Identification of a new Z-DNA inducer using SYBR green 1as a DNA conformation sensorJeong Hwan Hur1, Ae-Ree Lee2, Wanki Yoo1, Joon-Hwa Lee2 and Kyeong Kyu Kim1,3

1 Department of Molecular Cell Biology, Institute for Antimicrobial Resistance Research and Therapeutics, Sungkyunkwan University

School of Medicine, Suwon, Korea

2 Department of Chemistry and Research Institute of Natural Science, Gyeongsang National University, Jinju, Korea

3 Samsung Biomedical Research Institute, Samsung Advanced Institute for Health Sciences and Technology, Samsung Medical Center,

Sungkyunkwan University School of Medicine, Seoul, Korea

Correspondence

K. K. Kim, Department of Molecular Cell

Biology, Institute for Antimicrobial

Resistance Research and Therapeutics,

Sungkyunkwan University School of

Medicine, Suwon 16419, Korea

Tel: +82-31-299-6136

E-mail: kyeongkyu@skku.edu

(Received 30 April 2019, revised 13 June

2019, accepted 19 June 2019, available

online 10 July 2019)

doi:10.1002/1873-3468.13513

Edited by Miguel De la Rosa

Z-DNA, which is left-handed double-stranded DNA, is involved in various

cellular processes. However, its biological roles have not been fully evaluated

due to the lack of tools available that can control the precise conformational

change to Z-DNA in vitro and in vivo. Therefore, the need for identifying

new Z-DNA inducers is high. We developed an assay system to monitor the

conformational change in DNA utilizing the fluorescence of SYBR green I

integrated into a double-stranded oligonucleotide. By applying this assay to

screen for compounds that induce the B-DNA to Z-DNA transition, we iden-

tified the natural compound aklavin as a novel Z-DNA inducer.

Keywords: aklavin; B-to-Z transition; high-throughput assay; screening

system; SYBR green I; Z-DNA

Z-DNA, which is left-handed double-stranded DNA, is

induced and stabilized when alternating purine–pyrim-

idine repeats are exposed to positively charged mole-

cules, Z-DNA–binding proteins (ZBPs), or high salt

concentration [1]. Z-DNA can be also formed by nega-

tive supercoiling within cells in vivo to relieve transcrip-

tion-induced superhelical strain. Z-DNA is linked to

various cellular processes, including the innate immune

response [2] and transcriptional regulation [3]. More-

over, since Z-DNA formation can disrupt the confor-

mational and functional integrity of DNA, Z-DNA

formation is proposed to cause genomic instability and

deletions [4]. However, Z-DNA can be stabilized by Z-

DNA inducers that reduce the anionic repulsion cre-

ated by the close phosphate groups in its backbone [5].

Through intensive structural and biochemical analy-

ses, it has been well documented that ZBPs, including

ZBP1/DLM-1, ADAR1, E3L, and PKR-like protein

kinase, can induce the B-to-Z transition upon binding

and stabilize Z-DNA [6–9]. Moreover, it has been

reported that some metal chelate compounds, such as

([Ru(dip)2dppz]2+) [10], can efficiently push the equilib-

rium toward Z-DNA by reducing the electrostatic

repulsion in the phosphate backbone. Polyamines, such

as cobalt hexamine and spermine, can also induce the

formation of Z-DNA, presumably by a mechanism

similar to that of ruthenium complexes [11–13]. Z-

DNA can be also be stabilized in the presence of

monovalent or divalent cations, such as Mg2+, Zn2+,

Ni2+, Co2+, and Na+ (e.g. NaCl or NaClO4) at rela-

tively high concentrations in buffer [14–17]. Lysine-

containing peptide (Lys-Ala-Lys) can also transform B-

DNA to Z-DNA [18]. However, the precise control of

Z-DNA formation in vitro or in vivo requires a chemi-

cal inducer that can effectively and specifically trans-

form the DNA to a Z-DNA conformation.

To discover new Z-DNA inducers or probes, an effi-

cient and accurate high-throughput screening (HTS)

Abbreviations

HTS, high-throughput screening; SG, SYBR green I; ZBPs, Z-DNA–binding proteins.

