

0.1 – 1.8

0.8 – 4

1.5 – 20

3 – 60

5 – 100

3.3. Analyzing ProteinsBuffer exchange via gel filtration

Matrix Material pH stability (in aqueous buffer)

Sephadex

G – 25 Dextran 2 – 10

G – 50

G – 75

Sepharose

6B Agarose 3 – 13

4B

2B

Superdex

30 Agarose/Dextran 3 – 12

75

200

Sephacryl

S – 100HR Dextran/Bisacrylamide 3 – 11

S – 200HR

S – 300HR

Biogel

P – 2 Polyacrylamide 2 – 10

P – 4

P – 10

P – 60

P – 100

ins

erence 3)

Cut Off) is the minimum molecular retained by the membrane of the dialysis

which detergents begin to form micelles. imum concentration of detergent . changed by pH, temperature and the

a non-ionic detergent. A detergent with a ) is readily removed from detergent – hereas a detergent with a low CMC

nt in its monomeric form.

94
Working with Prote3
Properties of commonly used detergents: Definitions (see ref

Definitions The MWCO (Molecular Weight weight of a molecule that will betubes.

Critical micellar concentration (CMC) (in mM)

The minimum concentration atIn practice, the CMC is the maxmonomers that can exist in H2OThe CMC of a detergent may beionic strength of the solution.The CMC affects the dialysis of high CMC (and no ionic chargeprotein complexes by dialysis, wdialyzes away very slowly.

Monomeric molecular weight (MMW) (in Da)

Molecular weight of the deterge

d)

(AuS).rage number of monomers

ll have a high micellar high CMC will have a low

3.3. Analyzing ProteinsProperties of commonly used detergents: Definitions (continue

Micellar molecular weight (MMr) (in Da)

The average size of 1 micelle of a detergentAuS = MMW x aggregation number (= avein one micelle).In general, a detergent with a low CMC wimolecular weight while a detergent with a micellar molecular weight.

ins 95

g tion

Ease ofremoval

Application

erin

Good denaturing agent for proteins. Ideal for PAGE

glipid

Solubilization of membrane proteins

M Solubilization of membrane proteins.

Protein solubilization

Mild, non-denaturing detergent for the solubilization and reconstitution of membrane proteins. Easily removed via dialysis.

% Gentle solubilization and stabilization of membrane proteins

Solubilization of proteins and PAGE

glipid

Used for ELISA and Immunoblots

Working with Prote3

Characteristics of detergents

Detergent CMC MMW MMr Workinconcentra

AnionicSDS (Sodium dodecylsulfate) 8.3 288.4 18,000 > 10 mg p

mg prote

DOC (Deoxycholic acid) 1 – 4 416.6 4,200 0.1 – 10 mmembrane

ZwitterionicCHAPS (3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate)

4 614.9 6,150 6.5 – 13 m

NonionicNonidet P-40 [Ethylphenolpoly(ethyleneglycolether)n]

0.25 606.6(n = 11)

90,000 1–10 mM

n-Octylglucoside 14.5 292.4 46 mM

Sucrose monolaurate 0.2 524.6 0.2% – 5(w/v)

Triton X-100 [Octylphenolpoly (ethyleneglycolether)n]

0.2 647(n = 10)

90,000 13.5

Tween 20 [Poly(oxyethylene)nsorbitan-monolaurate]

0.06 1228(n = 20)

> 10 mg/mmembrane

t variables:

ion exchange column. then dialyze to remove urea. proteins, the column should its CMC.icellar size and low CMC: ialyze. Add a mixed bed resin

te.

ycholate, then remove

t detergent.exchange column, wash some proteins, the column t below its CMC.

3.3. Analyzing ProteinsRemoval of detergents

Removal of detergents from protein solutions depends on three differenthe physical properties of the detergentthe characteristics (e.g., hydrophobic/hydrophilic) of the proteinthe components of the buffer system

Ionic detergents Add urea to 8 M, then bind detergent to anThe protein will flow through in 8 M urea,Gel filtration via a G-25 column. For somebe equilibrated in another detergent belowFor ionic detergents with a relatively low mdilute the sample as much as possible and dto the dialysate to increase the exchange ra

Non-ionic detergents Gel filtration via a G-200 column.Dilute the sample and dialyze against deoxdeoxycholate by dialysis.Velocity sedimentation into sucrose withouBind protein to an affinity matrix or ion – to remove detergent and elute protein. Forshould be equilibrated in another detergen

ncentration of a solution from a initial n at 0°C:

owing to dissolve each portion before the next ntrations.

age saturation65 70 75 80 85 90 95 100

1 398 436 476 516 559 603 650 6971 368 405 444 484 526 570 615 6621 337 374 412 452 493 536 581 6271 306 343 381 420 460 503 547 5921 276 312 349 387 427 469 512 5571 245 280 317 355 395 436 478 5221 214 249 285 323 362 402 445 4881 184 218 254 291 329 369 410 4530 153 187 222 258 296 335 376 418

123 156 190 226 263 302 342 38392 125 159 194 230 268 308 34861 93 127 161 197 235 273 31331 62 95 129 164 201 239 279

31 63 97 132 168 205 24432 65 99 134 171 209

32 66 101 137 17433 67 103 139

34 68 10534 70

35

96
Working with Proteins3
Ammonium sulfate precipitation

Amounts of ammonium sulfate (in g/l solution) to change the copercentage of saturation to a desired target percentage saturatio

Add – step by step – small portions of the required amount of ammonium sulfate allportion is added. This will prevent accumulation of undesirable high local salt conce

Target percentInitial percentage saturation 20 25 30 35 40 45 50 55 60

0 106 134 164 194 226 258 291 326 365 79 108 137 166 197 229 262 296 3310 53 81 109 139 169 200 233 266 3015 26 54 82 111 141 172 204 237 2720 27 55 83 113 143 175 207 2425 27 56 84 115 146 179 2130 28 56 86 117 148 1835 28 57 87 118 1540 29 58 89 1245 29 59 9050 30 6055 306065707580859095

(TCA) to the sample and vortex.es at – 20°C.

ash the pellet with an the pellet in a buffer solution.

e sample and vortex.

ir dry.

f chloroform to the

d discard the upper phase.

ry.

3.3. Analyzing ProteinsOther precipitation techniques

Trichloroacetic acid(> 5 µg/ml)

Add equal volume of 100% trichloroacetic acidLeave for 20 minutes on ice or for 15 minutCentrifuge for 5 min at 6,000 – 10,000 g.Remove the supernatant.Resuspend the pellet with 0.1 M NaOH or wethanol/ether (1/1) solution and resuspend

Aceton precipitation(< 1 µg/ml)

Add 5 volumes of cold (– 20°C) aceton to thLeave for 30 min at – 20°C.Centrifuge for 5 min at 6,000 – 10,000 g.Remove the supernatant and let the pellet aResuspend the pellet in buffer.

Chloroform-Methanol precipitation(∼1 µg/ml)

Add 3 volumes of methanol and 1 volume osample and vortex.Add 3 volumes H2O, vortex for ~ 1 minute.Centrifuge for 5 min at 6,000 – 10,000 g anAdd 3 volumes of methanol and vortex.Centrifuge for 5 min at 6,000 – 10,000 g.Remove the supernatant and let pellet air dResuspend the dry pellet in buffer.

Notes


uitable control (solvent blank) at 280 nmion for proteins is:

in concentrations from 20 to 3000 µg/ml)

0.701.351.20

f protein concentrations from 1–100 µg/ml)

er blank) at 280 nm and 260 nm or 280 nmn using one of the following equations:

55 x A280) – (0.76 x A260)

A205/(27 + A280/A205)

ncodes 333 amino acids = 3.7 x 104 Da)

DNA

270 bp

810 bp

2.7 kbp

3.4. Quantification of ProteinsOD Measurement

Pure protein solutions Read the absorbance of the protein solution versus a sor 205 nm. A rough approximat

(Samples with absorbance > 2.0 should be diluted in the appropriate solvent to obtain absorbances < 2.0).

1 A280 Unit of proteins = 1 mg/ml. (for ranges of prote

Typical A280 values for 1 mg/ml protein are :

BSA:IgG:IgM:

Protein concentration (in mg/ml) = A205/31 (for ranges o

Protein solutions contaminated with nucleic acids

Read the absorbance versus a suitable control (e.g., buffand 205 nm. Calculate the approximate concentratio

(nucleic acid content up to 20% w/v or A280/A260 < 0.6)

Protein concentration (in mg/ml) = (1.

Protein concentration (in mg/ml) =

Molar conversions for Proteins Protein/DNA conversions (1 kb of DNA e

100 pmol Protein µg Protein Protein

10 kDa 1 10 kDa

30 kDa 3 30 kDa

100 kDa 10 100 KDa

s

l H2O. Dissolve 0.5 g CuSO4 – 5H2O f H2O. Add the Na2CO3 solution slowly on a magnetic stirrer. °C for one year.

gent A with 2 volumes of 5% SDS

temperature for 2 weeks.

-Ciocalteau Phenol reagent with

months in a dark bottle at room temperature. 12.5 µg/ml BSA in H2O. Add 1 ml of

te for 10 min at room temperature.diately and incubate at room temperature

re a linear standard curve and calculate

98
Working with Protein3
Assays

Lowry method Reagent A: ● Dissolve 10 g Na2CO3 in 500 m

and 1 g Na-tartrate in 500 ml oto the copper/tartrate solution

● This solution can be stored at 4Before usage: Reagent Aactivated● Combine one volume of the rea

and 1 volume of 0.8 M NaOH.● This solution is stable at room Reagent B:● Combine 1 volume of 2 N Folin

5 volumes H2O. ● This solution is stable for several Prepare samples of 100, 50, 25 andreagent Aactivated, mix and incubaAdd 0.5 ml of Reagent B, mix immefor 30 min.Read absorbance at 750 nm, prepaconcentration.

ly available.s of reagent B.µg/100 µl of BSA. sample and incubate for 30 min.

lank at 562 nm.late concentration.

e G250 in 50 ml 95% ethanol. d. Add H2O to a final volume of stable for 6 months at 4°C. µg/100 µl in the same buffer

th H2O, filter if precipitation occurs.le. The red dye will turn blue

to develop for at least 5 min,

a linear standard curve and

3.4. Quantification of ProteinsAssays (continued)

Bicinchoninic acid method

Reagent A and reagent B are commercialMix 1 volume of reagent A to 50 volumePrepare samples of 100, 50, 25 and 12.5 Add 2 ml of the combined reagent to eachat 37°C.Read the samples versus an appropriate bPrepare a linear standard curve and calcu

Bradford method Dissolve 100 mg Coomassie brilliant bluAdd 100 ml concentrated phosphoric aci200 ml. The Bradford dye concentrate isPrepare samples of 100, 50, 25, and 12.5solution as your protein sample.Dilute the Bradford dye concentrate 5 x wiAdd 5 ml of the diluted dye to each sampwhen binding to the protein, allow colornot longer than 30 min.Read the absorbance at 595 nm, preparecalculate concentration.

roteins

H2O and 6 g sodium potassium tartrate in

aOH and make up to 1 liter with H2O.er in the dark. This solution will keep ssium iodide is added to inhibit the reduction

.0, 1.5, 2, 2.5 and 3 mg of BSA. Add 2.5 ml of ct for 30 min.nm against a blank containing 0.5 ml of sample reagent.rve and calculate concentration. sensitivity (range 1 – 6 mg protein/ml).

99
Working with P3
Biuret method Biuret Reagent: ● Dissolve 1.5 g CuSO4 – 5

500 ml of water. ● Add 300 ml 10% (w/v) N● Store in a plastic contain

indefinitely if 1 g of potaof copper.

Prepare samples with 0.5, 1Biuret reagent, allow to reaMeasure absorbance at 540 buffer plus 2.5 ml of BiuretPrepare a linear standard cuNote that this test has a low

ontents of your buffer:

A205 A280

25 mM > 1 M

50 mM 100 mM

0.1% (w/v) 0.1% (w/v)

0.5 M 2 M

40 mM 0.5 M

< 0.01% (v/v) 0.02% (v/v)

< 1% (w/v) 10% (w/v)

< 0.1 M > 1 M

3.4. Quantification of ProteinsConcentration limits of interfering reagents for assays

Use this chart to select the appropriate wavelength depending on the c

DTT: dithiothreitol EDTA: ethylenediaminetetraacetic acid β-ME: β-mercaptoethanol SDS: sodium dodecylsulfate TCA: trichloroacetic acid

Reagents A205 A280 Reagents

Ammonium sulfate 9% (w/v) > 50% (w/v) NaOH

Brij 35 1% (v/v) 1% (v/v) Phosphate buffer

DTT 0.1 mM 3 mM SDS

EDTA 0.2 mM 30 mM Sucrose

Glycerol 5% (v/v) 40% (v/v) Tris buffer

KCl 50 mM 100 mM Triton X-100

β-ME <10 mM 10 mm TCA

NaCl 0.6 M > 1 M Urea

ins

tification assays

ffer page 148.

BCA Lowry Bradford

100
Working with Prote3
Compatibility of different buffer systems with protein quan

* Please also note the overview regarding pH buffering ranges in section 5.1, Bu

BCA Lowry Bradford

ACES HEPPSO

ADA MES

BES MOPS

Bicine MOPSO

Bis-Tris PIPES

CAPS POPSO

CHES TAPS

DIPSO TAPSO

Glycine TES

HEPES Tricin

HEPPS Tris

ification assays (continued)

fonic acid)d)anesulfonic acid)

droxymethyl)-methane)ic acid)

onic acid)-2-hydroxypropanesulfonic acid)anesulfonic acid)

ropanesulfonic acid)-hydroxypropanesulfonic acid)

lfonic acid) acid)panesulfonic acid))aminopropanesulfonic acid)mino-2-hydroxypropanesulfonic acid)minoethanesulfonic acid)lycine)

3.4. Quantification of ProteinsCompatibility of different buffer systems with protein quant

Abbreviations ACES (N-(2-Acetamido)-2-aminoethanesulADA (N-(2-Acetamido)(2-iminodiacetic aciBES (N,N-bis-(2-hydroxyethyl)-2-aminoethBicine (N,N-bis-(2-hydroxyethyl)-glycine)Bis-Tris (bis-(2-hydroxyethyl)-iminotris-(hyCAPS (3-Cyclohexylamino)-1-propansulfonCHES (2-(N-Cyclo-hexylamine)-ethanesulfDIPSO (3-N,N-Bis-(2-hydroxyethyl)-3-aminoHEPES 4-(2-hydroxyethyl)-piperazine-1-ethHEPPS (4-(2-hydroxyethyl)-piperazine-1-pHEPPSO (4-(2-hydroxyethyl)-piperazine-1(2MES (2- Morpholinoethanesulfonic acid)MOPS (3-Morpholinopropanesulfonic acid)MOPSO (3-Morpholino-hydroxypropanesuPIPES (Piperazine-1, 4-bis-(2-ethanesulfoicPOPSO (Piperazine-1, 4-bis-(2-hydroxyproTAPS (N-[Tris-(hydroxymethyl)-methyl]-3-TAPSO (N-[Tris-(hydroxymethyl)-methyl]-3-aTES (N-[Tris-(hydroxymethyl)-methyl]-2-aTricin (N-[Tris-(hydroxymethyl)-methyl]-g

Notes


Insect cells RTS*

**

***

30% up to 6 mg/ml

3.5. Purifying ProteinsCharacteristics of different expression systems

* Rapid Translation System available from Roche Applied Science (please refer to p. 103)** with chaperones*** with suitable kinase and substrate**** inhibited by e.g. cpmplete Protease Inhibitor Cocktail Tablets

CharacteristicsE. coli Yeast Mammalian

cells

Expression of toxic proteins

Expression from PCR templates

Proteolytic cleavage****

Glycosylation

Secretion

Folding

Phosphorylation

Percentage Yield (dry weight) 1 – 5% 1% < 1%

Labeling

roteins

ntaminating tibodies

Purity of specific antibody

Comments

her serum tibodies

10% (except for antigen affinity column)

Antigen-affinity purification procedure

ckground m calf serum

> 95%, no cross reaction high quality

Purification with protein A or G columns*

ne > 95%, no cross reaction high quality

Purification with protein A or G columns*

ckground m mouse tibodies

Max. 90%, cross reactions possible

Antigen affinity purification procedure

102
Working with P3
Sources of antibodies

* not recommended for IgM.

Source Type Quantity oftotal antibody

Quantity ofspecific antibody

Coan

Serum Poly-clonal

10 mg/ml < 1 mg /ml Otan

Culture supernatant with 10% FCS

Mono-clonal

1 mg/ml 0.01 – 0.05 mg/ml Bafro

Culture supernatant with serum-free medium

Mono-clonal

0.05 mg/ml 0.05 mg/ml No

Ascites Mono-clonal

1 – 10 mg/ml 0.9 – 9 mg/ml Bafroan

calable in vitro protein expression tudies, functional assays, or struc-ryotic (wheat germ) cell lysates.

Y (High-Yield) and the patented igher levels of protein expression

lds of up to 6 mg/ml of expressed

Green Fluorescent Protein) ompared to a conventional

ession system

3.5. Purifying ProteinsExpressing Proteins: Cell-free - Rapid Translation System

The Rapid Translation System (RTS) from Roche Applied Science is a splatform that produces large amounts of protein for characterization stural analysis. It is available based on bacterial (E. coli) as well as euka

RTS enables both transcription and translation utilizing the unique HCECF (continuous-exchange, cell-free) technologies. RTS offers much hcompared to other in vitro transcription/translation systems, with yieprotein.

Fig. 1: Schematic illustration of the continuous-exchange cell-free (CECF) reaction principle

Fig. 2: GFP (expression cin vitro expr

ins

ake place simultaneously in the reaction

nts needed for a sustained reaction are a semi-permeable membrane.-products are diluted via diffusion through eding compartment.n by allowing protein synthesis to continue

selates in a single reaction to express proteins

-based systems by expressing toxic proteins

d downstream steps (e.g., host-cell trans-

R-generated linear templates or suitable

103
Working with Prote3
Transcription and translation tcompartment.Substrates and energy componecontinuously supplied throughPotential inhibitory reaction bythe same membrane into the feHigh levels of protein expressiofor up to 24 hours.

