Evolutionary Art
description
Transcript of Evolutionary Art
Evolutionary ArtEvolutionary ArtSome slides are imported from Some slides are imported from
““Getting creative with evolution” fromGetting creative with evolution” fromP. Bentley, University College LondonP. Bentley, University College Londonhttp://evonet.dcs.napier.ac.uk/summerschool2002/http://evonet.dcs.napier.ac.uk/summerschool2002/
tutorials.htmltutorials.html
What is Evolutionary Art?What is Evolutionary Art? ““Imagery produced by a process of simulated Imagery produced by a process of simulated
evolution inside a computer, guided by an artist's evolution inside a computer, guided by an artist's aesthetic fitness selection”aesthetic fitness selection” Steven Rooke at http://www.azstarnet.com/~srooke/glossary.htmlSteven Rooke at http://www.azstarnet.com/~srooke/glossary.html
“… “… allows the artists to generate complex allows the artists to generate complex computer artwork without them needing to delve computer artwork without them needing to delve into the actual programming used”into the actual programming used”Andrew Rowbottom at http://www.netlink.co.uk/~snaffle/form/evolutio.htmlAndrew Rowbottom at http://www.netlink.co.uk/~snaffle/form/evolutio.html
“… “… more akin to genetic engineering than to more akin to genetic engineering than to painting”painting”Jeffrey Ventrella at http://www.ventrella.com/Art/Tweaks/tweaks.html Jeffrey Ventrella at http://www.ventrella.com/Art/Tweaks/tweaks.html
What is Evolutionary Art?What is Evolutionary Art?
Technically, it is creating pieces of art Technically, it is creating pieces of art
through human-computer interaction, wherethrough human-computer interaction, where compuer: runs evolutionary algorithmcompuer: runs evolutionary algorithm human: applies subjective/aesthetic selectionhuman: applies subjective/aesthetic selection
The Roles in Evolutionary The Roles in Evolutionary ArtArt
Role of compuer: Role of compuer: offers choices, creates diversityoffers choices, creates diversity
Role of human: Role of human: makes choices, reduces diversitymakes choices, reduces diversity
Selection (aesthetic, subjective) steers Selection (aesthetic, subjective) steers generation process towards generation process towards implicitimplicit user user preferencespreferencesQ: who is creative here?Q: who is creative here?
Example: Mondriaan Example: Mondriaan evolverevolver((Craenen, Eiben, van Hemert))
Application evolving images in the style of Piet Mondriaan
Programming assignment of my univ. course on evolutionary computing
1999 Dutch-Belgium AI Conference paper
On-line “toy” at: http://www.cs.vu.nl/ci/Mondriaanhttp://www.cs.vu.nl/ci/Mondriaan
ororhttp://www.xs4all.nl/~bcraenen/EArt/demo.htmlhttp://www.xs4all.nl/~bcraenen/EArt/demo.html
Composition with Red, Blue, and Yellow, 1930
Mondriaan evolverMondriaan evolver GUI shows population of 9 GUI shows population of 9
picturespictures User gives grades User gives grades
(thus defines fitness values)(thus defines fitness values) Computer performs one Computer performs one
evolutionary cycle, i.e.evolutionary cycle, i.e.– selection, based on this fitness selection, based on this fitness
(thus creates mating pool)(thus creates mating pool)– crossover & mutation crossover & mutation
(thus creates new population)(thus creates new population) Repeat Repeat See demo See demo herehere
The Evolutionary Art Cycle The Evolutionary Art Cycle 11
PopulationPopulation
Recombination,Recombination,mutationmutation
Parent poolParent poolParent selectionParent selectionaesthetic selectionaesthetic selectionsubjective selectionsubjective selection
Representation in Evolutionary Representation in Evolutionary ArtArt
AGCTCTTA
PhenotypePhenotypelevellevel
GenotypeGenotypelevellevel
Decoding
User selection actsUser selection actson this levelon this level
Genetic Genetic operators act on operators act on this levelthis level