2628 FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

system is necessary that identifies candidate chemicals

among many compounds in chemical libraries. In this

study, we developed a reporter system that can monitor

DNA conformational change by measuring the SYBR

green I (SG) fluorescence since SG fluorescence shows

a dramatic change during the B-to-Z transition. We

utilized this reporter to screen for and identify Z-DNA

inducers. To further separate real candidates from

false-positive candidates, we introduced a high-

throughput melting temperature analysis. The efficiency

of this screening system was validated using known Z-

DNA inducers, and it was ultimately used to identify a

new Z-DNA inducer from a natural compound library.

Methods and material

Purification of human ZaADAR1

The Za domain of human double-stranded RNA-speci-

fic adenosine deaminase 1 (hZaADAR1) was purified as

described previously. Briefly, the Za domain incorpo-

rated into pET28a was transformed into BL21 (DE3)

Escherichia coli, which were then cultured at 37 °C for

4 h, treated with 1 mM IPTG, and cultured for another

4 h. The cells were lysed using lysis buffer (50 mM Tris-

HCl, 300 mM NaCl, 30 mM imidazole, 0.1 mM PMSF,

0.5 lg DNase I, pH 8.0). The proteins were purified

using Ni-nitrilotriacetic acid and an SP column.

Purification of lac repressor protein

The DNA binding domain (1–331) of the lac repressor

protein was cloned into pVFT1S. The cloned plasmid

was transformed into BL21 (DE3), which were then

cultured at 37 °C for 4 h, treated with 1 mM IPTG,

and cultured for another 4 h. The cells were lysed

using lysis buffer (20 mM Tris-HCl, 300 mM NaCl,

20 mM imidazole, pH 7.5). The proteins were purified

using nitrilotriacetic acid followed by gel filtration.

Fluorescence measurement of SYBR green

I-labeled oligonucleotide

The single-strand synthetic oligonucleotides d(CG)6,

d(AT)6, and the lac repressor protein binding sequence

d(GAATTGTGAGCGCTCCTCTCACAATTC) (Cos-

mogenetech, Seoul, South Korea) were dissolved in

Buffer ‘A’ (5 mM HEPES, 10 mM NaCl, pH 7.5).

Then, the oligonucleotides were boiled at 97 °C for

5 min and slowly allowed to anneal at room tempera-

ture for at least 4 h. The oligonucleotides were stored

at 4 °C overnight followed by concentration via

centrifugation. The concentration of annealed DNA

was adjusted to 15 lM. The 10 0009 stock of SG

(Thermo Fisher Scientific, Waltham, MA, USA) was

mixed with the oligonucleotides to a dilution of 19.

The mixture of SG and the annealed DNA was again

boiled and annealed to incorporate SG into the DNA.

The mixture was stored at 4 °C before use. The fluo-

rescence intensities of the 15 lM SG-labeled DNA with

and without Z-DNA inducers were measured using a

Jasco FP-750 (Jasco, Easton, MD, USA). An excita-

tion scan was performed to determine the maximum

excitation wavelength. Then, an emission scan was per-

formed in the wavelength range of 500–700 nm after

exciting DNA at the maximum excitation wavelength.

The fluorescence intensity of the buffer was subtracted

from each dataset for normalization.

Screening of the Z-DNA–inducing chemicals

A natural product library containing 800 compounds

of diverse alkaloids, flavonoids, and sterols (NatProd

Collection; MicroSource Discovery System, Gay-

lordsville, CT, USA) was prepared in a 1 mM stock

solution in DMSO for screening. One microliter of

each chemical stock solution was introduced into a

well containing 29 lL of 15 lM DNA labeled with SG

in a 96-well plate. As a result, the total reaction vol-

ume was 30 lL and the final concentration of the

chemical was 333 lM. For screening, the plate was

sealed and inserted into a CFX Connect RT-PCR

machine (Bio-rad, Hercules, CA, USA), which has

excitation and emission ranges of 450–580 nm. Candi-

date chemicals from this first stage of screening were

chosen based on the fluorescence intensity of SG incu-

bated with DNA in the presence of each chemical. The

fluorescence intensity was measured by a Jasco FP-750

spectrofluorometer with excitation at 490 nm and

emission in the range of 500–550 nm (Fig. 2A). Then,

the melting temperature (Tm) of DNA was measured

in the presence of the chemicals selected in the first

stage (Fig. 2B). The Tm analysis was performed by

increasing the temperature from 10 to 95 °C in 0.5 °Cincrements with 5 s between each incremental increase.

