Characterization of HD2C and its interaction with novel ......14-3-3 interaction with HD2C was...

Characterization of HD2C and its interaction with novel partners in

Arabidopsis thaliana

This thesis is presented for the degree of Doctor of Philosophy of the University of Western Australia

Michael Van der Kwast

Biochemistry and Molecular Biology

School of Chemistry and Biochemistry

April 2013

Supervisors: Dr Thomas Martin and Dr Martha Ludwig

Declaration

The work presented in this thesis is my own work except where stated. This work was

carried out in the School of Chemistry and Biochemistry, Faculty of Life and Physical

Sciences, at the University of Western Australia. The material presented in this thesis

has not been presented for any other degree.

Michael Van der Kwast

April 2013

1

Acknowledgment

I would like to express my sincere gratitude and appreciation for the hard work of my

principle supervisor Dr. Thomas Martin. It was only through his guidance and

determination that I achieved my goal of finishing my PhD and accomplishing my

successes in the lab. I gained many insights into the scientific way of thinking through

our frequent meetings (I also enjoyed our many discussions on the merits of various

cricket players).I would also like to thank my second supervisor, Dr. Martha Ludwig,

who offered alternative viewpoints so that I could take my research down unexpected

avenues. Special thanks as well to all of the present and former members of the labs of

Dr. Patrick Finnegan and Martha. I enjoyed our fortnight meetings despite the

occasional disheartened atmosphere as we would share a frustrating or failed

experiment. In particular I must mention the early help that I received from Hung Chi

Lui, who took me under his wing at the start of my PhD.

I have been privileged to work with some talented scientists in Thomas’ lab. In

particular I would like to thank Adrian Sheng Hao Tong, Ruo Han Li, Sally Grasso. A

super, special thanks to Julia Man, for her amazing help when I was writing-up; their

presence kept me motivated (and occasionally entertained) in the lab and I will be sad

to leave such an enriching environment.

I am grateful for the help of Mr John Murphy and Dr Paul Rigby in learning and

operating the confocal microscope. My project was dependent on their skills and their

time was greatly appreciated.

I would like to acknowledge and thank the help of my family and friends. Daniel

Pegdon, I promised to acknowledge you here, but now you have to read EVERY WORD

of this thesis. My parents were always willing to help, and their gift of cooking dinner

when I was stressed was something that I often joked about, but really appreciated.

Lastly I would like to acknowledge and thank my wife, Karen. I am truly grateful for her

unwavering support and help whether I felt that I needed it or not. This was an equally

difficult time for her (although I’m sure that she appreciates all of the new things that

she has learnt about histone deacetylases).

2

Abstract

Histone deacetylases are known to bind a variety of targets and interacting proteins

which are responsible for determining its activity in a temporal and spatial context.

Here, Bimolecular Fluorescent Complementation (BiFC) assays were used to analyse

putative interactions of the plant specific histone deacetylase HD2C isoform from

Arabidopsis thaliana. Specifically, HD2C was shown to form homo- and hetero-dimers

through interaction with other HD2 isoforms; it was shown to interact with both

epsilon and non-epsilon 14-3-3 isoforms; and lastly it was shown to interact with the

transcription factor TGA6.

Localization of HD2C-GFP traced accumulation of HD2C to the nucleus and nucleolus of

Arabidopsis leaf cells. This was evidently dynamic, as salt stress induced the HD2C-GFP

to localize to the nucleolus. This was linked to HD2C dimers, which showed a similarly

nucleolar localization pattern. The nuclear localization was shown to be dependent on

an evolutionarily conserved KKAK motif.

14-3-3 interaction with HD2C was investigated using Bimolecular Fluorescent

Complementation. HD2C bound to both epsilon and non-epsilon classes of 14-3-3

proteins, while the other HD2 isoforms were able to bind to 14-3-3 epsilon. The region

required for this interaction was traced to three distinct areas of the HD2C protein.

Site directed mutagenesis of serine and threonine residues was used to identify critical

potentially phosphorylated binding sites within the C-terminal region of the HD2C. The

study revealed that substitutions of S284, T235 and S239 by alanine abolished 14-3-3

binding to a C-terminal peptide of HD2C.

Lastly, it was attempted to identify a link between HD2C and salicylic acid (SA) and

jasmonic acid (JA) signalling. Interaction between TGA6, a known SA and JA response

transcription factor with HD2C was demonstrated using BiFC. In addition two lines

over-expressing a HD2C-GFP construct in Arabidopsis plants were compared with Col-0

wild type plants to determine if there a SA or JA dependent phenotypes could be

linked to the enzyme. An increased sensitivity of the overexpressing lines to SA and JA

was found during germination. However, when analysing HD2C expression, exogenous

application of salicylic acid and jasmonic acid had no evident effect on HD2C

3

expression. Finally, HD2C was tested for its ability to regulate as-1 like promoter cis-

element containing genes which are known to be regulated by SA and/or JA. A slight

decrease in the expression of PDF1.2, a JA responsive gene, as well as in the expression

of the SA and JA- RLK1 gene was observed, suggesting that HD2C may be somewhat

involved in regulating their expression.

4

List of Abbreviations

ABA abscisic acid

ABRC Arabidopsis Biological Resource Centre

AMP adenosine monophosphate

ATP adenosine triphosphate

Arabidopsis Arabidopsis thaliana

BiFC bimolecular fluorescence complementation

bp base pairs

BSA bovine serum albumin

CaMV cauliflower mosaic virus

cDNA complementary DNA

DAPI 4’, 6-diamidino-2-phenylindole

DNA deoxyribonucleic acid

E. coli Escherichia coli

ECL enhanced chemiluminescence

ER endoplasmic reticulum

EtBr ethidium bromide

GFP green fluorescent protein

H2O2 hydrogen peroxide

HA hemagglutinin

HDACs histone deacetylases

HD2C Arabidopsis histone deacetylase 2C

LB medium Luria-Bertani Broth medium

MCS multiple cloning sites

MeJA methyl jasmonate

5

MQ H2O Milli-Q H2O

MS medium Murashige and Skoog medium

Nicotiana Nicotiana benthamiana

OD600 optical density at 600 nm

ORF open reading frame

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

PEG polyethylene glycol

RFP red fluorescent protein

PTGS post-transcriptional gene silencing

rpm revolutions per minute

SDS sodium dodecyl sulfate

SDW sterile deionised water

Tris tris (hydroxymethyl) aminomethane

VP1 VIVIPAROUS1

YC (C-YFP) C-terminal fragment of YFP

YFP yellow fluorescent protein

YN (N-YFP) N-terminal fragment of YFP

6

Table of Contents

Chapter 1 ..................................................................................................................................... 10

General introduction ................................................................................................................... 10

1.1 Epigenetics ........................................................................................................................ 11

1.2 DNA methylation ............................................................................................................... 12

1.3 Non-coding RNA ................................................................................................................ 13

1.4 Histone Modifications ....................................................................................................... 14

1.5 Plant specific HD2 family................................................................................................... 15

1.6 Structure of HD2 ............................................................................................................... 15

1.7 HD2 expression patterns ................................................................................................... 18

1.8 HD2 function ..................................................................................................................... 20

1.9 HD2s- functionally redundant? ......................................................................................... 23

1.10 The HD2 complex- determining a higher level protein interactome .............................. 23

1.11 Project hypothesis and aims ........................................................................................... 25

1.11.1 Hypothesis ................................................................................................................ 25

1.11.2 Project aims.............................................................................................................. 27

Chapter 2 ..................................................................................................................................... 29

Materials and Methods ............................................................................................................... 29

2.1 Materials ........................................................................................................................... 30

2.2 Methods ............................................................................................................................ 32

2.2.1 General methods ................................................................................................ 32

2.2 Plant growth and transformations .............................................................................. 32

2.2.1 Sterilizing seeds ................................................................................................... 32

2.2.2 Seed sowing ........................................................................................................ 32

2.3 Transformation of A. thaliana leaves .......................................................................... 33

2.3.1 Floral dip ............................................................................................................. 33

2.5 Bacterial preparations and transformations .............................................................. 34

2.5.1 Competent cell preparation (E.coli) ................................................................... 34

2.5.2 Competent cell transformation (E.coli) ............................................................... 34

2.5.3 Agrobacteria competent cell preparation .......................................................... 35

2.5.4 Agrobacteria competent cell transformation ..................................................... 35

2.5.5 A.tumefaciens infiltration of Nicotiana benthamiana leaves ............................. 36

2.6 Nucleic acid manipulations ......................................................................................... 36

7

2.6.1 Phenol extraction ............................................................................................... 36

2.6.2 Ethanol precipitation .......................................................................................... 37

2.6.3 Isolation of genomic DNA from Arabidopsis thaliana plants .............................. 37

2.6.4 Polymerase Chain Reaction (PCR) ....................................................................... 38

2.6.5.1 High fidelity cloning PCR .................................................................................... 38

2.6.5.2 Standard Taq polymerase, qualitative PCR ............................................................. 38

2.6.6 Miniprep .............................................................................................................. 42

2.6.7 Midiprep .............................................................................................................. 42

2.6.8 Restriction digestion ........................................................................................... 42

2.6.9 Agarose gel staining, excision and purification ................................................... 42

2.6.10 Ligation ............................................................................................................... 43

2.6.11 Semi-quantitative RT-PCR ................................................................................... 43

2.7 Protein assays and procedures ................................................................................... 43

2.7.1 Western Blot ...................................................................................................... 43

2.8 Microscopy .................................................................................................................. 45

2.8.1 Fluorescence microscopy ................................................................................... 45

2.8.2 Confocal microscopy ........................................................................................... 46

2.8.3 Image analysis ..................................................................................................... 46

Chapter 3 ..................................................................................................................................... 47

Characterization of the subcellular localization of HD2C ........................................................... 47

3.1 Introduction ...................................................................................................................... 48

3.1.1 The impact of localization on regulating protein function ................................. 48

3.1.2 Mechanism of Nuclear localization ..................................................................... 49

3.1.3 Nucleolar localization .......................................................................................... 51

3.1.4 HD2-HD2 interactions in tertiary protein complex ............................................. 52

3.1.5 Hypothesis and aims ........................................................................................... 53

3.2 RESULTS....................................................................................................................... 54

3.2.1 Investigating the subcellular localization of the HD2 family of proteins ............ 54

3.2.2 HD2 proteins form nucleolar localized dimers in planta .................................... 55

3.2.3 A nuclear import-related sequence maps to the C-terminus of HD2C ............... 56

3.2.4 The HD2C nuclear localisation signal is dependent on a KKAK motif ................. 58

3.2.5 Sequence alignment of HD2 gene family homologues reveals conservation of

the critical KKAK motif ........................................................................................................ 58

3.2.6 Nuclear localisation is not a pre-requisite for HD2C dimerisation. .................... 59

3.2.7 HD2C localization is altered in response to abiotic stress .................................. 60

8

3.3 Discussion .......................................................................................................................... 60

3.3.1 Summary ............................................................................................................. 60

3.3.2 All combinations of dimers are possible between HD2C and the HD2 family .... 61

3.3.3 HD2C localization state is dynamic and responds to salt stress ......................... 62

3.3.4 HD2C contains a critical KKAK domain necessary for exclusive nuclear

localization .......................................................................................................................... 65

3.3.5 Nucleolar localization is not tied to nuclear localization .................................... 65

3.3.6 Dimerisation does not require nuclear localisation of HD2C. ............................ 66

3.3.7 Conclusion and future ......................................................................................... 67

Chapter 4 ..................................................................................................................................... 75

Characterization of HD2C interaction with 14-3-3 proteins using Bimolecular Fluorescent

Complementation ....................................................................................................................... 75

4.1 Introduction ...................................................................................................................... 76

4.1.1 Possibility of 14-3-3 interaction with HD2C in Arabidopsis thaliana .................. 76

4.1.2 14-3-3 background .............................................................................................. 77

4.1.3 14-3-3 binding site .............................................................................................. 79

4.1.4 Aims and Hypotheses .......................................................................................... 80

4.2 Results .............................................................................................................................. 81

4.2.1 14-3-3 isoforms bind to HD2C in planta ............................................................. 81

4.2.2 HD2 isoforms bind 14-3-3 epsilon....................................................................... 83

4.2.3 Analysis of HD2C 14-3-3 binding domains .......................................................... 83

4.2.4 Determining the site of 14-3-3 binding to a single AA resolution ...................... 85

4.2.5 HD2C-mutants with disrupted C-terminal 14-3-3 binding do not have a clear

shift in localization pattern ................................................................................................. 87

4.3 Discussion ......................................................................................................................... 88

4.3.1 Summary ............................................................................................................. 88

4.3.2 HD2C does not show preference to 14-3-3 isoforms ......................................... 88

4.3.3 HD2C contains multiple 14-3-3 binding sites ...................................................... 90

4.3.4 Identification of 14-3-3 binding sites on HD2C ................................................... 91

4.3.5 The HD2C 14-3-3 binding site does not correspond to any consensus 14-3-3

binding motif ....................................................................................................................... 93

4.3.6 Conclusions and future ....................................................................................... 94

Chapter 5 ................................................................................................................................... 104

Role of HD2C in salicylic acid and jasmonate response in Arabidopsis thaliana ...................... 104

5.1 Introduction .............................................................................................................. 105

5.1.1 Hormone signalling in plants ............................................................................ 105

9

5.1.2 Possible role of HD2C signalling in response to salicylic and jasmonic acids ... 105

5.1.3 Salicylic acid ...................................................................................................... 106