Mondriaan representationMondriaan representation
w h ite 0 .5 g reen
sp lit_ y
ro o t
red 0 .33
w h ite 0 .5 g reen
sp lit_x
s p lit_ y
ro o t
red 0 .33
w h ite 0 .5
ye llo w 0 .5 g reen
sp lit_ y
sp lit_x
sp lit_ y
ro ot
The Evolutionary Art Cycle The Evolutionary Art Cycle 22
PopulationPopulationphenotypesphenotypes
Parent poolParent poolphenotypesphenotypesParent Parent
selectionselection
EncodingEncoding
AGCTCTTA
TGATCGTAGTGACTCC
Parent poolParent poolgenotypesgenotypes
PopulationPopulationgenotypesgenotypes
Recomb.Recomb.mutationmutation
AGCTCTTA
TGATCGTAGTGACTCC
CCTCACAACCTTTGGGCCTTTGAA
AGAGACTAAGTACTTA
AGAGACTA
DecodingDecoding
Effects Effects & hand-made mutations& hand-made mutations
AGCTCT+0000
1. Chromosomes consist of two parts: image + effect1. Chromosomes consist of two parts: image + effect they evolve togetherthey evolve together
2. User can try effects with preview and select one (some)2. User can try effects with preview and select one (some)
AGCTCT+0001AGCTCT+0100AGCTCT+1000
Chosen effects are coded onto the chromosomes (Lamarck)Chosen effects are coded onto the chromosomes (Lamarck)
Points of attentionPoints of attention RepresentationRepresentation
– phenotypes shluld be appealing (“fine art”)phenotypes shluld be appealing (“fine art”)– genotypes should be easy to manipulate (operators)genotypes should be easy to manipulate (operators)
Coding-decoding:Coding-decoding:– should be fastshould be fast– Lamarckian evolution in case of user-defined effectsLamarckian evolution in case of user-defined effects
OperatorsOperators– too disruptive: user sees no link between generationstoo disruptive: user sees no link between generations– too smooth (small changes): evolution is too slowtoo smooth (small changes): evolution is too slow
SelectionSelection– user grades are continuous (fitness values): hard to gradeuser grades are continuous (fitness values): hard to grade– user grades are binary (die/multiply): not enough differentiationuser grades are binary (die/multiply): not enough differentiation
Karl Sims, GalápagosKarl Sims, Galápagos GalápagosGalápagos is an interactive media installation is an interactive media installation
that allows visitors to "evolve" 3D animated that allows visitors to "evolve" 3D animated formsforms
http://www.genarts.com/galapagos/index.html http://www.genarts.com/galapagos/index.html Exhibited at the:Exhibited at the:
– ICC in Tokyo from 1997 to 2000, ICC in Tokyo from 1997 to 2000, – Interactive Computer Art, Interactive Computer Art,
Lincoln, Mass. Lincoln, Mass. – Boston Cyberarts Festival 1999Boston Cyberarts Festival 1999
Karl Sims, GalápagosKarl Sims, Galápagos
Box insect Beaded arms
Bfly larvaJellyfish
Multipus-green
Multipus-purple
Kleiweg, Evolutionary Art in Kleiweg, Evolutionary Art in PostScriptPostScript
%!PS-Adobe-3.0 EPSF-3.0%%BoundingBox: 45 170 545 670/X 0 def/Y 0 def/pixcol { } def/PI 3.14159265358979323846 def/INDEX { counttomark 1 sub exch cvi abs exch mod index} bind def/ROLL { exch cvi abs counttomark 2 sub mod 1 add exch cvi roll} bind def/DIV { dup abs .0001 lt { 0 lt { -.0001 } { .0001 } ifelse } if div
Eiben et al., Escher Eiben et al., Escher evolverevolver
Exhibited for 6 months in City Exhibited for 6 months in City Museum The HagueMuseum The Hague
Flat screens on walls show Flat screens on walls show computer genarted picturescomputer genarted pictures
Visitors vote on separate Visitors vote on separate images (define fitness values)images (define fitness values)
Computer performs one Computer performs one evolutionary cycle every 30 evolutionary cycle every 30 minutesminutes
Re-design: visitors choose Re-design: visitors choose between two images (split between two images (split screen)screen)Flatfish
How is this creativity How is this creativity achieved?achieved?
When evolution is told to When evolution is told to buildbuild solutions solutions from components, it becomes creative.from components, it becomes creative.