Circular dichrosim

For 1 h, 15 lM d(CG)6 was incubated with purified

human ZaADAR1 protein at a ratio of 1 : 8 for

complete transition, and the CD spectra were mea-

sured in the wavelength range of 230–320 nm by a

Jasco-810 (Jasco). Three spectra were collected to

obtain the average spectra. In the CD experiment with

DNA at the high salt condition, both d(CG)6 and

2629FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

J. H. Hur et al. Searching for a new Z-DNA inducer with SYBR green

d(AT)6 were incubated in 4 M salt buffer for 1 h before

obtaining the spectra. CD signal from buffer and chem-

icals were subtracted from the obtained result.

Nuclear magnetic resonance

The oligonucleotides were prepared at a concentration

of 0.2 mM in buffer containing 5 mM HEPES and

10 mM NaCl at pH 7.5. For monitoring the imino pro-

ton region, the oligonucleotides were also dissolved in

buffer ‘A’ with 10% D2O and 90% DNase I-treated dis-

tilled water. All NMR experiments were performed

using a 700 MHz NMR machine (Agilent Technologies,

Santa Clara, CA, USA) at 28 °C. The WATERGATE

3919 NMR pulse program was used to monitor the

imino proton chemical shift (12.5–13.5 p.p.m.).

Statistical analysis

Statistical significance was assessed by two-tailed t-test

using GRAPHPAD software (GraphPad software, La

Jolla, CA, USA).

Results

SYBR green I displacement was observed during

B-to-Z transition

SYBR green I emits strong fluorescence around 520 nm

when it binds to double-stranded DNA, but gives a low

emission signal when it is present in solution [19,20].

The SG binding to B-DNA, the most stable double-

stranded DNA, has been well characterized, but its

binding to other forms of double-stranded DNA has

not been well studied. Because Z-DNA is also double-

stranded DNA with base pair stacking, we expected

that SG would also bind to Z-DNA and emit fluores-

cence. To verify this, we first examined the Z-DNA for-

mation of SG-bound B-DNA using CD spectrometry

(Fig. 1A). d(CG)6, double-stranded deoxyribonucleic

acid with hexa-repeats of deoxycytidylic-deoxyguanylic

acids, was incubated with SG to make SG-bound B-

DNA. The formation of Z-DNA was monitored in the

presence of the known Z-DNA inducer hZaADAR1, a Z-

DNA binding domain of human ADAR1, and under a

high salt condition (4 M NaCl), which is also known to

induce Z-DNA. We confirmed the Z-DNA formation

of d(CG)6 under both conditions by observing the typi-

cal CD spectra of Z-DNA, including a negative peak at

295 nm and incremented ellipticity in the wavelength

range of 250–255 nm (Fig. 1A). These results verified

that SG-bound B-DNA can be converted into Z-DNA

when exposed to Z-DNA–inducing conditions.

However, based on this evidence, it was unclear if

SG remained bound to Z-DNA or detached during the

B-to-Z transition. Therefore, we performed CD and

FRET experiment with d(CG)6 at various concentra-

tion (500 mM, 750 mM, 1 M, 2 M, 3 M, 5 M, 7 M, and

9 M) of sodium perchlorate (NaClO4) to see the corre-

lation between B-to-Z transition and the changes in flu-

orescence intensity emitted by SG during the transition

(See also Fig. S1). As the concentration of NaClO4

increased, d(CG)6 showed canonical B-to-Z transition

where the CD value at 255 and 293 nm become posi-

tive and negative, respectively (See also Fig. S1A),

while showing the significant decrease in fluorescence

intensity at 520 nm and slight red shift to 550 nm at

high concentration of NaClO4 condition (> 3 M; See

also Fig. S1B). The plot showing the CD value at

255 nm and the fluorescence intensity at 520 nm at

each NaClO4 concentration explicitly explains the fluo-

rescence decrement is deeply correlated with B-to-Z

transition (See also Fig. S1C). Moreover, we monitored

SG fluorescence by fixing the excitation wavelength at

475 nm and observing the emission spectra from 500 to

550 nm during the B-to-Z transition under fixed Z-

DNA–inducing conditions. Upon the B-to-Z transition

induced by hZaADAR1, kmax shifted from 520 to

525 nm, and the fluorescence intensity at 520 nm was

reduced up to 86.5% compared to the fluorescence of

SG-bound B-DNA (Fig. 1B). We conducted the same

experiment using d(AT)6 as a control because d(AT)6cannot be converted to Z-DNA, even in the presence