Conquer complex problems with eaExpression of several DNA tempin parallelOvercome the limitations of cellin a cell-free RTS lysate.Elimination of laborious up- anformation, culturing, or lysis)Expression of proteins from PCexpression vectors

ontinued)

on of soluble disulfide-bonded or

urs

urs

3.5. Purifying ProteinsExpressing Proteins: Cell-free - Rapid Translation System (c

The RTS E. coli Disulfide and RTS Wheat Germ Kits allow the expressieukaryotic proteins with high success rates.

Prokaryotic cell-free expression kits mg/ml mg/µl reaction ho

RTS 100 E. coli HY Kit up to 0.4 mg/ml up to 0.02 mg/50 µl 4

RTS 100 E. coli Disulfide Kit up to 1.5 mg/ml up to 0.08 mg/50 µl 24

RTS 500 E. coli Disulfide Kit up to 2.5 mg/ml up to 2.5 mg/1 ml 24

RTS 500 ProteoMaster E. coli HY Kit up to 6 mg/ml up to 6 mg/1 ml 24

RTS 9000 E. coli HY Kit up to 5 mg/ml up to 50 mg/10 ml 24

Eukaryotic cell-free expression kits mg/ml mg/µl reaction ho

RTS 100 Wheat Germ CECF Kit up to 1 mg/ml up to 0.05 mg/50 µl 24

RTS 500 Wheat Germ CECF Kit up to 1 mg/ml up to 1 mg/1 ml 24

ins

y been expressed with RTS.

rmation please visit: www.proteinexpression.com

you should use ... or alternatively use ...

RTS Wheat Germ RTS E. coli

RTS Wheat Germ RTS E. coli after sequence opti-mization with ProteoExpert

RTS Wheat Germ

RTS Wheat Germ

RTS E. coli Disulfide

RTS E. coli

a cell-based system

you should use ... or alternatively use ...

RTS E. coli

. coli after sequence opti-ation with ProteoExpert

RTS Wheat Germ

RTS E. coli Disulfide

104
Working with Prote3
Many prokaryotic, eukaryotic, and viral proteins have alread

For the most current list of successfully expressed proteins and for further info

If your protein is eukaryotic and ...

didn’t express in E. coli in vitro

you want a high initial success rate

didn’t express in RTS E. coli

isn’t soluble when expressed in E. coli (RTS or in vivo)

needs disulfide bonds

doesn’t depend on correct folding for downstream applications

needs to be glycosylated

If your protein is prokaryotic and ...

doesn’t depend on correct folding for downstream applications

you want a high initial success rate RTS Emiz

needs disulfide bonds

nts

ice for polyclonal antibodies

ice for monoclonal antibodies

oice for monoclonal antibodies

oice for polyclonal antibodies

bleed

es are available during entire life of chicken

3.5. Purifying ProteinsChoices of animals for immunization

* during the course of one immunization regime

Animal Maximal amountof serum*

Possibility to generatemonoclonal antibodies

Inbred Comme

Rabbits ~500 ml Best cho

Mice ~2 ml Best cho

Rats ~20 ml Good ch

Hamsters ~20 ml Good ch

Guinea Pigs ~30 ml Hard to

Chicken ~20 ml/egg Antibodi

Notes


of injections Dose

utaneoususcularermalenous

50 – 1000 µg

utaneoususcularermal

50 – 1000 µg

utaneoususcularermal

50 – 1000 µg


50 – 1000 µg


50 – 1000 µg

3.5. Purifying ProteinsDoses of immunogens for Rabbits

Type of antigen Examples Routes

Soluble Proteins EnzymesCarrier proteins conjugated with peptidesImmune complexes

SubcIntramIntradIntrav

Particulate Proteins Viruses (killed)Yeast (killed)Bacteria (killed)Structural proteins

SubcIntramIntrad

Insoluble Proteins Bacterially produced from inclusion bodiesImmunopurified proteins bound to beads

SubcIntramIntrad

Carbohydrates PolysaccharidesGlycoproteins

SubcIntramIntradIntrav

Nucleic acids Carrier proteins conjugated to nucleic acids SubcIntramIntradIntrav

roteins

n Comments

soluble Easy injections

soluble Slow release

soluble Injections more difficult, slow release

ic detergent < 0.2%tergent < 0.5%

Not effective for primary immunizations

106
Working with P3
Routes of injections for Rabbits

Routes Maximum volume Adjuvant Immunoge

Subcutaneous 800 µl per site, 10 sites per animal

Possible Soluble or in

Intramuscular 500 µl Possible Soluble or in

Intradermal 100 µl per site, 40 sites per animal

Possible Soluble or in

Intravenous 1000 µl No Soluble, ionNon ionic deSalt < 0.3 MUrea < 1 M

in L

om solutions:

available from Roche Applied Science

ody Protein A Protein G Protein L

1 – + ++

a – ++ ++

b – + ++

c + ++ ++

++ ++ +

+ ++ –

++ ++ ++

1 – ++ –

2 +/- ++ –

++ ++ –

– – ++

1 – ++ –

2 ++ ++ –

ing

3.5. Purifying ProteinsPurifying antibodies using Protein A*, Protein G* and Prote

Use this chart to select the appropriate product to purify antibodies fr

* Protein A Agarose (Cat. No. 11 134 515 001) and G Agarose (Cat. No. 11 243 233 001) are

Organism Antibody Protein A Protein G Protein L Organism Antib

Human IgG1 ++ ++ ++ Rat IgG

IgG2 ++ ++ ++ IgG2

IgG3 – ++ ++ IgG2

IgG4 ++ ++ ++ IgG2

IgM + – ++ Rabbit IgG

IgA + – ++ Horse IgG

IgE – – ++ Pig IgG

IgD – – ++ Sheep IgG

Fab + + ++ IgG

F(ab)2 + + ++ Goat IgG

k light chain – – ++ Chicken IgY

scFv + – ++ Cow IgG

Mouse IgG1 + ++ ++ IgG

IgG2a ++ ++ ++++ = strong binding+ = moderate bind– = no binding

IgG2b ++ ++ ++

IgG3 – + ++

IgM + – ++

roteins

ice with ice-cold PBS to remove remaining lture medium.ml per immunoprecipitation reaction is

ffer: mM NaClodium deoxycholateibitor Cocktail Tableta per 25 to 50 ml buffer

at least 4 weeks at – 20°C.

93 116 001 (more details in reference 14)

107
Working with P3
Immunoprecipitation

Cell Preparation Wash cells/tissue at least twserum proteins from the cuA sample volume of 1 to 3 recommended.

Cell Lysis Composition of 1 x lysis bu● 50 mM Tris, pH 7.5; 150● 1% Nonidet P40; 0.5% s● 1 Complete Protease InhStability of lysis buffer: ● stable for 24 hours at 4°C● stable – in aliquots – for

a Product available from Roche Applied Science: Complete e.g., Cat. No. 04 6

interfere during isolations in nly exhibit pronounced activities

to be performed at these pH tin* to the above lysis buffer at

the cells and keeping proteins rgents included in the above ever, for some antigens, more y be applied when the protein e state.

3.5. Purifying ProteinsImmunoprecipitation (continued)

Note In rare cases, aspartic acid proteases cananimal tissues. These proteases however oin the acid pH range. If extractions havevalues, it is recommended to add pepstaa concentration of 0.7 µg/ml. Detergents are essential for breaking up in a soluble state. In most cases, the detementioned lysis buffer are suitable. Howsophisticated solubilization protocols mahas to be obtained in a functionally activ

Wash Buffers Low salt wash buffer: ● same buffer as lysis bufferHigh salt wash buffer (1x concentrated):● 50 mM Tris, pH 7.5● 500 mM NaCl● 0.1% Nonidet P40● 0.05% sodium deoxycholate

roteins

at least 4 weeks at – 20°C. ash buffers if solutions need to be stored

g between antibody and antigen, the more tions should be. The washing buffers described onditions are appropriate. If higher stringency ncentrations and ionic strength by using n the first wash. Additionally, 0.1% SDS may and the first two washes.

e whole procedure between 0 and 4°C to help ation.

t. No. 11 359 053 001 → 10 mg; Cat. No. 11 524 488 001 → 50 mg

108
Working with P3
Stability of wash buffers: ● stable for 24 hours at 4°C● stable – in aliquots – forAdd 20% glycerol to these wat – 20°C.Note: The tighter the bindinstringent the washing condiare used if low stringency cis required, increase salt co0.5 M NaCl or 0.5 M LiCl ibe applied during cell lysis

Tips Keep temperature during thto reduce enzymatic degrad

* Available from Roche Applied Science Cat. No. 10 253 286 001 → 2 mg; Ca

n the reversible absorption of ized ion exchange groups.ecific interaction with the choosen pH and counterion-

xperimentally to find the optimal rest from the resin. Neutralizing ike salts or by changing the pH

oups:oups n exchanger) and n exchanger)roups hanger) and anger). their behavior under different

3.5. Purifying ProteinsIon Exchange Chromatography

Principle Ion exchange chromatography depends ocharged solute biomolecules to immobilEvery soluble biomolecule will have a spthe resin, depending on its charge underconditions.These conditions have to be established eproportions to elute the molecule of intethe ionic interactions with counterions ldesorbs the molecule from the resin.

Types There exist two types of ion exchange gr● Anion exchangers with the charged gr

Diethylaminoethyl (DEAE, weak anioQuaterny ammonium (Q, strong anio

● Cation exchangers with the charged gCarboxymethyl (CM, weak kation excSulphopropyl (SP, strong kation exch

Strong ion exchangers are more stable inpH conditions.

roteins

a broad variety of immobile phases that define hysical and chemical properties of the resin.

overview of the different types of commercially efer to references 4, 7, 9, 10 and the product nt manufacturers of columns and media.

109
Working with P3
These groups are coupled tothe ligand density and the pFor a more comprehensive available products, please rspecifications of the differe

for proteins:

9

ilibrated at the same pH and buffer ful mixing.

asure the total content of the

othing in the supernatant) and der which counterion conditions

ple in 50 mM steps between

3.5. Purifying ProteinsIon Echange Chromatography: Experimental setup

An easy setup experiment for establishing chromatographic conditions

1. Adjust the pH of the sample in 0.5 pH steps between pH 6 and pH

2. Incubate 20 µl of the sample with 10 µl chromatographic resin, equconditions, for 10 minutes at an appropriate temperature with care

3. Spin down the chromatographic resin in a desk-top centrifuge.

4. Test the supernatant for the protein in comparison to the load, mesupernatant.

5. Choose the pH at which the protein of interest binds to the resin (ndesirably most of the total protein is in the supernatant and test unthe protein will no longer bind to the resin:

6. Adjust the counterion (e.g., KCl or NaCl) concentration of the sam100 mM and 1 M.

roteins

hic resin, equilibrated to the same counterion ropriate temperature with careful mixing.

entrifuge.

to the load, measure the total content of the

changers to find the most optimal resin. You can here most contaminants bind but the protein of

elution from a resin is more desirable because it

110
Working with P3
7. Incubate 20 µl of the sample with 10 µl chromatograpconcentration of the sample, for 10 minutes at an app

8. Spin down the chromatographic resin in a desk-top c

9. Test the supernatant for your protein in comparison supernatant.

10. These test should be performed with different ion-exalso use the obtained information to find conditions winterest remains unbound, although the binding and yields concentrated protein.

ipita- Immuno affinity purification Immunofluorescence

ix*Streptavidin Mutein-Matrix*. Lowered biotin dissociation constant (1.3x10-7M) allows elution of bio-tinylated proteins

Avidin-Fluorescein* or Avidin-Rhodamine*

Anti-Flag agrose affinity gels

Anti-Flag with secon-dary antibody

APTG-Agarose Anti-β-gal with secon-dary antibody

Anti-GFP* Direct green fluore-scence of fused proteins or Anti-GFP-Flourescein* antibody

Glutathion-agarose-beads

Anti-GST with secon-dary antibody

ti-HA ix*

Anti-HA*, Anti-HA Affinity Matrix*

Anti-HA-Biotin*, Flourescein* or Rhoda-mine*

Poly-His-Protein pu-rification-Kit

Anti-His with secondary antibody

3.5. Purifying ProteinsTagging

Tag Size Remarks/Sequence Host CleavageDetection via Western Blot-ting

Immunoprection

AviTag 15 aa Mono-biotinylation of proteins via the AviTag sequence/GLNDI-FEAQKIEWHE

RTS* (Cell-free) Mammalian cells Bacterial cells Insect cells Yeast

None Streptavidin-POD*

Streptavidin Mutein Matr

Flag 8 aa Synthetic peptideSequence: DYKDDDDK

Mammalian cellsBacterial cellsYeast

Enterokinase Anti-Flag Anti-Flag

β-gal 120 kDa

β-galactosidase Mammalian cellsBacterial cells

Factor Xa Anti-β-gal Anti-β-gal

GFP 27 kDa Green fluorescent protein

Mammalian cells None Anti-GFP* Anti-GFP*

GST 26 kDa Glutathione-S-transferase

Bacterial cellsInsect cells

Thrombin Fac-tor Xa

Anti-GST GST-AgaroseBeads

HA 9 aa Peptide of human influ-enza virusSequence: YPYDVPDYA

Mammalian cellsBacterial cells

None Anti-HA-POD* Anti-HA*, AnAffinity Matr

His6 or His10

6 aa or 10 aa

Polyhistidine binds me-tal ligand (affinity chro-matography)

Mammalian CellsBacterial cells Yeast Insect cells

Thrombin enterokinase

Anti-His6-POD*

Anti-His6*

roteins

ein Anti-Intein Chitin-beads Anti-Intein with secon-dary antibody

BP Amylose Resin

myc- Anti-c-myc* Anti-c-myc* Anti-c-myc with secon-dary antibody

tein Anti-Protein C,Anti-Protein C Affinity Matrix*

Anti-Protein C,Anti-Protein C Affinity Matrix*

Anti-Protein C with secondary antibody

V-G- Anti-VSV-G* Anti-VSV-G* Anti-VSV-G with secon-dary antibody

n via Blot- Immunoprecipita-

tionImmuno affinity purification Immunofluorescence

111
Working with P3
* availabel from Roche Applied Science

Intein 55 kDa Protein splicing element from the Yeast VMA 1 gene

Bacterial cells Mediated self-cleavage

Anti-Int

MBP 44 kDa Maltose binding protein Bacterial cells Factor Xa Anti-M

c-myc 10 aa Human c-myc protein Sequence: EQKLISEEDL


None Anti-c-POD*

Protein C 12 aa Ca2+ depending bin-ding of Anti-Protein C antibodySequence:EDQVDPRLIDGK


None Anti-ProC-POD

VSV-G 11 aa Vesicular Stomatitis Vi-rus Sequence: YTDIEMNRLGK

Mammalian cells Bacterial cells

None Anti-VSPOD

Tag Size Remarks/Sequence Host CleavageDetectioWesternting

celecular Biology, Spektrum Verlag,

Biologypring Harbor Laboratory Pressrs, Academic Press A Laboratory Manual, 2nd edition.

, IRL Press

ence

3.6. References

1. The Complete Guide for Protease Inhibition (2007) Roche Applied Scien2. Michal, G (2006) Biochemical Pathways: An atlas of Biochemistry and Mo

Heidelberg3. Biochemica Information (1994) Roche Applied Science4. Doonan, S. (1998) Protein Purification Protocols, Methods in Molecular 5. Harlow, E. and Lane, D. (1988) Antibodies, a Laboratory Manual, Cold S6. Brown, T. A. (1991) In: Molecular Biology LabFax. Bios Scientific Publishe7. Sambrook. J., Fritsch, E. J. and Maniatis, T. (1989) In: Molecular Cloning,

Cold Spring Harbor Laboratory Press8. Roche Applied Science, Technical Data Sheets9. Harris et al (1990) Protein Purification Applications, a practical approach

10. Wheelwright, S. (1991) Protein Purification, Hanser Publishers11. Hofmeister, F. (1888) Arch. Exp. Path. Pharmakol. 24, 247 – 26012. Rapid Translation System: Application Manual (2002) Roche Applied Sci13. Protein Expression and Analysis, Brochure (2005), Roche Applied Science

Working with CellsChapter 4

4.1. Precautions for handling Cells ................................... 1134.2. Basic Information ............................................................. 1174.3. Manipulating Cells .......................................................... 1234.4 Analyzing Cells ................................................................. 1314.5. References ......................................................................... 144

s: use only fresh media and

(e.g., RPMI 1640, DMEM). o acids, glucose), vitamins, inor-nstituents are quite unstable and

freshly added. Many cells need

of albumins, globulins, growth uantity and quality of these com- health of the animals from whichnificant biological variation.

ubstances/components which are ty, e.g., growth factors, trace .

4.1. Precautions for handling CellsTissue culture reagents

General Optimize growth conditions of your celladditives and minimize variations.

Basic medium Various commercial media are available Medium constituents are nutrients (aminganic salts and buffer substances. Some cotherefore may cause problems when not additional factors for proper growth.

Fetal calf serum Serum is an extremely complex mixture promotors and growth inhibitors. The qponents are affected by age, nutrition andthe serum is obtained. It is subject to sig

Additives Some cells are dependent on additional sneccessary for viability or dividing activielements, essential metabolites, proteins

2-incubator at 100% relative humidity.

e to pH variations. n of 5% CO2, other media have to be run

n incubator may cause variances between

cterial contamination's from the incubator

113
Working with Cells 4
CO2 Incubator Cells are grown at 37°C in a COCO2 is needed to control pH. Cell physiology is highly sensitivSome media need a concentratioat 10% CO2. Inconsistent conditions within aculture plates. Pollution, chemicals, fungal or bamay affect cell physiology.

plasm. Yeast FungiStability at 37°C

- - - 3 days

- + + 3 day

- - - 3 days

+ 5 days

+ - - 3 days

+ - - 3 days

+ + - 3 days

/- - - 5 days

- - - 4 days

- - - 5 days

- + + 3 days

- - - 3 days

- - - 5 days

- - - 5 days

4.1. Precautions for handling CellsTissue culture reagents

Commonly used antibiotics in cell culture

a two or more antibiotics at the suggested concentration may cause cytopathic effects.* Product available from Roche Applied Science

Antibiotic Concentration a)Gram-

pos.Bact.Gram-

neg. Bact.Myco

Ampicillin* 100 U/ml + +

Amphotericine B* 0,25 to 25 µg/ml - -

Cabenicillin 100 U/ml + +

Ciprofloxacin 10 µg/ml

BM-Cyclin* (Pleuronutilin and Tetracyclin derivates)

10 µg/ml5 µg/ml

+ +

Erythromycin 100 µg/ml + +

Gentamycin* 5 to 50 µg/ml + +

Kanamycin* 100 µg/ml + + +

Lincomycin 50 µg/ml + -

Neomycin 50 µg/ml + +

Nystatin 100 U/ml - -

Penicillin G* 50 to 100 U/ml + -

Polymixin B 100 U/ml - +

Streptomycin* 50 to 100 µg/ml + +

well plate with antibiotica free medium.ncentrations.st concentration of antibiotic.

to 2–times in future treatments. without antibiotic. culture is free of contamination.

