ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 1991, p. 1840-18480066-4804/91/091840-09$02.00/0Copyright © 1991, American Society for Microbiology

Genetic Analyses of Sulfonamide Resistance and Its Disseminationin Gram-Negative Bacteria Illustrate New Aspects

of R Plasmid EvolutionPETER RADSTROM, GOTE SWEDBERG,* AND OLA SKOLD

Department ofPharmaceutical Microbiology, Biomedical Center, Uppsala University,P.O. Box 581, S-751 23 Uppsala, Sweden

Received 26 December 1990/Accepted 1 July 1991

In contrast to what has been observed for many other antibiotic resistance mechanisms, there are only twoknown genes encoding plasmid-borne sulfonamide resistance. Both genes, sull and sulIl, encode a drug-resistant dihydropteroate synthase enzyme. In members of the family Enterobacteriaceae isolated from severalworldwide sources, plasmid-mediated resistance to sulfonamides could be identified by colony hybridization as

being encoded by sull, sullI, or both. The sull gene was in all cases found to be located in the newly defined,mobile genetic element, recently named an integron, which has been shown to contain a site-specificrecombination system for the integration of various antibiotic resistance genes. The sulIl gene was almostexclusively found as part of a variable resistance region on small, nonconjugative plasmids. Colonyhybridization to an intragenic probe, restriction enzyme digestion, and nucleotide sequence analysis of smallplasmids indicated that the sullI gene and contiguous sequences represent an independently occurring regiondisseminated in the bacterial population. The sullI resistance region was bordered by direct repeats, which insome plasmids were totally or partially deleted. The prevalence of sull and sullI could thus be accounted forby their stable integration in transposons and in plasmids that are widely disseminated among gram-negativebacteria.

The first R plasmids, studied in the late 1950s, mediatedsulfonamide resistance (1, 26). The biochemical mechanismof this resistance trait was later found to be the expression ofa plasmid-borne gene encoding a drug-resistant variant of thesulfonamide target enzyme, dihydropteroate synthase (35,49). Later, two different types of plasmid-mediated dihy-dropteroate synthases were recognized by restriction en-zyme digestion analysis of plasmids and by separation andcharacterization of the enzymes (39-41). Finally, the twogenes, sulI and sulII, were identified by their nucleotidesequences (31, 38).The sulI gene has almost exclusively been found on large

conjugative plasmids and located in a genetic element orig-inally observed as a transposon belonging to the Tn2J family(6, 38). Recently, this element was named an integron (36)and was shown to harbor a site-specific recombinationsystem for the integration of various antibiotic resistancegenes (30, 38). On the integron, in the vicinity of the site forthe integration of antibiotic resistance genes, there is a gene,int, encoding a polypeptide of 337 amino acids that has beenshown to be homologous to other members of the integrasefamily (28). In studies of cointegrate formation, the int genewas recently shown to be essential for site-specific recom-bination, and a crossover site was found to be identical to theresistance gene insertion site (23). There are now severalexamples of resistance genes, such as oxa-1, oxa-2, dhfrl,dhfrV, aadAl, and aadB, etc. (see Fig. 3), that are incorpo-rated into the recombination locus of the integron by thismechanism. These inserted resistance genes, as well as sulI,have been shown to possess a common promoter (38, 39).The integron could thus be regarded as a movable operon of

* Corresponding author.

antibiotic resistance genes that also carries an integrationmechanism for the addition of resistance traits.The other plasmid-borne sulfonamide resistance gene,

sulII, is frequently observed on small nonconjugative plas-mids, where it is genetically linked to a streptomycin resis-tance gene (31). In contrast, plasmid pGS05, containing sulIIand the same type of streptomycin resistance gene as thatfound on small plasmids, is a large self-transmissible Rplasmid. Furthermore, the streptomycin resistance gene inpGS05 is genetically separated from the sulII gene (31). Inhybridization experiments, two noncontiguous sequences ofpGS05 showed homology to the small nonconjugative plas-mid pBP1, possibly suggesting that a pBP1-like plasmidrecombined to form pGS05 (39). The nucleotide sequencesof sulII and its contiguous sequences in RSF1010 and pGS05were determined, but the homologous sequences endedwithout any remarkable characteristics explaining the origi-nal insertion of the gene (31).

In this work, the dissemination of sulI and sulII was

investigated and correlated to characteristics of their geneticsurroundings. The nucleotide sequences of the outer bound-aries of the conserved segment harboring sulII in fourplasmids were compared, and indications of recombinationalincorporation of sulII were found. Another approach was toinvestigate whether the sulI gene could be found in anylocation outside the newly defined integron. Finally, it wasdetermined whether plasmid-bome sulfonamide resistancecould be mediated by genes distinct from sulI and sulII.Clinical isolates from different parts of the world were

screened by colony hybridization and the determination ofsulfathiazole susceptibility. Results showed that all isolatesexpressing plasmid-mediated sulfonamide resistance hybrid-ized to sull, sullI, or both and that all isolates harboring sulIalso hybridized to the int probe.

1840

Vol. 35, No. 9

PLASMID-MEDIATED SULFONAMIDE RESISTANCE 1841

MATERIALS AND METHODS

Bacterial strains, plasmids, and phages. A collection of 339enterobacterial strains from Huddinge Hospital in Stock-holm, Sweden, was kindly provided by Carl Pahlson. Thebacteria were consecutive isolates from patients with urinarytract infections during July 1989. The 38 Shigellaflexneri and8 Shigella sonnei strains from Bangkok, Thailand, were

kindly supplied by Panida Jayanetra. The 86 sulfonamide-resistant strains of the family Enterobacteriaceae from La-gos, Nigeria, were kindly provided by Adebayo Lamikanra.Finally, 14 sulfonamide-resistant strains of Escherichia coliisolated in 1986 from day-care centers in Houston, Tex.,were kindly provided by Barbara E. Murray.The 6.3-kb plasmid pGS03B and the self-transmissible

plasmid pGS05 (approximately 100 kb), both mediating Surand Smr, were originally isolated in Stockholm (40). Thebroad-host-range plasmid RSF1010 (8.7 kb), belonging toincompatibility group Q, was originally described by Guerryet al. (14). The nonconjugative plasmid pHD148 (7.9 kb),encoding sulfonamide resistance, was supplied by Leslie A.Slaney. This plasmid was originally isolated from Haemoph-ilus ducreyi (2). Plasmids were transformed into E. coli C600(F- lacYl leuB6 supE44 thi-J thr-l tonA21 A-) (3), andpBR322 was used as a vector for cloned DNA fragments. Analidixic acid-resistant strain of E. coli C600 was used as a

recipient for conjugation. E. coli JM83 [ara A(lac-proAB)rpsL 4+80lacZ AM15] was used as a host strain for vectorspUC18 and pUC19 (52). Phages M13mpl8 and M13mpl9were used for the propagation of single-stranded DNA, andJM105 [endA hsdR4 A(lac-proAB) rpsL sbcB15 supE thi (F'lacIqZ AM15 proAB traD36)] was used as a host strain forM13 phages (52).Media and materials. The media used were LB medium