of hZaADAR1 (Fig. 1A). Although there was a slight

reduction in fluorescence, the reduction in intensity

caused by the incubation of d(AT)6 with hZaADAR1

was 39.4%, which was less than that of d(CG)6(Fig. 1B). Similarly, when SG-bound d(CG)6 was con-

verted into Z-DNA by 4 M NaCl, the reduction in SG

intensity was 51.1%, whereas d(AT)6 in 4 M NaCl

demonstrated only a 16.1% reduction in SG intensity

(Fig. 1B). Based on these results, we confirmed that SG

fluorescence was reduced when SG-bound B-DNA was

transformed into Z-DNA by either a protein inducer

or high salt conditions, although the reduction percent-

age varied depending on the inducing condition.

The fluorescence intensity of SG can also be dimin-

ished when dsDNA is denatured to ssDNA due to the

inability of SG to bind to ssDNA [19]. However, since

we observed that DNA remained in double-stranded

form based on the CD analysis during the transition

(Fig. 1A), the fluorescence reduction was likely caused

by the conformational change into Z-DNA rather than

the denaturation of dsDNA. However, it remained pos-

sible that protein binding to DNA caused SG fluores-

cence alterations. To examine this possibility, we

2630 FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

Searching for a new Z-DNA inducer with SYBR green J. H. Hur et al.

assessed the SG fluorescence change when the lac repres-

sor bound to its cognate dsDNA (See also Fig. S2B).

We found that the SG fluorescence was reduced by

21.4% upon protein binding (See also Fig. S2B), but

this reduction was less than that observed when hZaA-

DAR1 bound to d(CG)6. Notably, no conformational change

in DNA was observed upon lac repressor binding (See

also Fig. S2A). These results collectively suggest that the

change in SG fluorescence caused by hZaADAR1 binding

was mostly due to the subsequent conformational

change in DNA rather than the protein binding itself.

Therefore, we conclude that the altered fluorescence of

SG-bound DNA caused by a B-to-Z transition can be

distinguished from the fluorescence alterations observed

due to simple protein–DNA interactions or DNA-Na+

interactions.

SYBR green I is known to bind B-DNA by either

intercalation or surface binding depending on the ratio

of SG to DNA base pairs. Intercalation with DNA can

be achieved at a dye/base pair ratio (dbpr) of < 0.15,

whereas extra SG binds to the DNA surface when the

dbpr is higher than 0.15 [19]. Our experimental condi-

tions contained 175.0 lM base pairs of DNA and

66.2 lM SG, so the dbpr was calculated to be 0.38. There-

fore, it is highly probable that SG is bound on the surface

as well as intercalated in DNA based on the dbpr > 0.15.

Developed efficient and fast screening system for

identifying Z-DNA inducers

From the CD and fluorescence analyses of the SG-

bound DNA, we verified that DNA conformation

Fig. 1. CD spectra and fluorescence signal reduction showing changes in signal upon Z-DNA conformation. (A) CD spectra of SG-labeled d

(CG)6 and d(AT)6 in the presence of hZaADAR1 and 4 M NaCl (B) The measurement of fluorescence intensity changes upon the B-to-Z

transition. (C) The measurement of fluorescence intensity changes of SG d(CG)6 upon addition of a Z-DNA inducer (hZaADAR1) or control

(DMSO) in a 96-well set-up (***P < 0.0001).

2631FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

J. H. Hur et al. Searching for a new Z-DNA inducer with SYBR green

could be differentiated by change in SG fluorescence.