114
Decontamination of cell culture:

1) Dilute and seed cells into 96 2) Ad antibiotica at different co3) Check surviving rate at highe4) Reduce the concentration 1–5) Cultivate the cells in medium6) Repeat step 1) to 5) until the

4.1. Precautions for handling CellsGrowth areas and yields of cellsa in a culture vessels

a Such as 3T3, Hela or CHO cells.b Per well, if multiwell plates are used; varies slightly depending on supplier.c assuming confluent growth.

Cell Culture Vessel Growth areab (cm2) Numbers of cellsc

Multiwell plates

96 well 0.32 – 0.6 ~ 4 x 104

48 well 1 ~ 1 x 105

24 well 2 ~ 2.5 x 105

12 well 4 ~ 5 x 105

6 well 9.5 ~ 1 x 106

Dishes

Ø 35 mm 8 ~ 1 x 106

Ø 60 mm 21 ~ 2.5 x 106

Ø 100 mm 56 ~ 7 x 106

Ø 145 – 150 mm 145 ~ 2 x 107

Flasks

40 – 50 ml 25 ~ 3 x 106

250 – 300 ml 75 ~ 1 x 107

650 – 750 ml 162 – 175 ~ 2 x 107

900 ml 225 ~ 3 x 107

ultures, and one of the major problems in t up to 30% (variation from 5% to 85%) ntaminants being the species M.orale,

ys reveal their presence with macroscopic nants, particularly in continuous cell lines, ever, to affect various parameters c.) and thus can interfere with experiments utine, periodic assays to detect possible with continuous or established cell lines.

115
Mycoplasma Contamination

IntroductionMycoplasma is a common and serious contamination of cell cbiological research using cultured cells. It has been shown thacell cultures are contaminated with mycoplasma, the main coM.laidlawaii, M.arginii and M.hyorhinis.

It is important to keep in mind that mycoplasma do not alwaalterations of the cells or medium. Many mycoplasma contamigrow slowly and do not destroy host cells. They are able, how(e.g., changes in metabolism, growth, viability, morphology, etin cell culture. Therefore, it is an absolute requirement for rocontamination of cell cultures. This is particularly important

The major source of Mycoplasma contamination are:Cells purchased from outsidePeople handling cellsSerum, medium and additivesLiquid nitrogen

Segregate culture and test for Mycoplasma infection. Clean fume hood and incubator.


ation

essen-

4.1. Precautions for handling CellsMycoplasma Contamination

Indication for Mycoplasma contamination

Cells not adhering to culture vessel Mycoplasma contamination

Overlay trypsinized cells

No attachemend factors in medium

Decreased growth of culture Mycoplasma contamination

Low level bacterial or fungi contamin

Depletion, absence or breakdown oftial growth-promoting components.

Inproper storage of reagents

Very low initial cell inoculum


s

om

Specifity

+/-

+

+

+

+/-

116
Detection of Mycoplasma contamination

Overview of different assays

Suspension cells clumping together Mycoplasma contamination

Presence of calcium and magnesium ion

Cell lysis and release of DNA resulting froverdigestion with proteolytic enzymes

Assay Sensitivity

DNA staining with DAPI* +/-

DNA-RNA hybridisation +

ELISAa +/-

PCRa +

Culture +/-

1 663 925 910) are available from Roche Applied

ins double-stranded DNA

in aerobic and anaerobic conditions. lation.

peratly.

ycoplasma strains.

4.1. Precautions for handling CellsDetection of Mycoplasma contamination

a Mycoplasma Detection Kit (Cat. No. 11 296 744 001) and **Mycoplasma PCR ELISA (Cat. No. 1Science.* products available from Roche Applied Science.

Elimination of Mycoplasma in cell cultureBM-Cyclin*: 5–10 µg/ml mediumGentamycin*: 50 µg/ml mediumCiprofloxacin: 10 µg/ml medium

Assay Principle

DAPI* (4',6-Diamide-2'-phenylindole dihydro chloride)

DAPI is a fluorescent dye that specifically sta

Culture Combination of direct mycoplasma cultivationA species specific assay should follow the iso

ELISA** Determination of each species is use done se

PCR* Usely multiplex PCR for the most "popular" m


4.2. Basic InformationTypical Properties of Bacterial Cells

Domain Bacteria

Kingdom Bacteria

Nucleus no (common term prokarya)

Genomecircular, ca. 106 to 5 x107 kb,extra plasmids

RNA Polymerase one type

Starting amino acid for translation

formylmethionine

Reproduction binary scission

Cellular organization

unicellular (some are aggregated)

Nutritionchemoorganotrophic, photoautotrophic or photoheterotrophic

Size of cells average 1 – 5 µm, wide variation

Cell membranes rigid, contain peptidoglycans

Internal membranes noAfter Campbell, N.A.: Biology 4/e. Benjamin/Cummings 1996.

117

4.2. Basic InformationTypical Properties of Plant Cells

Domain Eukarya

Kingdom Plant

Nucleus yes

Genomelinear, 107 to > 1011 kb,organized in several chromosomes

RNA Polymerase several types


methionine

Reproduction asexual/sexual


multicellular

Nutrition photoautotrophic


Cell membranes rigid, contain cellulose and lignin

Internal membranes yes, they enclose organelles/vesiclesAfter Campbell, N.A.: Biology 4/e. Benjamin/Cummings 1996.

Working with Cells 4 118

Typical Properties of Animal Cells

Domain Eukarya

Kingdom Animals

Nucleus yes

Genomelinear, 107 to > 1011 kb,organized in several chromosomes

RNA Polymerase several types


methionine

Reproduction asexual/sexual


multicellular

Nutrition chemoheterotrophic


Cell membranes soft, lipid bilayer only

Internal membranes yes, they enclose organelles/vesiclesAfter Campbell, N.A.: Biology 4/e. Benjamin/Cummings 1996.

4.2. Basic InformationNucleic Acid and Protein content of a bacterial cell a

Theoretical maximum yield for a 1 liter culture (109 cells/ml) of protein of interest is0.1% of total protein: 155 µg per liter2.0% of total protein: 3 mg per liter50.0% of total protein: 77 mg per liter

a values for Escherichia coli or Salmonella typhimurium

Cell data Per cell Per liter culture (109 cells/ml)

Wet weight 950 fg 950 mg

Dry weight 280 fg 280 mg

Total Protein 155 fg 155 mg

Total genomic DNA 17 fg 17 mg

Total RNA 100 fg 100 mg

Volume 1.15 µm3 = 1 picoliter

Intracellular protein concentration 135 µg/ml


Nucleic Acid content in mammalian cells

Nucleic Acid content in a typical human cell RNA distribution in a typical mammalian cell

Cell data Per cell RNA Species Relative amount

Total DNA ~ 6 pg rRNA (28S, 18S, 5S) 80 – 85%

Total RNA ~ 10 – 30 pg tRNAs, snRNAs 15 – 20%

Proportion of total RNA in nucleus ~ 14% mRNAs 1 – 5%

DNA:RNA in nucleus ~ 2 : 1

Human genome size (haploid) 3.3 x 109

Coding sequences/genomic DNA 3%

Number of genes 0.5 – 1 x 105

Active genes 1.5 x 104

mRNA molecules 2 x 105 – 1 x 106

Average size of mRNA molecule 1900 b

Different mRNA species 1 – 3 x 104

119

4.2. Basic InformationNucleic Acid and Protein content in human blood*

* From a healthy individual.

Data Erythrocytes Leukocytes Thrombocytes

Function O2/CO2 transport Immune response Wound healing

Cells per ml 5 x 109 4 – 7 x 106 3 – 4 x 108

DNA content – 30 – 60 µg/ml (6 pg/cell) –

RNA content – 1 – 5 µg/ml –

Hemoglobin content ~ 150 mg/ml (30 pg/cell) – –

Plasma protein content – – 60 – 80 mg/ml

Notes


4.2. Basic InformationCell Cycle

G1 phasegrowth phase

G2 phaserepair andpreparator phase

S phaseDNA synthesis

Interphase

M phasesmitosis

G0 phaseresting state ordividing activitycompletely halted

Cytokinesiscontractile ringsfurrowing organelledivide


Prophasechromosomecondensation

centriole duplication

Prometaphasenuclear envelope

disruption

Telophasecontractile ringformation

Anaphasechromosomedivision

Metaphasespindle formation

chromosomes alignat equator

121

4.2. Basic InformationArresting Cells

Synchronization of mammalian somatic cells

Production of synchronized cells in cell cycle phase

method inhibition of reversibility of block

suitable for

G0 depriviation of serum from medium

protein synthesis + fibroblasts

late G1 L-mimosine formation of hyposunine from lysine

+/- CHO cells, HL-60

early S hydroxyureathymidine

synthesis of dNTPs +/- transformed human cells

G/S aphidicolin DNA polymerase + human fibroblaststransformed humancells

G2 topoisomerase II toposisomerase II inhibitors

+ transformed humancells

M nocodazole(followed by shake-off)

depolymerization of microtubuli

+ human fibroblasts transformed humancells

Notes


4.3. Manipulating CellsTransfection of mammalian cells

Ca2+ lipos. Transfection Transduction Electroporation Microinjection

Principle Ca phosphate / DNA aggregates are transferred through the cell membrane

DNA / lipophilic agent complexes are transferred through the membrane

Reagent to be cou-pled to a “transloca-tion peptid”

A high voltage pulse is used to open the membrane of the cells

Injection directly into the nucleus or cyto-plasm using micro glass capillaries

use for DNA

use for RNA

use for peptides

use for antibodies

Cells eukaryotic cells eukaryotic cells eukaryotic cells eukaryotic cellsbacteriayeasts

eukaryotic cells

Costs for equipment/ reagents

low / low low / medium medium high / low high / medium

Efficiency low medium - high low - high medium - high very high

Remarks inefficient but simple, high volumes possible

purity of DNA is important

Trends in Cell Biology 10(2000)290–295.Nature Biotechnology 19(2001), 360–364

standard method for many bacteria, sur-vival rate is critical for eukaryotic cells

non-random method, comparably few cells can be used, method of choice e.g., for antibodies

ds for delivery of molecules, especially ever no single technique alone is llular systems used for transfection and the specific experimental require-nes, primary cells, easy cell lines, ucleotides, proteins) or even high hod may possess advantages or disad-

t they are in good condition and set cell density from start to end of

le for uptake and expression of ells. Mitogenic stimuli (e.g., virus tioned media, feeder cells) are often

rs of magnitude between adherent at the limiting step is the uptake by

hanistic explanation on molecular e search for more efficient trans-

123
Transfection of mammalian cells (continued)

General There exist several well etablished methonucleic acids, into eukaryotic cells. Howsuitable for the multitude of different ceexperiments. Depending on the cell typements like transfection of difficult cell lidifferent molecules (DNA, RNA, oligonthroughput purposes, each transfer metvantages.Keep an eye on your cells: take care thaa suitable plating protocol for optimaltransfection.

Dividing vs. non-dividing cells

Dividing cells tend to be more accessibforeign DNA compared to quiescent ctransformation, growth factors, condiused to activate primary cells.

Adherent vs.suspension cells

Transfection efficiencies differ by ordeand suspension cells. It is speculated thendocytosis, however, a plausible meclevel does not exist so far. Therefore thfection reagents is mainly empirical.

e trypsinated in order to remove ep means a severe obstruction of the splitting protocol (e.g., extend ime untill transfection starts)f transfection experiments.

re features may change with time s, how often a cell line has been act passage number untill the line

t cases.o clonal selection. Cell lines with nificantly with respect to physio-ty).

e is space on the substrate (tissue ffected by cell density (contact in-bolic endproducts (e.g., pH). The tly correlated with cell number atell lysis.

4.3. Manipulating CellsTransfection of mammalian cells (continued)

Splitting protocol Before splitting, adherent cells have to bthem from the substrate. This routine stnormal cellular functions. Differences in of trypsination, inactivation of trypsin, tcould have an impact on the efficiency o

Passage number Cell lines tend to be unstable and therefoin culture. The passage number indicatesplitted (normally within one lab). The exhas been established is unknown in mosDifferent culture conditions could lead tthe same name could therefore differ siglogy and morphology (and transfectabili

Cell number (grade of confluency)

Cell lines divide exponentially when therculture dish). Growth rate is negatively ahibition), depletion of nutrients or metaextent of reporter gene expression is directransfection start and growth rate until c


DNA influences on transfection

General Control your vector: check the quality of your purified DNA and consider suitability of functional sequences for your special cellular system. Always use a control vector.

Vector integrity Functionality of a vector depends on the structural integrity of the plasmid preparation. Supercoiled form versus relaxed form, double strand breaks, degradation by nucleases and physical stress during storage and handlinginfluences transfection efficiency.

Vector preparation Vectors are produced in bacterial systems and purified according to various protocols. Contaminants in the vector preparation (e.g., CsCl) mayinfluence transfection efficiency.

Vector architecture (Enhancer / Promoter / cDNA / poly A signal)

Often transfection systems are optimized and compared by the use of control vectors with strong viral regulatory elements (e.g., RSVa, CMVb, SV40c). However, the relative efficiacy of viral promotor/enhancer systems can differ from cell line to cell line in a range of two orders of magnitude. In some cell lines expressing the large T antigen (e.g., COS) the SV40 system is highly efficient due to autonomous plasmid amplification. In many other cell lines the CMV promotor is most efficient.

a Respiratory Syncitial Virus b Cytomegalo Virus c Simian Virus 40

124

: start with the standard protocolo and dose for optimization.

reagents that DNA is packed into this form the DNA tends to leases and inaccessible to interca-agent/DNA-ratio, ionic strength, mperature affect the composition

complexes.

ly formed by charge interaction. ents (cell lines, primary cells), to give highest expression rates.

mplexes are more efficiently ad-ace. On the other hand, in in vivo negative charges proofed to be

mum characteristic when the ased. The ascending part of the

NA transfected into the cells.

4.3. Manipulating Cells Transfection protocol

General Establish a suitable transfection protocoland do some tests with variations in rati

Preparation of trans-fection complex

It is a common feature of all transfectioncompact, highly condensed particles. In be highly resistant to degradation by nuclating dyes. Variables like transfection rebuffer/pH, DNA/lipid- concentrations, teand the functionality of the transfection

Transfection reagent / DNA ratio (charge ratio)

Transfection complexes are predominantGenerally, in in vitro transfection experimcomplexes with a positive net-charge seemIt has often been argued that positive cosorbed to the negatively charged cell surfapproaches, complexes with an excess ofmost efficient.

Dose dependence Many transfection reagents show an optiamount of transfection complex is increcurve reflects the increasing amount of D

eflects the cytostatic (some times cytotox-ansfection complex on cells. Interestingly s* does not show this decrease at the

o apply the transfection complex to the ise to the medium or in combination with ith medium. The first option is more con- a more constant application which avoids

transfection affects transfection ve manner. This is true for different basic cially when calf serum has to be included. eagents the efficiency is reduced in the m). Some companies provide optimized to be used in combination with the trans-NE® Transfection Reagents* are effective um.

125
The declining part of the curve ric) effect of larger amounts of trFuGENE® Transfection Reagenthigh-dose end.

Application of transfec-tion complex

There are two alternative ways tcells. Either concentrated, dropwa medium exchange prediluted wvenient. The latter option allowslocal toxic doses.

Transfection medium The medium present during theefficiency in a positive or negatimedium compositions and espeWith a number of transfection rpresence of FCS (Fetal Calf Seruserum-free transfection media**fection reagents. However FuGEin the presence or absence of ser

* Available from Roche Applied Science** Nutridoma-CS; -HU; -NS; -SP are also offered by Roche Applied Science

ransfection experiment for optimal

ells into culture plates. At the ould be about 50% confluent, in

end of the experiment. If serum is ay arrest for some time. cells takes place within a period of uration characteristic which means,rease in efficiency can be detected.

n complex, the medium has to . This step is absolutely essential if absence of FCS. With non-toxic presence of serum (e.g., FuGENE® be eliminated, if there is enough eriod.

4.3. Manipulating Cells Time course of transfection

General Set up a suitable time course for your texpression of your protein of interest.

Start of transfection 12 hours before transfection split the cbeginning of transfection the culture shorder to nearly reach confluency at thetaken away during transfection cells mThe uptake of transfection complex byhours (0.5h – 6h). The kinetic has a satthat after a certain point no further inc

Medium exchange After the application of the transfectiobe replaced by normal growth mediumtransfection has to be performed in thetransfection reagents* which work in theTransfection Reagents*) this step couldmedium for the following expression p

126

yzed 24h to 48h after the start of transfec-s a constant increase in concentration of depends on the sensitivity of the reporter r) and the ”lab routine“ when is the best

w.powerful-transfection.com


Time of analysis Reporter gene expression is analtion. Within this period, there ireporter gene product. It mainlygene assay (strength of promototime for harvesting the cells.

* Products available from Roche Applied Science, please visit and bookmark ww

exponential growth phase plates.

e medium should be changed

5 µg plasmid DNA is diluted EDTA, pH 7.6) to a final

s added quickly to an equal l, 1.5 mM Na2HPO4,

(pH of 7.3 – 7.6.).

O cells, a "glycerol shock" is PBS. After 1 min the glycerol on of the mixture and replace-ck" is used, just replace with

rm F.M., Transfecting mammalian cells: e precipitate formation., Nucleic Acids

4.3. Manipulating Cells Calcium phosphate-DNA coprecipitation

The day before transfection plate cells from (1 – 4 x 105 cells/ml) into 12-well or 60 mm

One hour before the precipitate is added, thwith fresh medium.

A solution of 100 µl 2.5 M CaCl2 and up to 2with low TE buffer (1 mM Tris-HCl, 0.1 mMvolume of 1 ml.

One volume of this 2 x Ca2+/DNA solution ivolume of 2x HEPES solution (140 mM NaC50 mM HEPES, pH 7.05 at 23°C).