5.1.4 Jasmonic acid and methyl-jasmonate ............................................................... 107

5.1.5 SA/JA crosstalk .................................................................................................. 108

5.1.6 Aims and Hypotheses ........................................................................................ 109

5.2 Results ....................................................................................................................... 110

5.2.1 Expression of HD2 proteins when exposed to SA, INA and MeJA .................... 110

5.2.2 HD2C expression has no impact on root growth when exposed to SA or MeJA

111

5.2.3 35S:HD2C-GFP plants have a delayed germination response to SA and MeJA 112

5.2.4 HD2C binds TGA6 transcription factor .............................................................. 113

5.2.5 Expression of TGA6 overlaps with HD2C in some tissues and developmental

stages 114

5.2.6 Analysis of the expression of genes controlled by TGA6 in HD2C modified plants

114

5.3 Discussion .................................................................................................................. 115

5.3.1 Summary ........................................................................................................... 115

5.3.2 Plants expressing 35S:HD2C-GFP have altered development in response to SA

and MeJA........................................................................................................................... 116

5.3.3 HD2C binds TGA6 transcription factor .............................................................. 118

5.3.4 Conclusions and future work ............................................................................ 120

Chapter 6 ................................................................................................................................... 129

Final Discussion ......................................................................................................................... 129

6.1 Summary ................................................................................................................... 130

6. 2 Results suggest new model of HD2 action ..................................................................... 131

6.3 HD2C for use in genetically modified plants ................................................................... 132

6.4 C-terminal domain appears to be necessary for protein binding ................................... 134

6.5 Future .............................................................................................................................. 136

Chapter 7 ................................................................................................................................... 137

References ................................................................................................................................ 137

Chapter 8 ................................................................................................................................... 148

Appendices ................................................................................................................................ 148

10

Chapter 1 General introduction

11

1.1 Epigenetics

The nature of a cell is determined by specific patterns of gene expression that result in

the production of a correspondingly specific subset of proteins. This capacity to

differentially regulate the composition of proteins in a cell has provided complex

multicellular organisms with a mechanism to evolve discrete tissue types that are

collectively able to perform diverse functions that would otherwise be impossible for a

single cell to perform (Koltunow, Truettner et al. 1990; Atchley and Hall 1991).

Underlying this process are the determinants of gene expression - gene regulators that

control expression via interaction with chromatin in regions neighbouring the gene

region (DeRisi, Iyer et al. 1997). The most overt manifestation of control is exerted

through transcription factors; proteins that bind to promoter regions and enhance or

repress the binding of transcription machinery necessary for RNA production (Pabo

and Sauer 1992; Kadonaga 1998). This system is relatively complex, and given the size

of a genome is an inefficient method of ensuring that only a subset of genes are

expressed at one time. For example, genomic analysis has revealed that there are over

2000 transcription factors in Arabidopsis (Mitsuda and Ohme-Takagi 2009), required

for both specific and endemic expression control. The presence of all genes in a

genome dictates that specific expression is controlled via a global repression

mechanism that has the specificity of transcription factors in targeting gene regions,

but with a fraction of the energy required to maintain this repression. It has become

evident that such global repression is regulated through processes which have come to

be defined under the developing field of ‘epigenetics’ (Holliday 1990; Jaenisch and Bird

2003).

Epigenetics was originally coined by Conrad Woddington in 1942, who defined the

term as ‘the branch of biology which studies the causal interactions between genes

and their products, which bring the phenotype into being’ (Goldberg, Allis et al. 2007).

Early research was somewhat limited by the scope of understanding of modern

genetics, let alone the technology to sequence and characterize DNA, yet nevertheless

recognized that some phenotypes could not be described by Mendelian genetics alone

(Morris 2001). With the advent of DNA characterization and sequencing, a clearer link

was established between genotype and phenotype. Robin Holliday initially suggested

that DNA methylation was responsible for some level of gene regulation, however this

12

speculation was not experimentally proven until his paper "The heritability of

epigenetic defects" which showed that loss of methylation led to heritable

abnormalities in gene expression (Holliday 1987; Holliday 2006). This work has been

widely cited as the first molecular characterization from which all modern epigenetic

research has been based.

More recently, the definition and field of epigenetic research has widened to be a

bridge between genotype and phenotype. This increase in complexity has led to some

level of confusion over the definition of the term ‘epigenetics’ and indeed the utility of

defining such a rapidly expanding field. A consensus definition was published in 2009

to clarify the term, stating that ‘an epigenetic trait is a stably heritable phenotype

resulting in changes in a chromosome without alterations in the DNA sequence’ (Zhang

2008; Berger, Kouzarides et al. 2009). Despite this, even within the timespan of this

thesis the issue of heritability has been argued against because traditionally epigenetic

processes could not conform to the necessity to be truly heritable (Goldberg, Allis et al.

2007). A number of sources suggest that epigenetic pathways involve DNA

methylation, histone modifications or non-coding RNA. These are summarized below.

1.2 DNA methylation

Briefly, DNA methylation is a covalent modification of DNA characterized by the

addition of a methyl group to cytosine at the 5 position of the pyrimidine ring or

adenine at the 6 position of the purine ring (Razin and Riggs 1980). While there is some

evidence that methylation has a role in DNA stability (Eden, Gaudet et al. 2003), the

overwhelming consensus links DNA methylation to regulating gene expression. On a

global level methylated cytosines comprise ~1% of the genome, thus accounting for

70-80% of all CpG dinucleotides in the genome (Saxonov, Berg et al. 2006). A

significant fraction of non-methylated CpG dinucleotides are positioned in the 5’ ends

of many genes, referred to as CpG islands, and which remain transcriptionally active

when unmethylated (Larsen, Gundersen et al. 1992). Similarly, unmethylated and

transcriptionally active genes have been shown to be silenced following methylation of

the promoter region (Brooks, Harkins et al. 2004).

13

The mechanism of this gene repression is of current interest. Two principle

mechanisms of action are currently favoured. The first is that methylation of the DNA

changes the binding surface, thereby preventing the binding of some gene activators

that would otherwise induce gene expression (Watt and Molloy 1988; Mancini, Singh

et al. 1999). Methylation was shown to prevent binding of the mammalian

transcription factor E2F in this way (Watt and Molloy 1988). This mode of action

appears to be the less predominant form of repression. Rather, the second mode of

action is that DNA methylation marks the DNA as a binding surface for specific methyl-

DNA binding proteins (Watt and Molloy 1988). It is these proteins which mediate a

gene repression response. The Arabidopsis genome contains 12 putative methyl-

target specific methylation patterns to repress gene expression (Ito, Koike et al. 2003;

Bogdanović and Veenstra 2009).

1.3 Non-coding RNA

Non-coding RNA refers to transcripts which are not ultimately translated into proteins.

Since its original classification as ‘junk DNA’, it has become clear that non-coding RNA

constitutes a significant molecular class within a cell (Costa 2008). Many proteins were

shown to bind RNA molecules in a process that determined where their activity was

directed onto specific chromosome locations; including histone deacetlyases (Aufsatz,

Mette et al. 2002), transcription factors (Sittka, Lucchini et al. 2008) and DNA

methyltransferases (Imamura, Yamamoto et al. 2004). Additionally, It is thought that

non-coding RNA is essential to direct sequence specific interactions of a limiting

number of chromatin regulatory complexes with target DNA regions so that regulation

can be relevant in the correct cells, in the correct tissues and at the correct time

(Mattick 2001). There are a number of different mechanism by which RNA can exercise

control on gene regulation. These include RNA editing (Covello and Gray 1989), RNA

interference (Hannon 2002) and regulation of chromatin modifying complexes (Hirota,

Miyoshi et al. 2008).

14

1.4 Histone Modifications

Chromatin is the combination of DNA and protein that is found in the nucleus of a cell.

The fundamental unit of chromatin is the nucleosome, which is comprised of an

octamer of four core histone isomers (H2A, H2B, H3 and H4) around which ~147 base

pairs of DNA are wrapped ‘like beads on a string’ (Noll 1974; Margueron and Reinberg

2010). The role of histones has wider implications than simple organization; rather, the

structure and function of chromatin is regulated by a number of epigenetic

mechanisms as well as DNA repair and replication (Berger 2007). This is controlled via

modification to the unstructured, positively charged N-terminal histone ‘tails’ which

extend from the globular protein that itself interfaces with DNA (Luger and Richmond

1998). These modifications are complex both in number and combination. Currently

there are at least nine known post-translational modifications of chromatin

methylation, acetylation, phosphorylation, ubiquitination, sumoylation, ADP

ribosylation, glycosylation, biotinylation, and carbonylation (reviewed in (Loidl 2004;

Margueron, Trojer et al. 2005))

In the context of transcriptional regulation, histone modifications mediate availability

of cis-regulatory elements of genes to transcriptional machinery. The mechanism by

which this occurs is categorized as either class I or class II. Class I include all

modifications that indirectly regulate chromatin structure by recruiting chromatin

remodelling proteins. Class II include all modifications that directly regulate chromatin

structure by chemically interfering with the nucleosome structure (Kouzarides 2007).

Chromatin acetylation occurs on the N-terminal tails of histone H3 at residues K9, K14,

K18 and K24 and histone H4 at residues K8, K12, K16 and K20 (Grunstein 1997). Unlike

other chromatin modifications, acetylation of histones modifies chromatin structure by

both class I and class II modifications. Its class I mechanism is mediated by bromo-

domain proteins that bind specifically to acetylated histones in a similar mechanism to

that described for histone methylation (Zeng and Zhou 2002). Its class II modification

operates through the addition of acetyl groups to neutralize the positive charge of

histone tails and decreases their affinity to DNA (Eberharter and Becker 2002). This

leads to a loose chromatin structure, thereby providing access to the DNA of

transcriptional regulators. It is the competing actions of two classes of enzymes that

15

control this modification, histone deacetylases which remove acetyl groups to histones

and histone acetyl transferases which add acetyl groups to histones.

1.5 Plant specific HD2 family

The HD2 family of enzymes was first characterized as a high molecular weight complex

abundant in maize embryos by Lusser and colleagues in 1997 (Lusser, Brosch et al.

1997). Maize embryos at the time were known to contain four different isoforms of

histone deacetylase, named HD1-A, HD1-B, HD1-BII and HD2 (Brosch, Lusser et al.

1996). HD2 was discriminated as different from the HD1 isoforms based on the

biochemical fractionation and purification techniques at the time and this simple

nomenclature has held for this family of enzymes. Since that time the significance of

the classification has become evident, as bioinformatic analyses have indicated a

separate path of origin from the more ubiquitous HD1 family. Whereas the

RPD3/HDA1 and SIR2 family of enzymes are present in almost all eukaryotes and are

derived from a common enzyme, the HD2s appear to be present only in plants and are

more closely related to the PPIases. It was subsequently suggested that the HD2s and

PPIases share a common ancestral enzyme origin, with the enzymatic histone

deacetylase activity of the HD2s being an example of convergent evolution rather than

diverging from the more common HDACs (Aravind and Koonin 1998).

1.6 Structure of HD2

Currently there is no published x-ray crystallography data for any member of the HD2

family, with structural data so far derived from bioinformatic predictions and analysis

of the primary and secondary structure. Early sequence analysis identified two

important structural domains- the N-terminal catalytic domain and a central acidic

domain, which appear to be present in all HD2 homologues (Wu, Tian et al. 2000). It

was subsequently shown that a C-terminal zinc-finger domain is present in the HD2A

and HD2C isoforms as well as their orthologous proteins in maize and rice (Dangl,

Brosch et al. 2001). The lack of this domain in the HD2B and HD2D isoforms suggests

that there are functional differences between the Arabidopsis isoforms.

16

N-terminal catalytic domain

The HDAC catalytic domain is defined as the minimal region required to catalyze the

cleavage and removal of acetyl groups from histone residues. In assays linking

Arabidopsis HD2A deacetylase activity to the expression of the GUS reporter gene, it

was shown that a region between amino acids 1-162 is both sufficient and necessary

for repression of GUS expression (Wu, Tian et al. 2003). The low resolution of this

deletion assay does not preclude the existence of a more minimal catalytic domain.

From early bioinformatic surveys it was noted that there was a putative critical

histidine 25 and aspartic acid 69 residues which may be involved in the catalytic

process (Aravind and Koonin 1998). A subsequent study tested this hypothesis in the

AtHD2A isoform, using site directed mutagenesis to determine the catalytic

importance of the two residues (Wu, Tian et al. 2003). It determined that while

mutation of the histidine to alanine caused a statistically significant decrease in

deacetylase activity, the aspartic acid mutation had no effect. Moreover, an N-terminal

MEFWG motif is completely evolutionarily conserved and deletion of this motif caused

inactivation of the enzyme’s desacetylase activity. Together this suggests that the N-

terminal of the protein is required for HDAC activity, with the N-terminal MEFWG

motif essential and H25 important for the gene repression activity of AtHD2A.

Central acidic region

The extended central acidic domain is present in all HD2s. It is structured as two

distinct acidic stretches separated by a short cluster of basic amino acids (Dangl,

Brosch et al. 2001). In HD2A the acidic domain stretches between residues 110-206AA

and contains a high density of Aspartate and Glutamate residues which are principally

responsible for the acidic isoelectric point for this protein. In addition, the

concentration of these residues to a short stretch in the middle of the HD2s means

that there is a dense region of highly charged protein at the surface of the protein.