(5), twofold-concentrated YT broth (24), M9 minimal me-

dium (32), and Iso-Sensitest medium (Oxoid Ltd., Basing-stoke, United Kingdom). Sulfathiazole was from SigmaChemical Co., St. Louis, Mo., and ampicillin was from AstraLakemedel AB, Sodertalje, Sweden. Restriction endonu-cleases were from Boehringer GmbH, Mannheim, Germany,and Pharmacia LKB Biotechnology, Sollentuna, Sweden.T4 DNA ligase was from New England BioLabs, Inc.,Beverly, Mass. [a-32P]dCTP and [a-35S]dATP were fromAmersham International plc., Little Chalfont, United King-dom, and New England Nuclear, Dreieich, Germany, re-

spectively. Agarose (DNA grade) was from Bio-Rad Labo-ratories, Richmond, Calif.

Sulfathiazole susceptibility testing. One bacterial colonywas suspended in 5 ml of M9 minimal medium. A fewmicroliters of the bacterial suspension was spread to obtainsingle cells on Iso-Sensitest agar plates containing sulfathi-azole. The growth of single colonies was interpreted as

resistance to the concentration of sulfathiazole used. TheMIC was defined as the lowest concentration allowing thegrowth of no visible single colonies.DNA sequencing. Small-scale plasmid preparation was

done by the alkaline lysis method described by Sambrook etal. (32). Large-scale preparation and purification of plasmidDNA were done as described earlier (31). M13 clones forsequencing were obtained by digestion of the original plas-mids with the restriction endonucleases shown in Fig. 1,Sau3A, and TaqI. The sequencing method was the dideox-ynucleotide chain termination method of Sanger et al. (33),and a Sequenase reagent kit from U.S. Biochemical Corp.was used for elongation reactions. The reaction mixtureswere labeled with [a-35S]dATP in accordance with manufac-

turer instructions. The software package of the University ofWisconsin Genetics Computer Group was used for DNAsequence analysis (10).Colony hybridization. Overnight cultures (2 ,u) were added

to nitrocellulose membranes (Millipore) placed on Iso-Sen-sitest agar plates (14-cm diameter) for hybridization (32).The plates were incubated for 2.5 h at 37°C before alkalinetreatment. The nitrocellulose membranes were carefullyplaced on the following solutions (1.5 ml) with the bacterialcolonies upwards: 0.5 M sodium hydroxide for 7 min, 0.1 Msodium hydroxide-1.5 M sodium chloride for 10 min, 1 MTris hydrochloride (pH 7.5) two times for 2 min each time,and 0.5 M Tris hydrochloride (pH 7.5)-1.5 M sodium chlo-ride for 4 min. Between each operation, the filters wereplaced on Whatman 3MM filter paper. After the last treat-ment, the filters were dried for 30 min at 37°C and baked ina vacuum oven at 80°C for 60 min. The hybridization andfilter washes were performed as described by Perbal (29).Prehybridization and hybridization were done in slowlyrotating tubes at 42°C. The filters were washed two times in1 liter of each of the following buffer solutions at 68°C for 30min: 2x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodiumcitrate [pH 7.0])-0.2% sodium dodecyl sulfate (SDS), lxSSC-0.2% SDS, and 0.1x SSC-0.2% SDS. The DNA probeswere labeled with [ot-32P]dCTP with a randomized hexanu-cleotide primer kit from Pharmacia LKB Biotechnology. Asa probe for sulI an intragenic 0.66-kb SacII-BglII fragmentwas utilized. The sullI probe consisted of a 0.78-kb Hincllfragment representing a major part of the gene. The thirdprobe was made of the 1.17-kb BamHI-RsaI fragment fromthe region harboring the int gene.

RESULTS

Restriction maps of plasmids carrying the sullI gene. Thesmall multicopy plasmids RSF1010 and pBP1 share anidentical resistance region encoding sulfonamide and strep-tomycin resistance (46). At least parts of the same resistanceregion are found on other plasmids belonging to differentincompatibility groups (31). However, the resistance deter-minant for sulIlI has not been associated with a transposon,and the mechanism responsible for the spread of this gene isunknown. To find evidence for a recombinational eventassociated with sulII, we studied the nucleotide sequences atthe ends of the common resistance regions in several plas-mids. First, the previously published restriction endonucle-ase cleavage maps of the plasmids involved in this studywere refined to show where the sequences could be expectedto diverge. The sulII gene and its contiguous regions inpGS05, pHD148, RSF1010, and pGS03B are shown in Fig. 1.The restriction endonuclease maps of pGS05, RSF1010, andpGS03B are based on the previously determined nucleotidesequence of the sulII gene (31). Plasmid pGS03B was, asdetermined by detailed restriction endonuclease mapping,identical to pBP1. The locations of restriction sites for PstI,AvaI, HincII, EcoRI, Sacl, BglI, and HpaI showed absoluteidentity with the known restriction map of pBP1 (46, 47).The current map of pGS05 includes a new BamHI site,which forms one end of the originally isolated 6.1-kb BamHIfragment (31). The map of pGS03B has been extended byEcoRV, PvuII, and HinclI sites downstream from the strep-tomycin resistance genes. The restriction sites of pHD148,mainly from Willson et al. (48), have been slightly adjustedand include two SspI sites and an extra PstI site. The geneticmap of RSF1010 is based on the complete nucleotide se-quence of 8,684 bp determined by Scholtz et al. (34). Figure

VOL. 35, 1991

ANTIMICROB. AGENTS CHEMOTHER.

Sul N recISulInXrepm

B/mobA--I

Iii a.Q_ 46_ COIL >o

RSF 1010repC sul 11 strA strB

0.Q_.I(I)Cb W.cO

I CL UJ I COcCO a.X CLI

pGS03B(PBPB1)sul 11 strA strB

AA

AB

1.0 2.0 3.0

oriT

oriV mobC repB/mobA mobB

CcIr

AC

4.0 kbFIG. 1. Genetic and physical maps of the resistance regions containing sulII in pGS05, pHD148, RSF1010, and pGS03B. Vertical lines

between the maps represent homologous DNA segments. The triangles designated A, B, and C indicate the positions of the nucleotidesequences shown in Fig. 2. Solid lines below the maps show the sequenced regions, and broken lines represent previously publishedsequences (31). The genetic map of RSF1010 is from Scholtz et al. (34). Abbreviations: sulll, type II sulfonamide resistance dihydropteroatesynthase gene; repB and repC, genes encoding replication functions; mobA and mobB, genes involved in mobilization; oriV, origin ofvegetative replication; oriT, origin of transfer; strA apd strB, streptomycin resistance genes.