Only those approaches that use Only those approaches that use component-based representations component-based representations provide sufficient freedom.provide sufficient freedom.
Evolution now Evolution now exploresexplores new ways of new ways of putting components together to putting components together to construct innovative solutions.construct innovative solutions.
Instead of optimising selected elements of a given solution, we allow evolution to build new solutions from scratch, using component-based representations
Component-based Component-based representationsrepresentations
Component-based Component-based representationsrepresentations
P. Bentley used primitive shapes to construct novel designs
sin() pdiv() pminus() mandelstalk() pqj4da2013() pln() M_PI 0.022307 x y
Steven Rooke uses GP functions and terminals
Component-based Component-based representationsrepresentations
John Gero used ‘wall fragments’ to generate house floor plans
Component-based Component-based representationsrepresentations
Creative Computers - Creative Computers - What does this mean?What does this mean?
We are now beginning to understand We are now beginning to understand the benefits and pitfalls of creative the benefits and pitfalls of creative evolutionary computation.evolutionary computation.
Evolution can find solutions that Evolution can find solutions that disregard our conventions and theories.disregard our conventions and theories.
Efficient Efficient new designsnew designs have been have been evolved, and evolved, and unusual artunusual art..
Creative Computers - Creative Computers - What does this mean?What does this mean?
Some solutions do perform better, but their Some solutions do perform better, but their functioning is bizarre and functioning is bizarre and difficult to difficult to understandunderstand (circuits, neural networks, (circuits, neural networks, computer programs).computer programs).
Principle extraction (reverse engineering)Principle extraction (reverse engineering) is is one way of overcoming the fears.one way of overcoming the fears.
Rather than use directly the wacky evolved Rather than use directly the wacky evolved designs, we can designs, we can learn new design learn new design techniquestechniques and then apply them ourselves. and then apply them ourselves.
Creative Computers - Creative Computers - What does this mean?What does this mean?
Legal issues arise when computers are Legal issues arise when computers are used as composition machines.used as composition machines.
For instance, the (British) law only For instance, the (British) law only recognises people as capable of music recognises people as capable of music composition.composition.
When using a computer to evolve novel When using a computer to evolve novel music, someone must be nominated to music, someone must be nominated to be the composer…be the composer…
Listen to sample from P. BentleyListen to sample from P. Bentley
ConclusionsConclusions Creative computers allow more Creative computers allow more
innovative ideas to be explored in a innovative ideas to be explored in a shorter time.shorter time.
Evolution is enabling our technology Evolution is enabling our technology and arts to develop in surprising and and arts to develop in surprising and exciting new ways.exciting new ways.
Some useful Web linksSome useful Web links Andrew Rowbottom,Andrew Rowbottom, Organic, Genetic, and Evolutionary Art (incl. large Organic, Genetic, and Evolutionary Art (incl. large
software overview) software overview) http://snaffle.users.netlink.co.uk/form/evolutio.htmlhttp://snaffle.users.netlink.co.uk/form/evolutio.html Craig Reynolds,Craig Reynolds, Evolutionary Computation and its application to art and Evolutionary Computation and its application to art and
design design http://www.red3d.com/cwr/evolve.htmlhttp://www.red3d.com/cwr/evolve.html
Matthew Lewis,Matthew Lewis, Visual Aesthetic Evolutionary Design Links Visual Aesthetic Evolutionary Design Links http://www.accad.ohio-state.edu/~mlewis/aed.htmlhttp://www.accad.ohio-state.edu/~mlewis/aed.html
Steven Rooke,Steven Rooke, Evolutionary Art, Glossary of Terms: Evolutionary Art, Glossary of Terms: http://www.azstarnet.com/~srooke/glossary.htmlhttp://www.azstarnet.com/~srooke/glossary.html
Karl Sims,Karl Sims, Homepage at Homepage at GenArts, Inc.,GenArts, Inc., http://www.genarts.com/karl/http://www.genarts.com/karl/
Linda Moss,Linda Moss, Evolutionary GraphicsEvolutionary Graphicshttp://www.marlboro.edu/~lmoss/planhome/index.htmlhttp://www.marlboro.edu/~lmoss/planhome/index.html