The precise role or function of this region has not yet been elucidated. Similar acidic

domains in other nucleolar proteins such as nucleolin offer possible insight into its

function. Nucleolin is a multifunctional phospho-protein which shifts between the

cytoplasm, nucleus and nucleolus (Ginisty, Sicard et al. 1999). It contains a similarly

acidic charged domain which functions as a highly mobile binding surface for proteins

17

such as histone H1 and various ribosomal proteins (ERARD, Belenguer et al. 1988;

Tajrishi, Tuteja et al. 2011). Given the fact that the positively charged histone tails are

the substrate preference for HDACs, the negatively charged central domain of the

HD2s would logically provide the ideal binding surface. Further clarification of the link

between the central acidic domain and its histone substrate is clearly required.

C-terminal zinc-finger domain

Zinc-fingers are small (~30AA) protein domains common to eukaryotes which have a

well-defined function for binding to DNA, RNA and proteins (Klug and Rhodes 1987;

Laity, Lee et al. 2001). Structurally they are characterised by a series of cysteine and

histidine residues within the protein’s sequence which are coordinated in complex

with a zinc ion (Lee, Gippert et al. 1989). The zinc ion is largely responsible for

mediating and maintaining the protein fold, which itself mediates interaction with

DNA, RNA and proteins. Zinc fingers comprise a large motif family, and are arranged in

classes; separated by the arrangement of cysteine and histidine residues relative to the

complexed zinc ion. This number of cysteine and histidine residues and the

composition of the surrounding protein sequence has a significant impact on the

three-dimensional shape of the motif (Kim and Berg 1996). Because the protein’s fold

is essential for mediating contact between the protein and its target, each fold

typically preferentially binds to one of DNA, RNA or protein as targets (Laity, Lee et al.

2001).

The putative C-terminal zinc-finger domain of AtHD2A and AtHD2C appears to be an

evolutionarily conserved motif specific to the HD2s. Dangl et al compared 8 isoforms of

HD2 from maize, rice and Arabidopsis and showed conservation of this motif in 6 of

the 8 homologues (Dangl, Brosch et al. 2001). The motif was not present in the related

prokaryotic PPIases, which together with other HD2s lacking this moiety, suggests that

it is an evolutionarily recent acquisition adapted for specific HDAC related function.

The zinc-finger motif present in the HD2s conforms to the TFIIIA-type zinc fingers

originally characterized in the species Xenopus with the transcription factor IIIA (Klug

and Rhodes 1987). Throughout eukaryotes it has been identified as a DNA-binding

motif, with each zinc-finger mediating interaction with ~4bp of DNA, centred within

the major groove of the double helix (Theunissen, Rudt et al. 1992). A significant

18

aspect of this DNA:protein interaction is that multiple zinc finger domains are arranged

to stabilize the interaction. This has led to the speculation that HD2s do not directly

interact with DNA through this zinc finger domain, but rather that it mediates various

protein interactions (Dangl, Brosch et al. 2001). However there is some precedent to

suggest that this may not be the case. In Drosophila, the transcription factor GAGA is

the only protein that contains a single C2H2 domain. Together with its surrounding

basic amino acids it is able to provide a stable DNA:protein interaction (Pedone,

Ghirlando et al. 1996; Iuchi 2001). Similarly, the Arabidopsis transcription factor

SUPERMAN binds DNA through its single zinc-finger domain with a similar

arrangement of basic amino acids (Dathan, Zaccaro et al. 2002). Together this indicates

that although rare, the direct interaction of HD2s that contain a zinc finger with DNA is

possible and requires further investigation. Moreover, zinc-finger specificity for

methylated DNA has been reported in human proteins, giving rise to the possibility of

further crosstalk between the DNA methylation and histone acetylation pathway

(Sasai, Nakao et al. 2010).

1.7 HD2 expression patterns

The initial characterization of HD2s was carried out in germinating maize embryos as

the investigators noted that this tissue was ‘a source particularly rich in these enzymes’

(Lusser, Brosch et al. 1997). The presence of these epigenetic effectors being so

prominently expressed in germinating tissue is significant as it suggests that they play a

prominent role in the developmental pathway between seed and seedling. Further

characterization has revealed that HD2 expression is not limited to embryogenesis and

is responsive to various developmental, tissue specific and stress induced pathways

(Hollender and Liu 2008).

Tissue specific and developmental expression patterns

A number of studies have concentrated on the expression profiles of HD2s in an effort

to gain insight into where and when HD2s function. Micro-array data comparing HD2

expression throughout development reveal that HD2s are expressed in all tissues,

although induction is most evident during early and late flowering (Hollender and Liu

2008). Semi quantitative RT-PCR appears to be consistent with these observations,

19

with expression detected in stems, leaves, flower, roots and seedlings for HD2A-C, with

higher expression found in the stem, flower and seedling stages (Zhou, Labbe et al.

2004). It has been suggested that the highly similar expression profiles between the

four Arabidopsis homologues is suggestive of functional redundancy (Hollender and Liu

2008).

In situ hybridization assays were used in the same study to reveal spatial expression

patterns to a higher degree of qualitative resolution (Wu, Tian et al. 2003). It revealed

that expression was evident at all levels in the organs examined, but the highest levels

of accumulation were found in the ovules, embryos, shoot apical meristem and first

leaves. They noted that this pattern of expression is consistent with other genes that

control embryogenesis, such as WUSCHEL and SERK which control flowering through

their action as transcription factors (Jönsson, Heisler et al. 2005; Pérez-Núñez, Souza et

al. 2009). To test the link between HD2s and embryogenesis, they overexpressed a

BBM gene leading to the formation of somatic embryos on transgenic Arabidopsis

cotyledons. This led to an induction in the expression of HD2s, suggesting that there is

a clear link between the HD2 gene expression and somatic and zygotic embryogenesis

(Zhou, Labbe et al. 2004).

In results consistent with this, a specific study in the expression of genes in the ovules

of the plant Solanum chacoense identified the ScHD2a gene in a negative selection

screen to so-called ‘restricted areas’ (Lagace, Chantha et al. 2003). This expression was

triggered by fertilization and appears to correspond with induction of other genes

involved in gene repression such as ScP18 and ScSWlb, suggesting that it played a role

in the transition from fertilized germoplasm to seed development

Environmental induction of HD2 expression

The sessile nature of plants necessitates a dynamic expression pattern that quickly

responds to challenges imposed by the environment. The ability for HD2s to globally

repress the genome in a specific manner suggests that it will be highly responsive to

such challenges, either at the level of transcription or post-translation. Linking the

expression profile of HD2 to various environmental stimuli remains in its infancy with

only a few studies published to date. Typically, environmental response pathways are

20

mediated by various hormones in specific signal transduction cascades that ultimately

change cell expression (Moore 1979; Davies 2010).

In barley the expression of the HD2 isoform HvHD2AC2-1 were measured in response

to treatment with jasmonic acid, abscisic acid and salicylic acid using quantitative RT-

PCR in seven day old seedlings that were either wild type or transgenic lines

overexpressing the HD2 isoform (Demetriou, Kapazoglou et al. 2009). It revealed a

strong induction in expression following JA treatment, a differential response between

the two over-expressing lines in response to ABA treatment while no conclusion could

be drawn following SA treatment. In rice a similar result was obtained, showing a

strong induction following JA treatment and repression following ABA. This led the

author to suggest that there are functional similarities in gene expressions between

monocots.

In Arabidopsis the relationship between HD2C and the ABA pathway have been well

characterized. ABA is a hormone that is primarily involved in drought and salt stress

response (Xiong, Schumaker et al. 2002), inhibition of seed germination (Penfield, Li et

al. 2006) and biotic attack (Hirayama and Shinozaki 2007). In Arabidopsis plants

treatment with ABA was shown to repress HD2C expression using RT-PCR (Sridha and

Wu 2006). In subsequent analyses all HD2 isoforms were shown to have a repression

of HD2 expression in response to ABA and NaCl treatment, suggesting a co-regulatory,

ABA dependent cis-element may be conserved within this family (Luo, Wang et al.

2012).

1.8 HD2 function

The function of HD2s has not yet been fully elucidated either at the molecular, cellular

or whole plant level. The molecular catalysis of histone deacetylation has previously

been reviewed and the lack of knowledge into its enzymatic properties is clearly a

signal for future research to be directed into this field. More recently studies have

focused on forward and reverse genetic screens of the protein’s function, both

because this provides insight into the molecular process of the enzyme and because of

the significance of understanding a critical player in the epigenetic pathway that has a

process endemic to eukaryotes, yet evolutionarily specific to plants (de Ruijter, Van

21

Gennip et al. 2003). From these analyses, critical functions in the context of

development and environmental response have been determined.

Development

It has been well established that HD2 is involved in development of reproductive

tissue. Its initial characterization resulted from the observation of its high level of

expression in maize embryonic tissue, suggesting that it either maintains the seed

state or drives the transition to seed germination of the plant (Brosch, Lusser et al.

1996). Additionally, a number of reverse genetic screens have demonstrated that HD2s

are involved in development, specifically of reproductive tissue. HD2A down-regulation

by RNAi resulted in an aborted seed development phenotype and led the team to

conclude that its function was required for seed to seedling transition (Wu, Tian et al.

2000). Subsequent T-DNA knockout experiments have not shared this specific

phenotype, although it has been suggested that due to sequence redundancy the RNAi

was effectively knocked down expression of all HD2s, leading to a general reduction in

the pool of HD2s in the plant (Colville, Alhattab et al. 2011). The combination of these

results suggest two probable hypotheses; firstly that HD2s are together involved in the

seed formation process and secondly that there is a level of functional redundancy

existing within this family which allows HDAC activity to proceed in the absence of a

single isoform.

A study into Solanum chacoense, a model species for research in fertilization, showed

that an HD2A orthologue was strongly induced in specific ovular regions following

fertilization (Lagace, Chantha et al. 2003). Moreover, this was a highly tissue specific

accumulation only evident in in situ hybridization, whereby ovular expression was

heightened with no difference in HD2 levels in closely surrounding tissue. They

rationalized the formation of siliques with a seedless phenotype which was observed

in the HD2 knockdown plants was related to the absence of this specific surge of

expression in the ovules integument.

Stress response

There is a current concerted effort to identify and manipulate pathways related to

plant stress response because such environmental stresses directly influence the yield

22

of all cropping plants (Berman and DeJong 1996; Peng, Huang et al. 2004; Schijlen, Ric

de Vos et al. 2004; Gill and Tuteja 2010). The capacity for yield gain and loss from year

to year has long been correlated to the environmental stresses faced by plants

annually (Peng, Huang et al. 2004). Traditionally this has been best correlated to

rainfall; however other factors that are increasingly relevant include salinity,

temperature and mechanical stresses that may be caused by wind or precipitation.

In plants there are a number of models showing that the acetylation state of histones

is linked to a plant response to abiotic stresses such as cold, salt and drought (Bae, Cho

et al. 2003; Kim, To et al. 2008; Chen, Luo et al. 2010). The HD2C protein has been

implicated in plant stress response related to salt, drought and ABA (Sridha and Wu

2006). Transgenic lines containing an HD2C-GFP construct conferred a decreased

sensitivity to the inhibition of root growth by NaCl and a corresponding increase in

germination rate when grown on 100mM NaCl conditions. Additionally, over-

expressing lines had an observed partial stomatal closure which correlated to reduced

transpiration and increased drought resistance. This was confirmed by the same group

in subsequent studies where they used T-DNA insertion HD2C knockouts to show a

conversely sensitive phenotype to ABA and NaCl, suggesting that this is a novel

regulator of ABA and salt stress response in Arabidopsis (Luo, Wang et al. 2012).

Recognizing that there was likely to be a link between the ABA resistant phenotype

present in HD2 over-expressing transgenic lines and the ABA response genes that

mediate the hormones signal transduction chain, the researchers analysed the

expression of the response genes in the transgenic plants. Using RT-PCR, they found a

notable up-regulation of LEA class genes which are expressed during seed

development and are implicated in the protection of cellular dehydration.

Contrastingly, there was a down regulation of genes related to water loss such as

ADH1, KAT1-2 and SKOR. While implicating the action of HD2C on these gene regions,

the researchers did not explore further to determine whether HD2C directly mediates

deacetylation of histones at their specific loci (Luo, Wang et al. 2012).

The recognition that HD2 is necessary for the development of reproductive tissue and

that the isoform HD2C is implicated in a stress response role of the plant is significant.

However, it is clear that further identification of the precise regions of genomic DNA

23

that HD2 acts upon is necessary to develop true insight into the mechanism by which it

uses that ultimately results in the observed phenotype.

1.9 HD2s- functionally redundant?

The issue of the level of functional redundancy between isoforms is currently being

determined from several groups. The discrepancy seen between the RNAi and

knockout of AtHD2A previously described has led some to suggest that this is evidence

that redundancy between isoforms is significant (Wu, Tian et al. 2000). Similarly there

does not appear to be a significant difference between the expression patterns of

HD2A-C. However several lines of evidence suggest that this is not true. Firstly,

differences were observed between HD2A and HD2C in the seed germination rates on

glucose, ABA and NaCl (Colville, Alhattab et al. 2011). Secondly, developmentally

abnormal phenotypes seen in the AtHD2A plants were not evident in the AtHD2C

plants, suggesting some deviation in function between the two isoforms. Lastly, a

significant structural difference between isoforms HD2A/C and HD2B/D is the presence

of a zinc-finger motif that may influence a regulatory role between either DNA or

protein binding (Lawrence, Earley et al. 2004). This significant structural moety is likely

to impart a specific subset of processes which suggest a diversification of functions

between isoforms.