1 shows 8 of the 11 known genes found in RSF1010,including the previously characterized sulIlI. Notably,RSF1010 and probably pGS03B contain two genes specify-ing streptomycin resistance. The strA gene downstream ofsulII is the earlier observed aminoglycoside phosphotrans-ferase [APH-(3")] (19), and the other gene, strB, showshomology with a str gene found in transposon Tn5 (34).

Evidence for a recombinational mechanism involved in thedissemination of sullI. The identical resistance region inpBP1 and RSF1010 was estimated to be 3 kb in length (46).To identify the exact points of DNA sequence divergencebetween pGS03B and RSF1010, we sequenced the outerboundaries' of the resistance region in pGS03B and comparedthe sequence with the published sequence of RSF1010 (34).Figure 2A shows 180 bases 5' of the sulII gene in pGS03Bthat included a breakpoint at position 247. The point ofsequence divergence 3' of the resistance genes was found atposition 3488 (Fig. 2C). Thus, the exact length of the

commop resistance region in pGS03B and RSF1010 was3,242 bases. The extent and location of the region are shownin Fig. '1. Comparison of the sequences at the en4s of thehomologous element provided no explanation of the recom-binational mechanism involved. Restriction mapping indi-cated that the homology among RSF1010, pGS05, andpHD148 extended further 5' of sulII than did the homologybetween RSF1010 and pGSO3B (pBP1). Figure 2A showsthe sequence of the promoter region, including points ofsequence divergnnce in pHD148' pGS05, RSF1010, andpGS03B. The breakpoints were rather sharp amongpHD148, pGS05, and RSF1010 and very close to theRSF1010 repC gene (stop codon at position 33 in Fig. 2A),which encodes a positively acting initiation factor for DNAreplication. The point of DNA divergence downstream ofsulII in RSFlQlO, pHD148, and pGS05 was more diffuse(Fig. 2B). Surprisingly, the sequences 3' of sulII in pHD148and pGS05 were identical beyond the end of the sequence

pGS05

pHD 148

c

00.

0

._

1842 RADSTROM ET AL.

VOL. 35, 1991 PLASMID-MEDIATED SULFONAMIDE RESISTANCE 1843

A . . . . 50. 100.pHD148 TGTCATGGCTGATCTCCAAACATATCAAGCGTGTCTGT CCCACTCI TTGTAAACAAGACATTTTTATCTTTTATATTCAATGGCTTATTTTCCTGCTAATTGGTAAT

EcoRI - - -------- --------------------------------------------------------------

pGS05 GAATTCCCAG TCCCACTCIATTGTAAACAAGACATTTTTATCTTTTATATTCAATGGCTTATTTTCCTGCTAATTGGTAAT

RSF1O10 AGTACGACATCACCCGGCCCAAGGCGGCAGGCTGACCCC TCGATTTAAACAAGACATTTTTATCTTTTATATTCAATGGCTTATTTTCCTGCTAATTGGTAAT

...SspI. . . Pst.I . * 200.35 prmot*r5 -10ACCATGAAAAATACCATGCTCAGAAAAGGCTTAACAATATTTTGAAAAATTGCCTACTGAGCGCTG i CACAGCTCCATAGGCCG TTTCC GCTTTGCTTCCAGATG ATGC TC-------S------------------------SspI---------------------------- ___________________ _____. -----_ACCATGAAAAATACCATGCTCAGAAAAGGCTTAACAATATTTTGAAAAATTGCCTACTGAGCGCTGC CACAGCTCCATAGGCCG TTTCC GCTTTGCTTCCAGATG ATGCT TC-----------------------------------S3pI--------------------------- ------------__________________ ___-_____________- _ACCATGAAAAATACCATGCTCAGAAAAGGCTTAACAATATTTTGAAAAATTGCCTACTGAGCGCTG CACAGCTCCATAGGCCG GTTCCCTTTGCTTCCAGATG ATGC? TC

pGS03B AAAAAGATAAATATATCTACTTATTGAGAGATGATATATTTATTTCCAAAATGCTACA,A

-35 prOmter6 -10P-%tI. 250. 300. .... 350.

TGCTCCTGCAGCTAATGGATCACCGCAAACAGGTTACTCGCCTGGGG TCCC TCGACCCGAGCATCCGCrATGA CTCATGCTCGATTATTATTATTATAGAA CCCATGAATAA-___-PstI------------------ -------------------- ___________

TGCTCCTGCAGCTAATGGATCACCGCAAACAGGTTACTCGCCTGGGGA TTCCC TCGACCCGAGCATCCGCTATG4G CTCATGCTCGATTATTATTATTATAGAA CCCATGAATAA-----P.tI---------------------_-------------------- -------------- -----------------------_______________________-______TGCTCCTGCAGCTAATGGATCACCGCAAACAGGTTACTCGCCTGGGGA TCCC TCGACCCGAGCATCC TATCA CTCATGCTCGATTATTATTATTATAGAA CCCATGAATAA

TACATCATCATGAAACGGATCACCGCAAACAGGTTACTCGCCTGGGGA TCCC TTCGACCCGAGCATCC ATG CTCATGCTCGATTATTATTATTATAGAA CCCATGAATAAsUlII-->

B EcoRI HpaI . . . . 1200. . . . . 1250. SspIpHD 148 GAATTCGTTAACTGCACATTCCGGCATATTTCTCTATiTTCGCCCCTTCAGCAGGCATGTCCCCTTTGAGGGCCACCCGACGACAGGATAATCGACCTTATGGTGCCCCAAATA

EcoRI-HpaI-------------------------------------------------------------------------------------------------SspIpGS05 GAATTCGTTAACTGCACATTCGGGATATTTCTCTATATTCGCGGTTCAGCAGGCATGTCCCCTTTGAGGGCGACCCGACGACAGGATAATCGACCTTATGCTGCGCAAATA

EcoRI-HpaI-------------------------------- ------- SspI - -RSF 10 10 CGAATTCGTTAACTGCACATTCGGGATATTTCTCTATATTCGCGCTTCATCAGAAAACTGAAGGAACCTCCATTGAATCGAACTAATATTTTTTTTGGTGAATCGCATTCTG

sulII ----SspI------------ --------

pAZ1 AACTAATATTTTTTTTGGTGCCTCGCATTCATC=

1300. . . . . 1350.TTTCGGCACAGACGGTATTCGTCCCAAAGCCAACGAAGCGCCCCATGACGCGGCAAACCGCCCTGCCCCTTCGGCCTATCTTTAGCCCCCCTCCGGCTGGCCATGCTCCTGTGCCCTGCTGTTTC--------------------------------_ ______---------------------- -- - - - - - - BsLEII - -TTTCCGCACAGACGGTATTCGTGGCAAAGCCAACGAAGCGCCCCATGACGCGGCAAACCGCCTTGCGCGCTCGGCATGCGGCCTGCCGCTGTCTTTCGTCGCCCCTGACCACCGCCATCGTCT