The cells are precipitated for 2 – 6 h at 37°C

After incubation, for some cell lines, e.g., CHadvised. Cells are exposed to 20% glycerol inis removed by adding fresh medium, aspiratiment with fresh medium. If no "glycerol shofresh medium.

For detailed information see: Jordan M., Schallhorn A., and Wuoptimization of critical parameters affecting calcium-phosphatResearch, 24 (4) p.p. 596–601, 1996.


Liposomal and non-liposomal Transfection Reagents

For more information and a database of successfully transfected cells, please consult www.powerful-transfection.com

Transfection of siRNA oli-go´s for gene knockdown applications

X-tremeGENE siRNA Transfection Reagent:

Proprietary blend of lipids and other components, sterile filtered and free of components derived from an-imals. It enables the efficient transfection of a wide range of cell lines with low cytoxic side effects and, siRNA- and cotransfection-based gene knockdown experiments. It also functions exceptionally well in the presence and absence of serum.

Transfection of plasmids and linear DNA fragments for cellular analysis, pro-tein expression and gene knockdown applications (using shRNA expressing plasmids)

FuGENE® HD Transfection Reagent:

Next-generation proprietary non-liposomal reagent that is free of animal-derived components. As proven by many scientists, it combines minimal cytotoxic side effects with excellent transfection efficiency in many cell lines not transfected well by other reagents (e.g. cell lines commonly used in oncology research, stem cells and many other difficult-to-transfect cell lines). The reagent functions in up to 100% serum and, requires a limited amount of handling steps (dilute plasmid DNA, mix with FuGENE® HD Transfection Re-agent, incubate and pipet the complex directly to the cells).

127

4.3. Manipulating CellsElectroporation

Electroporation uses of a transmembrane electric field pulse to induce microscopic pathways (pores) in a bio-membrane. All major manufactur-ers of electroporation devices offer detailed protocols for many cell lines. Electroporation is not restricted to any substance. Almost any substance that can be solved or dispersed in water can be transferred into living cells. Two very different methods are used, long Millisecond Pulses and short Mi-crosecond Pulses. The latter are much more physiologically compatible.

The cells should be in the exponential growing phase before harvesting. Adherent cells should not be more confluent than 70%.

Keep treatment of adherent cells with trypsin as short as possible, other-wise the membrane gets damaged.

Solve the DNA in water, or in low TE (1mM Tris-HCl, 0.1 mM EDTA, pH 7.6), EDTA inside the cell has very toxic effects.

After electroporation the cell membrane is open. Handle cells with extreme care. Do no shake, aspirate very slowly with pipette.


Times and temperature are critical. Resealing of the holes in the membrane occurs during approx. 1 – 3 minutes at room temperature.

Please note: Don’t keep cells on ice because after 30 minutes the cells leak out and the ion gradient is destroyed.

128

following formula:

strength which has been cal-between electrodes [cm]):

crements

4.3. Manipulating CellsElectroporation

Calculating the Required Field Strength for Electroporation

A standard value for the required field strength can be calculated using the

Example:Cell radius a = 10 µm = 10 · 106 cmCritical breakdown voltage at room temperature Vc = 1 V [Vc (4°C) = 2 V]

The voltage required for the Multiporator can be calculated using the field culated and the distance between the electrodes in the cuvette (d: Distance

V = Ec · d

Suggestion for a test series:

1. Voltage applied: 130 V2. Voltage applied: 160 V3. Voltage applied: 200 V4. Additional voltage 240 V and in appropriate in

Vc

1.5 x aEc =

Critical field strength Ec =1 V

1.5 x 10 x 10-4 cm

V

cm = 666

Example for 2 mm cuvettes:V

cm x 0.2 cm = 133

V

cm 666

ammalian Transfection Mode

e [μs]

129
Voltage Profile

Voltage Profile of Eppendorf Multiporator in M

1000

800

600

400

200

0

Volta

ge [

Volt]

� = 30 μs Tim

4.3. Manipulating CellsMicroinjection

This physical method offers the best possible transfection efficiency as the DNA is brought directly intothe cell nucleus. Cells are injected using an extremely fine glass capillary (e.g., Eppendorf Femtotips) which is filled with DNA, RNA or any other liquid reagent. With the aid of a micromanipulator (e.g., Eppendorf InjectMan 5179) this glass capillary is moved into the cells and with the aid of a microinjector (e.g., Eppendorf FemtoJet 5247) pressure is applied to force the liquid into the cells.

Microinjection is the only non-random transfection method available. It has some unique advantages and limitations as well.

Advantages1. It is the only method where the user can actively decide which cells should

be transfected. 2. It is possible to inject directly into the nucleus or the cytoplasm of a cell.3. Cells remain in their cellular context; thus, intra- and extracellular signals

or transport processes can be analyzed.4. Co-transfection of different reagents is possible.5. The cells can be monitored in real time during the transfection process.6. In principle any kind of cells or substances can be used for microinjection.

Limitations1. The number of cells that can be analyzed is

limited. Using automatic microinjectors, a maxi-mum of about 1000 adherent cells per hour can be transfected. If suspension cells are used this number is even much lower.

2. The equipment is rather expensive.3. It takes time to be an expert with this technique.


Use of Selection Markers for Stable Cell Lines

Seed cells at 25% confluence, let the cells grow overnight.Substitute the cells with medium containing varying concentration of selection reagentReplace the selection medium every 3 to 4 days Determine the appropiate concentration of selection reagent

* Product available from Roche Applied Science

Selection Reagent Concentration Cell death after

Blasticidin 1 to 20 µg/ml 7 to 10 days

G-418 (Neomycin) 50 to 1000 µg/ml 7 to 14 days

Hygromycin* 10 to 500 µg/ml 7 to 14 days

Zeocin 50 to 1000 µg/ml 7 to 14 days

130

t6,7 mechanisms: Necrosis or pounds and cells are said to be

th. the difference between these

e start with some basic

ly be defined:ological process which occurs or chemical insult.death) is the physiological re eliminated during develop-.

hemical compound (such as a iator cell (cytotoxic T cell). In cytotoxicity does not indicate

t is, cell death mediated by ei-ral killer [NK] cells) combines.

4.4. Analyzing Cells Apoptosis/Necrosis

Terminology of cell death

Cell death can occur by either of two distincApoptosis. In addition, certain chemical comcytotoxic to the cell, that is, to cause its deaSomeone new to the field might ask, what'sterms? To clear up any possible confusion, wdefinitions.

Necrosis and apoptosis The two mechanisms of cell death may briefNecrosis ("accidental" cell death) is the pathwhen cells are exposed to a serious physical Apoptosis ("normal" or "programmed" cell process by which unwanted or useless cells ament and other normal biological processes

Cytotoxicity Cytotoxicity is the cell-killing property of a cfood, cosmetic, or pharmaceutical) or a medcontrast to necrosis and apoptosis, the terma specific cellular death mechanism.For example, cell-mediated cytotoxicity (thather cytotoxic T lymphocytes [CTL] or natusome aspects of both necrosis and apoptosis

131
Illustration of the morphological features of necrosis and apoptosis

al and biochemical differences

o extreme variance from physio-oxia) which may result in damage gical conditions direct damage to like complement and lytic viruses.

e cell's ability to maintain home-xtracellular ions. Intracellular or-

, and the entire cell swell and reakdown of the plasma mem-

g lysosomal enzymes are released vivo, necrotic cell death is often ng in an intense inflammatory

death that occurs under normal n active participant in its own


Differences between necrosis and apoptosis

There are many observable morphologicbetween necrosis and apoptosis.

Necrosis occurs when cells are exposed tlogical conditions (e.g., hypothermia, hypto the plasma membrane. Under physiolothe plasma membrane is evoked by agents

Necrosis begins with an impairment of thostasis, leading to an influx of water and eganelles, most notably the mitochondriarupture (cell lysis). Due to the ultimate bbrane, the cytoplasmic contents includininto the extracellular fluid. Therefore, inassociated with extensive damage resultiresponse.

Apoptosis, in contrast, is a mode of cell physiological conditions and the cell is ademise ("cellular suicide").

rmal cell turnover and tissue homeo and maintenance of immune tolerance, tem and endocryne-dependent tissue

characteristic morphological and bio-s include chromatin aggregation, nuclear artition of cytoplasm and nucleus into totic bodies) which contain ribosomes,

ndria and nuclear material. In vivo, these gnized and phagocytized by either macro-s. Due to this efficient mechanism for the o no inflammatory response is elicited. In l as the remaining cell fragments ultimate-minal phase of in vitro cell deathrosis”.

132
It is most often found during nostasis, embryogenesis, inductiondevelopement of the nervous sysatrophy.

Cells undergoing apoptosis showchemical features. These featureand cytoplasmic condensation, pmembrane bound-vesicles (apopmorphologically intact mitochoapoptotic bodies are rapidly recophages or adjacent epithelial cellremoval of apoptotic cells in vivvitro, the apoptotic bodies as welly swell and finally lyse. This terhas been termed “secondary nec

s

rane blebbing, but no loss of integrityation of chromatin at the nuclear membrane with shrinking of cytoplasm and condensa- nucleusith fragmentation of cell into smaller bodies

tion of membrane bound vesicles (apoptotic )ondria become leaky due to pore formation

ng proteins of the bcl-2 family.

individual cellsed by physiological stimuli (lack of growth , changes in hormonal environment)

cytosis by adjacent cells or macrophageslammatory response


Necrosis Apoptosi

Morphological features

Loss of membrane integrity

Begins with swelling of cytoplasm and mitochondriaEnds with total cell lysisNo vesicle formation, complete lysisDisintegration (swelling) of organelles

MembAggregBeginstion ofEnds wFormabodiesMitochinvolvi

Physiological significance

Affects groups of contiguous cellsEvoked by non-physiological disturbances (comple-ment attack, lytic viruses, hypothermia, hypoxia, ischemic, metabolic poisons)Phagocytosis by macrophagesSignificant inflammatory response

AffectsInductfactors

PhagoNo inf

Tightly regulated process involving activation and enzymatic stepsEnergy (ATP)-dependent (active process, does not occur at 4°C)Non-random mono- and oligo nucleosomal length fragmentation of DNA (Ladder pattern after agarose gel eletrophoresis)Prelytic DNA fragmentationRelease of various factors (cytochrome C, AIF) into cytoplasm by mitochondriaActivation of caspase cascadeAlternations in membrane asymmetry (i.e., transloca-tion of phosphatidylserine from the cytoplasmic to the extracellular side of the membrane)

133
Biochemical features

Loss of regulation of ion homeostasisNo energy requirement (passive process, also occurs at 4°C)

Random digestion of DNA (smear of DNA after aga-rose gel electrophoresis

Postlytic DNA fragmentation (= late event of death)

totoxicity assays were used. These

hat measure increases in plasma s become leaky.

ion in the metabolic activity of ls cannot metabolize dyes, while

th types of cytotoxicity assays , early phases of apoptosis do not . Although the cytotoxicity assays ys were needed to detect the early

at occour during apoptosis, a assays can measure one of the

4.4. Analyzing Cells Apoptosis Assay Methods

Originally, to study both forms of cell death, necrosis and apoptosis, cyassays were principally of two types:

Radioactive and non-radioactive assays tmembrane permeability, since dying cell

Colorimetric assays that measure reductmitochondria, mitochondria in dead celmitochondria in living cells can.

However, as more information on apoptosis became available, that bovastly underestimated the extent and timing of apoptosis. For instanceaffect membrane permeability, nor do they alter mitochondrial activitymight be suitable for detecting the later stages of apoptosis, other assaevents of apoptosis.

In relation with increased understanding of the physiological events thnumber of new assay methods have been developed. For instance, thesefollowing apoptotic parameters:

lations of cells or in individual cells, in to different fragments.

metry. Phosphatidylserine translocates acellular side of the cell membrane.

. This family of protease sets off a cascade e of cellular functions.

F into cytoplasma by mitochondria.

poptosis

134
Fragmentation of DNA in popuwhich apoptotic DNA breaks in

Alternations in membrane asymfrom the cytoplasmic to the extr

Activation of apoptotic caspasesof events that disable a multitud

Release of cytochrome C and AI

For more details please check out http://www.roche-applied-science.com/a

4.4. Analyzing Cells Apoptosis Assay Methods: Selection Guide


Start

Do you analyze data by

FACS microscopy

All Products are available from

Roche A

pplied Science, h

ttp://w

ww

.roche-ap

plied

-science.com

/apop

tosis

4.4. Analyzing Cells Cell Proliferation and Viability

General Rapid and accurate assessment of viable cell number and cell proliferation is an important requirement in many experimental situations involving in vitro and in vivo studies.Usually, one of two parameters are used to measure the health of cells

Cell Viability Can be defined as the number of healthy cells in a sample. Whether the cells are actively dividing or are quiescent is not distinguished. Cell viability as-says are often useful when non-dividing cells (such as primary cells) are isolated and maintained in culture to determine optimal culture conditions for cell populations.Methods for determining viable cell number is a direct counting of the cellsin a hemocytometer, cell morphology (staining), metabolic activity

Cell Proliferation Is the measurement of the number of cells that are dividing in a culture.Methods for determination: clonogenic assays (plate cells on matrix), establish growth curves (time-consuming), measurement of DNA synthesis (3H-thymidine or bromodeoxyuridine), indirect parameters(measure cell cycle regulating molecules)

Notes


4.4. Analyzing Cells Proliferation Assay Methods: Selection Guide

137
All Products are available from

Roche A

pplied Science, h

ttp://w

ww

.roch

e-app

lied-scien

ce.com

/apo

pto

sis

to physically separate and eneous populations.

ensitivity: + Duration: +++

irectly labeled primary antibody

ate at 37°C) first.

ncubate with directly labeled antibody.

chrome.

4.4. Analyzing Cells FACS (Fluorescence activated cell sorting)

General powerful technique used in flow cytometryidentify specific types of cells from heterog

Procedure: Staining of surface proteins on intact cells

Sensitivity: +++ Duration: + Sensitivity: ++ Duration: ++ S

Biotin-Streptavidin enhancement Directly labeled 2nd Ab D

Harvest Cells (5x105) per stain, (For suspending adherent cells, try EDTA (2mM in PBS, incubTrypsin solutions might damage surface antigens and preclude their detection)

Wash cells once with FACS buffer

Incubate with first antibody 30 min (1–10 µg/ml) I

Wash cells with FACS buffer

Add Biotinylated 2nd Ab (1–10 µg/ml) Add labeled 2nd Antibody, incubate 30 min.

Wash cells with FACS buffer

Add streptavidin linked fluorochrome (1–5 µg/ml) incubate 15–30 min.

Wash, resuspend in FACS buffer, measure

All incubations should be done on ice. Keep solutions in the dark after addition of the fluoro

, Propidium Iodide (PI) or 7-Aminoactin-d in the final step.

inoactinomycin-D (7-AAD) selectively fluorescence in FL3 allowing to exclude ay bind antibodies unspecifically).

Influenced by

g up Cell Type, Cell treatment (some chemicals exhibit strong autofluorescence!). Dead cells might exhibit stronger autofluorescence.

econdary Immunoglobulin receptors on the cell surface (might bind secondary antibody). Secondary reagents might stick to dead (permeabilized) cells.

primary

138
For discrimination of dead cellsomycin-D (7-AAD) can be addePropidium Iodide (PI) and 7-Amenter dead cells and lead to highthem from analysis (dead cells m

Controls

Control type Parameter controlled

Cells only in FACS-Buffer Autofluorescence, used for settinInstrument

Omit first antibody (not for directly labelled) Controls non-specific binding of sreagents.

Isotype control antibody instead of primary antibody.

Controls specificity of staining forantibody

hat bulk of cells is in window.

djust fluorescence level of ade (Fig. 2)

r

s, fluorescent proteins (eg. GFP), and DNA

4.4. Analyzing Cells FACS

Measurements

1: Switch on FACS, check levels of sheath, waste etc. (ask operator)

2: With the unstained cells as sample, set up the following

Set up dot plot view of FSC vs. SSC adjust amplification levels so tSet gate on population to be measured (Fig. 1)Set up histogram view of fluorescence channel(s) to be measured. Achannel(s) to be used, so that the bulk of the cells is in the first dec

Name Measured paramete

FSC (Forward Scatter) Size of cell

SSC (Sideward scatter) Granularity of cell

FL 1–4 (Fluorescence channel 1–4) Detection of antibodiebinding molecules

ells are located in the gate R1 (red). Dead 2 (green).

of population R1 from Fig.1. Black: control antibody. Red: Specific antibody.

Fig 2

139
Fig 1: FSC vs. SSC plot. Intact ccells and debris are in the gate R

Fig 2: Overlay of measurementsAutofluorescence. Blue: Isotype

Fig 1

roscope.s are not in the window)?

ystem. SSC plotith buffer (´Prime´)

round-bottom plates, for easy

in (H3) tubes. Just put one of

needle jacket should be ion.

4.4. Analyzing Cells FACS

Troubleshooting No signal/no cells visible in FSC/SSC plot:Cells lost during staining? Check with a micFSC/SSC amplification too high or low (cellTry lowering/raising the amplification.Problem with the FACS system. Restart the sNo clear population, cells are spread in FSCAir bubbles are aspirated ? Refill flow path wCells lost? Check with microscope.

Tips Stainings can be conveniently done in 96 wellhandling with a multichannel pipettor.Small samples (50 – 200 µl) can be measuredthe small tubes in a larger 'Facs' tube.For measurement of small samples the outerremoved to prevent complete sample aspirat

Notes


ISA Histology WESTERN BLOT

Mat

eria

l

Tim

e (h

)

Ch

emic

al

Imm

un

o-

log

ical

E* 4 1 ng/band

E* 4 1 ng/band

– – – –

4.4. Analyzing Cells Overview: Reporter Gene Assays

* E = Extract

REPORTER

CHEMILUMI-NESCENCE

EL

Sen

siti

vity

Mat

eria

l

Tim

e (h

)

Sen

siti

vity

CAT non endogene-ous activity

narrow linear range

– – – 10 pg

β-Gal bio- and chemical assays

endogeneous activity(mammalian cells)

20 fg E* 1.5 – 2.5

10 pg

Luc high specific activity

requires sub-strate + O2 + ATP

5 fg –1 pg

E* 0.5 –

1 pg S* 4 – – 1 ng/band

– – – – – 1 ng/band

– – – – – 5 ng/band

141
* no cross-reactivity with rat GH

** S = Supernatant

hGH* secreted –protein

cell lines with defects in the secretary pathway

– – –

SEAP secreted protein

endogeneous activity in some cells &cell lines with defects in the secretary pathway

10 fg

S* 1

GFP auto-fluores-cence

requires post-translational modifications

– – –

of eukaryotic gene expression and e to an early detectable “reporter”

transfection efficiency.

http://www.roche-applied-science.com


Reporter systems contribute to the study regulation by joining a promoter sequencgene.