1.10 The HD2 complex- determining a higher level protein interactome

‘Interactomics’ describes the study of how molecules are functionally linked in a cell or

organism, and the outcome that these interactions play on the organism’s homeostasis

(Collura and Boissy 2007). Whereas specific functions may be uniquely attributed to a

single protein or protein family; it is inevitably bound by a multitude of other proteins

that control some aspect of its activity. Thus any single protein will itself have an

‘interactome’ defined by the subset of proteins that it binds to, which itself is

dependent on the cell expression state at the time (Marras and Capobianco 2008). The

identification of a protein’s interactome is important when trying to determine its

higher function. Significant insights into the core functions of HD2s have been

determined based on the identification of their interacting partners, either confirming

24

hypotheses based on extrapolations of mammalian HDACs, or by raising new and novel

hypotheses.

A significant feature of mammalian HDACs is that the catalytic activity of the enzyme is

directed to specific substrates by other proteins. A HD2 homologue from longan fruit

was shown to interact with ERF1 using a combination of yeast 2-hybrid assay and

bimolecular fluorescent complementation (Kuang, Chen et al. 2012). ERF1 belongs to

the ethylene response factor (ERF) family of proteins and constitutes one of the largest

transcription factor families in plants. Specifically ERF1 binds to the GCC box of

ethylene regulated promoters. This study focused on the implication of HD2 co-

operation with ERF1 in the context of fruit senescence. However the wider

implications of HD2 interaction with transcription factors is in line with a model

whereby histone deacetylase activity is directed to specific promoters through client

protein led specificity.

Luo and colleagues identified and characterized the interaction between HD2C and

HDA6 using a combination of BiFC, co-imunoprecipitation and pull-down analysis to

suggest that these proteins interact physically with one another (Luo, Wang et al.

2012; Luo, Wang et al. 2012). This interaction was used to rationalize the ABA and NaCl

response seen in HD2C knockout plants also used in this study. The ABA and NaCl

response in plants with altered HD2C expression had previously been identified by this

group, where plants over-expressing an HD2C-GFP construct were resistant to

germination on media with high salt or ABA. They subsequently showed interaction

using the BiFC assay between all HD2 isoforms and both HDA6 and HDA19. Taken

together, these results suggest that there is some level of overlap between the

pathways affecting plant specific and non-plant specific histone deacetylases.

Another important aspect of HDAC activity that has been identified in mammalian

systems is the cross talk between various epigenetic pathways. As previously

mentioned, DNA methylation has been shown to mark specific regions of DNA for

methyl-DNA binding proteins, which themselves mediate the formation of a chromatin

remodelling complex. Several mammalian HDACs have been shown to be involved in

such complexes; indeed the condensation of chromatin is an important step in down-

regulating gene expression via the epigenetic pathway. HD2s have been implicated in

25

this process following the discovery that they bind a DNA methyltransferase in

Arabidopsis (Song, Wu et al. 2010). Here it was shown to bind HD2C, with the binding

shown to affect the DNA methyltransferase activity.

The activity of HDACs has previously been shown to be dependent on post-

translational modifications. Indeed, the HD2 isoform characterized in the initial study it

was shown to have its catalytic activity determined by the phosphorylation state

(Lusser, Brosch et al. 1997). In a pull-down analysis it was identified that putative 14-3-

3 binding proteins, isoforms HD2A-C were identified by mass spectrometry to be co-

precipitated with 14-3-3 epsilon (Paul, Liu et al. 2009). These results are not

confirmation of interaction as they are not performed in planta, and do not match the

requirement of utilizing multiple technologies to identify interaction. 14-3-3 proteins

bind to specifically phosphorylated serine or threonine residues and have been

characterized to recognize specific consensus motifs termed motif 1-3 (DeLille, Sehnke

et al. 2001; Johnson, Crowther et al. 2010). While no HD2 contains such a motif, it

suggests the possibility that it binds to the phospho-HD2 at a novel site and may

mediate HD2 catalytic activity.

The identification of novel HD2 interactions has thus yielded significant insight into the

function and mechanism of HD2 activity that may otherwise not be easily

characterized. It is likely that further core functions of this family of enzymes may be

discovered by uncovering and characterizing other interacting partners. Such novel

interactions would thereby provide valuable insight both into the core function of the

enzyme, as well as providing a biological context in which this function is activated.

1.11 Project hypothesis and aims

1.11.1 Hypothesis

After the initial biochemical analysis of enzyme activity to identify this gene family as a

histone deacetylase enzyme, research has been redirected to molecular biological

studies to identify their biological role in the context of gene regulation. Despite a

growing body of knowledge being made in this field, research has so far concentrated

on developing insight into the role of the proteins using phenotypic marker analyses.

Here changes at the plant level during developmental, temporal, spatial and

26

environmental conditions using wild type and mutant lines reflect the action of HD2

and thus implicate their action in a variety of roles (Wu, Tian et al. 2000). As previously

identified, this has been used to great effect to show that these are down-regulators of

gene transcription with principle roles in development, stress response, and as

negative regulators of elicitor-induced cell death.

From the studies performed so far it is clear that there are a number of aspects still to

be considered relating to the function of HD2 proteins. Most overtly, and the overall

aim of this project, is to identify the mechanism of their regulation in the context of

gene regulation. In mammalian histone deacetylases this has been more widely

researched and it has become clear that as in most biological systems, these enzymes

do not work in isolation. Rather, activity is brought about through the combinatorial

efforts of many different factors. These contribute to the sequestration of the protein

to the subcellular location of its activity, the regulation of this enzymatic activity and

the direction of enzyme activity to specific targets within this location.

While it has been shown that these gene families have arisen from different

evolutionary pathways, there are several lines of evidence supporting the hypothesis

that there are shared regulatory mechanisms involved between mammalian histone

deacetylases and HD2.

1. Phosphorylation has been shown to regulate both nuclear-cytosolic localization

and enzymatic activity in mammalian HDACs. Similarly, it was shown that only

the phosphorylated HD2 is active (Lusser, Brosch et al. 1997), suggesting a

possible role in modulating the enzyme’s activity. Furthermore, mammalian

HDACs have been shown to be regulated at these phosphorylated residues by

14-3-3 proteins. In a recent co-immunoprecipitation screen of 14-3-3 binding

targets in Arabidopsis thaliana, HD2A-C have been listed as putative targets,

suggesting that these phosphorylation sites are also targeted by 14-3-3s.

2. Both homo-dimerization and hetero-dimerization between HDACs in mammals

have been shown to regulate protein activity and the gene targets that they act

on (Fischle, Dequiedt et al. 2002). Such dimerization events have been

speculated on since the enzyme was purified to homogeneity yet ran on an SDS

gel with an approximate size of 400kDa (Lusser, Brosch et al. 1997).

27

3. DNA and histone modification enzymes are rarely directed to their gene targets

in isolation; rather DNA-binding factors take the enzyme to specific sequences

that they recognize and allow modification at these sites. Such a mechanism

has not been proven in the HD2 gene family; however the presence of a single

zinc-finger domain in HD2A and HD2C has led other groups to speculate that

this may be a site of protein binding rather than direct DNA binding. A clear

hypothesis would therefore be to suggest that this is a docking site to allow

general DNA binding proteins to regulate the DNA-histone/HD2 interaction.

1.11.2 Project aims

From the above hypothesis it is clear that the current hole in understanding into the

regulatory mechanism of the HD2s is both present and easily filled. This project

therefore aims to identify the regulation underlying this enzyme at three levels; the

subcellular localization of the protein, control of the enzymatic function and the

prospect of other proteins directing the HD2s to specific genes under defined

biological conditions. The general aims are listed below:

1. Determine the capacity for the four Arabidopsis HD2 proteins to homo- and

hetero-dimerize in planta and subsequently determine the region/s necessary

for dimerization.

2. Analyse the effect that nuclear import may have on the ability of HD2s to

dimerize in the cell.

3. Determine the capacity for the four Arabidopsis HD2 proteins to bind 14-3-3

proteins in planta. Use this same method to determine whether all 14-3-3

isoforms have the potential to bind HD2.

4. Determine the HD2 residue/s necessary for 14-3-3 binding and conduct

enzymatic and phenotypic tests to analyse the impact that destroying this site

may have on the protein’s function.

5. Use bioinformatics, predictions and publications to identify novel proteins that

bind to HD2C. These will then be confirmed using BiFC to test whether this

interaction is conserved across the gene family.

28

By the conclusion of this project there will be a further understanding into the field of

the HD2 proteins, specifically with regard to their regulation. Furthermore, it will

develop an insight into the role that HD2 has on regulating gene expression at both the

cellular and holistic level which has so far been outside of the scope of the previous

studies in this field.

29

Chapter 2 Materials and Methods

30

2.1 Materials

Materials Supplier

Acrylamide Amresco

Agar, Bacteriological Amresco

Agarose, Molecular grade Bioline

Ammonium nitrate Univar

Ammonium persulfate Sigma-Aldrich

Antibodies (HA-probe/ c-myc) Santa Cruz Biotechnologies

Bromophenol Blue (BPB) Bioline

Calcium chloride AnalaR®

D-glucose (anhydrous) Univar

Dithiothreitol (DTT) Bioline

EDTA disodium salt Univar

Ethanol Chem-Supply

Glycerol Univar

Glycine Amresco

HEPES AppliChem

Intercept® 70WG Scotts

Isopropanol Asia Pacific Specialty Chemicals

limited

Magnesium chloride Univar

Magnesium sulfate Univar

Manganese (II) chloride Univar

MES free acid monohydrate Amresco

Methanol Univar

3-(N-morpholino)propanesulfonic acid

(MOPS)

Sigma-Aldrich

Oligonucleotides Integrated DNA technologies

Phenylmethanesulfonylfluoride (PMSF)

Poly (unylpolypyrrolidone) PVPP Sigma-Aldrich

Potassium acetate AnalaR®

31

Potassium chloride Sigma-Aldrich

Potassium dihydrogen phosphate

(Anhydrous)

Amresco

Potassium hydroxide Univar

Restriction endonucleases New England Biolabs

Rubidium chloride Sigma-Aldrich

SDS Amresco

Silwet L-77

Sodium chloride Univar

Sodium hydrogen phosphate (Anhydrous) Amresco

Sucrose Amresco

TEMED Sigma-Aldrich

Tris Amresco

Tryptone Amresco

Tween 20 Sigma-Aldrich

Yeast extract, Bacteriological Amresco

32

2.2 Methods

2.2.1 General methods

2.2.1.1 Centrifugation

Centrifugation steps were performed in a bench-top microcentrifuge (Eppendorf,

Germany) at 16000xg and room temperature unless otherwise specified.

2.2.1.2 Autoclaving

Autoclaving was performed in a Gentinge lab steriliser autoclave, and occurred at a 15

minute incubation at 121 degrees Celsius under pressure of 30psi unless otherwise

specified.

2.2 Plant growth and transformations

2.2.1 Sterilizing seeds

Arabidopsis thaliana seeds used to sow onto MS media were surface sterilized to

ensure that the competing growth of fungi and bacteria did not affect the germination

or growth of seedlings. Arabidopsis thaliana ecotype Columbia 0 seeds were pooled

into 20mg sets and surface sterilized by incubation in 1mL sterilization solution for six

minutes with periodic inversions. The seeds were moved to a laminar flow and allowed

to settle under gravity, with the supernatant subsequently discarded. Seeds were

washed twice with 1mL of 95% ethanol. Following the second wash, the supernatant

was removed by micropipette and the remaining seeds dried at room temperature for

approximately four hours with the microfuge tubes cap off. Surface sterilized seeds

were kept at room temperature and under dark conditions in the sterile

microcentrifuge tube until required.

2.2.2 Seed sowing

Seeds were sown either onto MS agar or into compost, whereas Nicotiana

benthamiana seeds were sown only into compost.

MS agar: MS media was prepared (Murashige and Skoog basal salt mixture, 2.15g/L;

2mM MES; pH 5.8; 0.8% agar) and sterilized seeds scattered on top to a density of

~200 seeds/plate. Plates were then wrapped in tinfoil to maintain darkness and

33

stratified for 2 days at 4 degrees Celsius to facilitate homogeneous germination. After

stratification, seeds were placed in a growth cabinet at 16 hour day/night cycles (~80-

100μE/cm2, cool, fluorescent white light) and 22°C.

Compost mix was prepared and transferred into either 12cm pots (floral dip) or pot-

trays with 5cmx5cm cavities. These were then placed in cat-litter trays filled with a

solution containing three liters of water and 100mL Presept insecticide solution. These

were kept in the solution for two hours to allow the solution to penetrate the

compost. Pools of 20-30 seeds were then scattered onto the compost and pressed

lightly into the soil. In the instance of floral dip, the tops of the pots were covered and

bound in fly screen. Pots were further covered in Saran (plastic) wrap to prevent drying

out of the compost and in tinfoil to keep seeds dark. Potted seeds were stratified for 2

days at 4°C and then moved to a growth cabinet where they were grown under 12

hour day/night cycles at 22°C and ~80-100μE/cm2, cool, fluorescent white light.

2.3 Transformation of A. thaliana leaves

2.3.1 Floral dip

Healthy pots of ecotype Col-0 Arabidopsis thialiana seeds were densely grown in pots.

Fly screen was fastened to the top ensuring that later inversion of the pots would not

cause plants or soil to fall out. After ~5 weeks, the first bolts of influorescence were

removed to encourage a greater subsequent proliferation of flowers.