- - - ---- - -.----- - -- - - -- - - -- -- SacIACTGGTTGCCT5TCAGAGCGGCAGAATCTCGGTCATTTTGTTTTTCGACGTGGTGACGGGCATGCCTTCGCGAAAATCGCACCTGCTTCCCGCCGCGGCTGAGCTCGCTGGAGACCCTGACC

GCCCCTGGATACGGGTTGTGTCTGGGGTAATCAGCTCACGCTCTGCGCATGGGATGATGATGCCATCTTCAGCCTGGGTTGCCCCCATGTACGCCAAAGGTGACTAATCCGCTCAACAGAGC=3

C 3400. * * * * 3450. . * * 3500.RSF 1010 TACAGTCTATCGCTTAGCGGAAAGTTCTTTTACCCTCAGCCGAAATGCCTGCCGTTGCTAGACATTGCCAGCCAGTGCCCGTCA TCCCTACTAACTGTCACGAACCCCT

pGS03B TACAGTCTATCGCTTAGCGGAAAGTTCTTTTACCCTCAGCCGAAATGCCTGCCGTTGCTAGACATTGCCAGCCAGTGCCCGTCA CCCACTC ACATTGTTCGCAGTAT

*0 0 1. . oriV . 3600.GCAATAACTGTCACGCCCCCCCTGCAATAACTGTCACGAACCCCTGCAATAACTGTCAcCGCCCCCAAACCTGCAAACCCAGCAGGGCGGGGGCCTGCGGGGCTGTTGGAAAAATCCATCCA

CTAGGTACATGTTATTGCGTGCACCTTCATGATGTATAATGTTATTAATGACAGCAGAAAGATC

FIG. 2. Comparison of the nucleotide sequences at the outer ends of the resistance regions containing sullI (Fig. 1). (A) Region upstreamof sulII, including promoters in pHD148, pGS05, RSF1010, and pGS03B. (B) Region downstream of sulII, beginning with the common EcoRIsite in pHD148, pGSO5, and RSF1010. The comparison includes pAZ1, the sequence of which is from Fling et al. (12). (C) Region downstreamof strB in RSF1010 (34) and pGS03B. Closed and open arrows show repeats at the points of sequence divergence. Thin arrows representinverted and direct repeats outside the resistance regions. Boxed nucleotides indicate nucleotide differences, promoter regions, and outerends of resistance determinants.

homologous with RSF1010 and continued for another 128 only TCCC was left in the repeat. The length of the sequencebases. This result indicated a closer relationship between the between repC and oriV, the origin of vegetative DNAresistance determinants in pHD148 and pGS05 than between replication, would only be 20 bp if the proposed resistanceeither of these resistance determinants and the one in element were deleted from RSF1010 with its outer ends. ThisRSF1010. The sharp breakpoints upstream of sulII in Fig. 2A 20-bp sequence could be thought to have acted as a targetand the breakpoints downstream of strB in pGS03B con- sequence for the incorporation of the resistance region intained a direct repeat of 9 bp. The sequence TCCCACTCT RSF1010, and the direct repeat sequences could be a reflec-was found in the sequence upstream of sulII in pHD148 and tion of the original insertion of the resistance determinant.pGS05 and in the sequence downstream of strB in pGS03B. The fact that pGS03B lacks the common direct repeatIn RSF1010, the sequence upstream of sulII was changed to upstream of sulII could be explained by a secondary deletionCCCCATCT, and at the breakpoint downstream of strB, of the true end. Another IncQ plasmid, pAZ1, mediating

ANTIMICROB. AGENTS CHEMOTHER.

trimethoprim and sulfonamide resistance, is homologous toRSF1010, except for a substitution of the str region with thedhfrIII gene, specifying a trimethoprim-resistant dihydrofo-late reductase (12). The sequence downstream of sullI inpAZ1 differed from those in pGS05 and pHD148 but was

homologous to part of the RSF1010 sequence (Fig. 2). Thepoint at which RSF1010 and pAZ1 diverged contained a 9-bpsequence identical to the one found at the end of theresistance determinant in RSF1010 (TCCCGTACT), but inthe inverse orientation (Fig, 2). The similarity between thedirect repeat sequences mentioned above and the 9-bpsequence at the breakpoint downstream of sulII in pAZ1could be a reflection of a common recombinational mecha-nism.

Nucleotide sequence differences in the promoter region.Four differences in the nucleotide sequences of the threeplasmids were found in the promoter region upstream ofsulII. The first was an A instead of a C in pHD148 at position178, explaining the extra PstI site in the conserved sulIIregion in pHD148 (Fig. 1). The second base difference was a

C in RSF1010 instead of an A in pHD148 and pGS05 atposition 227, after the conserved -10 hexamer of promoterP5. The third nucleotide shift was a T instead of a G inRSF1010 at position 307, located within the -10 hexamer ofpromoter P6; this change created weaker promoter se-

quences in pHD148, pGS05, and pGS03B, as compared withthat in RSF1010 and the E. coli consensus promoter se-

quence (15). The last base change, at position 338, was

within the ribosome binding sequence of sulII. The changewas a T instead of a C in pHD148. To determine whetherthese changes had any influence on the expression of resis-tance to sulfonamides, we transformed the four plasmidsinto the E. coli K-12 strain C600 and tested them on platescontaining 1, 5, 10, or 20 mM sulfathiazole. All four trans-formants could grow easily on 5 mM drug and only as smallcolonies on 10 mM drug, indicating that the observed se-

quence differences did not affect the expression of resis-tance.

Investigation of plasmid-borne sulfonamide resistance ingram-negative bacteria. To investigate plasmid-mediated sul-fonamide resistance, we collected consecutive clinical iso-lates from patients with urinary tract infections in HuddingeHospital in Stockholm. A total of 339 gram-negative bacteriawere tested for drug susceptibility by growth on Iso-Sensit-est agar plates containing a very low concentration (0.05mM) of sulfathiazole, and 190 strains grew on these plates(Table 1). These 190 strains were used for colony hybridiza-tion performed in duplicate with DNA probes for sull, sulII,and int (Fig. 3). Notably, 133 of the 190 strains did nothybridize to either the sulI or the sulIf probe; thus, 70% ofthe strains that could grow on 0.05 mM sulfathiazole lackedthe two known types of plasmid-encoded dihydropteroatesynthases. All 190 strains were tested with higher concen-

trations of sulfathiazole (0.1 and 0.5 mM) to determine theirlevels of resistance. Of the 133 strains that did not hybridizeto the sulI or sulII probe, 24 grew on plates containing 0.1but not 0.5 mM sulfathiazole. Plasmid DNAs from these 24strains were isolated, but attempts to transform E. coli C600to sulfathiazole resistance failed. Attempts to transfer sulfo-namide resistance by conjugation also failed. Thus, it is notlikely that the 24 strains expressed plasmid-mediated sulfa-thiazole resistance. On the basis of the pattern shown inTable 1, 57 strains hybridized with the sul probes. Of these,34 strains contained sulII and 31 strains harbored sulI,making the distribution of the two genes in this collectionapproximately equal. Furthermore, all strains expressing