Reporter systems are also used to check

CAT* Chloramphenicol Acetyltransferaseβ-Gal* β-GalactosidaseLuc* LuciferasehGH* Human Growth HormonSEAP* Secreted Human Placental Alkaline PhosphataseGFP Green Fluorescent Protein

* Nonradioactive Reporter Gene Assays available from Roche Applied Science; please visit:

142

Notes


Dynamic range/Sensitivity

Sensitivity comparison of Luciferase Reporter Gene Assays

5 ng–400 ng/ml of cell extract

Luciferase Reporter Gene Assayhigh sensitivityLuciferase Reporter Gene Assayconstant light signal


Method/detection Advantages

Luciferase Reporter Gene Assay, high sensitivity

Quantify enzymatically active luciferaseD-Luciferin/chemiluminescence

Produces a high intensity light emission (t1/2 � 5 min)Optimized lysis buffer for dual reporter genes assays

Luciferase Reporter Gene Assay, constant light signal

Quantify enzymaticallyactive luciferaseLuciferin/chemiluminescence

Produces an extended light emission (t1/2 � 3h) Ideal for high throughput screening (HTS)Optimized lysis buffer for dual reporter genes

hGH ELISA(secreted human growth hormone)

ELISA for hGH secreted in culture medium Measure total (active and in-active) hGH Colorimetric, fluorescent, or chemiluminescent detection

20 times more sensitive thanisotopic hGH assaysNo cell lysis requiredStudy protein expression ki-netics over extended periodsMaster-lot standardization*

tive

ission

uffer for es

400 pg–400 pg/ml of cell extract

ssay ardization*rial

uffer for es


reagents s or tissue

ired Ex-sion

dium for

ression

500 fg–50 ng/ ml of of cell extract

Dynamic range/Sensitivity

143
β-Gal ReporterGene Assay,chemiluminescent

Quantify enzymatically active β-Gal Galacton PlusTM Chemilu-minescent Substrate

Highly sensitive Measures only acenzyme Extended light em(t1/2 � 10 min)Optimized lysis bdual reporter gen

β-Gal ELISA ELISA determines total ex-pressed (active and inactive) β-Gal enzyme Colorimetric, fluorescent, or chemiluminescent detection

Nonradioactive aMaster-lot standSpecific for bacteβ-glactosidase Optimized lysis bdual reporter gen

β-Gal Staining Set Measures enzymatic activityHistochemical stain for β-Gal expressing cells ortissue sections

Easy to use. Mix and apply to cellsection

SEAP Reporter Gene Assay,chemiluminescent(secreted alkaline phosphatase)

Quantify enzymatically ac-tive alkaline phosphatase in culture mediumCSPD Chemiluminescent Substrate

No cell lysis requtended light emis(t1/2 � 1h) Assay culture mereporter proteinStudy protein expkinetics

Method/detection Advantages


* Master-lot standardized controls and the provided lot specific information enables direct comparison of data from different sets of experiments, even when kits from different production lots are used. As a result, you can compare results from assays run at different times.

All reporter gene assays listed are available from Roche Applied Science.

Method/detection Advantages Dynamic range/Sensitivity

CAT ELISA determines total ex-pressed (active and inactive) CAT enzymeColorimetric, fluorescent, or chemiluminescent detection

Highly sensitive Master-lot standardization* Anti-CAT-coated tubes and micro-titer plates available for detectionOptimized lysis buffer for dual reporter genes


CAT ELISA performed with various detection systems

CAT Staining Set Measures enzymatic activityHistochemical stain for CAT expressing cells or tissue sections

Easy to use. Mix reagents and apply to cells or tissue section


4.5. References

1. Schwartzman, R. A. and Cidlowski, J. A. (1993) Apoptosis: the biochemistry and molecular biology of programmed cell death. Endocrine Rev. 14, 133

2. Vermes, I. and Haanan, C. (1994) Apoptosis and programmed cell death in health and disease. Adv. Clin. Chem. 31, 177

3. Application Manual: Apoptosis, Cell Death and Cell Proliferation, 3rd edition (2004), Roche Applied Science 4. Transfection Reagents and Reporter Gene Assays, (2002) Roche Applied Science5. Brochure: Protein Expression and Analysis (2005), Roche Applied Science6. D. Kahle and K. Lukas, personal communication, Eppendorf GmbH7. Brochure: The cpmplete Guide for Protease Inhibition (2006), Roche Applied Science8. Brochure: Gene Knockdown: Integrated solutions for effective and specific gene knockdown (2005),

Roche Applied Science9. Brochure: FuGENE® HD Transfection Reagent: Cover new ground - one reagent for superior results" (2007),

Roche Applied Science

Preparing Buffers and MediaChapter 5

5.1. Buffers ................................................................................. 1465.2. Antibiotics ........................................................................... 1605.3. Media for Bacteria .......................................................... 1615.4. References ......................................................................... 163

solution of 5 M NaOH (= 5 mol/l)?l volume

molecules = 6.023 x 1023 H2O molecules.

mol/liter) solution of Tris in H2O is prepared ing 1 mol Tris molecules in H2O to a final

f 1 liter.

r weight of Tris: 121.1 g/mol. An 1 M (mol/tion of Tris in H2O is prepared by dissolving ris in H2O to a final volume of 1 liter.

5.1. BuffersDefinitions

Example: How many grams of NaOH are needed to make up a 100 ml Formula: Needed grams = Concentration x Molecular weight x Fina

= 5 mol/liter x 40 g/mol x 0.1 liter = 20 g

Term Symbol Meaning Example

Mole mol An amount containing Avogadro’s* number of whatever units are being considered. Avogadro’s* number = 6.023 x 1023

1 mol H2O

Molar or Molarity

mol/literor M

Concentration of a substance in a liquid. An 1 M (by dissolvvolume oMolarity =

moles of substance

liter of solution

Molar weight g/mol Weight of 1 mol (= 6. 023 x 1023 parts) of a molecule, as defined by the molecular weight of this molecule.

Moleculaliter) solu121.1 g T

* Named after Amedeo Avogadro (1776 –1856), a famous Italian physical chemist.

5

e of reagents.

ble-distilled or deionized H2O. deionization unit with a resistance

nstructions from the manufacturers.

y shaking, do not use spatulas.

account when calculating the amount with a given molarity.– 7H2O126.11 (MW of 7 molecules H2O)

121°C at 1 bar21°C at 1 barining glucose, SDS, utoclaved.lter as an alternative.

146
Preparing Buffers and Media
Precautions

Reagents Use the highest possible purity grad

H2O Prepare all solutions with fresh douOnly use H2O from a destillation orvalue of 18 MOhm/cm.Regularly clean the units following i

Preparing Buffers Remove reagents from parent vials bWear gloves.Take the water of crystallization intoof reagent needed to make solutions● e.g., Molecular weight of MgSO4

= 120.37 (MW of MgSO4) + = 246.48

Sterilizing By autoclaving: ● 0.5 liter solution: ~ 15 minutes at● 1 liter solution: ~ 20 minutes at 1Caution: certain buffers (e.g., contaβ-mercaptoethanol) should not be aUse filtration through an 0.22 µm fi

position.he pH.taining SDS.at least two calibration solutions.the diaphragm wet and solution inside the electrode.ter after usage.

perature-dependent:n = 8.07 n = 7.50n = 7.22

rmation and material safety data

ns into account when working

5.1. BuffersPrecautions (continued)

pH measurement Always fix the pH electrode in a vertical Gently stir the solution when adjusting tNever put the electrode in solutions conPeriodically calibrate the electrode with Store the pH electrode in solution, keep make sure that there is always electrolyteClean the pH electrode with distilled waCaution: the pH of most solutions is tem

e.g.,: 5°C: pH of a 0.05 M Tris solutio25°C: pH of a 0.05 M Tris solutio37°C: pH of a 0.05 M Tris solutio

Safety Carefully consult the product safety infosheets of chemicals.Take local safety and laboratory regulatiowith chemicals.

Notes

Preparing Buffers and Media 5 147

0 10.5 11 11.5

6.1

6.6

6.8

6.8

6.9

7.1

7.2

7.4

7.5

8.1

8.0

8.1

8.3

8.4

8.4

9.3

CAPS 10.4

pKa

5.1. BuffersBuffering ranges of commonly used buffers (at 20°C)

pH 5.5 6 6.5 7 7.5 8 8.5 9 9.5 1

MES

ADA

ACES

PIPES

MOPSO

BES

MOPS

TES

HEPES

TRIS

EPPS

TRICINE

BICINE

TAPS

GLYGLY

CHES

5

ate (NH4OAc, MW = 77.08) in

. at room temperature.

e – 6H2O (CaCl2 – 6H2O, MW = 219.08)

. at room temperature.

vinylpyrrolidone and 50 g bovine serum

. ore at –20°C.

reitol (DTT, MW = 154.25) in 20 ml

rilize by filtration.

148
Recipes for stock solutions

10 M NH4OAc – 1 liter Dissolve 770.8 g ammonium acet800 ml H2O. Adjust volume to 1 liter with H2OSterilize by autoclaving and store

1 M CaCl2 – 1 liter Dissolve 219.08 g calcium chloridin 800 ml H2O.Adjust volume to 1 liter with H2OSterilize by autoclaving and store

250 x Denhardt Solution – 1 liter

Dissolve 50 g Ficoll 400, 50 g polyalbumin (BSA*) in 600 ml H2O.Adjust volume to 1 liter with H2ODivide in aliquots of 25 ml and st

1 M DTT* – 20 ml Dissolve 3.085 g 1,4-dithio-DL-th10 mM sodium acetate (pH 5.2). Divide in aliquots of 1 ml and steStore at – 20°C.


tetraacetate – 2H2O ml H2O; stir vigorously

ellets) and adjust volume

ing.

lute when the pH of the NaOH.

anoside

ion. 4 months.

O (MgCl2 – 6H2O,

autoclaving.

5.1. BuffersRecipes for stock solutions (continued)

0.5 M Na2EDTA (pH 8.0) – 1 liter

Dissolve 186.12 g disodium ethylenediamine(Na2 EDTA – 2H2O, MW = 372.24) ) in 800 on a magnetic stirrer. Adjust to pH 8.0 with NaOH (~ 20 g NaOH pto 1 liter with H2O. Divide into aliquots and sterilize by autoclavStore at room temperature.Note: the disodium salt of EDTA will only sosolution is adjusted to 8.0 by the addition of

0.1 M IPTG* – 50 ml Dissolve 1.19 g isopropyl ß-D-thiogalactopyr(IPTG, MW = 238.3) in 40 ml H2O. Adjust volume to 50 ml with H2O. Divide in 5 ml aliquots and sterilize by filtratStore at – 20°C, this solution is stable for 2 –

1 M MgCl2* – 1 liter Dissolve 203.31 g magnesium chloride – 6H2MW = 203.31) in 800 ml H2O.Adjust volume to 1 liter with H2O. Divide in aliquots of 100 ml and sterilize by Store at room temperature.

fonic acid (MOPS – free acid, tate – 3H2O (NaOAc – 3H2O, d H2O and stir until completely

a2EDTA solution and adjust pH

eated H2O. – protected from light – at 4°C. aliquot.

2O (NaOAc – 3H2O, MW = 136.08)

id or to pH 7.0 with diluted acetic

om temperature.

Cl, MW = 58.44) in

om temperature.

149
Preparing Buffers and Media 5
10 x MOPS* – 1 liter Add 41.85 g 4-morpholinopropanesulMW = 209.27) and 6.80 g sodium aceMW = 136.08) to 800 ml DEPC treatedissolved. Add 20 ml of a DEPC treated 0.5 M Nto 7.0 with 10 M NaOH. Adjust volume to 1 liter with DEPC trDivide into 200 ml aliquots and storeIf the solution turns yellow, use a new

3 M NaOAc – 1 liter Dissolve 408.24 g sodium acetate – 3Hin 800 ml H2O. Adjust to pH 5.2 with glacial acetic acacid.Adjust volume to 1 liter with H2O. Sterilize by autoclaving and store at ro

5 M NaCl – 1 liter Dissolve 292.2 g sodium chloride (Na800 ml H2O. Adjust volume to 1 liter with H2O. Sterilize by autoclaving and store at ro


ls (SDS) in 900 ml H2O.

perature., wear a mask when weighing e after use.old temperature), redissolve

ml H2O.

methane

ncentrated HCl:

mperature.

5.1. BuffersRecipes for stock solutions (continued)

10% SDS* – 1 liter Dissolve 100 g sodium dodecyl sulfate crystaHeat to 68°C to solute the crystals.Adjust pH to 7.2 with HCl (~ 50 µl). Adjust volume to 1 liter with H2O. Dispense into aliquots and store at room temNote: the fine crystals of SDS disperse easilySDS and clean the weighing area and balancWhen SDS crystals precipitate (e.g., due to cby warming the solution at 37°C.

100% (w/v) TCA Add 500 g trichloroacetic acid (TCA) to 227 This solution contains 100% (w/v) TCA.

1 M Tris* – 1 liter Dissolve 121.14 g tris(hydroxymethyl)amino(Tris, MW = 121.14) in 800 ml H2O.Adjust pH to the desired value by adding co● pH 7.4: ~ 70 ml● pH 7.6: ~ 60 ml● pH 8.0: ~ 42 mlAdjust volume to 1 liter with H2O.Sterilize by autoclaving and store at room te

5

oro-3-Indolyl-β-D-galactoside (X-gal) de.tore in a glass or polypropylene C. This stock solution is stable for

150
X-gal* (20 mg/ml) 20 ml

Dissolve 400 mg 5-Bromo-4-Chlin 20 ml N,N’-dimethyl formamiDivide into 500 µl aliquots and stube protected from light at – 20°2 – 4 months.


PO4 – 7H2O and 2.4 g KH2PO4 in

aving.

citrate – 2H2O in 800 ml H2O.

aving.

– 1H2O and 7.4 g Na2EDTA

f a 10 M solution).

aving.

5.1. BuffersRecipes for buffers

10 x PBS* – 1 liter Dissolve 80 g NaCl, 2 g KCl, 26.8 g Na2H800 ml H2O. Adjust to pH 7.4 with HCl. Adjust volume to 1 liter with H2O. Divide in aliquots and sterilize by autoclStore at room temperature.

20 x SSC* – 1 liter Dissolve 175.3 g NaCl and 88.2 g sodiumAdjust pH to 7.0 with HCl.Adjust volume to 1 liter with H2O. Divide in aliquots and sterilize by autoclStore at room temperature.

20 x SSPE – 1 liter Dissolve 175.3 g NaCl, 27.6 g NaH2PO4 in 800 ml H2O. Adjust pH to 7.4 with NaOH (~ 6.5 ml oAdjust volume to 1 liter with H2O. Divide in aliquots and sterilize by autoclStore at room temperature.

5

or 7.4) and 2 ml 0.5 M Na2EDTA**

with H2O.

enzymatic reactions),

151
1 x TE – 1 liter Add 10 ml 1 M Tris (pH 8.0, 7.6 (pH 8.0) to 800 ml H2O.Mix and adjust volume to 1 liter Sterilize by autoclaving.Store at room temperature.

* Products available from Roche Applied Science** For certain applications (e.g., storage of DNA that will be used in PCR or other

add 200 µl 0.5 M Na2EDTA instead of 2 ml.

ml H2O and adjust to 1 liter

(NaOAc – 3H2O, MW = 136.08) ith H2O.of these solutions and H2O that on of 0.1 M NaOAc with a specific

ml H2O and adjust to 1 liter

Ac, MW = 98.14) in H2O.of these solutions and H2O that ion of 0.1 M KOAc with a specific

5.1. BuffersRecipes for buffers with desired pH

0.1 M NaOAc – 100 ml 0.2 M acetic acid: ● mix 11.55 ml glacial acetic acid in 500

with H2O.0.2 M sodium acetate:● dissolve 27.21 g sodium acetate – 3H2O

in 800 ml H2O and adjust to 1 liter wThe table below gives the volumes in ml should be mixed to obtain a 100 ml solutidesired pH.

0.1 M KOAc – 100 ml 0.2 M acetic acid: ● mix 11.55 ml glacial acetic acid in 500

with H2O0.2 M potassium acetate:● dissolve 19.62 g potassium acetate (KO

800 ml H2O and adjust to 1 liter withThe table below gives the volumes in ml should be mixed to obtain a 100 ml solutdesired pH.

5

l pH with a pH meter.

0.2 M sodium or potassiumacetate solution (ml)

H2O (ml)

3.7 50

6.0 50

9.0 50

13.2 50

19.5 50

24.5 50

30.0 50

35.2 50

39.5 50

41.2 50

45.2 50

152
aIt is strongly recommended to check the fina

pH table for acetate buffersa Desired pHa 0.2 M acetic acid

solution (ml)

3.6 46.3

3.8 44.0

4.0 41.0

4.2 36.8

4.4 30.5

4.6 25.5

4.8 20.0

5.0 14.8

5.2 10.5

5.4 8.8

5.6 4.8

salt:= 138) in 500 ml H2O and

: = 268.1) in 500 ml H2O

f these solutions and H2O 200 ml solution of 0.1 M

sium salt: in 500 ml H2O and adjust

m salt: in 500 ml H2O and adjust

f these solutions and H2O 200 ml solution of 0.1 M

5.1. BuffersRecipes for buffers with desired pH (continued)

0.1 M Na Phosphate 200 ml

0.2 M sodium phosphate, mono-sodium ● dissolve 27.6 g NaH2PO4 – 1H2O (MW

adjust to 1 liter with H2O0.2 M sodium phosphate, di-sodium salt● dissolve 53.62 g Na2HPO4 – 7H2O (MW

and adjust to 1 liter with H2O.The table below gives the volumes in ml othat should be mixed together to obtain a Na-phosphate with a specific desired pH.