At this time, A. tumefaciens strains carrying the genes of interest (section ) were grown

in 200 mL of selective LB broth containing Kanamycin (50μg/mL), Rifampicin (50μg/mL)

and Gentamicin (5μg/mL) overnight at 30°C. The overnight bacterial cultures grown

were centrifuged at 5000xg and 4 degrees Celsius and resuspended in 200 mL of 5%

sucrose solution to give a final optical density OD600 of 0.8. Prior to dipping in the case

of Arabidopsis, Silwet L-77 solution was added to the sucrose solution to give a final

concentration of 0.05% (v/v) and mixed thoroughly by repeat inversions. Silwet L-77

allows the lowering of surface tension of aqueous solutions and thus allows for a more

effective infiltration of the protein-vector construct of interest.

34

The prepared Arabidopsis plant was then dipped into the A. tumefaciens sucrose

solution and gently agitated for 10 seconds. Care was taken to ensure all inflorescence

and rosettes were immersed in the solution before returning the plants to a tray in the

growth cabinet covered under commercial ‘sandwich bags’ for 24 hours to maintain

high humidity. Plants were watered normally before a second round of floral dip was

performed six days after the first procedure. Following the second floral dip, loose

bolts were covered with small paper bags and taped to collect the seeds.

2.5 Bacterial preparations and transformations

2.5.1 Competent cell preparation (E.coli)

E.coli DH5 cells were streaked from glycerol stocks on LB agar plates to obtain single

colonies and incubated overnight at 37°C. A single colony was picked and grown

overnight at 37 °C in 4mL LB broth. A 1mL aliquot from this culture was used to spike

100mL of LB broth, which itself was grown to an OD600 of 0.4-0.6. Once reached, cells

were pelleted by centrifugation (Beckman-Coulter, Australia) at 5000g for five minutes

at 4°C. The supernatant was removed and the cell pellet gently resuspended in 40mL

of ice cold TFBI solution at 4°C. Cells were then pelleted by centrifugation at 5000g for

five minutes and 4°C. The supernatant was again removed and the cells resuspended

in 4mL ice cold TFBII solution and left on ice for ten minutes. Cells were then either

used immediately or alternatively snap frozen in liquid nitrogen and stored at -70°C

until needed.

2.5.2 Competent cell transformation (E.coli)

Competent E.coli DH5 cells were obtained either directly following preparation or

from stocks stored at -70 °C which were kept on ice until partially thawed. Further

manipulations of competent cells were performed on ice to ensure maximum

transformation efficiency. A ~5ng sample of plasmid DNA was added to 50μL of

competent cells, mixed gently and incubated on ice for 30 minutes. Following

incubation, the cells were heat shocked at 42 °C for 45 seconds and placed

immediately back on ice. LB media (500μL) pre-warmed to 37 °C was added to the

transformation and gently mixed by inverting three times. Cells in LB medium were

35

then incubated at 37°C for 45 minutes on a shaking incubator at 250rpm for post-shock

recovery. After incubation, 50μL of transformed cell suspension was streaked out on

an LB agar plate supplemented with 50μg/mL kanamycin. The remaining 450μL of the

culture were centrifuged for ten seconds and 400μL of the supernatant was removed.

The cells were resuspended in the remaining 50μL of the supernatant and streaked

onto a second LB plate as described above. Bacteria were allowed to grow overnight at

37°C until colonies had grown to >2mm in size.

2.5.3 Agrobacteria competent cell preparation

A glycerol stock of A.tumefaciens cells was streaked onto selective LB agar plates

containing Rifampicin 50μg/mL and Gentamicin 5μg/mL. These plates were incubated

at 30°C for three days until colonies had grown to >2mm. A single colony was used to

inoculate 3mL of LB medium containing Rifampicin 50μg/mL and Gentamicin 5μg/mL.

The cell suspension was incubated overnight at 30°C with 250rpm overnight shaking.

Of the resulting culture, 100μL was used to inoculate 50mL of selective LB medium

containing Rifampicin 50μg/mL and Gentamicin 5μg/mL. The cell suspension was

incubated overnight at 29°C with 250rpm overnight shaking until the OD600 reached

0.75. The cell culture was then chilled on ice for 10 minutes before centrifugation at

3000 x g for 10 minutes at 4°C. The supernatant was discarded and the pellet of

A.tumefaciens cells was rinsed and gently resuspended in 1mL of ice-cold 20mM CaCl2

solution, followed by another centrifugation to remove the excess antibiotics. The

resulting cell pellet was resuspended in ice-cold 20mM CaCl2 (1 mL per 50 mL culture)

and transferred in 0.2mL aliquots to sterilised microfuge tubes. The tubes were

subsequently snap-frozen in liquid nitrogen and either used immediately or stored at -

70°C.

2.5.4 Agrobacteria competent cell transformation

Transformation of A.tumefaciens competent cells was performed following validation

of plasmid DNA by restriction mapping and DNA sequencing. A 50μL aliquot of

competent cells was used either directly after preparation or from storage at -70°C. To

the cells, ~20ng of plasmid DNA was added and mixed gently by agitation. Plasmid DNA

36

was inserted into the cells by successive 5 minute incubations of the DNA-cell mixture

on ice, in liquid nitrogen and at 37°C respectively. After the final incubation 400μL of

LB broth was added and the cells were recovered by a two hour incubation at 30°C

with orbital shaking at 250rpm. The resulting transformants were plated onto selective

LB agar plates containing Kanamycin (50μg/mL), Rifampicin (50μg/mL) and Gentamicin

(5μg/mL) in 50μL and 200μL aliquots for incubation at 30°C. Successful transformations

should yielded >50 colonies after three days of incubation at 30°C.

2.5.5 A.tumefaciens infiltration of Nicotiana benthamiana leaves

A single colony of A.tumefaciens containing the vector construct of interest (section

2.2.4.4) was inoculated in 5mL of LB medium containing Kanamycin (50μg/mL),

Rifampicin (50μg/mL) and Gentamicin (5μg/mL) and cultured overnight at 30°C with

constant shaking at 250rpm. The resulting culture was centrifuged the following day

and the supernatant removed. The pelleted cells were resuspended in 1.5mL of

infiltration buffer and the OD600 measured. Typical measurements were within the

range of 1.5-3. Ideal infection and subsequent transient transformation is observed

where OD600 is within the range of 0.6-1, thus the cells were diluted to give a

calculated OD600 of 0.75 in 1mL of cell mixture. Acetosyringone was added to a

concentration of 200µM and incubated on ice for an hour. Working suspensions were

prepared by combining the appropriate clones containing the two putatively

interacting proteins, as well as the p19 plasmid at a 1:1:1 ratio. The mixed

A.tumefaciens strains were co-infiltrated into the abaxial air space of N.benthamiana

leaves using a 1mL syringe. Infiltrated plants were returned to the growth cabinet and

grown under long day conditions for 3-4 days before leaf samples were prepared and

observed for protein interaction in the lower epidermal cell layer as indicated by

fluorescence.

2.6 Nucleic acid manipulations

2.6.1 Phenol extraction

DNA was purified from protein using phenol extraction when inactivation of enzymes

such as KpnI was not possible by standard heat inactivation. The DNA solution was

37

mixed with one volume phenol:chloroform:isoamylalcohol (25:24:1) and vortexed for

20 seconds. Subsequent centrifugation was performed for five minutes, allowing

separation of organic and aqueous liquid phases. The aqueous phase containing DNA

was removed and used for downstream purposes whilst the protein remained in the

organic interphase and was discarded.

2.6.2 Ethanol precipitation

Ethanol precipitation was used to purify DNA from a buffer solution. Here, 0.1 volumes

of 0.3M sodium acetate solution was added to the DNA solution and mixed by vortex,

followed by the addition of 2.5 volumes of 100% ethanol. This was mixed by inversion

and incubated on ice for five minutes before the DNA precipitated was collected by

centrifugation for five minutes. The supernatant was discarded while the pellet

containing DNA was washed with 1mL of 70% ethanol, mixed by inversion and

centrifuged for five minutes. The supernatant was again removed and excess ethanol

was evaporated off at room temperature for 15 minutes. The DNA pellet was

resuspended in 30μL SDW for downstream purposes unless otherwise stated.

2.6.3 Isolation of genomic DNA from Arabidopsis thaliana plants

DNA was purified from seedlings of approximately 3 weeks old, grown in compost as

previously described. Whole seedlings were taken, snap-frozen in liquid nitrogen and

ground to a fine powder using a pre-cooled mortar and pestle. To this, 500μL of

2xCTAB solution was added and the suspension was transferred to a pre-cooled

microfuge tube. The suspension was then mixed by vortex for approximately one

minute until the mixture appeared homogenous. Samples were then incubated firstly

at 65° C for two hours in a water bath and then cooled for 5 minutes at room

temperature. A 1uL RNase A (10μg/ml) solution was added and incubated for 30

minutes at 37°C to degrade RNA. Samples were again cooled to room temperature and

DNA was isolated from cellular debris by the addition of 500μL of

chloroform:isoamylalcohol (24:1) which was mixed carefully into the solution by

inversion. The DNA was subsequently isolated by centrifugation for ten minutes,

where phase separation enabled the aqueous supernatant containing genomic DNA to

38

be transferred to a new tube. The chloroform:isoamylalcohol treatment was repeated

with the DNA containing supernatant again transferred to a new tube. To this, 0.8

volumes isopropanol was added and mixed carefully by inversion to precipitate DNA

and centrifugation for ten minutes used to collect the precipitated the DNA. The

supernatant was discarded and the pellet washed with 1mL 70% ethanol followed by a

one minute centrifugation. The supernatant was again removed and the pellet was

dried for 20 minutes at room temperature. The purified genomic DNA was dissolved in

50μL SDW and the solution stored at -20° C.

2.6.4 Polymerase Chain Reaction (PCR)

PCR was used both as the first step of cloning and additionally to detect specific DNA

sequences in bacteria and plants. The difference is derived from the differing type of

DNA polymerase used.

2.6.5.1 High fidelity cloning PCR

This was performed using the Accuzyme (Bioline) premixed solution of polymerase, a

high fidelity polymerase which yields blunt ended amplicons. A standard reaction

contains 25μL of Accuzyme mix, 10pg of forward and reverse primers, 1-5ng of plasmid

DNA and SDW to 50μL. Reaction was mixed by vortex, centrifuged briefly and loaded

onto the thermocycler immediately to prevent degradation of primers by the DNA

polymerase.

2.6.5.2 Standard Taq polymerase, qualitative PCR

Low fidelity PCR was performed as above except, the Accuzyme premix was not used.

In its place, Taq Polymerase (Bioline) was used along with the required buffers

supplied and dNTPs (10mM stock, Bioline). Primer concentration and amount of DNA

and SDW were the same as stated above.

39

Table 2.2: Primers used for PCR amplification of DNA

Primer description Forward primer sequence

shown 5’ to 3’

Reverse primer sequence

shown 5’ to 3’