Therefore, this method had the potential to assess the

B-to-Z conformation transition and be useful in identi-

fying Z-DNA inducers or stabilizers. Based on this

hypothesis, we developed a screening system for identi-

fication of Z-DNA-inducing substances (Fig. 2). The

proposed assay method consists of three steps: (a) an

initial screen of the substances that can induce fluores-

cence change in SG-bound B-DNA; (b) Tm analysis of

DNA in the presence of the candidates selected in the

first step to verify whether they can stabilize the DNA

conformation; and (c) CD spectroscopic measurement

of DNA in the presence of candidate molecules to vali-

date the chemical-induced Z-DNA formation. The

measurement of Tm in the second step is necessary to

exclude any compounds that induce denaturation of

dsDNA, given that any fluorescence change observed

in the first step may also be caused by SG binding to

single-strand DNA. The first and the second steps can

be conducted simultaneously in 96-well plates using a

real-time PCR machine with a fluorescence reader.

Considering the short duration and simple setup of

these experiments, we believe that this method can be

employed as a HTS assay to discover new Z-DNA

inducer candidates.

Identified aklavin as Z-DNA inducer

To validate the utility of this method in a high-through-

put approach, we first tested whether known Z-DNA

inducers such as hZaADAR1 can be detected using this

method in a 96-well setup with a plate reader (CFX

connect machineTM; Bio-rad, Hercules, CA, USA). For

comparison, DMSO was used as a negative control.

Reduction in SG fluorescence was clearly detected when

hZaADAR1 was applied to the SG-bound B-DNA

(Fig. 1C) although, the scale of the fluorescence change

observed by the plate reader was different from that

obtained using the spectrofluorometer (Fig. 1B). This

discrepancy is likely due to the differences in excitation

and emission wavelengths of the spectrofluorometer

and the plate reader. Collectively, we determined that

the high-throughput approach could be used to identify

Z-DNA inducer candidates by monitoring changes in

SG fluorescence intensity. Therefore, we applied this

method to screen for Z-DNA inducers among 800 natu-

ral compounds by measuring the fluorescence intensity

changes of SG-bound DNA upon introduction of each

candidate. Because protein binding itself produces some

degree of reduction in fluorescence, we set our cut-off at

60.0% rather than 80.0%. Thirty-two compounds

demonstrated a > 60.0% decrease in SG fluorescence

intensity compared to the nontreated DNA control and

proceeded to the next step. The selected 32 candidate

compounds were then assessed by Tm analysis. This step

further selected seven of the 32 compounds that had a

measured Tm higher than the Tm (56.0 °C) of the

untreated DNA sample (See also Fig. S3A,B, Table S1).

These seven compounds were further validated as Z-

DNA inducers by CD spectrometry. Among the seven,

aklavin hydrochloride showed the CD spectra most rep-

resentative of Z-DNA (Fig. 3C, See also Fig. S3C).

Thus, we further characterized aklavin hydrochloride as

a Z-DNA inducer. When the Tm of DNA in the presence

of aklavin hydrochloride was analyzed again, more

accurately using the real-time PCR machine, we

observed that the absolute Tm of the DNA increased

from 56.0 to 69.0 °C (Fig. 3D). These results clearly sug-

gest that Z-DNA is highly stabilized when it interacts

with aklavin. Generally, Z-DNA can be characterized

by a distinct CD spectrum, with a negative peak around

290 nm and a positive peak around 255 nm; B-DNA

results in a positive peak at 290 nm and a negative peak

at 255 nm. We observed that d(CG)6 demonstrated a

positive peak (0.24 mdeg) at 300 nm and a negative

peak (�3.19 mdeg) at 255 nm, suggesting that it had a

B-DNA conformation in the absence of chemicals

(Fig. 3C). However, DNA in the presence of aklavin

hydrochloride at a 1 : 1 ratio resulted in a spectrum with

a negative peak (�0.66 mdeg) at 300 nm. In addition,

its ellipticity at 255 nm was positively shifted

(�1.65 mdeg) compared to B-DNA. When the ratio of

aklavin to DNA was increased to 2 : 1, the CD elliptic-

ity values at 300 and 255 nm were negatively

(�1.39 mdeg) and positively shifted (�0.94 mdeg),

respectively (Fig. 3C). These results demonstrate conver-

sion of B-DNA to Z-DNA in the presence of aklavin.