0.1 M K Phosphate 200 ml

0.2 M potassium phosphate, mono-potas● dissolve 27.2 g KH2PO4 (MW = 136.09)

to 1 liter with H2O0.2 M potassium phosphate, di-potassiu● dissolve 34.8 g K2HPO4 (MW = 174.18)

to 1 liter with H2O.The table below gives the volumes in ml othat should be mixed together to obtain a K-phosphate with a specific desired pH.

5

sodium or potassium, phosphate mono salt

solution (ml)

sodium or potassium,phosphate di salt

solution (ml)

H2O(ml)

45.0 55.0 100

39.0 61.0 100

33.0 67.0 100

28.0 72.0 100

23.0 77.0 100

19.0 81.0 100

16.0 84.0 100

13.0 87.0 100

10.5 90.5 100

8.5 91.5 100

7.0 93.0 100

5.3 94.7 100

153
pH table for phosphate buffersa:

a It is strongly recommended to check the final pH with a pH meter.

DesiredpHa

sodium or potassium, phosphate mono salt

solution (ml)

sodium or potassium,phosphate di salt

solution (ml)

H2O(ml)

DesiredpHa

5.7 93.5 6.5 100 6.9

5.8 92.0 8.0 100 7.0

5.9 90.0 10.0 100 7.1

6.0 87.7 12.3 100 7.2

6.1 85.0 15.0 100 7.3

6.2 81.5 18.5 100 7.4

6.3 77.5 22.5 100 7.5

6.4 73.5 26.5 100 7.6

6.5 68.5 31.5 100 7.7

6.6 62.5 37.5 100 7.8

6.7 56.5 43.5 100 7.9

6.8 51.0 49.0 100 8.0

M Tris buffer, 0.1 M HCl to obtain a 100 ml solution a:

pH meter.

1 M Tris (ml) H2O (ml)

50 6.6

50 8.0

50 9.7

50 11.5

50 13.4

50 15.5

50 18.0

50 20.8

50 23.8

50 27.1

50 30.1

50 32.8

50 35.3

50 37.6

5.1. BuffersRecipes for buffers with desired pH (continued)

0.05 M Tris – 100 ml The table below gives the volumes of 0.1and H2O that should be mixed together of 0.05 M Tris with a specific desired pH

a It is strongly recommended to check the final pH with a

pH table for Tris buffers

Desired pHa 0.1 M HCl (ml) 0.

7.3 43.4

7.4 42.0

7.5 40.3

7.6 38.5

7.7 36.6

7.8 34.5

7.9 32.0

8.0 29.2

8.1 26.2

8.2 22.9

8.3 19.9

8.4 17.2

8.5 14.7

8.6 12.4

5

and/or 250 mg xylene cyanol

cid in 900 ml H2O.) and adjust volume to 1 liter

0) and 57.1 ml glacial acetic acid .

1.679 g/ml) and 40 ml

154
Electrophoresis of DNA

10 x agarose gel sample buffer 100 ml

Dissolve 250 mg bromophenol blue in 33 ml 150 mM Tris pH 7.6.Add 60 ml glycerol and 7 ml H2O.Store at room temperature.

10 x TBE*(Tris-borate) 1 liter

Dissolve 108 g Tris and 55 g Boric aAdd 40 ml 0.5 M Na2EDTA (pH 8.0with H2O.Store at room temperature.

50 x TAE*(Tris-acetate) 1 liter

Dissolve 242 g Tris in 500 ml H2O.Add 100 ml 0.5 M Na2EDTA (pH 8.Adjust volume to 1 liter with H2O.Store at room temperature.

10 x TPE (Tris-phosphate) 1 liter

Dissolve 108 g Tris in 700 ml H2OAdd 15.5 ml 85% Phosphoric acid (0.5 M Na2EDTA (pH 8.0).Adjust volume to 1 liter with H2OStore at room temperature

* Products available from Roche Applied Science as convenient ready-to-use solutions

7% formaldehyde and

20°C.

RNA.ldehyde is a carcinogen. y safety procedures.

Bromophenol Blue. void ribonuclease contamination.

20°C.ample (RNA plus sample buffer).

5.1. BuffersElectrophoresis of RNA

RNA Sample buffer Mix 10 ml deionized formamide, 3.5 ml 32 ml 5 x MOPS.Divide into 500 µl aliquots and store at –The buffer is stable for 6 months.Use 2 parts sample buffer for each part ofNote: Formamide is a teratigen and formaWork in a fumehood and follow laborator

RNA Loading Buffer Prepare in DEPC-treated H2O: 50% glycerol, 1 mM Na2EDTA, and 0.4% Use the highest possible grade of glycerol to aDivide into 500 µl aliquots and store at –Use 2 µl loading buffer per 10 – 20 µl RNA s

5 155

ate (DEPC) to 100 ml of a solution

night in a fume hood. the remaining DEPC.erature.ood when using DEPC

amino groups (e.g., Tris, MOPS, EDTA, tly with DEPC. Prepare these solutions


DEPC-treatment

DEPC-treatment per 100 ml solution

Add 0.1– 0.2 ml diethylpyrocarbon(e.g., H2O).Shake vigorously and incubate overAutoclave the solution to inactivateStore treated solution at room tempNote: Wear gloves and use a fume h(suspected carcinogen).All chemical substances containing HEPES, etc.) cannot be treated direcin DEPC-treated H2O.

y adding 1 g ethidium bromide mplete dissolved.

µg per ml agarose solutionµg per ml staining solutionn and is toxic. Wear gloves when ask when dissolving the powder.

, stable at – 20°C

, TBE or TAE buffer.

312 nm transillumination with the

is (pH 8.0). remove upper aqueous phase. to emulsify and let phases separate.

5.1. BuffersStaining of Nucleic Acids

Ethidium Bromide 100 ml

Prepare a stock solution of 10 mg/ml bto 100 ml H2O. Stir until the dye has coStore in the dark at 4°C.Staining: ● During electrophoresis: add 0.5 – 1 ● After electrophoresis: add 0.5 – 2 Caution: Ethidium bromide is a mutageworking with the solution and wear a m

SYBR Green I Nucleic Acid Gel Stain*

Supplied* as a stock solution in DMSOfor 6 – 12 months.Working solution: dilute the stock solution 1:10,000 in TESensitivity: as low as 80 pg per band dsDNA using Lumi-Imager F1 System.

Phenol* – 1 liter Dissolve 500 g phenol in 500 ml 1 M TrOnce dissolved, let phases separate andAdd 500 ml 100 mM Tris (pH 8.0); stir

5

l pH of upper, aqueous phase is less

t. s red/brown.

l 50 mM sodium acetate (pH 4.0).rate and remove upper aqueous phase. tate (pH 4.0); stir to emulsify and

of upper, aqueous phase is less than

t.

e and can cause severe burns.hing and safety glasses when

ol, immediately wash with a large volume

156
Repeat procedure with TE untithan pH 7.2.Store at 4°C protected from lighDiscard when the solution turn

Phenol* (acid) – 1 liter

For RNA only!

Dissolve 500 g phenol in 500 mOnce dissolved, let phases sepaAdd 500 ml 50 mM sodium acelet phases separate. Repeat procedure until the pH pH 4.1.Store at 4°C protected from ligh

Caution: Phenol is highly corrosivAlways wear gloves, protective clotworking with phenol.If skin comes in contact with phenof water and soap.


) in 8 ml H2O.

ethylenebisacrylamide

chemicals.

is absorbed through the skin. paring the solutions.

SDS, 30 ml glycerol, mophenol blue.

at – 20°C.

5.1. BuffersElectrophoresis of Proteins

10% Ammonium persulfate – 10 ml

Dissolve 1 g ammonium persulfate (APSAdjust volume to 10 ml with H2O.Solution is stable at 4°C for two weeks.

30% acryl-bisacryl-amide mix – 100 ml

Dissolve 29 g acrylamide and 1 g N,N’-min 60 ml H2O.Heat the solution to 37°C to dissolve theAdjust volume to 100 ml with H2O.Store at 4°C protected from light. Caution: Acrylamide is a neurotoxin andAlways wear gloves and a mask when pre

2 x SDS PAGE sample buffer 100 ml

Mix 10 ml 1.5 M Tris (pH 6.8), 6 ml 20%15 ml β-mercaptoethanol and 1.8 mg broAdjust volume to 100 ml with H2O.Aliquot in 10 ml stock solution and storeStore working solution at 4°C.

5

d 144.1 g glycin in 800 ml H2O..

nt Blue R-250” in a mixture c acid and 400 ml H2O.

.

etic acid and 400 ml H2O..

157
10 x SDS PAGE Running buffer 1 liter

Dissolve 10 g SDS, 30.3 g Tris anAdjust volume to 1 liter with H2OStore at room temperature.

Coomassie Blue staining solution 1 liter

Dissolve 2.5 g “Coomassie Brilliaof 450 ml methanol, 100 ml acetiAdjust volume to 1 liter with H2OStore at room temperature.

Coomassie Blue destaining solution 1 liter

Mix 450 ml methanol, 100 ml acAdjust volume to 1 liter with H2OStore at room temperature.

(ml) per gel mold volume of

25 ml 30 ml 40 ml 50 ml

13.25.06.30.250.250.02

15.96.07.50.30.30.024

21.28.0

10.00.40.40.032

26.5010.0012.500.500.500.04

11.56.76.30.250.250.015

13.98.07.50.30.30.018

18.510.71.00.40.40.024

23.2013.3012.500.500.500.03

9.98.36.30.250.250.01

11.910.07.50.30.30.012

15.913.310.00.40.40.016

19.8016.7012.500.500.500.02

8.210.06.30.250.250.01

9.912.07.50.30.30.012

13.216.010.00.40.40.016

16.5020.0012.500.500.500.02

5.712.56.30.250.250.01

6.915.07.50.30.30.012

9.220.010.00.40.40.016

11.5025.0012.500.500.500.02

5.1. BuffersResolving gels for denaturing SDS – PAGE

Volume of components

% Gel Components 5 ml 10 ml 15 ml 20 ml

6% H2O30% acryl-bisacrylamide mix1.5 M Tris (pH 8.8)10% SDS10% ammonium persulfateTEMED

2.61.01.30.050.050.004

5.32.02.50.10.10.008

7.93.03.80.150.150.012

10.64.05.00.20.20.016


2.31.31.30.050.050.003

4.62.72.50.10.10.006

6.94.03.80.150.150.009

9.35.35.00.20.20.012

10% H2O30% acryl-bisacrylamide mix 1.5 M Tris (pH 8.8)10% SDS10% ammonium persulfateTEMED

1.91.71.30.050.050.002

4.03.32.50.10.10.004

5.95.03.80.150.150.006

7.96.75.00.20.20.008


1.62.01.30.050.050.002

3.34.02.50.10.10.004

4.96.03.80.150.150.006

6.68.05.00.20.20.008


1.12.51.30.050.050.002

2.35.02.50.10.10.004

3.47.53.80.150.150.006

4.610.05.00.20.20.008

5

s (ml) per gel mold volume of

l 5 ml 6 ml 8 ml 10 ml

3.4 4.1 5.5 6.8

0.83 1.0 1.3 1.7

0.63 0.75 1.0 1.25

0.05 0.06 0.08 0.1

0.05 0.06 0.08 0.1

0.005 0.006 0.008 0.01

158
5% stacking gels for denaturing SDS-PAGE

ComponentsVolume of component

1 ml 2 ml 3 ml 4 m

H2O 0.68 1.4 2.1 2.7

30% acryl-bisacrylamide mix 0.17 0.33 0.5 0.67

1.5 M Tris (pH 6.8) 0.13 0.25 0.38 0.5

10% SDS 0.01 0.02 0.03 0.04

10% ammonium persulfate 0.01 0.02 0.03 0.04

TEMED 0.001 0.002 0.003 0.004

7 g SDS in 200 ml methanol.

id and 30 g sulfosalicylic acid

ris, pH 10.4

is, pH 9.4 and 40 mM amino hexane acid

is, pH 10.4

5.1. BuffersWestern Blotting

1x Transfer Buffer for wet blots – 1 liter

Dissolve 2.9 g Glycine, 5.8 g Tris and 0.3Adjust volume to 1 liter with H2O.Store at 4°C.

1x Transfer Buffer for semi-dry blots

Scheme:

Ponceau S Solution – 100 ml

Mix 2 g Ponceau S, 30 g trichloracetic acin 80 ml H2O.Adjust volume to 100 ml with H2O.Store at room temperature.

Layer Content and Buffer

5 (top) 3 x 3 MM papers soaked in 300 mM T

4 membrane

3 gel

2 3 x 3 MM papers soaked in 25 mM Tr

1 (bottom) 3 x 3 MM papers soaked in 25 mM Tr

5

8.76 g NaCl (150 mM) in 800 ml H2O.9.5 ml).

.ths. peroxidase activity, it is not icrobial reagent.

TBS buffer.nths.

st applications but depending on dies used, different detergents det P40*) and concentrations tter results.

g solutions are described in the

fat dried milk in TBS or PBS is

tive blocking solutions* containing .

159
1 x TBS (Tris Buffered Saline)– 1 liter

Dissolve 6.05 g Tris (50 mM) andAdjust pH to 7.5 with 1 M HCl (~Adjust volume to 1 liter with H2OTBS is stable at 4°C for three monNote: Since sodium azide inhibitsrecommended for use as an antim

1 x TBST (Tris Buffered Saline Tween) – 1 liter

Dissolve 1 ml Tween 20* in 1 literTBST is stable at 4°C for three moNote: Tween 20 is suitable for mothe type of membrane and antibo(like SDS*, Triton X100* or Nonibetween 0.01 – 1% may lead to be

Blocking solution* A wide variety of different blockinliterature.A solution of 2.5 to 5% (w/v) nonsufficient for most blots.If background is high, use alterna1% of e.g., BSA, gelatine or casein


trations: for the selection of plasmids with

in ethanol should not be sterilized.

Working Concentrationa Stock Solutionb

20 – 100 µg/ml

(50 µg/ml)100 mg/ml in H2OStore at – 20°C.

25 – 170 µg/ml(100 µg/ml)

34 mg/ml in EthanolStore at – 20°C.

t 10 – 50 µg/ml


10 – 125 µg/ml


10 – 50 µg/ml(10 µg/ml in liquid culture – 12.5 µg/

ml in plates)

12.5 mg/ml in EthanolStore at – 20°C.

5.2. AntibioticsSelection of prokaryotic cells

a lower concentrations: for the selection of plasmids with a low copy number, higher concena high copy number, values in brackets indicate commonly used concentrations.

b stock solutions in H2O: sterilize by filtration and store protected from light. Stock solutions

Antibiotic Mode of Action Mechanism of Resistance

Ampicillin (Amp)

Inhibits cell wall synthesis by inhibiting formation of the pepti-doglycan cross-link.

The resistance gene (bla) specifies an enzyme, β-lactamase, which cleaves theβ-lactam ring of the antibiotic.

Chlor-amphenicol (Cm)

Prevents peptide bond formation by binding to the 50S subunit of ribosomes.

The resistance gene (cat) specifies an acetyltransferase that acetylates and thereby inactivates the antibiotic.

Kanamycin (Kan)

Causes misreading of mRNA by binding to 70S ribosomes.

The resistance gene (kan) specifies an aminoglycoside phosphotransferase thainactivates the antibiotic.

Streptomycin (Sm)

Causes misreading of mRNA by binding to 30S subunit of ribosomes.

The resistance gene (str) specifies an enzyme that modifies the antibiotic andinhibits its binding to the ribosomes.

Tetracycline (Tet)

Prevents protein synthesis by preventing binding of the amino-acyl tRNA to the ribosome A site.

The resistance gene (tet) specifies a protein that modifies the bacterial membrane and prevents transport of the antibiotic into the cell.

5

filtration, store protected from light.

lied Science.

Working Concentration Stock Solutiona

odes a pho- anti-

50 – 1000 µg/ml; optimal concentra-tion is to be tested experimentallyb

5 – 50 mg/ml in culture medium or physiological buffersStore at – 20°C

an erase

100 µg/ml 10 – 50 mg/ml solution in H2O.Store at 4°C

h) ates oryla-

50 – 1000 µg/ml; optimal concentra-tion is to be tested experimentallyb

50 mg/ml in PBSStore at 4°C

160
Selection of eukaryotic cells

a stock solutions in H2O, culture medium, physiological buffers or PBS: sterilize byStock solutions in ethanol should not be sterilized.

b a table with optimal cell-line specific concentrations is available from Roche App

Antibiotic Mode of Action Mechanism of Resistance

Geneticin (G 418)

Interferes with the function of 80S ribosomes and blocks protein synthesis in eukaryotic cells.

The resistance gene (neo) encbacterial aminoglycoside phostransferase that inactivates thebiotic.

Gentamycin Inhibits protein synthesis by binding to the L6 protein of the 50S ribosomal subunit.

The resistance gene specifies aminoglycoside phosphotransfthat inactivates the antibiotic.

Hygro-mycin B

Inhibits protein synthesis of bac-teria, fungi and eukaryotic cells by interfering with translocation and causing mistranslation.

The resistance gene (hyg or hpcodes for a kinase that inactivHygromycin B through phosphtion.

t extract and 10 g NaCl in

~ 200 µl).

temperature.

4, 0.5 g NaCl and 1 g NH4Cl

~ 100 µl).

temperature. CaCl2 and 10 ml 20% glucose.

emperature.

t extract, 0.5 g NaCl and

0 µl) and add H2O to 990 ml. temperature.

.