Full length genes cloned for BiFC and GFP analysis

HD2A PG179NS cloning TTGATTCTTAGCCATGGAGT

TCTGG

TAAGAAACCACTAGTCTTGG

CAGCAGCG

HD2B PG179NS cloning GGAATCTAGAATGGAGTTC

TGGGGAGTTGCGGTG

CGATCTCGAGAGCTCTACCC

TTTCCCTTGCC

HD2C PG179NS cloning CACAACAATGGAGTTCTGG CGACTCTCGAGAGCAGCTG

CACTGTGTTTGGCCTTTG

HD2D PG179NS cloning TTTCACTAGCTATGGAGTTT

TGG

AATATCTCGAGCTTTTTGCA

AGAGGGACCACAAGG

TGA2 PG179NS cloning ATATGGCTGATACCAGTCCG

AGAAC

CGATCTCGAGCTCTCTGGGT

CGTGCAAGCCATAAG

TGA5 PG179NS cloning AATGGGAGATACTAGTCCA

AGAAC

CGATCTCGAGCTCTCTTGGT

CTGGCAAGCCATAG

TGA6 PG179NS cloning CATGGCTGATACCAGTTCAA

GGAC

CGATCTCGAGCTCTCTTGGT

CGTGCAAGCCACAAGGAAC

HD2C deletion primers for BiFC and GFP analysis

HDT3 75 forw: ATGATCTCTCAGGTTGCTTTGGGAG

HDT3 180 forw: CTATG GAGAAGTTTCCTCAGCTGTC TACGG

HDT3 255 forw: ATG AGCGT TTTCTTCTCTGGTTACAAAG

HDT3 360 forw: CTATG GCTGCGAAACAGGTGAACTT TCAG

HDT3 435 forw: ATG GACG GTAGTGAAGAGGATTCTTC

HDT3 540 forw: ATG GAAGAAGATGACTCCTCAGA AGAG

HDT3 615 forw: ATGTCCTCCAAGAACCCTGCGTCCAAC

HDT3 720 forw: CTATGCAGGCGGGTAAGAATTCTGGTGGAG

HDT3 795 forw: ATG GCGTTTGGGTGCAAGTCGTGC

HDT3 180 rev: GGAAACTTCTCGAGAGATAGCGTTCCAATG

HDT3 255 rev: CGATCTCGAGCTTCCAAGTATGAGACAGCG

CAAAG

40

HDT3 360 rev: CGATCTCGAGAGCAGCTTTGAAACCAGCAG

CCTC

HDT3 435 rev: CGATCTCGAGAGCGTCATCATCTTGCTTGGC

TTTG

HDT3 573 rev: CTTCCTCCTCGAGTCCAGAGTTTTC

HDT3 681 rev: GAATCTGTTTTCTCGAGAGTTACAAAC

HDT3 720 rev: CGATCTCGAGCTGTTTTGAGGGATGAGGAG

TTG

HDT3 795 rev: GGTGTCTCGAGCTGCTTCGATGTCTCTCCAG

HD2 Site Directed Mutagenesis Primers

265 SDM FOR

GCTCACGCTAAGGCCAAAC

ACAGTGCAGCTG

GCCTTAGCGTGAGCCTGCA

ATCCCATTTC

234 SDM FOR

GCAGCAGGAGAAGCAGCAA

AGCAGCAGCAGAC

TGCTGCTTCTCCTGCTGCGC

CTCCACCAGAATTC

260 SDM FOR

AAGCACCGAAGGCAGCAGG

AGCGTTTG

CTGCCTTCGGTGCTTGCTGC

TGCTTCGATG

272 SDM FOR

AGGCATGCGCAAGAACCTT

TACTTCGGAAATG

TTCTTGCGCATGCCTTGCAC

CCAAACG

HDT3 KKR>AAA SDM

CCGCAGCAGCATCAGCAGA

ACCCAACTCCTCCAAG

TGATGCTGCTGCGGGTTCTT

CAGGCTTCTTTGG

HDT4 KKA>KKR SDM AAGCGACCAAATGGTGCAT

TTGAGATAGCTAAAG

CACCATTTGGTCGCTTTTTG

CTCGGAGGAG

Primers for cloning into Yeast 2-hybrid vectors

Clon PGAD HDT1 For GGAGGCCAGTGAATTCATG

GAAGTTAAATCAGGAAAGC

CGAGCTCGATGGATCCTTAC

TTGGCAGCAGCGTGC

Clon PGAD HDT2 For GGAGGCCAGTGAATTCGTT CGAGCTCGATGGATCCTTAC

41

GCGGTGACACCAAAAAAC TTTCCCTTGCCCTTGTTAG

Clon PGAD HDT3 For GGAGGCCAGTGAATTCGGT

GTTGAAGTTAAGAATGG

CGAGCTCGATGGATCCTTAA

GCAGCTGCACTGTGTTTG

Clon PGAD HDT4 For GGAGGCCAGTGAATTCGGT

ATCGAGATTAAGCCAGG

CGAGCTCGATGGATCCTTAC

TTTTTGCAAGAGGGACCAC

Clon PGAD Eps For GGAGGCCAGTGAATTCATG

GAGAATGAGAGGGAAAAG

CGAGCTCGATGGATCCTTAG

TTCTCATCTTGAGGC

Clon PGAD TGA6 For GGAGGCCAGTGAATTCGCT

GATACCAGTTCAAGGAC

CGAGCTCGATGGATCCTCAC

TCTCTTGGCCGGGCAAG

HDT3 Clon ZF For

GGAGCAAAGTCGGCCACCA

GAACCTTTACTTCG

GTGGCCGACTTTGCTCCAAA

CGCTCCTGCAGACTTC

Sequence primers

35S-seq forward primer GTAAAGACTGGCGAACAG

NYFP-seq reverse primer ATGAACTTCAGGGTCAGC

CYFP-seq reverse primer AGCTCAGGTAGTGGTTGTC

42

2.6.6 Miniprep

The miniprep procedure was performed using the ‘Wizard® Plus SV Minipreps DNA

Purification System’ as per standard instructions. The column was dried of

contaminating ethanol by a further five minutes of centrifugation at low speed with

the centrifuges lid off, with the DNA finally captured into a microfuge tube through the

addition of 50μL of SDW and a final one minute centrifugation.

2.6.7 Midiprep

Midiprep was performed using a kit supplied from Qiagen following standard protocol

instructions. DNA was air dried at room temperature for 30 minutes and re-dissolved

in 100μL SDW. This was stored at -20°C for downstream applications.

2.6.8 Restriction digestion

Restriction enzymes and associated buffers were purchased from New England Biolabs

(NEB). Plasmid DNA was digested in 1.7mL microfuge tubes containing ~1μg of

plasmid DNA, 2μL of appropriate NEB 10X reaction buffer, 0.2μL of 100X BSA solution

and 10 units of the appropriate NEB restriction enzymes (Table 2.3). These reaction

tubes were vortexed and centrifuged briefly before incubation at 37°C for four hours.

Double digestions were performed where there was an overlap in buffer

compatibilities where the enzyme had >75% activity in a certain buffer. Otherwise,

single digestions were performed in order and separated by a heat inactivation and

ethanol precipitation step.

2.6.9 Agarose gel staining, excision and purification

Digested DNA that required downstream reactions were purified by agarose gel

staining, excision and purification to prevent liberated DNA strands contaminating

further ligation reactions. An agarose gel was prepared in an identical manner as

described in section 2.6.4 with the exception that the addition of ethidium bromide

was omitted. After the DNA samples have been run and separated on the agarose gel,

the gel was added to 200mL of a 0.05% methylene blue solution and incubated for an

43

hour at room temperature with shaking at 50rpm. The methylene stain resolves DNA

at amounts down to 100ng and is facilitated by greater contrast. This was achieved by

removing the methylene blue and destaining with SDW for an hour, at which point the

appropriate DNA strand is clearly in evidence. This was removed by scalpel and at this

point the DNA is purified from the gel following the ‘Wizard® SV Gel and PCR Clean-Up

System’ standard protocol. The resulting solution containing the DNA of interest was

stored at -20°C until required for downstream applications.

2.6.10 Ligation

Unless otherwise mentioned, all ligation reactions were carried out in a reaction mix

containing 1μL each of T4 DNA ligase buffer (NEB), T4 DNA ligase (NEB) and

vector:insert ratio of 1:3. The volume of gene insert to be utilised was determined

based on the amount of DNA present as approximated from an agarose gel. A final

reaction volume of 10μL was apportioned with SDW. The microfuge tubes were briefly

vortexed and centrifuged before being left to incubate either room temperature for

one hour, or overnight at 4°C to allow ligation reaction to occur. Selection for

successfully ligated gene-vector construct was carried out by transformation and

growth of DH5α competent cells (section 2.2.4.2).

2.6.11 Semi-quantitative RT-PCR

RNA was extracted from 100μg plant tissue using the RNeasy Plant Mini Kit (QIAGEN)

following the standard procedure. cDNA was then prepared from the RNA extract by

taking 100ng of RNA and following the standard instructions for the Quantitect

Reverse Transcription Kit (QIAGEN). cDNA was then quantified using a nanodrop.

2.7 Protein assays and procedures

2.7.1 Western Blot

Western blots were performed on both A.tumefaciens infiltrated leaves and the stably

transformed A.thaliana leaves to ensure protein expression and validate protein

identity after co-immunoprecipitation. This is particularly relevant for BiFC as

fluorescence not observed must be attributed to non-interacting proteins rather than

the lack of protein expression in planta.

44

Preparation of samples and extraction of protein

Protein extraction was performed on plant tissue by first grinding in liquid nitrogen

until a fine powder was formed. A minimal aliquot of extraction buffer (50mM Tris-HCl,

pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, 20% glycerol, 1% Igepal CA-630,

Protease inhibitor cocktail [1:100]), roughly constituting 1mL per 1g of tissue was then

added to the sample and vortexed vigorously for a minimum of two minutes at room

temperature. Further extraction was achieved by homogenising with a hand held

homogeniser for another two minutes. Cellular debris was then cleared by centrifuging

the samples for five minutes, with the supernatant then aliquoted to another tube.

To standardise the amount of protein to be loaded for each sample, a BSA curve was

generated by measuring the optical density OD600 using the Biuret assay. The OD600

reading of each protein extract was also measured by diluting 5μL of protein sample to

795μL of sterile water and 200μL of Biuret solution. The volume of each sample to be

loaded was determined according to the amount of protein loaded for the most

diluted sample. The protein sample was diluted to 1x loading buffer concentration and

boiled for five minutes at 95 degrees Celsius in preparation for SDS-PAGE.

SDS-PAGE and protein transfer

Protein samples in loading buffer were loaded onto a 12% SDS-Polyacrylamide gel and

run at 200mV until the dye front reached the end of the gel. After SDS-PAGE the gel

may either be stained in coomassie blue to visualize the protein bands, or used to

transfer the protein bands onto a membrane for further Western blot.

Antibody incubations

The membrane was removed from the overnight blocking reaction and briefly rinsed

with two changes of wash buffer. Primary antibody, either mouse anti-cmyc or mouse

anti-HA antibody, was diluted 1 in 500 with wash buffer and incubated with the

membrane on an orbital shaker for one hour at room temperature. Thereafter, the

membrane was washed in >4mL/cm2 of washer buffer for 15 min at room

temperature followed by three five minute washes with fresh changes of the wash

buffer.

45

Secondary antibody solution was made up with a 1 in 400 dilution of the goat anti-

mouse HRP-labelled secondary antibody with wash buffer. The washed membrane was

incubated with secondary antibody solution for one hour at room temperature on an

orbital shaker, followed by two five minute washes with wash buffer. A final 50mL of

washer buffer was added and incubated for 15 min at room temperature.

Detection

Detection reagents (Amersham Detection solutions) were equilibrated to room

temperature before mixing in a ratio of 1:1 (0.125mL per cm2 of membrane).

In the dark room, Amersham Hyperfilm™ ECL film was cut to the size of the membrane

and placed vertically onto the membrane in the x-ray cassette. The cassette was closed

and exposed for one minute and subsequently developed in the developing solution

and fixed in the fixer solution. Subsequent films were developed with varying exposure

time based on the appearance of the first film being developed.

2.8 Microscopy

2.8.1 Fluorescence microscopy

Leaf samples to be examined for fluorescence were cut into 0.5cm X 0.5cm pieces and

loaded onto microscope slides using water as a fixative. The Olympus IX-71 inverted

fluorescence microscope was used to observe fluorescence in the lower epidermal cell

layer of Nicotiana benthamiana leaves. Two filters were utilised in this project.

The green fluorescent protein (GFP) observing filter U-MGFPHQ consists of an

excitation filter with a wavelength of 460-480nm, diachronic mirror of 485nm and a

barrier filter of 495-540nm. This filter set was used to visualise fluorescence resulting

from the reconstitution of the yellow fluorescent protein only as there was sufficient

overlap of both excitation and emission spectra between YFP and GFP.

The red fluorescent protein (RFP) observing filter U-MRFPHQ consists of an excitation

filter with a wavelength of 535nm to 555nm, diachronic mirror of 565nm and a barrier

filter of 570nm to 625nm. This filter set was utilised to differentiate autofluorescence

and genuine fluorescence generated from the reconstitution of the YFP protein or

46

whole GFP protein as YFP would not be expected to be sufficiently excited to emit

yellow light at this range.

2.8.2 Confocal microscopy

Leaf material from either transiently transformed N. benthamiana plants or stably

transformed Arabidopsis plants were loaded on glass slides using water as a fixative

solution. These were analysed using the confocal laser scanning microscope (CLSM)

using a TCS SP2 AOBS confocal microscope (Leica) through a 40Xobjective lens.

Confocal images were collected using the ‘Leica confocal softwareTM’ and the following

excitation lasers and emission channels were used:

Protein tag identity Excitation

wavelength (nm)

Emission wavelength (nm)

GFP 488nm 510-540nm

YFP 488nm 530-550nm

Chlorophyll autofluorescence 514nm 680-700nm

DAPI 358 nm 461 nm

2.8.3 Image analysis

Quantitative analysis of images was performed using the Image J plugin “confocal

stacks” (Abràmoff, Magalhães et al. 2004). Microscope images were imported into

Photoshop and the contrast and brightness altered.

47

Chapter 3

Characterization of the interaction and subcellular localization of

HD2C

48

3.1 Introduction

3.1.1 The impact of localization on regulating protein function

Identifying the regulation of enzyme activity is essential to building an understanding

of an enzyme’s role in the context of cell response. Knowledge of such regulation is

required as a basis for manipulating this role to divert cellular activity in a specific

direction (Martin 2010). A critical mechanism of enzyme control is by limiting

availability of enzyme to its substrate. In eukaryotes, this level of regulation is

facilitated through the compartmentalization of specific functions to organelles.

Moving an enzyme in or out of an organelle can prevent or enable access to the

enzyme’s substrate (Carmo-Fonseca 2002; Shaffer, Sharma et al. 2005). The advantage

of this is two-fold. Firstly, it ensures that there is a stable pool of enzyme present in the

cell so that signals can quickly be converted to action without the delay caused by gene

expression. Secondly, the removal of enzyme from its substrate is an energy efficient

mechanism of repression that is not dependent on specialized inhibitory proteins that

limit or block substrates from the catalytic domain.

Spatial regulation of a protein was identified in a number of RPD3-like histone

deacetylases (Grozinger and Schreiber 2000; Verdel, Curtet et al. 2000). This was

initially hypothesised when the mammalian RPD3-like HDAC5 was fused to GFP and

expressed in human cells to reveal a mixture of nuclear and cytoplasmic fluorescence

(Wang, Kruhlak et al. 2000). Localisation was subsequently shown to correspond to the

phosphorylation state of the HDAC with phosphorylation marking the protein for

sequestration to the cytoplasm and de-phosphorylation being a requirement for

nuclear import. The plant specific histone deacetylases belonging to the HD2s have not

been analysed to determine whether the regulation of localization is a relevant

mechanism of control for this enzyme. However, it was shown using both

immunofluorescence and direct visualization of GFP tagged HD2 proteins that a

number of HD2 homologues accumulate in the nucleus and nucleolus (Lusser, Brosch

et al. 1997; Zhou, Labbe et al. 2004; Panni, Montecchi‐Palazzi et al. 2011). It will

therefore be important to determine whether nuclear localization is a mechanism of

control used by this class of enzymes and whether their localization can be

manipulated so that access to their histone substrates may be exogenously controlled.