Verified aklavin as Z-DNA inducer using 1D1H-NMR

To further verify the Z-DNA–inducing activity of akla-

vin, we acquired the 1D 1H-NMR spectra of the 6-bp

DNA duplex d(CG)3 as a function of the [A]/[D] ratio

under both 10% D2O and 100% D2O conditions

(Fig. 4, right panel). Generally, the B-to-Z transition

can be confirmed by characteristic changes in the gua-

nine imino proton resonances. For example, the ability

of the ruthenium chemical compound to induce the Z-

DNA conformation of d(CG)12 was previously vali-

dated by line-broadening and downfield shifts of the

imino proton resonances of the guanine nucleotide at

around 13.0 p.p.m. followed by the treatment of ruthe-

nium [10]. Using a similar technique, we monitored the

change in imino proton resonances of the guanine

nucleotides (G2b and G4b) in d(CG)3 while adding

2632 FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

Searching for a new Z-DNA inducer with SYBR green J. H. Hur et al.

Fig. 2. Schematic representation of the HTS system for identification of Z-DNA-inducing molecules. (A) ‘Step 1’ measures the SG

fluorescence intensity reduction relative to the ‘control’ (black) to identify a ‘candidate’ (red). (B) ‘Step 2’ measures the increase in Tm of a

‘candidate’ (red) molecule compared to the ‘control’ (black). (C) ‘Step 3’ measures the ellipticity (mdeg) of d(CG)6 in the presence of

‘candidate molecules’.

2633FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

J. H. Hur et al. Searching for a new Z-DNA inducer with SYBR green

increasing concentrations of aklavin. We used the

WATERGATE 3–9–19 pulse sequence, which sup-

presses water resonance and enhances desired proton

resonances from nucleic acids. The intensities of the

imino resonances of the DNA decreased and broadened

as the [A]/[D] ratio increased up to 1.0 (Fig. 4). The two

imino resonances from the second guanine residue

(G2b) at 12.95 p.p.m. and the fourth guanine residue

(G4b) at 12.92 p.p.m., exhibited significant line-

broadening upon binding to aklavin in a concentra-

tion-dependent manner. In addition, the imino reso-

nances of G2b (G2z) and G4b (G4z) moved to 12.93

and 12.90 p.p.m., respectively. This represents a chem-

ical shift difference (Dd) of 0.02 p.p.m. (~ 14 Hz) for

(G4b) and 0.01 p.p.m. (~ 7 Hz) for G4b upon the

addition of with aklavin. This chemical shift differ-

ence was previously observed in high salt-induced

(Dd = 0.16 p.p.m.) [21] and ruthenium-induced

Fig. 3. Validation of aklavin hydrochloride as a Z-DNA inducer. (A) Representative data from a screen demonstrating a primary Z-DNA–

inducing candidate molecule (red bar) via observation of the reduction in SG intensity compared to the control (black bar), where each tick

on the x-axis represents each chemical compound in the set. The y-axis represents the SG fluorescence intensity, and the 60% reduction

cut-off is indicated by the red dotted line. (B) Chemical structure of aklavin. (C) CD spectra of d(CG)6 with increasing aklavin [A] to DNA [D]

molar ratio ([A]/[D]). (D) Tm analysis of d(CG)6 in the presence of aklavin (**P < 0.005).

2634 FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

Searching for a new Z-DNA inducer with SYBR green J. H. Hur et al.

Z-DNAs (Dd = 0.05 p.p.m.)[10]. In addition, this inter-

action represents a fast exchange mode rather than a

slow exchange mode. In the 100% D2O condition

(Fig. 4, left panel), significant peak broadening was

observed at the C1H6, C3H5’, and C5H5’ resonances,

indicating the interaction of aklavin with these residues.

These results suggest that d(CG)3 exists as a left-handed

Z-DNA after aklavin treatment (Fig. 4).

Discussion

Aklavin is known to have antibiotic activity as well as

antiphage activity [22], but its mechanism of action

remains unclear. It is also known that aklavin prevents

virus-mediated host cell lysis in a concentration-depen-

dent manner by altering the host–virus interaction and

suppressing viral growth [22]. Therefore, aklavin has

multiple functions in cells through binding to various

macromolecules via many functional groups. It is well

known that Z-DNA can be stabilized by reducing the

repulsive forces between negatively charged phosphate

groups in its backbone. It is possible that the tertiary

amine derivative of aklavin reduces the electrostatic

repulsion in the negatively charged phosphate back-

bone in this way, thus stabilizing the Z-DNA

(Fig. 3B). However, the detailed binding mode of akla-

vin to Z-DNA and the mechanism of the aklavin-me-

diated B-to-Z transition require further investigation.