5.3. Media for BacteriaRecipes for 1 liter

LB Mix 10 g Bacto-Tryptone, 5 g Bacto-Yeas900 ml H2O. Adjust the pH to 7.0 with 10 M NaOH (Adjust volume to 1 liter with H2O.Sterilize by autoclaving and store at room

M9 minimal Mix 12.8 g Na2HPO4 – 7H2O, 3 g KH2POin 750 ml H2O.Adjust the pH to 7.4 with 10 M NaOH (Adjust volume to 1 liter with H2O.Sterilize by autoclaving and cool to roomAdd 2 ml 1 M MgSO4 – 7H2O, 0.1 ml 1 MSterilize by filtration and store at room t

SOB Mix 20 g Bacto-Tryptone, 5 g Bacto-Yeas2.5 ml 1 M KCl in 900 ml H2O. Adjust pH to 7.0 with 10 M NaOH (~ 10Sterilize by autoclaving and store at roomBefore use, add 10 ml sterile 1 M MgCl2

5

that it additionally contains 20 ml

cto-Yeast extract and 4 ml glycerol

to < 60°C.sphate* and store at room temperature.

o-Yeast extract and 2.5 g NaCl

(~ 200 µl)..

at room temperature.

ml H2O. Adjust volume to 100 ml with H2O and

161
SOC Identical to SOB medium, exceptsterile 1 M glucose.

TB Mix 12 g Bacto-Tryptone, 24 g Bain 900 ml H2O.Sterilize by autoclaving and cool Add 100 ml of sterile 10 x TB pho

YT Mix 8 g Bacto-Tryptone, 5 g Bactin 900 ml H2O.Adjust pH to 7.0 with 10 M NaOHAdjust volume to 1 liter with H2OSterilize by autoclaving and store

* Made by dissolving 2.31 g KH2PO4 (= 0.17 M) and 12.54 K2HPO4 (= 0.72 M) in 90sterilize by autoclaving. Store at room temperature.

ate)

cipes given on page 161.dium and sterilize by

dd the appropriate amount or the best concentration of

pour into sterile plates. plates with a bunsen burner

he dishes at 4°C in the

ntibiotic in the plate e stripe for kanamycin plates, …). inverted position for 1 hour

.

5.3. Media for BacteriaRecipes for 1 liter (for ∼ 40 plates of 90 mm, ∼ 25 ml per pl

Agar plates Prepare liquid media according to the reAdd 15 g Bacto-Agar to 1 liter liquid meautoclaving.Allow the medium to cool to 50°C and aof antibiotic (see chapter 5.2., page 160, fantibiotic).Gently mix the medium by swirling and Flame the surface of the medium in the to remove air bubbles. Allow the medium to solidify and store tinverted position.Store tetracycline plates in the dark.Use a color code to indicate the type of a(e.g., black stripe for ampicilin plates, bluBefore use, incubate plates at 37°C in theto remove condensation within the plate

5

.1 M) – final concentration:

0 mg/ml) – final concentration:

o the recipes given on page 161.id medium and sterilize by autoclaving.

162
X-gal/IPTG indicator plates

Before pouring the plates, add:● 2 ml of IPTG stock solution (0

0.2 mM● 2 ml of X-gal stock solution (2

40 µg/ml

Top agar overlay Prepare liquid media according tAdd 7 g Bacto-Agar to 1 liter liqu

Protocols in Molecular Biology. John Wiley and Sons, New Yorkgy LabFax. Bios Scientific Publishers, Academic Pressochemistry and Molecular Biologyds in Enzymology, 24, 53 – 68

Sheetss, T. (1989) In: Molecular Cloning, A Laboratory Manual, 2nd edition.

5.4. References

1. Ausubel, F. M. et al., (1991) In: Current2. Brown, T. A. (1991) In: Molecular Biolo3. Fluka (1998), MicroSelect: Basics for Bi4. Good, N. E. , Izawa, S. (1972) In: Metho5. Roche Applied Science, Technical Data 6. Sambrook. J., Fritsch, E. J. and Maniati

Cold Spring Harbor Laboratory Press

Conversion Tables and FormulasChapter 6

6.1. Nucleotide ambiguity code.......................................... 1646.2. Formulas to calculate melting temperatures ....... 1646.3. %GC content of different genomes ......................... 1656.4. Metric prefixes ................................................................ 1656.5. Greek alphabet ................................................................ 1666.6. Properties of radioisotopes ......................................... 1666.7. Temperatures and Pressures ..................................... 1676.8. Centrifugal forces ........................................................... 1676.9. Periodical system of elements ................................... 1686.10. Hazard Symbols .............................................................. 1686.11. References ........................................................................ 169

Complement

T

C

G

A

R

Y

W

S

M

K

H

B

D

V

X/N

6.1. Nucleotide ambiguity code

Code Represents

A Adenosine

G Guanine

C Cytosine

T Thymidine

Y Pyrimidine (C & T)

R Purine (A & G)

W weak (A & T)

S strong (G & C)

K keto (T & G)

M amino (C & A)

D not C

V not T

H not G

B not A

X/N unknown

s and Formulas 6

ure Tm

d %GC values between 30 – 75%n the nucleic acid, %for = percentage of formamide in the

C) – 0.61 (%for) – 500/N

) + 11.8 (%GC)2 – 0.50 (%for) – 820/N

) + 11.8 (%GC)2 – 0.35 (%for) – 820/N

in length:)] + [4°C x (number of G and C bases)]

leotides: see formula for DNA/DNA hybrids

164
Conversion Table
6.2. Formulas to calculate melting temperat

a The proposed formula is valid for Na+ concentrations between 0.01 – 0.4 M anb [Na+] = concentration of Na+ ions, %GC = percentage of G and C nucleotides i

hybridisation solution, N = length of the duplex in base pairs

Systema Formulab

DNA – DNA hybrids (see reference 6)

Tm = 81.5°C + 16.6 log[Na+] + 0.41 (%G

DNA – RNA hybrids (see reference 7)

Tm = 79.8°C + 18.5 log[Na+] + 0.58 (%GC

RNA – RNA hybrids (see reference 8)

Tm = 79.8°C + 18.5 log[Na+] + 0.58 (%GC

Oligonucleotides (see reference 9)

For oligonucleotides 14 – 25 nucleotides● Tm = [2°C x (number of A and T basesFor Oligonucleotides longer than 25 nuc

%GC content

40.3

40.9

40.3

41.8

6.3. %GC content of different genomes

Organism %GC content Organism

Phages Vertebrates

T2 34.6 Homo Sapiens

T3 49.6 Xenopus laevis

T7 47.4 Mus musculus

Lambda 48.6 Rattus species

Prokaryotes

Agrobacterium tumefaciens 58 – 59.7

Bacillus subtilis 42.6

Escherichia coli 51

Mycobacterium tuberculosis 65

Staphylococcus aureus 32.4 – 37.7

s and Formulas 6 165

-10 m-8 cm-4 µm-1 nm

* Named after Anders J. Ångström (1814 – 1874), a famous Swedish spectroscopist

Conversion Table

6.4. Metric prefixes

Examples: 1 ng (nanogram) = 10-9 gram5 pmol (picomole)= 10-12 mol

Factor Prefix Symbol

1018 exa E

1015 peta P

1012 tetra T

109 giga G

106 mega M

103 kilo k

10-3 milli m

10-6 micro µ

10-9 nano n

10-12 pico p

10-15 femto f

10-18 atto a

1 Å* =10101010

6.5. Greek alphabet

� � alpha � nu

� beta � xi

� � gamma � � omicron

� � delta � � pi

� � epsilon � � rho

� � zeta � � sigma

� � eta ! � tau

" # theta $ % upsilon

& ' iota ( � phi

) * kappa � chi

+ � lambda , - psi

. / mu 0 1 omega

s and Formulas 6

Autoradio-graphy cpm

needed overnight

Fluorography cpm needed

overnight

Fluorographymethod

2,000 200 PPO impregnated gel (– 70°C)

100 10 screen (– 70°C)

50 10 screen (– 70°C)

1,000 100 – 200 PPO impregnated gel (– 70°C)

1,000 100 – 200 PPO impregnated gel (– 70°C)

>107 3,000 PPO impregnated gel (– 70°C)

166

ays, y = yearseta radiationelectron capture Geiger-Müller detectorliquid scintillationnd window

Conversion Table

6.6. Properties of radioisotopesIsotope Half-

lifeaDecayb Maximum

range in air (cm)

Protection Detec-tionc

Calcium-45 45Ca 164 d β 52 acrylic shield GM, LS

Carbon-14 14C 5730 y β 24 acrylic shield LS,P

Chromium-51 51Cr 27.7 d EC lead shield LS,P

Iodine-125 125I 59.6 d EC lead shield GM, LS

Phosphor-32 32P 14.3 d β 790 acrylic shield GM, LS

Phosphor-33 33P 25.3 d β 46 acrylic shield GM, LS

Sulphur-35 35S 87.4 d β 30 acrylic shield GM

Tritium 3H 12.4 y β 0.6 LS

Units: 1 µCi = 2.2 x 106 desintegrations/minute= 3.7 x 104 becquerels (Bq)

1 Becquerel = 1 desintegration/secondDosis: 1 Gray (Gy) = 100 rad

1 Sievert (Sv) = 100 rem

a d = db β = b

EC = c GM =

LS = P = E

6.7. Temperatures and Pressure

From Centigrade to Fahrenheit From Fahrenheit to Centigrade

°F = 32 + (°C x ) °C = x (°F – 32)

From millibars (mbar) to Multiply by

Millimeters of mercury (mm Hg) 0.750000

Inches of mercury (inch Hg) 0.039400

Pounds per square inch (psi) 0.014500

Atmospheres (atm) 0.000987

Kilopascals (kPa) 0.100000

Torrs (Torr) 0.750000

95

59

and Formulas 6

gram:

167
Conversion Tables
6.8. Centrifugal forces

link between revolutions/minute, centrifugal force and rotor radius

Align a straight line through known values in two columns and read desired value in third column

Mathematical:

rpm = 1000��

RCF = 1.12 x R( )2

where rpm = revolutions per minute of rotorRCF = relative centrifugal force

R = radius of rotor in mm

at room temperature

RCF1.12 x R

rpm1000

Nomo

6.9. Periodical System of Elements

Conversion Tables and Formulas 6

ol Hazard Caution

able Spontaneously flammable substan-ces. Chemicals igniting in air.

Avoid contact with air.

Gases, gas mixtures (also liquefied ones) which have an ignition range with air at normal pressure.

Avoid formation of flammable gas-air mixture.

Substances sensitive to moisture. Chemicals which readily from flammable gases on contact with water.

Avoid contact with moisture water.

Liquids with flash point below 21°C. Keep away from open fires, sources of heat and sparks

Solid substances which ignite easily after a short term effect of a source of ignition.

Avoid all contact with all sources of ignition.

ing Oxidizing substances can ignite combustible material or worsen existing fires and thus make fire-fighting more difficult.

Keep away from combustible material.

ive This symbol designates substances which may explode under definite conditions.

Avoid shock, friction, sparks, and heat.

Symbol Hazard Caution

Harmful or Irritant

Inhalation and ingestion of, or skin penetration by these substances is harmful to one’s health. Non-recur-ring, recurring, or lengthy exposure to these substances may result in irreversible damage.

Avoid contact with the human body, including inhalation of the vapors and in cases of malaise, consult a doctor.

This symbol designates substances which may have an irritant effect on skin, eyes, and respiratory organs.

Do not breathe va-pors and avoid con-tact with skin and eyes.

Corrosive Living tissue as well as equipment are destroyed on contact with these chemicals.

Do not breathe vapors and avoid contact with skin, eyes, and clothing.

Toxic The substances are very hazardous to health when breathed, swallo-wed, or in contact with the skin and may even lead to death. Non-recur-ring, recurring, or lengthy exposure to these substances may result in irreversible damage.

Avoid contact with the human body and immediately consult a doctor in cases of malaise.

. Hazard Symbols and Risk Phrases

168

Symb

Flamm

Oxidiz

Explos

6.10

n Wiley and Sons, New York

ers, Academic Press

A Laboratory Manual, 2nd edition

IRL Press, Virginia

6.11. References

1. Ausubel, F.M. et al., (1991) In: Current Protocols in Molecular Biology. Joh2. Biochemica Information (1987) Roche Applied Science3. Brown, T. A. (1991) In: Molecular Biology LabFax. Bios Scientific Publish4. Roche Applied Science, Technical Data Sheets5. Sambrook. J., Fritsch, E. J. and Maniatis, T. (1989) In: Molecular Cloning,

Cold Spring Harbor Laboratory Press6. Meinkoth, J. et al., (1984) Anal. Biochem., 138, 2677. Casey, J., et al., (1977) NAR, 4, 15398. Wallace, R. B., et al., (1979) NAR, 6, 35439. Thein, S. L., et al., (1986) Human Genetic Diseases, a practical approach,

Addresses,Abbreviations and IndexChapter 7

7.1. Selection of useful addresses ...................................... 1707.2. Lab Steno............................................................................. 1727.3. Abbreviations ..................................................................... 1737.4. Alphabetical Index............................................................ 176

formation on

nd related data, physical and genetic maps psis thaliana

type culture collection

et version of the traditional r Mannheim wall chart.

a collection of 260 Pathway/Genome Databases.

al domain classification of protein structures

data and other information on single pass cDNA or expressed sequence tags from a number of

dia of E.coli genes and metabolism

EDLINE

e DBta from crystallographic and NMR structural tions)

of the Drosophila Genome

7.1. Selection of useful addresses*

Name Internet address Contains in

Arabidopsis http://arabi4.agr.hokudai.ac.jp/Links/Links.html#At_genome

Genomic aof Arabido

ATCC http://www.atcc.org American

Biochemical Pathways

http://www.expasy.ch/tools/pathways/ The internBoehringe

BioCyc http://biocyc.org/ BioCyc is

CATH http://www.biochem.ucl.ac.uk/bsm/cath Hierarchic

dbEST http://www.ncbi.nlm.nih.gov/dbEST/index.html Sequencesequencesorganisms

EcoCyc http://ecocyc.org/ Encyclope

ENTREZ http://www.ncbi.nlm.nih.gov/Entrez PubMed/MProtein DBNucleotidNM3D (dadetermina

Flybase http://flybase.bio.indiana.edu/ Database

Addresses, Abbreviations and Index 7

Location of human genes, DNA fragments, fragile sites and breakpointsPopulations, polymorphisms, maps and mutations

Genetic sequence database automatically collected of publicly available sequences

Enzyme reactionsChemical compoundsMetabolic pathways with links to gene catalogues.

Genetics of laboratory mouse.

Human genes and genetic disorders

3D coordinates of macromolecular structures.

Restriction enzymes and methylases

Contains information on

170

es, quickly invalidating any list of “useful” sites.

GDB http://www.gdb.org

Genbank http://www.ncbi.nlm.nih.gov/genbank

KEGG/LIGAND

http://www.genome.ad.jp/kegg/kegg.htmlhttp://www.genome.ad.jp/dbget/ligand.html

MGD http://www.informatics.jax.org

Omim http://www.ncbi.nlm.nih.gov/omim/

PDB http://www.rcsb.org/pdb/

REBASE http://rebase.neb.com

Name Internet address

* Web sites continually appear, disappear and change addressAll of the web sites given here were operating in July, 2007.

RestEnzy

g & Cloning

RochApplScie

tfolio, online technical support and e-shop che Applied Science.

SCO cation of protein domains

SWIS s obtained or translated from nucleotide ing descriptions of protein functions,

, posttranslational modifications, …

UnivProb

qPCR assays in seconds.

Yeas east Genome Database, annotated complete f Saccharomyces cerevisiae

Nam ion on

7.1.

riction mes

http://www.restriction-enzymes.com Tools for Mappin

e ied nce

http://www.roche-applied-science.com total product poravailable from Ro

P http://scop.mrc-lmb.cam.ac.uk/scop Structural classifi

-PROT http://www.expasy.ch/sprot Protein sequencesequences, includdomain structure

ersal eLibrary

http://www.universalprobelibrary.com Design real-time

t http://mips.gsf.de/proj/yeast/ Comprehensive YDNA sequence o

e Internet address Contains informat

Selection of useful addresses* (continued)

es, Abbreviations and Index 7 171

ting any list of “useful” sites.

z3950/gateway.html

plied-science.com

Address

* Web sites continually appear, disappear and change addresses, quickly invalidaAll of the web sites given here were operating in July, 2007.

For information on Web address

Gateway to North American Libraries http://lcweb.loc.gov/

PCR and multiplex PCR: guide and troubleshooting http://www.roche-ap

7.2. Lab Steno

Symbol Explanation Example Translation

centrifuge spin at 13 000 g-force

mix “over head” mix 5–times “over head”

shake shake for 3 minutes

vortex vortex for 15 seconds

rotate / mixing by turn over rotate the sample for 15 minutes

do for (time) at (number) °C incubate for 5 min at 4°C

next step

add add 5 ml buffer A

discard

divide into

digest digest pUC19 with BamH I

Addresses, Abbreviations and Index 7 172

Symbol Explanation Example Translation

precipitate / pelletate

pellet redisolve pellet in 5 ml buffer A

supernatant

buffer / solution buffer B

interrupt

stop

(monoclonal) antibody antibody against HIS

anti 2nd anti mouse POD

mouse rabbit anti mouse

rabbit sheep anti rabbit

negative/positive reaction #5 is negative

mo-4-chloro-3-indolyl-phosphateair(s)erel

mo-uridine-5'-triphosphatemo-2'-deoxyuridine serum albumin

ne or cytidinemphenicol acetyltransferase

lementary DNAholamidopropyl)-dimethyl-ammonio]-1-pro-

ulfonate

ne kinase lyasel micellar concentration monophosphateyme As per minuteium 3-(4-methoxyspiro{1,2-dioxetane-3,2'-loro)-tricyclo[3.3.1.13'7]decan}-4-yl)phenyl hatene-5'-triphosphateteinehrome c

7.3. Abbreviations

AA adenine or adenosineA260 unit Absorbance unit (≈ 50 µg for double-stranded DNA)AAS Atomic absorption spectrophotometryAb antibodyABTS 2,2-Azino-di-[3-ethylbenzthiazoline sulfonate (6)]Acetyl-CoA Acetyl-coenzyme AADA Adenosine deaminaseADH Alcohol dehydrogenaseADP Adenosine-5'-diphosphateAgarose LE Agarose low electroendosmosisAgarose LM-MP Low melting point multi purpose agaroseAgarose MP Multi purpose agarose AIDS Acquired immunodeficiency syndromeAla L-AlanineAMP adenosine monophosphateAMV Avian myeloblastosis virusAOD Amino acid oxidaseAP Akaline phosphataseAPMSF (4-Amidinophenyl)-methane-sulfonyl fluorideArg L-ArginineArg-C Endoproteinase, arginine-specificAsn L-AsparagineAsp L-Aspartic acidATP Adenosine-5'-triphosphate

BBCIP 5-Brobp Base pBq BecquBr-UTP 5-BroBrdU 5-BroBSA Bovine

CC cytosiCAT ChloracDNA CompCHAPS 3-[(3-C

pane sCi CurieCK CreatiCL CitrateCMC CriticaCMP CyclicCoA Coenzcpm CountCSPD Disod

(5'-chphosp

CTP CytidiCys L-Cyscyt-c Cytoc

es, Abbreviations and Index 7

Double-stranded (DNA)Thymidine-5'-diphosphate1,4-DithioerythritolThymidine-5'-monophosphate1,4-DithiothreitolThymidine-5'-triphosphateDeoxy-uridine2'-Deoxy-uridine-5'-triphosphate