TABLE 1. Hybridization properties and sulfathiazolesusceptibilities of clinical isolates of the familyEnterobacteriaceae collected in Stockholma

Hybridizationtoc: Susceptibility toNo. of Hybridization to: sulfathiazole atd:isolates'

sulI int sulII 0.1 mM 0.5 mM

24 - _ + + +23 + + - + +8 + + + + +1 - - + _ _1 - + + + +

24 - _ _ +109

190 31 32 34 80 56a Numbers in the last row represent total numbers.b A total of 190 of 339 consecutive gram-negative urinary tract isolates were

selected by growth on 0.05 mM sulfathiazole.cFigure 3 describes the probes used.d Based on single-cell growth on Iso-Sensitest agar plates containing 0.1 and

0.5 mM sulfathiazole.

high-level sulfonamide resistance (MIC, >0.5 mM sulfathi-azole) contained sulI, sulIl, or both. However, one of thestrains containing the sullI gene or part of the gene ex-pressed a very low level of resistance (MIC, 0.05 mM).Notably, all strains containing sulI hybridized to the intprobe, indicating that the sulI gene is strongly linked to theintegron. Interestingly, one of the int-positive strains did nothybridize with the sulI probe; instead, it hybridized with thesulII probe.A collection from Bangkok of 46 Shigella isolates that

expressed high-level sulfonamide resistance was examinedfor the presence of sulI, sulII, and int (Table 2). Thedissemination patterns of the two sulfonamide resistancegenes were similar to that observed in the collection fromStockholm, except for a surprisingly high percentage of int-and sulII-positive strains (28 of 46). Also, in the strains fromBangkok, high-level resistance to sulfonamides (MIC, >0.5mM sulfathiazole) could be accounted for by the presence ofsull, sullI, or both. Table 3 shows the sul patterns for 14strains of E. coli isolated in Houston. There was an equaldistribution of sulI and sulII, and many of the strainscontained both resistance markers (8 of 14). The final bac-terial collection was from Lagos and contained 86 strains ofthe family Enterobacteriaceae (Table 4). An equal preva-lence of sulI and sulII, a constant association between sulIand int, and a complete absence of strains carrying nontype-able resistance to sulfonamides made the Lagos collectionsimilar to those from Stockholm, Bangkok, and Houston.To determine whether the relatively large number of int-

and sulII-positive Shigella strains from Bangkok representeda linkage between type II sulfonamide resistance and theintegron, we chose 1 strain from Stockholm and 11 strainsfrom Bangkok for plasmid analysis. Plasmid DNAs from theoriginal strains were isolated and electrophoresed (Fig. 4A).The plasmid patterns revealed the presence of more than oneplasmid in all 12 strains. The isolated plasmids from thestrains were transformed into E. coli C600, and the transfor-mants were spread on Iso-Sensitest agar plates containingsulfathiazole (0.5 mM). By electrophoresis, the presence ofone single type of plasmid harboring sulII was demonstratedin each clone of the transformants (Fig. 4A). The originalstrains and the transformants were hybridized with the sulIland int probes (Fig. 4B, C, and D). The int and sulII genes

1844 RADSTROM ET AL.

PLASMID-MEDIATED SULFONAMIDE RESISTANCE 1845

I

I a dhftrlll

0.78kb probe strA,strBHis 2su_l.

sul 11

mEco Coa: cI) ma

cc-*1.17kb probe -

| orf 1 f066kb probe|

int aadA1, aadA2 sul I

aadB, aacAl,aacA4, aacCl,dhfrl, dhfrilb,dhfrllc, dhfrV,oxal, oxa2,pse2

ccO" mll"m ---

FIG. 3. Genetic organization of the regions containing sulII and sulI. Heavy lines and hatched boxes indicate conserved segments of thetwo resistance elements harboring the sul genes. The open box downstream of sullI represents other resistance genes, such as dhfrIII (12)and strA and strB (34). The open box between int and sulI represents the site-specific locus for the integration of other antibiotic resistancegene cassettes, such as aadAl (16, 38), aadA2 (43), aacAl (44), aacA4 (45), aacCl (50), aadB (7), dhfrI (37), dhfrllb (42, 53), dhfrlIc (11),dhfrV (38), oxa-I (27), oxa-2 (8), and pse-2 (18). The probe fragments are shown between relevant restriction sites. IR, inverted repeats of25 bp.

were located on different plasmids in all 12 strains. Further-more, the plasmids harboring sulII seemed to be of the samesize in all 12 strains, and the plasmid pattern for the Bangkokstrains was more or less identical to that of the repre-sentative strain shown in Fig. 4A. The reason for the largenumber of strains with int and sulII could thus be explainedby a clonal expansion of one particular strain of S. flexneri.Eight of the 12 plasmids harboring sulII were digested withAvaI and HinclI, and 6 of these plasmids, including theplasmid from Stockholm, showed identical bands after re-striction endonuclease digestion and agarose gel electropho-resis. Restriction cleavage with AvaI revealed four commonfragments (1.8, 1.7, 1.4, and 1.1 kb). HinclI digestion alsorevealed four common fragments, of approximately 2.7, 2.1,0.8, and 0.7 kb. Comparison with other small R plasmidsrevealed that the six related plasmids had the same restric-tion endonuclease sites as pGS03B (pBP1) for AvaI andHinclI, indicating that the small sulII-carrying plasmid foundhere was pBP1. In fact, Korfmann et al. (20) have demon-strated that the resistance of about one-third of the strepto-

TABLE 2. Sulfonamide resistance patterns of S. flexneriand S. sonnei isolates collected in Bangkoka

No. of Hybridization to':isolates' suil it suill

1 - - +8 + + _9 + + +

28 - + +

46 17 45 38

a See Table 1, footnote a.b Shigella spp. for which the MIC of sulfathiazole was >0.5 mM.See Table 1, footnote c.

mycin-resistant strains of E. coli all over the world ismediated by APH-(3") and that 80% of these strains harborpBP1.