49

3.1.2 Mechanism of Nuclear localization

The nucleus stores chromatin within a double phospholipid membrane perforated with

pores and transporters that facilitate the movement of macromolecules (Fahrenkrog

and Aebi 2003). It was shown that nuclear pores allow the non-specific, passive

diffusion of macromolecules up to 60kDa, although some sources have speculated that

this size exclusion may not apply to dense macromolecules even larger than this

(Perez‐Terzic, Jaconi et al. 1997; Wang and Brattain 2007). Therefore, nuclear

accumulation of proteins under this critical threshold may be achieved by passive

diffusion across the membrane. Subsequent protein-protein interactions may then

amass sufficient size that together trap smaller proteins within the nucleus. For

proteins and complexes larger than this critical size threshold, active transport is

required to mediate passage across the nuclear membrane. HD2s are ~32kDa in size

and therefore are within the size limit that would allow for passive diffusion as a

possible mechanism for nuclear accumulation. However, as functional proteins they

were shown to be part of large complexes which are ~400kDa in size. Such large

complexes would not be able to pass the nuclear membrane. The issue of how their

nuclear and nucleolar localization pattern occurs has not yet been solved.

Nuclear import of proteins by active transport involves three main molecular

components; karyopherins, nuclear pore complexes (NPCs) and Ran guanidine di- and

tri-phosphates (Ran-GDP/GTP). Karyopherins include the protein importin, a molecular

dimer consisting of an alpha and beta subunit which binds to target proteins that

contain a nuclear localization signal (NLS) (Görlich, Kostka et al. 1995). Once bound,

importin is activated and recognized by the NPC where it is transported through the

membrane spanning channel of the pore (Hinshaw, Carragher et al. 1992; Fahrenkrog

and Aebi 2003). In the nuclear matrix, the importin-cargo complex is exposed to Ran-

GTP, which is recognized and bound by importin and results in the release of its cargo.

The importin/Ran-GTP is then recycled to the cytoplasm where Ran GTP itself is

hydrolysed to Ran-GDP by GTPase activating protein (GAP) causing importin to release

Ran-GDP and to become available to form a new importin:protein complex (Moore

1998). Ran-GDP is then recycled by being translocated to the nucleus where a guanine

nucleotide exchange factor (GEF) converts Ran-GDP to Ran-GTP (Lange, Mills et al.

2007). The closely related nuclear export process differs in that the karyopherin

proteins facilitating the transport are exportin proteins. These bind the cargo and Ran-

http://en.wikipedia.org/wiki/Nucleotide_exchange_factor

http://en.wikipedia.org/wiki/Nucleotide_exchange_factor

50

GTP in the nucleus which drives recognition and translocation through the NPC’s.

Conversion of Ran-GTP to Ran-GDP allows the release of cargo and subsequent

recycling of Ran-GDP and importin to the nucleus.

An important element of the nuclear import process is the recognition of a target

protein by importin to specific NLS sequences. For example topoisomerase II was

shown to bind importin alpha in vivo, however this functionality was removed

following mutation of its nuclear localization signal. Localization tags are specific

sequences of amino acids that are recognized by other proteins that facilitate the

transport from one compartment to another (Jans, Xiao et al. 2000). Nuclear

localization sequences can be highly varied, with dozens of consensus motifs shown to

allow active transport of proteins across the nuclear membrane (Cokol, Nair et al.

2000). Based on a number of such sequences identified in plants and animals it was

shown that NLSs consist of clusters of lysine and/or arginine residues that are broadly

classified as being either monopartite, bi-partite or irregular. Simply defined,

monopartite sequences consist of a single string of positive residues such as the SV40

large T antigen NLS [PKKKRRV], whereas bipartite sequences consist of two discrete

clusters of positive residues that are separated by ~10 amino acids such as the

nucleoplasmin NLS [KRPAATKKAGQAKKKK]. Irregular sequences are broadly defined as

anything that does not match the parameters of mono- and bi-partite sequences and

most commonly bind directly to the beta-subunit of the importin hetero-dimer (Lee,

Cansizoglu et al. 2006). These signals are marked by their notable absence of lysine or

arginine residues in the sequence, for instance the human hnRNP A1 protein contains

a novel 38 amino acid transport signal that is required to confer nuclear translocation

(Pollard, Michael et al. 1996).

The importance of nuclear localization sequences are that they provide specific binding

sites for importin, and are therefore required for active import into the nucleus. A

significant regulatory mechanism that determines localization state is therefore

limiting access of the NLS to importin. This is typically achieved by post-translational

modifications such as phosphorylation, or protein-protein interactions such as binding

of 14-3-3 proteins which cause steric changes in protein structure exposing or hiding

the import sequence from the surface of the protein area. This is commonly coupled to

the exposure of nuclear export signals so that the protein may be effectively confined

51

to its designated cellular context. This was shown in the regulation of the Arabidopsis

floral identity transcription factor APETALA3, which requires co-expression of

PISTILLATA to form obligate heterodimers. Interaction with PISTILLATA induces a

structural change in APETALA3 that exposes its nuclear localization signal (McGonigle,

Bouhidel et al. 1996). In this way, despite its cellular presence throughout floral

induction, its role as a transcription factor to induce floral identity is only activated in

response to PISTILLATA expression.

3.1.3 Nucleolar localization

The fact that a noticeable fraction of the HD2C-GFP fluorescence is localized to the

nucleolus is likely to be a significant aspect of its function. The nucleolus is a non-

membrane bound sub-structure of the nucleus which is comprised of DNA, RNA and

protein which accounts for approximately 25% of nuclear volume. The nucleolus is

centrally involved in ribosomal RNA transcription, ribosome assembly, cell cycle

progression, developmental regulation and cell stress response. HD2C has been shown

to have roles in each of these functions (Hollender and Liu 2008), which is consistent

with its nucleolar localization. Therefore determining the protein sequence required

for its nucleolar localization will be significant for future manipulation of its biological

process.

Like nuclear localization, nucleolar localization can be achieved either via direct

nucleolar targeting by a nucleolar localization sequence (NoLS), or by interaction with

proteins that are themselves localized to the nucleolus. NoLSs and NLSs are structurally

similar as they usually contain stretches of positive amino acids, however their

mechanism of action differ. As mentioned previously, NLSs function via active

transport, whereby movement across the nuclear membrane is mediated by importin

which binds the NLS and the nuclear channel which provides the path of movement. In

contrast to this, nucleolar localization is driven by strong associations with nucleolar

core components, suggesting a retentive mode of localization. The similarity in amino

acid compositions is significant, as it has been shown that a significant fraction of NLSs

have NoLS joint targeting. For example, in Saccharomyces cerevisiae, the C-terminus of

UTP20 contains a lysine and arginine rich region which confers both nuclear and

nucleolar localization (Dez, Dlakić et al. 2007). Alternatively NoLSs may be completely

52

separate from any NLS, or indeed contain no NLS and thus rely on passive diffusion to

access its chromatin binding region (Saslowsky, Warek et al. 2005).

Aside from the description of HD2C as a nuclear and nucleolar protein, no further

characterization of the molecular mechanism for its subcellular localization has been

provided. Given the relative importance of its internal sequestration to these cellular

sub-structures, investigation of the process which drives its internal targeting may

provide a valuable insight into its regulatory dynamics.

3.1.4 HD2-HD2 interactions in tertiary protein complex

The HD2 family was first identified by investigating proteins obtained by purification of

chromatin from germinating maize embryos (Lusser, Brosch et al. 1997). Native maize

HD2 was found to elute at a molecular mass of ~400kDa in gel filtration

chromatography, leading to speculation that it functions in a protein complex. A silver-

stained SDS-PAGE revealed this complex to consist of three polypeptides of near

identical size. Subsequently it was shown that these peptides differed only by their

phosphorylation state, with phosphorylation evidently controlling the catalytic activity

(Durek, Schmidt et al. 2010). These data suggested that HD2s operate as a large,

homogenous protein complex that forms as a result of HD2-HDAC interactions. Indeed

the Arabidopsis HD2C protein was previously shown to bind both HDAC6 and 19 in

response to various abiotic stresses (Luo, Wang et al. 2012). It was shown in other

HDAC systems that homologous interactions have both regulatory and enzymatic roles.

HDAC4 and 5 function as a complex with HDAC3 in the nucleus of mammalian cells to

bind and deacetylate their target histone substrate (Grozinger, Hassig et al. 1999).

Aside from its likely regulatory importance, the dimerization or possible

multimerization of HD2 would likely increase its molecular size sufficiently that it is

unable to passively diffuse across the nuclear membrane. Whether this affects its

ability to cross into the nucleus, or instead aids in its nuclear retention is likely

dependent on where the dimer formation occurs. Complex formation of the catalytic

subunit of cyclic AMP dependent protein-kinase (PKA) was shown to control nuclear or

cytoplasmic localization in this way. Complex formation in the cytoplasm forms a high

molecular weight structure that cannot pass into the nucleus and therefore

53

equilibrium is reached where all PKA is cytoplasmic (Harootunian, Adams et al. 1993).

When the complex dissociates, the smaller subunit is released and becomes able to

passively diffuse across the nuclear membrane. HD2s may operate in the opposite way

to this so that complex formation occurs in the nucleus and thereby preventing

diffusion back across the membrane and into the cytosol. This passive approach marks

an alternative strategy to the conventional active transport via NLS targeting

previously described. Alternatively, complex formation could occur in the cytosol and

be a prerequisite for nuclear import via exposure or formation of nuclear import

signals. It would therefore be important to identify where the HD2 complex formation

occurs so that a model of HD2 transport can be proposed.

3.1.5 Hypothesis and aims

The subcellular localizations of HD2A, HD2B and HD2C have been analysed

independently in a number of studies, utilizing Arabidopsis, maize and longan

homologues to demonstrate a conserved nuclear and nucleolar phenotype between

various homologues. However, no study has so far performed a parallel localization

analysis of all HD2 homologues from one organism, in the same tissue type and under

identical experimental conditions to compare subcellular localization between the

proteins. Such an analysis is essential to identify any localization patterns specific to

one homologue which may suggest a diverse function. Furthermore, HD2D was not

previously characterized with regards to its subcellular localization. It is expected that

all Arabidopsis HD2 homologues contain the same nuclear and nucleolar subcellular

localization pattern that was previously identified. It is therefore important to identify

the molecular mechanism of this localization pattern. Furthermore, the possibility of a

dynamic shuttling between cytoplasm and nucleus, or nucleus and nucleolus will be

investigated. Lastly, the prospect of HD2:HD2 interaction will be tested and the

localization of these dimers compared to the HD2-GFP localization pattern. The aims of

this study are therefore:

1. Construct HD2-GFP- fusion proteins to analyse the subcellular localization

patterns of all four HD2 isoforms using the same system and approach.

2. To test for the potential of HD2s to form dimers and to further analyse if all

dimer combinations of HD2C:HD2 can occur in planta. Bimolecular fluorescent

54

complementation (BiFC) will be used here because it offers an in planta

approach to test interaction, and will additionally allow for direct qualitative

evidence of the localization pattern of the dimers.

3. To investigate if HD2C nuclear import is driven by a nuclear localization signal.

To test this, deletion constructs of HD2C will be fused to GFP and visualized in

planta. Site directed mutagenesis will then be performed to determine the

critical residues required for nuclear localization.

4. To test if localization is dynamic by comparing the localization pattern of HD2C-

GFP in stressed and non-stressed plants. Stably transformed Arabidopsis lines

expressing 35S:HD2C-GFP will be made and the movement of HD2C-GFP traced

in response to salt stress. Salt was previously shown to affect HD2C expression

and caused deacetylation of ABA response factors.

3.2 RESULTS

3.2.1 Investigating the subcellular localization of the HD2 family of proteins

HD2 homologues A-D were cloned into the PG179NS-GFP vector so that HD2-GFP

fusion proteins could be expressed. These vectors were used to transform

Agrobacteria, which were themselves used to infect and transiently transform

Nicotiana benthamiana leaves by agro-injection. Three days after injection,

fluorescence was observed using a fluorescent microscope, and recorded using

confocal microscopy. Standard images for each construct are represented in figure 3.1,

showing GFP emission for the protein localization, DAPI emission for staining of the

nuclear area and chloroplast autofluorescence to show cellular context and as a

control for potential autofluorescence in the GFP channel.

GFP fluorescence for the three isoforms HD2A, B and C were very similar. Fluorescence

of these three GFP fusion proteins appeared as a strong, discrete signal surrounded by

a halo of weaker fluorescence that overlayed completely with the fluorescence in the

DAPI channel (figure 3.1). The localisation of the weaker and the stronger fluorescence

suggested that the weaker fluorescence was contained within the nucleus and the

stronger represented subnuclear structures such as the nucleolus. These

interpretations would be in agreement with published work showing that HD2A, B and

C are present in the nucleus and nucleolus. The fluorescence observed here is not

55

caused by autofluorescence as it did not match the fluorescence observed under the

RFP channel used to monitor chloroplastic and other cellular autofluorescence (figure

3.1).

