DEPARTAMENTO DE CIENCIAS DE LA VIDA CARRERA DE INGENIERÍA EN CIENCIAS AGROPECUARIAS

Click here to load reader

  • date post

    22-Feb-2016
  • Category

    Documents

  • view

    72
  • download

    0

Embed Size (px)

description

DEPARTAMENTO DE CIENCIAS DE LA VIDA CARRERA DE INGENIERÍA EN CIENCIAS AGROPECUARIAS. ESTUDIO FILOGENÉTICO DE TRES LINEAS DE CUYES ( Cavia porcellus L.), PERÚ, ANDINA E INTI EN LA HACIENDA “EL PRADO ”. Previa a la obtención de Grado Académico o Título de: INGENIERO AGROPECUARIO. - PowerPoint PPT Presentation

Transcript of DEPARTAMENTO DE CIENCIAS DE LA VIDA CARRERA DE INGENIERÍA EN CIENCIAS AGROPECUARIAS

Ghjgh hjghjg hghg hghghghjgg h

ESTUDIO FILOGENTICO DE TRES LINEAS DE CUYES (Cavia porcellus L.), PER, ANDINA E INTI EN LA HACIENDA EL PRADODEPARTAMENTO DE CIENCIAS DE LA VIDA

CARRERA DE INGENIERA EN CIENCIAS AGROPECUARIASPor: MARCELA ALEXANDRA DAZ RIVADENEIRAPrevia a la obtencin de Grado Acadmico o Ttulo de:INGENIERO AGROPECUARIOFebrero 14, 2012

introduccinINTRODUCCIN

PER > consumo > produccin16.500 TM (Chauca, 1999)ECUADORPoblacin > 5 millones de individuosConsumo >13 millones de individuos 25.590 TM (III Censo Agropecuario, 2002)Creciente demandaCreciente demanda> Produccin Semi-tecnificadaSeleccinMejoramiento gentico y productivoMarcadores moleculares> Produccin de carne> CalidadVariabilidad genticaPor: Marcela Daz R. (Marzo, 2012)objetivosEstablecer relaciones morfolgicas y moleculares en las lneas de cuyes Per, Andina e Inti que sirvan como base para un futuro programa de mejoramiento gentico en el Proyecto de Especies Menores de la Carrera de Ingeniera Agropecuaria.

Identificar caracteres morfolgicos, especficos para cada lnea, que permitan la seleccin de especmenes para mejoramiento gentico. Caracterizar molecularmente tres lneas de cuyes mejorados a travs del gen mitocondrial para citocromo b y estimar posibles relaciones con especies silvestres que se encuentran registradas en el GenBank.Establecer el grado de asociacin o de variabilidad gentica de las lneas de produccin con el fin de conocer el nivel de endogamia dentro de cada lnea.

Por: Marcela Daz R. (Marzo, 2012)Revisin de literatura

REVISIN DE LITERATURAGeneralidades sobre el cuy Cavia porcellus

REINOAnimalCLASEMammaliaSUBCLASEPlacentaliaORDENRodentiaSUBORDENHystricomorphaFAMILIACavidaeGNEROCaviaESPECIECavia porcellus

64 cromosomas (2n)1200 g (3 meses)Por: Marcela Daz R. (Marzo, 2012)REVISIN DE LITERATURAHERRAMIENTAS MOLECULARESEXTRACCIN DE ADNLisis

Eliminacin de protenas

Lavado

Secado

Recoleccin de ADNPCR(Reaccin en cadena de la polimeraza)Proteasa OB50 70CEtanolBuffer con etanolCentrifugacin

Por: Marcela Daz R. (Marzo, 2012)REVISIN DE LITERATURAHERRAMIENTAS MOLECULARESELECTROFORESIS

SECUENCIACIN

Por: Marcela Daz R. (Marzo, 2012)REVISIN DE LITERATURAGen mitocondrial Citocromo bCONCEPTOS BSICOS

Codificador de protenas

En el transporte de electrones a travs de la cadena respiratoria (Ochoa, et al. 2008)