DISCUSSION

Sulfonamides, the first drugs found to suppress bacterialinfections, were soon displaced by penicillin and otherantibiotics, partly because of the emergence of sulfonamide-resistant bacteria. The main reason for the development ofthis resistance in gram-negative bacteria was the establish-ment of sulfonamide resistance determinants on R plasmids.Hughes and Datta (17) have shown that of 433 strains of thefamily Enterobacteriaceae collected by E. D. G. Murrayfrom 1917 to 1954, not 1 expressed resistance to sulfona-mides. Thus, the intensive use of sulfonamides since theirintroduction in the 1930s probably stimulated the evolutionof R plasmids carrying this resistance.The first plasmids containing the sulfonamide-resistance

determinant sulII were recognized in a collection of Salmo-

TABLE 3. Sulfonamide resistance patterns of E. coli isolatescollected in Houston'

No. of Hybridization to':isolates' sulI int sulll

1 - - +3 + +8 + + +2 - + +

14 11 13 11

"See Table 1, footnote a.E. coli for which the MIC of sulfathiazole was >0.5 mM.

'See Table 1, footnote c.

VOL. 35, 1991

ANTIMICROB. AGENTS CHEMOTHER.

TABLE 4. Sulfonamide resistance patterns of isolates of thefamily Enterobacteriaceae collected in Lagosa

No. of Hybndization toc:isolatesb sull int sulI

18 -+24 + + -41 + + +3 - + +

86 65 68 62a See Table 1, footnote a.b Isolates of the family Enterobacteriaceae for which the MIC of sulfathi-

azole was >0.5 mM.c See Table 1, footnote c.

nella typhimurium strains in the 1960s (21). Plasmid R300B,isolated from one of the strains, was later shown to beidentical or closely related to RSF1010 (13). Notably, nineother strains were found to harbor plasmids related to butnot identical to R300B, with degrees of homology of 80 to93% (4). In this paper, the sulIlI region in four plasmids wasanalyzed. Two of the plasmids, pHD148 and RSF1010,belonging to incompatibility group Q and isolated fromdifferent bacterial species, are homologous, except for re-gions on both sides of sulII, as demonstrated by heterodu-plex mapping (2). At the nucleotide sequence level, how-

ever, the replicon parts of the two plasmids are not identical.Part of repB has been sequenced in pHD148 and comparedwith repB in RSF1010 (see Fig. 1 for the determined region).The observed sequence divergence in repB of RSF1010 andpHD148 (Fig. 5) indicates two related but not identicalreplicons. Probably, IncQ plasmids have existed separatelyin different bacterial species for a long time. Otherwise, onewould expect, as has been suggested (4, 46), that a singleIncQ plasmid containing sulII has spread efficiently aroundthe world and created the RSF1010-like plasmids of today.Therefore, it seems most likely that the resistance regionfound in pHD148 and RSF1010 has been independentlyintegrated into two distinct plasmids. Furthermore, thehomology downstream of sulII extends further in pGS05 andpHD148 than it does between either of these plasmids andRSF1010, showing that pHD148 harbors a resistance regionwhich is more related to that of pGSO5. Plasmids pGS03Band pGS05 are totally unrelated to those of the IncQ group.The appearance of sullI in all these different plasmids couldonly be explained by recombinational spread. As a possibleconsequence of this presumed recombination, a 9-bp directrepeat was found at the outer boundaries of the resistancedeterminants. The 9-bp direct repeat was observed at thebreakpoints among pHD148, pGS05, and pGS03B (Fig. 2),but in no case was it completely conserved at both ends. Ithas been suggested that small nonconjugative plasmids aresometimes fused with self-transmissible plasmids during

P346 C600 P347 EOG PM c.

P357 C600 P360 C600 P344 C"0(P357) (P360) (P364)

PM C60O P371 C600 P373 C6"(P366) (P371) (37f1)

(014P76:C600tI 37 4)0 (1p341

R2S5C6000 ;

FIG. 4. Analysis of sulII- and int-positive strains. (A) Agarose gel electrophoresis (0.7%) of isolated plasmids from one representativeBangkok strain harboring sulIl and int and the single sulII- and int-positive strain from Sweden. Lanes: 1, plasmids from the Shigella strainisolated in Bangkok (P360); 2, plasmid harboring sulII in P360; 3, plasmids from the strain isolated in Stockholm (H255) showing int- andsulII-positive hybridization (Table 1); 4, plasmid harboring sullI in H255. (B) Nitrocellulose membrane used for colony hybridization of 12int- and sullI-positive strains and the transformants (C600) harboring the plasmid containing sulII. The transformants are to the right of eachoriginal strain (P, strains from Bangkok; H, strain from Stockholm). (C) Autoradiography of the filter with the sulII probe. (D)Autoradiography of the filter with the int probe.

1846 RADSTROM ET AL.

PLASMID-MEDIATED SULFONAMIDE RESISTANCE 1847

pHD148 --- --C --- C-- --C --- -GG -C- --- --C --- --- ---

RSF1010 TCC GGG CAC ATG CCG GAG TTC GTC GAG CGG CCC GCC GAC 168

___--- --- --- --- --- --- --- --- --- --- --- ---

169 TAC TGG GAT GCT GCC GAC CTG TAT GAA CGC GCC AAT GGG 207

--- --- --- --A--- --T --G --- --- --- --- --- --A208 CGG CTG TTC AAG GAG GTC GAA TTT GCC CTG CCG GTC GAG 246

--- --- --A --T --- --- CG- -A- --- -T- GA- --A ---

247 CTG ACC CTC GAC CAG CAG AAG GCG CTG GCG TCC GAG TTC 285FIG. 5. Comparison of the sequence of part of repB in pHD148 with the sequence in RSF1010 (34). Differences in the sequence of repB

in pHD148 are indicated above the corresponding sequence in RSF1010. Nucleotide A in the start codon (ATG) is number 1.

mobilization (14) and that oriT, the origin of transfer, isinvolved in this fusion of plasmids (9). In fact, pGS05 couldbe a plasmid containing stably integrated parts of a smallsulII-containing plasmid.The sulI gene also seems to have appeared soon after the

introduction of sulfonamides. The first example of a plasmidcarrying the sulI gene was R100 (originally called 222 orNR1), which was isolated in Japan in 1958 (25, 51). The sulIgene has recently been sequenced and characterized in trans-poson Tn2J and in IncW plasmid R388 (38), and it occurs aspart of a distinct element called an integron (30, 36, 38). Theouter boundaries of the integron could be the inverted repeatsof 25 bp at the ends of the 11.2-kb sulfonamide-streptomycinresistance element found within Tn2J (6, 30).Our results showed that sulI always seemed to be local-

ized within an integron. Of 124 sulI-containing isolates fromStockholm, Bangkok, Houston, and Lagos, all containedsequences homologous to the int probe. The disseminationof sulI on R plasmids obviously relies on the stable locationof sulI in an integron. The integron also gives the bacteria anefficient system for acquiring other types of antibiotic resis-tance genes (Fig. 3). The selective advantage obtained by theacquisition of other inserted resistance genes must havecontributed to the spread of sulI. Most known trimethoprimresistance genes are found on sulI-carrying integrons. Thegenetic linkage between several dhfr genes and sulI could beseen as a bacterial response to the frequent use of thecombination of trimethoprim and various sulfonamides. Themechanism for the mobility of the integron is still unex-plained, but at least four different ways to distribute theintegron are possible. The first is the mobility of the integronitself, as indicated by its different genetic locations (30, 36,38). Second, the integron could be distributed by integrationinto transposons belonging to the Tn2J family. The thirdpossibility is the horizontal transfer of the integron via Rplasmids, such as IncW plasmids pSa and R388. The lastmechanism of spread could be through compound trans-posons. Recently, a compound transposon (Tn6JO) wasfound in Mycobacterium fortuitum and determined to carrypart of the integron, including sulI and two flanking IS6-likeinsertion sequences (IS6100) (22). In conclusion, the sulIgene, located within the integron, has powerful mechanismsfor dissemination.