Considering the important potential roles of Z-DNA

in various biological processes and diseases, there is a

need to identify Z-DNA inducers that can control Z-

DNA–relevant biological processes and can potentially

be used for therapeutic purposes. However, there is no

reliable screening system to identify Z-DNA inducers.

In this study, we developed an efficient and fast

screening system to identify Z-DNA inducers based on

the change in SG fluorescence and Tm, followed by

CD validation. We demonstrated the utility of this

screening system by identifying a novel Z-DNA indu-

cer from a natural compound library. This system

could be used to similarly identify more Z-DNA

inducers if applied to other chemical libraries. There-

fore, this screening system will play a pivotal role in

the discovery and validation of new Z-DNA inducers

with various chemical properties.

Acknowledgement

This work was supported by Samsung Science & Tech-

nology Foundation (SSTF-BA1301-01).

Author contributions

JHH and KKK wrote the manuscript under KKK’s

advisory. JHH performed HTS and CD-related experi-

ment, and prepared sample for NMR. ARL analyzed

and processed NMR data. WY purified lac repressor

proteins. JHL advised on the NMR experiment and

data. KKK advised on the entire project and the

manuscript.

Fig. 4. 1D 1H-NMR result of d(CG)3 upon titration with aklavin. 1D 1H-NMR spectra at the 10% D2O condition (right panel) showing the B-

to-Z transition upon addition of aklavin ([A]/[D] = 0, 0.25, 0.5, 0.75, and 1.0). The resonances from the B-form are labeled as G2b

(12.94 p.p.m.) and G4b (12.92 p.p.m.), and those from the Z-form are labeled as G2z (12.92 p.p.m.) and G4z (12.90 p.p.m.). 1D 1H-NMR

spectra at the 100% D2O condition (left panel) showing the B-to-Z transition upon addition of aklavin ([A]/[D] = 0, 0.25, 0.5, 0.75, and 1.0).

2635FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

J. H. Hur et al. Searching for a new Z-DNA inducer with SYBR green

References

1 Crawford JL, Kolpak FJ, Wang AH, Quigley GJ, van

Boom JH, van der Marel G and Rich A (1980) The

tetramer d(CpGpCpG) crystallizes as a left-handed

double helix. Proc Natl Acad Sci USA 77, 4016–4020.2 Takaoka A, Wang Z, Choi MK, Yanai H, Negishi H,

Ban T, Lu Y, Miyagishi M, Kodama T, Honda K et al.

(2007) DAI (DLM-1/ZBP1) is a cytosolic DNA sensor

and an activator of innate immune response. Nature

448, 501–505.3 Oh DB, Kim YG and Rich A (2002) Z-DNA-binding

proteins can act as potent effectors of gene expression

in vivo. Proc Natl Acad Sci USA 99, 16666–16671.4 Wang G, Carbajal S, Vijg J, DiGiovanni J and Vasquez

KM (2008) DNA structure-induced genomic instability

in vivo. J Natl Cancer Inst 100, 1815–1817.5 Rich A and Zhang S (2003) Timeline: Z-DNA: the long

road to biological function. Nat Rev Genet 4, 566–572.6 Ha SC, Choi J, Hwang HY, Rich A, Kim YG and Kim

KK (2009) The structures of non-CG-repeat Z-DNAs

co-crystallized with the Z-DNA-binding domain, hZ

alpha(ADAR1). Nucleic Acids Res 37, 629–637.7 Kim D, Hur J, Park K, Bae S, Shin D, Ha SC, Hwang