Ms tiles para los trabajos filogenticos

Tipo de herencia uniparental

Regin conservadaMarcadores MolecularesPor: Marcela Daz R. (Marzo, 2012)REVISIN DE LITERATURAInferencia filogentica CONCEPTOS BSICOS

Distancias genticas o evolutivas (cM)FILOGENIASMILESDIVERGENTESPor: Marcela Daz R. (Marzo, 2012)Materiales y mtodosMATERIALES Y MTODOSCOLOR DE PELOLneaColor TpicoRango de colores para todas las lneasPuntajeImagenAndinaBlanco100% tpico2PerAlazn75% tpico, 25% otro2IntiBayo50% tpico, 50% otro2IntiBayo25% tpico, 75% otro2CARACTERIZACIN MORFOLGICA

COLOR DE OJOSColorPuntajeImagenNegro2Rojo0

FENOTPICACUALITATIVAPor: Marcela Daz R. (Marzo, 2012)MATERIALES Y MTODOSCARACTERIZACIN MORFOLGICACOLOR DE OREJASColorDetallePuntajeImagenNegroAmbas orejas de color negro2RosadoAmbas orejas de color rosado2CombinadoUna oreja de color negro y la otra color rosado1PintadoUna o ambas orejas con pintas de color negro o rosado0

NMERO DE DEDOSCategoraPatas anterioresPatas posterioresPuntajeNormal432Polidactilia parcial4 31Polidactilia total 4 30FENOTPICACUALITATIVA

Por: Marcela Daz R. (Marzo, 2012)

MATERIALES Y MTODOSVARIABLESuperior a la mediaAlrededor de la mediaBajo la mediaPeso vivo (PV)210Largo total (LT)210Longitud cabeza-cuerpo (CC)210Largo rudimento caudal (LC)012Largo de la oreja (LO)012Largo de la pata (LP)012Largo de la cabeza (Lca)012Altura de la cabeza (Aca)012Largo del pelo (Lp)012CARACTERIZACIN MORFOLGICAFENOTPICACUANTITATIVAPor: Marcela Daz R. (Marzo, 2012)MATERIALES Y MTODOSVARIABLE SINTTICAVARIABLES FENOTPICASVARIABLESFENOTPICASCUANTITATIVASVARIABLE SINTTICAGRUPO 1GRUPO 2GRUPO 3Color de peloColor de ojosColor de orejasNmero de dedosPeso vivo (PV)Largo total (LT)Longitud cabeza-cuerpo (CC)Largo de la oreja (LO)Largo de la pata (LP)Largo de la cabeza (Lca)Altura de la cabeza (Aca)Largo del pelo (Lp)Por: Marcela Daz R. (Marzo, 2012)MATERIALES Y MTODOSCARACTERIZACIN MOLECULAR

Toma de muestras

Extraccin de ADN

Por: Marcela Daz R. (Marzo, 2012)Visualizacin

MATERIALES Y MTODOSCARACTERIZACIN MOLECULARVisualizacin

Amplificacin PCR

INICIADORESSECUENCIA NUCLEOTDICA PRIMERREFERENCIACitocromo b1 (Forward F78)5-TCCAATGTAGGAATTATGACCCACC-3Spotorno, et al. 2004Citocromo b2 (Reverse B149)5-TTTCCCATCTCTGGCTTACAAGAC-3Spotorno, et al. 2004Por: Marcela Daz R. (Marzo, 2012)

MATERIALES Y MTODOSCARACTERIZACIN MOLECULARSecuenciacin

Anlisis filogenticoAnlisis de secuencias completasAnlisis de secuencias incompletasInferencia filogenticaSeleccin de reproductores