Absorptivity (absorption coefficient)Escherichia coliEnzyme classification (enzyme commission) numberEthylenediamine tetraacetic acidEthyleneglycol-bis-(2-aminoethylether)-N,N,N',N'tetraacetic acidEnzyme immunoassayEnzyme-linked immunoabsorbent assayErythropoietin

Variable sequence fragment of immunoglobulin, generated by pepsinVariable sequence fragment of immunoglobulin, generated by papainFluorescence-activated cell sortingFlavin adenine dinucleotide

173
Address
DdADP 2'-Deoxyadenosine-5'-diphosphatedAMP 2'-Deoxyadenosine-5'-monophosphateDAPI 4',6-Diamidine-2'-phenylindole dihydrochloridedATP 2'-Deoxyadenosine-5'-triphosphatedCDP 2'-Deoxycytidine-5'-diphosphatedCTP 2'-Deoxycytidine-5'-triphosphateddATP 2',3'-Dideoxyadenosine-5'-triphosphateddCTP 2',3'-Dideoxycytidine-5'-triphosphateddGTP 2',3'-Dideoxyguanosine-5'-triphosphateddNTP Dideoxynucleoside triphosphateddTTP 2',3'-Dideoxythymidine-5'-triphosphateddUTP 2',3'-Dideoxyuridine-5'-triphosphatedCDP 2'-Deoxyguanosine-5'-diphosphatedGMP 2'-Deoxyguanosine-5'-monophosphatedGTP 2'-Deoxyguanosine-5'-triphosphateDIG DigoxigeninDIN German standardsdITP 2'-Deoxyinosine-5'-triphosphateDL Dosis lethalDMF DimethylformamideDMSO Dimethyl sulfoxideDNA Deoxyribonucleic acidDNase DeoxyribonucleasedNTP Deoxynucleoside triphosphatedpm Decays per minute

dsdTDPDTEdTMPDTTdTTPdUdUTP

E�

E. coliECEDTAEGTA

EIAELISAEPO

FF(ab')2

Fab

FACSFAD

leukinleukin 2-receptorleucineIodophenyl)-5-(4-nitrophenyl)-3-phenyl-tetra-m chloridered spectroscopyu hybridizationnational unit

ase pair(s)ecquerelDalton

al dosisucineleucinesineproteinase, Iysine-specific

ercaptoethanolabecquerelrpholineethanesulfonic acidthionineram (10-3 g)

ogramm (10-6 g)oliter (10-6 L)omolar (10-6 M)

FC Flow cytometryFITC Fluorescein isothiocyanateFLUOS 5(6)-Carboxyfluorescein-N-hydroxysuccinimide esterFMN Flavin mononudeotidefmol femto molFRET+ Fluorescence Resonance Energy Transfer

GG guanine or guanosine�-Gal �-GalactosidaseGDP Guanosine-5'-diphosphateGln L-GlutamineGlu L-Glutamic acidGlu-C Endoproteinase, glutamic acid specificGly L-GlycineGMP Guanosine-5'-monophosphateGTP Guanosine-5'-triphosphate

HHepes 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acidHg MercuryHis L-HistidineHIV Human immunodeficiency virusHPLC High pressure liquid chromatographyHRP Horse radish peroxidase

IIg ImmunoglobulinIH lmmunohistochemistryIHC/ICC lmmunohisto/cytochemistry

IL InterIL-2R InterIle L-lsoINT 2-(4-

zoliuIR lnfraISH In sitlU Inter

Kkbp KilobkBq KilobkD Kilo

LLD LethLeu L-LeIle L-lsoLys L-LyLys-C Endo

M�-ME �-MMBq MegMes 4-MoMet L-Memg milligµg micrµl micrµM micr


Parts per millionL-ProlinePoIyvinylidene-difluoride

Rapid amplification of cDNA endsrecA-assisted restriction endonuclease cleavageRestriction enzymeRibonucleic acidRibonucleaseReverse transcriptase

E Sodium dodecyl sulfate polyacrylamid gel electro-phoresisSodium dodecyl sulfateL-SerineSingle-stranded (DNA)

thymine or thymidineTris-acetate-EDTATris-borate-EDTATerabecquerelTrichloroacetic acidTriethanolamineL-Threonine

174
Address
ml milliliter (10-3 L)mm millimeter (10-3 m)mM millimolar (10-3 M)mRNA Messenger RNAMTP Microtiter plateMW molecular weight

NNBT 4-Nitro blue tetrazolium chlorideNC Nitrocellulosenm Nanometernmol nanemole (10-9 mole)

OONPG 2-NitrophenyI-�-O-gaIactopyranoside

PPAGE Polyacrylamide gel electrophoresisPCR Polymerase Chain ReactionPEG Polyethylene glycolPFGE Pulsed field gel electrophoresispg picogram (10-12 g)Phe L-PhenylalaninepI Isoelectric pointpmol picomole (10-12 mole)PMSF Phenyl-methyl-sulfonyl fluoridePOD Peroxidase

ppmProPVDF

RRACERARERERNARNaseRT

SSDS-PAG

SDSSerss

TTTAETBETBqTCATEAThr

ht/volumeern (protein) blots

omo-4-chIoro-3-indoIyI-�-D-galactopyranosideomo-4-chIoro-3-indoIyI-�-D-glucuronic acidomo-4-chloro-3-indolyl-phosphateum 3'-[1-(phenyl-amino-carbonyl)-3,4-tetrazoli-bis (4-methoxy-6-nitro)-benzene soIfonic acidate

t Artificial Chromosome

TM Melting temperatureTMB TetramythylbenzidineTPCK N-TosyI-L-phenyl-alanine-chloromethyl ketoneTris Tris(hydroxymethyl)-amino-methanetRNA Transfer ribonucleic acidTyr L-Tyrosine

UU Unit (of enzyme activity)U uracil or uridineUDP Uridine-5'-diphosphateUTP Uridine-5'-triphosphateUV Ultraviolet

Vv/v Volume/volumeVal L-Valine

Ww/v WeigWB West

XX-Gal 5-BrX-Gluc 5-BrX-phosphate 5-BrXTT Sodi

um]-hydr

YYAC Yeas

Addresses, Abbreviations and Index

Notes

7 175

apter.

157els 158

16290

148157160

160160160160160160160160

7.4. Alphabetical index

The colors of the topics refer to the color code of the respective ch

AAcrylamide-bisacrylamide,recipe

recipe to prepare resolving and stacking gAgar plates, recipeAmino Acids, characteristics of Ammonium acetate buffer, recipeAmmonium persulfate, recipeAmpicillin, general informationAmplification of DNA: see PCRAntibiotics, ampicillin, general information

chloramphenicol, general informationgeneticin, general informationgentamycin, general informationhygromycin, general informationkanamycin, general information streptomycin, general informationtetracyclin, general information

s, Abbreviations and Index 7

105102106107106131134157

11927, 28

12094

146146146146147148

176
Addresse
Antibodies, choices of animals for immunizationdifferent sourcesdoses of immunogens for rabbitspurification via immunoprecipitationroutes of injections for rabbits

Apoptosis / NecrosisApoptosis Assay MethodAPS, recipe

BBacterial cell: nucleic acid and protein contentBacterial Strains (commonly used)Blood: nucleic acid and protein contentBuffer exchange via gel filtrationBuffers, calculating molarities and concentrations

precautionspurity of reagents and H2OsterilizingpH measurementpH range of commonly used buffers

148121136167160

9185

9100

9868

46388918988

167167157115

CCaCl2, recipeCell CycleCell Proliferation and ViabilityCentrifugal forces, calculation of Chloramphenical, general informationCodon UsageCompleteConcentration of DNA via OD measurementConcentration of Proteins, interfering substances

via OD measurementConcentration of RNA via OD measurementConversion of DNA from pmol to µg and µg to pmol, calculationConversion of RNA from pmol to µg and µg to pmol, calculationConversion from Nucleic Acids to Proteins Amino Acids

Codon UsageGenetic CodeInformation Transfer

Conversion of pressureConversion of temperatures between Centrigrade and FahrenheitCoomassie Blue staining and destaining solutionCulture vessels: growth areas and yields of cells


148155

23116

939494969431

26233

82

61148

177
Addresse
DDenhardt solution, recipeDEPC, treatmentDephoshorylation of DNADetection of mycoplasma contaminationDetection of Proteins on membranesDetergents, commonly used

general propertiesremoval of

Dialysis of ProteinsDIG Labeling of Nucleic AcidsDissolving of DNADissolving of RNADNA Polymerase I for nick translationDNA purification,MagNA Pure LC InstrumentDrying of DNADrying of RNADTT, recipe

149128156103

24138

50

16589

160160166115

EEDTA, recipeElectroporationEthidum bromide, recipeExpression of Proteins, characteristics of different systems

FFill-in 3´and 5´recessed ends of DNAFluorescence activated cell sortingFluorescence Resonance Energy Transfer

GGC content of different genomesGenetic CodeGeneticin, general informationGentamycin, general informationGreek alphabetGrowth areas and yields of cellsa in a cultural vessel


2604850

160

107109149

86768

656665

178
Address
HHandling of DNAHandling of RNAHybridization Probes HybProbe FormatHygromycin, general information

IImmunoprecipitation of antibodiesIon exchange chromatography of proteinsIPTG, recipeIsolation of DNA MagNA Pure LC Instrument

product application tableproduct characteristics tableproduct selection table

Isolation of RNA MagNA Pure LC InstrumentIsolation of RNA product application table

product characteristics tableproduct selection table

1602432

152153

293435332932302929

7979

1612247

KKanamycin, general informationKlenow to fill-in 3´recessed ends of DNA

for random primed labeling of DNAKOAc, recipe for buffer with desired pHK phosphate, recipe for buffer with desired pH

LLabeling of DNA Choice of labeling method

3´End labeling with Terminal Transferase5´End labeling with Polynucleotide KinaseNick TranslationPurification of labeled probeRandom Primed labelingTechniques, overviewTemplateType of label

Labeling of Oligonucleotides, see Labeling of DNALabeling of RNA Choice of labeling method

In vitro Transcription with RNA PolymerasesLB medium, recipeLigation of DNALightCycler® System

, Abbreviations and Index 7

127127127155

1618

149119

28261

16157

164165149

179
Addresses
Liposomal and non-liposomal Transfection ReagentsFuGENE® HD Transfection ReagentX-tremeGENE siRNA Transfection Reagent

Loading buffer for RNA gelelectrophoresis

MM9 minimal medium, recipeMagNA Pure LC InstrumentMagnesium chloride, recipeMammalian cell: nucleic acid contentManipulation of DNAManipulation of ProteinsManipulation of RNAMedia for BacteriaMelting Curve Analysis (LightCycler)Melting temperatures, calculation of Metric prefixesMgCl2, recipe

13010

3resis 11

929263

resis 69149

26115

149149152153148

33119119120

MicroinjectionMolecular Weight MarkersMolecular weight of DNA, calculation of

via acrylamide and agarose gelelectrophoMolecular weight of Proteins, commonly used markers

via denaturing SDS PAGEMolecular weight of RNA, calculation of

via acrylamide and agarose gelelectrophoMOPS, recipeMung Bean Nuclease, removing 3´ and 5´protruding ends of DNAMycoplasma Contamination

NNaCl, recipeNaOAc, general recipe

recipe for buffer with desired pH Na phosphate, recipe for buffer with desired pHNH4OAc, recipeNick Translation of DNANucleic Acid and Protein content of a bacterial cella

Nucleic Acid content in a typical human cellNucleic Acid content in human blood


15142

41364343444443434041424441

4141414141

180
Addresse
PPBS, recipePCR Additives to reaction mix

Choice of Polymerase Contamination, avoiding ofCycling profile initial denaturation

denaturation during cyclingfinal extensionnumber of cyclesprimer annealingprimer extension

MgCl2 concentrationNucleotides concentration and storagepH of reaction mix

PCR Standard Pipetting SchemeExpand High FidelityExpand High Fidelity PLUS PCR SystemExpand Long Template PCR SystemFastStart Taq DNA PolymeraseGC-Rich PCR SystemTaq, Pwo polymerase

42414138383939394038395140384648504850595155

Polymerase, concentration ofproduct characteristicsproduct selection

Primers, annealing temperatureconcentrationconcentration via OD measurementconversion of µg to pmol and pmol to µg

µM to pmol and pmol to µMdesignmelting temperaturemolecular weight, calculation of

Probe Designer Software (LightCycler®) softwarestorage

PCR Real Time AnalysisReal-Time PCR Assay FormatsFluorescence Resonance Energy TransferHybridization Probes HybProbe FormatMelting Curve AnalysisProbe Designer Software (LightCycler®) Quantification Principles


37lymerase 45

168147156156

262

363

cleotides 35159152153

282

181
Address
PCR Template, amount, integrity and purity ofStandard Temperature Profile for Taq, Tth and Pwo po

Periodical system of elementspH measurement Phenol, caution when using

recipePipetting of DNAPipetting of RNApmol of ends of DNA, calculation ofpmol of ends of RNA, calculation ofPolynucleotide Kinase for 5´end labeling of DNA and OligonuPonceau S solution, recipePotassium acetate, recipe for buffer with desired pHPotassium phosphate, recipe for buffer with desired pHPrecautions for handling DNAPrecautions for handling Proteins

6097969797

16751

117118118

838561

107

109111

968

Precautions for handling RNAPrecipitation of Proteins with aceton

ammonium sulfatechloroform/methanolTrichloroacetic acid

Pressure, conversionsPrimers: Probe Designer Software (LightCycler® System)Properties of Bacterial CellsProperties of Plant CellsProperties of Animal CellsProtease Activity, inhibition ofProtease Inhibitor, product selection tableProtector RNase InhibitorPurification of antibodies via immunoprecipitationPurification of DNA: see Isolation of DNAPurification of Proteins via ion exchange chromatography

via taggingPurification of RNA: see Isolation of RNAPurity of DNA via OD measurementPurity of RNA via OD measurement

QQuantification of Proteins: see concentration of Proteins


16632

103

24142144143143143143143

1515121514152114

182
Addresse
RRadioisotopes: properties of Random primed labeling of DNARapid Translation SystemReal-Time PCR (see PCR Real Time Analysis)Remove 3´and 5´protruding ends of DNAReporter Gene Assays

CAT (Chloramphenicol Acetyltransferase) β-Gal (β-Galactosidase)Luc (Luciferase)hGH (Human Growth Hormon)SEAP (Secreted Human Placental Alkaline Phosphatase)GFP (Green Fluorescent Protein)

Restriction Enzymes Activity in buffer systemin PCR buffer mix

Buffer system and componentsCharacteristics of individual enzymesInactivation Methylation, sensitivity toPartial DigestPulse field gradient electrophoresis

15ences 19

14131212

6170767677

7575

77, 787575717270

Recognition sitesRecognition sites, palindromic recognition sequRemoval from reaction mixStar activityStability and storageUnit definition

Reverse transcription of RNA: see RT-PCRRNAse InhibitorsRT-PCR Contamination, avoiding of

One Step Procedures advantagesdescriptionenzymes, choice of

RT-PCRPolymerase, combinations with DNA polymerases

divalention requirementRNase H Activitysensitivity and specificitytemperature optima

Primers for reverse transcription, choice ofdesign of

RNAse contamination, avoiding of

, Abbreviations and Index 7

70767677

157

154157155130

2351

sis 1192

esis 69161161149152

183
Addresses
Template, type and integrityTwo Step Procedures advantages

descriptionenzymes, choice of

RTS (see Rapid Translation System)Running buffer for Protein SDS PAGE

SSample buffer for DNA agarose gelelectrophoresis, recipe

Protein SDS and urea PAGERNA agarose gelelectrophoresis, recipe

Selection Markers for Stabile Cell LinesShrimp Alkaline Phosphatase for dephosphorylationSimpleProbe FormatSize estimation of DNA via acryamide and agarose electrophoreSize estimation of Proteins via denaturing SDS PAGESize estimation of RNA via acrylamide and agarose electrophorSOB medium, recipeSOC medium, recipeSodium acetate, general recipe

recipe for buffer with desired pH

149150153

80151151

8686868787879393

28261

160156

Sodium chloride, recipeSodium dodecyl sulfate, recipeSodium phosphate, recipe for buffer with desired pHSP6 Polymerase for labeling of RNASSC, recipeSSPE, recipeStabilization of Proteins Addition of osmolytes

proteinssaltsreducing reagentsspecific ligandssubstrates

Staining of Proteins on denaturing SDS PAGE gelsStaining of Proteins on membranesStorage of DNAStorage of ProteinsStorage of RNAStreptomycin, general informationSYBR green staining for DNA and RNA gelelectrophoreis


80154111161154159159150151

t 16762

leotides 34160113113113113162154

184
Address
TT3 and T7 Polymerase for labeling of RNATAE, recipeTagging of ProteinsTB medium, recipeTBE, recipeTBS, recipeTBST, recipeTCA, recipeTE, recipeTemperature, conversion between Centrigrade and FahrenheiTemperature sensitivity of RNATerminal transferase for 3´end labeling of DNA and OligonucTetracycline, general informationTissue culture reagents

Fetal calf serumCO2 IncubatorCO2 Incubator, concentrations

Top agar overlay, recipeTPE, recipe

123150150154

53

159159

150162

161

Transfection of mammalian cellsTrichloroacetic acid, recipeTris, general recipe

recipe for buffer with desired pH

UUniversal ProbeLibrary

WWestern blotting, blocking solution, recipe

transfer buffer for semi dry and wet blots, recipe

XX-gal, recipeX-gal/IPTG indicator plates, recipe

YYT medium, recipe

Addresses, Abbreviations and Index 7 185

Trademarks

COMPLETE, EXPAND, FASTSTART, HIGH PURE, LC, LIGHTCYCLER, LUMI-IMAGER, MAGNA PURE, NUTRIDOMA, RTS, SURE/CUT, TAQMAN, TITAN, TRIPURE, MINI QUICK SPIN, are trademarks of Roche.

FuGENE is a registered trademark of Fugent, L.L.C., USA.UPL, PROBELIBRARY and LNA are trademarks of Exiqon A/S, Vedbaek, Denmark.Other brands or product names are trademarks of their respective holders.

lab_faqs

Documents

Transcript of lab_faqs