Notably, the sulII gene seems to have mechanisms ofdissemination as efficient as those of sulI, because thefrequencies of strains harboring sulI or sulII proved to bemore or less identical (Tables 1, 3, and 4), except for theBangkok collection (Table 2). The frequency of strainscontaining sulI or sulII among gram-negative bacteria iso-lated from patients with urinary tract infections in Stock-

holm was approximately 10% (31 or 34 of 339, respectively),a value which is quite high with regard to the limited use ofsulfonamides in Sweden. Also, of the strains carrying neithersulI nor sulII, a substantial number showed a low level ofresistance to sulfonamides. The clinical significance of thislow-level resistance, which is probably chromosomally me-diated, is unclear. In conclusion, only two genes, sulI andsullI, were found to be responsible for plasmid-borne sulfo-namide resistance. This result could be explained by thegenetic localizations of these genes on very efficient vehiclesfor dissemination.

ACKNOWLEDGMENTS

We thank Kristina Lundberg for technical assistance.This work was supported by a grant from the Swedish Medical

Research Council to Ola Skold and Gote Swedberg.

REFERENCES1. Akiba, T., K. Koyama, Y. Ishiki, S. Kimura, and T. Fukushima.

1960. On the mechanism of the development of multiple-drug-resistant clones of Shigella. Jpn. J. Microbiol. 4:219.

2. Albritton, W. L., J. L. Brunton, L. Slaney, and I. MacLean.1982. Plasmid-mediated sulfonamide resistance in Haemophilusducreyi. Antimicrob. Agents Chemother. 21:159-165.

3. Bachmann, B. J. 1972. Pedigrees of some mutant strains ofEscherichia coli K-12. Bacteriol. Rev. 36:525-557.

4. Barth, P. T., and N. J. Grinter. 1974. Comparison of thedeoxyribonucleic acid molecular weights and homologies ofplasmids conferring resistance to streptomycin and sulfona-mides. J. Bacteriol. 120:618-630.

5. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phageliberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300.

6. Brown, N. L., T. K. Misra, J. N. Winnie, A. Schmidt, M. Seiff, andS. Silver. 1986. The nucleotide sequence of the mercuric resistanceoperons of plasmid R100 and transposon Tn501: further evidencefor mer genes which enhance the activity of the mercuric iondetoxification system. Mol. Gen. Genet. 202:143-151.

7. Cameron, F. H., D. J. G. Obbink, V. P. Ackerman, and R. M.Hall. 1986. Nucleotide sequence of the AAD(2") aminoglycosideadenylyltransferase determinant aadB. Evolutionary relation-ship of this region with those surrounding aadA in R538-1 anddhfrII in R388. Nucleic Acids Res. 14:8625-8635.

8. Dale, J. W., D. Godwin, D. Mossakowska, P. Stephenson, and S.Wall. 1985. Sequence of the OXA2 P-lactamase: comparisonwith other penicillin-reactive enzymes. FEBS Lett. 191:39-44.

9. Derbyshire, K. M., G. Hatfull, and N. Willetts. 1987. Mobiliza-tion of the nonconjugative plasmid RSF1010: a genetic andDNA sequence analysis of the mobilization region. Mol. Gen.Genet. 206:161-168.

10. Devereux, J., P. Haeberli, and 0. Smithies. 1984. A comprehen-sive set of sequence analysis programs for the VAX. NucleicAcids Res. 12:387-395.

11. Flensburg, J., and R. Steen. 1986. Nucleotide sequence of the

VOL. 35,1991

ANTIMICROB. AGENTS CHEMOTHER.

trimethoprim resistant dihydrofolate reductase encoded by Rplasmid R751. Nucleic Acids Res. 14:5933.

12. Fling, M. E., J. Kopf, and C. Richards. 1988. Characterizationof plasmid pAZ1 and the type III dihydrofolate reductase gene.Plasmid 19:30-38.

13. Grinter, N. J., and P. T. Barth. 1976. Characterization of SmSuplasmids by restriction endonuclease cleavage and compatibilitytesting. J. Bacteriol. 128:394-400.

14. Guerry, P., J. van Embden, and S. Falkow. 1974. Molecularnature of two nonconjugative plasmids carrying drug resistancegenes. J. Bacteriol. 117:619-630.

15. Harley, C. B., and R. P. Reynolds. 1987. Analysis of E. colipromoter sequences. Nucleic Acids Res. 15:2343-2361.

16. Hollingshead, S., and D. Vapnek. 1985. Nucleotide sequenceanalysis of a gene encoding a streptomycin/spectinomycin ade-nyltransferase. Plasmid 13:17-30.

17. Hughes, V. M., and N. Datta. 1983. Conjugative plasmids inbacteria of the 'pre-antibiotic' era. Nature (London) 302:725-726.

18. Huovinen, P., S. Huovinen, and G. A. Jacoby. 1988. Sequence ofPSE-2 ,-lactamase. Antimicrob. Agents Chemother. 32:134-136.

19. Kawabe, H., T. Tanaka, and S. Misuhashi. 1978. Streptomycinand spectinomycin resistance mediated by plasmids. Antimi-crob. Agents Chemother. 13:1031-1035.

20. Korfmann, G., W. Ludtke, U. van Treeck, and B. Wiedemann.1983. Dissemination of streptomycin and sulfonamide resistanceby plasmid pBP1 in Escherichia coli. Eur. J. Clin. Microbiol.2:463-468.

21. Lawn, A. M., G. G. Meyneli, E. Meynell, and N. Datta. 1967.Sex pili and the classification of sex factors in the Enterobac-teriaceae. Nature (London) 216:343-346.

22. Martin, C., J. Timm, J. Rauzier, R. Gomez-Lus, J. Davies, andB. Gicquel. 1990. Transposition of an antibiotic resistanceelement in mycobacteria. Nature (London) 345:739-743.