GENBANKPor: Marcela Daz R. (Marzo, 2012)RESULTADOS Y DISCUSINVARIABLE SINTTICACualitativoCuantitativoPuntaje TotalLneaCdigoSub TotalSub TotalANDINAA181115A210513A310918A410717A5101524A67913A710916PERP19917P281520P3101120P481018P591018P661217P781017INTII1101120I210917I381622I481116I5101219I671420I7101120Media(X)17,95Desv. Estan.(S)2,69CARACTERIZACIN MORFOLGICAVARIABLEACRNIMOPROMEDIOPeso vivoPV1237,62 gLargo totalLT360,24 mmLongitud cabeza-cuerpoCC353,75 mmLargo del rudimento caudalLC6,49 mmLargo de la orejaLO35,04 mmLargo de la pataLP59,39 mmLargo de la cabezaLca82,16 mmAltura de la cabezaAca40,90 mmLargo del peloLp31,30 mmLNEA INTILARGO TOTAL270,0 mmLARGO DEL CUERPO263,8 mmLARGO RUDIMENTO CAUDAL6,2 mmLARGO OREJA34,0 mmLARGO PATA45,0 mmLARGO CABEZA62,5 mmANCHO CABEZA29,0 mmPESO600 gLNEA ANDINALARGO TOTAL289,0 mmLARGO DEL CUERPO281,0 mmLARGO RUDIMENTO CAUDAL8,0 mmLARGO OREJA33,7 mmLARGO PATA50,0 mmLARGO CABEZA62,5 mmANCHO CABEZA26,0 mmPESO600 gLNEA PERLARGO TOTAL270,0 mmLARGO DEL CUERPO263,4 mmLARGO RUDIMENTO CAUDAL6,6 mmLARGO OREJA32,0 mmLARGO PATA46,5 mmLARGO CABEZA64,0 mmANCHO CABEZA30,0 mmPESO600 g(Guzmn, 2000)(Guzmn, 2000)Por: Marcela Daz R. (Marzo, 2012)

CARACTERIZACIN MOLECULAR

ADN mitocondrial amplificadoADN mitocondrial secuenciadoPor: Marcela Daz R. (Marzo, 2012)RESULTADOSNUCLETIDOSReferenciasC. porcellus1120,8 nt334,8 amino100 %1125 a 1140 pb (Solarte et al. 2005)IASA1101,5 nt331,9 amino98,27%1140 nt (Guevara, 2004SECUENCIAS COMPLETASSITIOSESPECIENo. SITIOSCONSERVADOSVARIABLESPARSIMONIO INF.C. porcellus122810501558685,50%14,50%55,48%PARESEspeciesIdnticosTransiciones (TS)Transversin (TV)Tasa No. Pares%No. Pares%No. Pares%TS/TVC. porcellus106298,08121,1190,831,33C. porcellus vs. Dolichotis patagonum (outgroup)104896,63222,03151,381,47TRANSICINTRANSVERSINAGTCATACTGCGAlta similitudPor: Marcela Daz R. (Marzo, 2012)

RESULTADOSSECUENCIAS COMPLETASPor: Marcela Daz R. (Marzo, 2012)RESULTADOSSECUENCIAS COMPLETAS

Sitios de divergencia transicional entre secuencias del gen mitocondrial citocromo bSitios de divergencia transversional entre secuencias del gen mitocondrial citocromo b

LNEAMUESTRAPOSICINSECUENCIA NUCLEOTDICAINTI19_I5_B1354 - 3745- TCTTCTGTTCACAGTTATGGC -3795 - 8155-ACCACACATTTAAACCCAGAG-3Por: Marcela Daz R. (Marzo, 2012)

RESULTADOSSELECCIN DE REPRODUCTORESI2MORFOLGICAMENTEMOLECULARMENTESimilitud del 97% entre I2 e I5 (BLAST)Mayor distancia gentica con el resto de la poblacin muestreadaI5Menor nivel de consanguinidad en la descendenciaI5Excelente fenotipoGrupo 2 (alrededor de la media)Largo de la cabezaI2Peso VivoI5Produccin de carneI5I5

Por: Marcela Daz R. (Marzo, 2012)RESULTADOSANLISIS FILOGENTICO

Por: Marcela Daz R. (Marzo, 2012)conclusionesCONCLUSIONESLos caracteres fenotpicos cualitativos que permiten una adecuada seleccin de reproductores de las lneas Per, Andina e Inti son el color del pelo, de las orejas y de los ojos, y el nmero de dedos en las patas anteriores y posteriores.