HY, Hohng S, Lee JH, Lee S et al. (2014) Distinct Z-

DNA binding mode of a PKR-like protein kinase

containing a Z-DNA binding domain (PKZ). Nucleic

Acids Res 42, 5937–5948.8 Ha SC, Lokanath NK, Van Quyen D, Wu CA,

Lowenhaupt K, Rich A, Kim YG and Kim KK (2004) A

poxvirus protein forms a complex with left-handed Z-

DNA: crystal structure of a Yatapoxvirus Zalpha bound

to DNA. Proc Natl Acad Sci USA 101, 14367–14372.9 Ha SC, Kim D, Hwang HY, Rich A, Kim YG and

Kim KK (2008) The crystal structure of the second Z-

DNA binding domain of human DAI (ZBP1) in

complex with Z-DNA reveals an unusual binding mode

to Z-DNA. Proc Natl Acad Sci USA 105, 20671–20676.10 Wu Z, Tian T, Yu J, Weng X, Liu Y and Zhou X (2011)

Formation of sequence-independent Z-DNA induced by

a ruthenium complex at low salt concentrations. Angew

Chem Int Ed Engl 50, 11962–11967.11 Gessner RV, Quigley GJ, Wang AH, van der Marel

GA, van Boom JH and Rich A (1985) Structural

basis for stabilization of Z-DNA by cobalt

hexaammine and magnesium cations. Biochemistry 24,

237–240.12 Bancroft D, Williams LD, Rich A and Egli M (1994)

The low-temperature crystal structure of the pure-

spermine form of Z-DNA reveals binding of a spermine

molecule in the minor groove. Biochemistry 33, 1073–1086.

13 Subramani VK, Ravichandran S, Bansal V and Kim

KK (2019) Chemical-induced formation of BZ-junction

with base extrusion. Biochem Biophys Res Commun 508,

1215–1220.14 Drozdzal P, Gilski M, Kierzek R, Lomozik L and

Jaskolski M (2013) Ultrahigh-resolution crystal

structures of Z-DNA in complex with Mn(2+) and Zn

(2+) ions. Acta Crystallogr D Biol Crystallogr 69 (Pt

6), 1180–1190.15 Hacques MF and Marion C (1986) DNA

polymorphism: spectroscopic and electro-optic

characterizations of Z-DNA and other types of left-

handed helical structures induced by Ni2+.

Biopolymers 25, 2281–2293.16 Chatake T and Sunami T (2013) Direct interactions

between Z-DNA and alkaline earth cations, discovered

in the presence of high concentrations of MgCl2 and

CaCl2. J Inorg Biochem 124, 15–25.17 Popenda M, Milecki J and Adamiak RW (2004) High

salt solution structure of a left-handed RNA double

helix. Nucleic Acids Res 32, 4044–4054.18 Takeuchi H, Hanamura N, Hayasaka H and Harada I

(1991) B-Z transition of poly(dG-m5dC) induced by

binding of Lys-containing peptides. FEBS Lett 279,

253–255.19 Zipper H, Brunner H, Bernhagen J and Vitzthum F

(2004) Investigations on DNA intercalation and surface

binding by SYBR Green I, its structure determination

and methodological implications. Nucleic Acids Res 32,

e103.

20 Dragan AI, Pavlovic R, McGivney JB, Casas-Finet JR,

Bishop ES, Strouse RJ, Schenerman MA and Geddes

CD (2012) SYBR green I: fluorescence properties and

interaction with DNA. J Fluoresc 22, 1189–1199.21 Sarma MH, Gupta G, Dhingra MM and Sarma RH

(1983) During B-Z transition there is no large scale

breakage of Watson-Crick base pairs. A direct

demonstration using 500 MHz 1H NMR spectroscopy.

J Biomol Struct Dyn 1, 59–81.22 Strelitz F, Flon H, Weiss U and Asheshov IN (1956)

Aklavin, an antibiotic substance with antiphage activity.

J Bacteriol 72, 90–94.

Supporting information

Additional supporting information may be found

online in the Supporting Information section at the end

of the article.

Fig. S1. The correlation between B-to-Z transition and

SG fluorescence intensity.

Fig. S2. CD spectra and fluorescence signal reduction

upon lac repressor binding.

Fig. S3. The physical characteristics of the candidate

molecules.

Table S1. Characteristics of selected compounds.

2636 FEBS Letters 593 (2019) 2628–2636 ª 2019 Federation of European Biochemical Societies

Searching for a new Z-DNA inducer with SYBR green J. H. Hur et al.