23. Martinez, E., and F. de la Cruz. 1990. Genetic elements in-volved in Tn21 site-specific integration, a novel mechanism forthe dissemination of antibiotic resistance genes. EMBO J.9:1275-1281.

24. Muller-Hill, B., L. Crapo, and W. Gilbert. 1968. Mutants thatmake more lac repressor. Proc. Natl. Acad. Sci. USA 59:1259-1264.

25. Nakaya, R., A. Nakamura, and Y. Murata. 1960. Resistancetransfer agents in Shigella. Biochem. Biophys. Res. Commun.3:654-659.

26. Ochiai, K., T. Yamanaka, K. Kimura, and 0. Sawada. 1959.Inheritance of drug resistance (and its transfer) between Shi-gella strains and between Shigella and E. coli strains. Nippon IjiShimpo 1861:34.

27. Ouellette, M., L. Bissonnette, and P. H. Roy. 1987. Preciseinsertion of antibiotic resistance determinants into Tn2l-liketransposons: nucleotide sequence of the OXA-1 ,B-lactamasegene. Proc. Natl. Acad. Sci. USA 84:7378-7382.

28. Ouellette, M., and P. H. Roy. 1987. Homology of ORFs fromTn2603 and from R46 to site-specific recombinases. NucleicAcids Res. 15:10055.

29. Perbal, B. V. 1988. A practical guide to molecular cloning, 2nded., p. 440 445. John Wiley & Sons, Inc., New York.

30. Radstrom, P., L. Sundstrom, G. Swedberg, J. Flensburg, and 0.Skold. Submitted for publication.

31. R&dstrom, P., and G. Swedberg. 1988. RSF1010 and a conjuga-tive plasmid contain sullI, one of two known genes for plasmid-borne sulfonamide resistance dihydropteroate synthase. Anti-microb. Agents Chemother. 32:1684-1692.

32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

33. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

34. Scholtz, P., V. Haring, B. Wittmann-Liebold, K. Ashmann, M.Bagdasarian, and E. Scherzinger. 1989. Complete nucleotidesequence and gene organization of the broad-host-range plasmidRSF1010. Gene 75:271-288.

35. Skold, 0. 1976. R-factor-mediated resistance to sulfonamides by

a plasmid-borne, drug-resistant dihydropteroate synthase. An-timicrob. Agents Chemother. 9:49-54.

36. Stokes, H. W., and R. M. Hall. 1989. A novel family ofpotentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol. Microbiol. 3:1669-1683.

37. Sundstrom, L., and 0. Skold. 1990. The dhfrI trimethoprimresistance gene of Tn7 can be found at specific sites in othergenetic surroundings. Antimicrob. Agents Chemother. 34:642-650.

38. Sundstrom, L., P. R&dstrom, G. Swedberg, and 0. Skold. 1988.Site-specific recombination promotes linkage between trimeth-oprim- and sulfonamide-resistance genes. Sequence characteri-zation of dhfrV and sulI and a recombination active locus ofTn2l. Mol. Gen. Genet. 213:191-201.

39. Swedberg, G. 1987. Organization of two sulfonamide resistancegenes on plasmids of gram-negative bacteria. Antimicrob.Agents Chemother. 31:306-311.

40. Swedberg, G., and 0. Skold. 1980. Characterization of differentplasmid-borne dihydropteroate synthases mediating bacterialresistance to sulfonamides. J. Bacteriol. 142:1-7.

41. Swedberg, G., and 0. Skold. 1983. Plasmid-borne sulfonamideresistance determinants studied by restriction enzyme analysis.J. Bacteriol. 153:1228-1237.

42. Swift, G., B. J. MacCarthy, and F. Heffron. 1981. DNA se-quence of a plasmid-encoded dihydrofolate reductase. Mol.Gen. Genet. 181:441-447.

43. Tait, R. C., H. Rempel, R. L. Rodriguez, and C. I. Kado. 1985.The aminoglycoside-resistance operon of the plasmid pSa: nu-cleotide sequence of the streptomycin-spectinomycin resistancegene. Gene 36:97-104.

44. Tenover, F. C., K. L. Phillips, T. Gilbert, P. Lockhart, P. J.O'Hara, and J. J. Plorde. 1989. Development of a DNA probefrom the deoxyribonucleotide sequence of a 3-N-aminoglyco-side acetyltransferase [AAC(3)-I] resistance gene. Antimicrob.Agents Chemother. 33:551-559.

45. Tran Van Nhieu, G., and E. Collatz. 1987. Primary structure ofan aminoglycoside 6'-N-acetyltransferase, AAC(6')-4, fused invivo with the signal peptide of the Tn3-encoded 1-lactamase. J.Bacteriol. 169:5708-5714.

46. van Treeck, U., F. Schmidt, and B. Wiedemann. 1981. Molecularnature of a streptomycin and sulfonamide resistance plasmid(pBP1) prevalent in clinical Escherichia coli strains and integra-tion of an ampicillin resistance transposon (TnA). Antimicrob.Agents Chemother. 19:371-380.

47. Willson, P. J., W. L. Albritton, L. Slaney, and J. K. Setlow.1989. Characterization of a multiple antibiotic resistance plas-mid from Haemophilus ducreyi. Antimicrob. Agents Chemo-ther. 33:1627-1630.

48. Willson, P. J., H. G. Deneer, A. Potter, and W. Albritton. 1989.Characterization of a streptomycin-sulfonamide resistance plas-mid from Actinobacillus pleuropneumoniae. Antimicrob.Agents Chemother. 33:235-238.

49. Wise, E. M., Jr., and M. M. Abou-Donia. 1975. Sulfonamideresistance mechanism in Escherichia coli: R-plasmids can de-termine sulfonamide-resistant dihydropteroate synthases. Proc.Natl. Acad. Sci. USA 72:2621-2625.

50. Wohlleben, W., W. Arnold, L. Bissonnette, A. Pelletier, A.Tanguay, P. H. Roy, G. C. Gamboa, G. F. Barry, E. Aubert, J.Davies, and S. A. Kagan. 1989. On the evolution of Tn21-likemultiresistance transposons: sequence analysis of the gene(aacCl) for gentamicin acetyltransferase-3-I(AAC(3)-I), anothermember of the Tn2J-based expression cassette. Mol. Gen.Genet. 217:202-208.

51. Womble, D. D., and R. H. Rownd. 1988. Genetic and physicalmap of plasmid NR1: comparison with other IncFII antibioticresistance plasmids. Microbiol. Rev. 52:433-451.

52. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

53. Zolg, J. W., and U. J. Hanggi. 1981. Characterization of an Rplasmid-associated, trimethoprim-resistant dihydrofolate reduc-tase and determination of the nucleotide sequence of the reduc-tase gene. Nucleic Acids Res. 9:697-710.

1848 RADSTROM ET AL.