Las variables morfomtricas que favorecen la seleccin de reproductores en las lneas Per, Andina e Into son: Peso vivo (PV), Largo total (LT), Longitud cabeza-cuerpo (CC), Largo del rudimento caudal (LC), Largo de la oreja (LO), Largo de la pata (LP), Largo de la cabeza (Lca), Ancho de la cabeza (Aca) y Largo del pelo (Lp).

Las secuencias completas del gen mitocondrial citocromo b de las lneas Andia, Per e Inti tienen un promedio de 1101,5 nucletidos que se traducen en 331,9 aminocidos y son similares en un 98,08%.Por: Marcela Daz R. (Marzo, 2012)CONCLUSIONESLas secuencias completas del gen mitocondrial citocromo b de las lneas Andia, Per e Inti presentaron 1082,8 pares de nucletidos intra-especficos de los cuales 1062 pares (98,08 %) son idnticos y 21 (1,92 %) son divergentes por transicin (12 pares) y transversin (9 pares).

Los ejemplares de la lnea Inti, I2 e I5 poseen mayor variabilidad gentica y se encuentran ms distantes del resto de la poblacin del IASA. Ambos individuos presentaron la misma topologa el 60 % de las repeticiones bajo una frecuencia de remuestreo de 1000 rplicas.

Los fragmentos de mayor variabilidad se encontraron en la secuencia de la muestra I5 representante de la lnea Inti. Estos fragmentos se ubicaron desde la posicin 354 a la 374, y desde la posicin 795 hasta la 815, lugares donde se encontraron las secuencias ms divergentes 5-TCTTCTGTTCACAGTTATGGC-3 y 5ACCACACATTTAAACCCAGAG-3, respectivamente.Por: Marcela Daz R. (Marzo, 2012)CONCLUSIONESSe seleccion como reproductor al ejemplar I5, de la lnea Inti, por presentar excelentes caracteres fenotpicos cualitativos, buen peso vivo en edad reproductiva y mayor variabilidad gentica intra poblacional.

El anlisis filogentico muestra que las secuencias de la especie Cavia porcellus provenientes del IASA con las secuencias del GenBank de la misma especie, pertenecen al mismo grupo monofiltico y que comparten caracteres heredados con el grupo parafiltico de ejemplares C. tschudii y C. aperea.

Las especies silvestres como Cavia tschudii y Cavia aperea se encuentras distanciadas genticamente de Cavia porcellus pero comparten secuencias genticas heredadas por lo que se confirma la descendencia de Cavia porcellus a partir de Cavia tschudii.Por: Marcela Daz R. (Marzo, 2012)recomendacionesRECOMENDACIONESHacer una evaluacin exhaustiva fenotpica y genotpica de la descendencia del reproductor seleccionado en base a las tcnicas moleculares de este estudio para certificar la seleccin de reproductores por este mtodo.

Adquirir reproductores de diferentes criaderos con el fin de reducir la homogeneidad de los caracteres moleculares e incrementar la variabilidad gentica de la especie dentro del criadero de la Hda. El Prado.Por: Marcela Daz R. (Marzo, 2012)RECOMENDACIONESUtilizar fragmentos del gen mitocondrial citocormo b de mayor divergencia para la elaboracin de primers que permitan investigar ms profundamente el uso del gen citocromo b en la seleccin de reproductores.

Evaluar molecularmente a cuyes silvestres y criollos del pas para identificar caracteres morfolgicos, de comportamiento y particularmente moleculares que ayuden a incrementar la variabilidad gentica en cuyes mejorados y permitan conservar material gentico para anlisis futuros.

Aplicar esta tcnica a otros sistemas de explotacin a fin de comprobar su eficiencia en la seleccin de reproductores y su aporte en la aplicacin de programas para mejoramiento gentico.

Por: Marcela Daz R. (Marzo, 2012)gracias