In contrast to HD2A, B and C, HD2D showed a novel, previously not described

localisation pattern with GFP fluorescence observed in both the cytosol and nucleus.

Furthermore, there was no discrete sub-nuclear localization, suggesting that there is

no inherent nucleolar targeting as demonstrated for the isoforms HD2A-C. The HD2D

fluorescent pattern was similar to the pattern observed when expressing GFP alone,

therefore suggesting that there is no targeting mechanism capable of exclusive nuclear

localization in this HD2 homologue.

3.2.2 HD2 proteins form nucleolar localized dimers in planta

A necessity for a large protein complex comprised of only HD2s is the interaction of

HD2s with each other. Here, it was determined if HD2 proteins have the ability to form

HD2 homo- and/or heterodimer complexes. BiFC was used to identify whether

members of the HD2 family have the potential to engage in such interactions in planta.

HD2A-D coding sequences were cloned into PG179NS-YN and PG179NS-YC BiFC

vectors to generate HD2-YN and –YC fusion proteins. Obtained plasmids were

transferred into Agrobacteria and co-injected into Nicotiana benthamiana leaves so

that a HD2-YN and a HD2-YC protein could be co-expressed. First, the ability of HD2C

to form homodimers in planta was investigated. Fluorescence, indicating interaction of

the HD2C-YN and HD2C-YC fusion proteins was observed almost exclusively in the

nucleolus of infiltrated Nicotiana epidermal leave cells (figure 3.2). This was significant

as it revealed a difference from the nuclear and nucleolar pattern of fluorescence

obtained when the HD2C-GFP construct was tested in section 3.1.1. The N-terminal

end of HD2C is the catalytic domain of the protein and therefore unlikely to mediate

dimerization. It was therefore used as a negative control to ensure that interaction

was not dependent on the YFP fragments spontaneously recomplementing. The N-

terminal end (AA1-60) of HD2C was therefore fused to the N-terminal of YFP and

tested with HD2C-YC. This yielded no detectable fluorescence in the YFP channel,

suggesting that the fluorescence reported above was due to HD2C:HD2C interaction

56

(figure 3.2). Western blot detection of each protein was used to ensure that expression

was not the reason for the absence of any fluorescence (appendix 1).

Micro-array data and evidence from semi-quantitative RT-PCR experiments

demonstrated an overlap in physiological expression patterns of HD2s. This gives rise

to the biologically relevant prospect of heteromeric HD2 interaction in the formation

of a functional HD2 complex. To test this hypothesis, HD2A, HD2B and HD2D were

cloned into the PG179NS-YC BiFC vector and tested for interaction with HD2C-YN.

Consistent with HD2C dimers, fluorescence indicating interaction of the HD2C with the

three other HD2 isoforms was almost entirely restricted to the nucleolus, with only

very faint nuclear fluorescence (figure 3.2). It was interesting to observe that the

HD2C:HD2D dimer was similarly nucleolar, which was in contrast to the cytoplasmic

and nuclear localization of the HD2D-GFP fluorescence observed earlier

3.2.3 A nuclear import-related sequence maps to the C-terminus of HD2C

In this thesis and in published work, it was shown that all four Arabidopsis HD2

proteins localize at least partially to the nucleus (Zhou, Labbe et al. 2004). Nuclear

localization can be achieved either by direct migration of the protein if the size of the

protein is beyond the exclusion size of the nuclear pore complex or by an active

transport requiring a nuclear localization sequence. Despite the known nuclear

localisation, no nuclear localisation signal was reported for any of the HD2 proteins so

far. To determine whether HD2 proteins have a NLS, HD2C was chosen for a mutation

analysis coupled with localisation studies of the obtained mutant HD2C variants. As a

beginning for this analysis, N- and C-terminally truncated variants of HD2C were

constructed and fused with a C-terminal GFP. Individual constructs were transformed

into Agrobacteria which were then used to transform N.benthamiana leaf tissue via

injection to assess localization of the encoded HD2C protein mutants. It was hoped

that this analysis would reveal if HD2C contains a region required for nuclear import.

Expression and localisation of the mutant HD2C-GFP fusion proteins were analysed

using confocal and fluorescent microscopy (Appendix 2). Localisation patterns were

assessed as nuclear, nucleolar, cytoplasmic or relevant permutations of these based on

the fluorescent patterns of the various constructs. Shown in figure 3.3A are graphic

representations of the deletion constructs and a description of their localization

57

patterns. Together these data allowed a map of the relative positions of regions

required for nuclear and nucleolar localization to be determined.

N-terminal truncations up to and including amino acid residue 185 did not impact on

the localization of HD2C deletion proteins, with those variants localising to the nucleus

and nucleolus as did the full (figure 3.3A) length protein. Further N-terminal

truncation up to and including residue 205 caused HD2C-GFP fusion proteins to lose

exclusive nuclear/nucleolar localisation and to produce a nuclear, nucleolar and

cytoplasmic expression. Subsequent deletion up to and including residue 240 led to a

complete loss of nucleolar localisation and presence of the protein in the nucleus and

cytoplasm only, which was similar to the fluorescent pattern of GFP alone.

Serial truncations from the C-terminal end up to and including amino acid residue 225

did not impact on the ability of HD2C to localize to the nucleus and nucleolus (figure

3.3A). Further C-terminal truncations, up to and including amino acid 204 resulted in

loss of exclusive nuclear localization as well as nucleolar localisation. These results

suggested that the residues required for exclusively nuclear localization and nucleolar

localization of HD2C were contained between amino acids 185–226. Next the putative

minimal localization domain was tested to determine if it was sufficient to transfer

exclusive nuclear and nucleolar localisation to a GFP protein which is usually found in

the cytosol and the nucleus. Thus, the 185–226AA peptide was cloned into the

PG179NS-GFP vector and expressed via Agrobacteria injection in epidermal leave cells

of Nicotiana benthamiana. The localization of the fusion protein was investigated using

confocal microscopy. Interestingly, despite the clear necessity for this domain to be

present in HD2C to allow exclusive nuclear and nucleolar localization, the putative NLS

domain consisting of residues 185-226 did not confer exclusive nuclear fluorescence to

GFP. Instead the fusion GFP protein was present in the cytosol and the nucleus. A

larger HD2C peptide fragment comprising AA143-226 was therefore tested to

determine the minimal region required to cause exclusive nuclear localization of GFP.

This fragment was sufficient to confer exclusive nuclear localization to GFP, but did not

have any nucleolar presence (figure 3.4B). Instead, a further tested fragment

consisting of amino acids 206-257 conferred a nucleolar presence; however this was

not sufficient to allow exclusive nuclear fluorescence as fluorescence was also

detected in the cytosol (figure 3.3B). Together these results show that overlapping but

58

discrete regions of HD2C are required to impart nuclear localization and nucleolar

localization.

3.2.4 The HD2C nuclear localisation signal is dependent on a KKAK motif

Having shown that residues 143–226 of HD2C are sufficient and required for nuclear

localization, it was determined whether this sequence contains an NLS and if so, to

localize the critical residues. From previous studies it is known that NLSs are comprised

of either a basic amino acid cluster defined as monopartite, or of two basic clusters

separated by ~10 amino acids which constitute a bipartite NLS. The HD2C region that is

critical for nuclear localization contains a number of lysine and arginine residues

(figure 4.4). Four subregions of this peptide sequence contained lysine residues which

may be critical determinants of nuclear localization. To be able to differentiate

between these four subregions, four different full length HD2C constructs with

different permutations of lysine to alanine substitution mutations were constructed;

these were named nuclear localization sequence mutants 1-4 (NLSM1-4), with the

mutated regions shown in figure 3.4A. There was no evident alteration in the nuclear

pattern of localization in NLSM1-3 when compared to the wild type HD2C protein (data

not shown). However the NLSM4 mutation resulted in a nuclear, cytoplasmic and

nucleolar pattern of fluorescence (figure 4B). This indicated that the motif KKAK was a

critical determinant of exclusive nuclear localization.

3.2.5 Sequence alignment of HD2 gene family homologues reveals conservation of

the critical KKAK motif

To determine if the KKAK sequence is evolutionarily conserved in HD2 family members,

a multiple sequence alignment was constructed of the four Arabidopsis HD2s and

related homologues from poplar, rice, wheat and maize (figure 3.5). The sequence

alignment revealed that the three lysine residues in the KKAK motif of HD2C were

absolutely conserved in all of the HD2 homologues, indeed the whole KKAK sequence

was conserved in seven of the eight homologues analysed including in those of

monocot plants. Interestingly, the only difference observed for the KKAK motif was in

HD2D, which had previously been shown to have a nuclear and cytoplasmic

localization pattern. Instead of a KKAK motif, it contained a KKNK motif, which may

59

rationalize the altered localization pattern compared to the other Arabidopsis HD2

homologues.

3.2.6 Nuclear localisation is not a pre-requisite for HD2C dimerisation.

Nuclear retention of HD2C could be mediated either through active transport or

through accumulation of molecular mass, e.g. a higher order protein complex, in the

nucleus which prevents leakage into the cytoplasm. The KKAK motif which is critical for

exclusive nuclear localization conforms to the core [K(/R)KXK] motif present in

monopartite nuclear localization sequences, which suggests that active transport is the

preferred method of translocation. However, this still left two options; firstly that the

import of HD2C occurs via its monomers with multimerisation taking part in the

nucleus or nucleolus or secondly that multimerisation in the cytosol precedes import

of the multimer into the nucleus. As a first step towards answering this question, it

was tested whether dimerisation can occur in the cytosol or if nuclear localisation is an

absolute requirement for dimerisation of HD2C. Co-expression of the NLSM4-YN and

wild type HD2C-YC in N.benthamiana epidermal leaf cells was used to investigate if

dimers could still form and if so, where they appeared (figure 3.6). BiFC analysis

demonstrated firstly that the mutated HD2C is still able to form dimers with the wild

type HD2C protein. Secondly, the dimers were observed in the nucleus and nucleolus

which clearly showed that both isoforms migrated to the nucleus. This distribution was

identical to that of the wild type HD2C:HD2C dimer. As demonstrated earlier in this

thesis, the HD2C mutant protein is not able to move into the nucleus. Thus it can be

concluded that its nuclear and nucleolar localisation required previous dimerisation

with wild type HD2C in the cytosol and subsequent re-localisation in a ‘piggy-back’

mechanism to the nuclear and nucleolar compartment. To further provide evidence

for cytoplasmic dimerisation, subcellular localisation of a NLSM4 homodimer was

tested using BiFC. Fluorescence was observed in the cytosol, nucleus and nucleolus

(figure 3.6). This finally indicated that dimerisation can occur in the cytosol. It

furthermore supported the statement that a complete NLS is not required for

dimerisation. Although not finally conclusive, this result can also be used as evidence

for the hypothesis that dimerisation occurs in the cytoplasm and that dimers or higher

order multimers move into the nucleus with the aid of the NLS.

60

3.2.7 HD2C localization is altered in response to abiotic stress

Although there is a well characterized nuclear and nucleolar localization pattern for

HD2C, there is the possibility that this pattern is only observed in a non-stressed

context. Previously, it was shown that abiotic stresses such as salt displayed various

phenotypes in transgenic Arabidopsis lines with modified HD2C expression. This gives

rise to the possibility that these phenotypes are a result of post-translational

modification to HD2C which may induce a change in protein localization. To test this

hypothesis, transgenic Arabidopsis lines expressing 35S:HD2C-GFP were made using

the floral dip method. Two independent lines were collected which displayed strong

expression as determined by RT-PCR and direct visualization under a fluorescent

microscope (results not shown).

The role of salt stress on HD2C-GFP localization was tested by transferring two week

old seedlings germinated and grown on 0.5MS media onto either 0.5MS media

containing 150mM NaCl, or 0.5MS plates without addition of NaCl (control). After 24

hours, leaf tissue was harvested and investigated under the confocal microscope

(figure 3.7). Results indicated that there was a visual increase in the proportion of

nucleolar fluorescence compared to the rest of the nucleus. This was consistent for

both lines, in three independent experiments. To quantify this observation, images

were compiled and pixel density counts performed using Image J software. Results

showed that in non-treated Arabidopsis cells, the nucleolar fluorescence accounted for

25% of total nuclear fluorescence. In contrast, salt stressed plants had an increased

nucleolar proportion to 39%. A one tailed, independent t-test confirmed that these

results were statistically significant. These results therefore indicate that there is a

dynamic shift of nuclear to nucleolar HD2C localisation in response to salt stress, but

not between the nucleus and cytoplasm.

3.3 Discussion

3.3.1 Summary

Here, the localization of HD2C was analysed using fluorescent protein fusions to trace

the accumulation of HD2C in Nicotiana benthamiana epidermal cells. Consistent with

61

previous results was the observation that HD2C was present in the nucleus and

nucleolus when fused to GFP. However, it appears that this localization may be

dynamic, as stably transformed 35S:HD2C-GFP plants showed increased accumulation

of nucleolar fluorescence after 24 hours of salt stress. The mechanism of this

accumulation remains unknown; however dimerization of HD2s appears to be

involved, as the fluorescent pattern observed when performing a BiFC analysis of

HD2C:HD2 interaction was almost exclusively nucleolar. In addition, the mechanism of

nuclear and nucleolar localization appears to be separate. Mutation of an

evolutionarily conserved KKAK motif removes exclusive nuclear localization but not

nucleolar localization. In addition, a minimal NLS results in the absence of a nucleolar

fluorescent signal. Similarly a minimal nucleolar localization signal resulted in nucleolar

accumulation, but did not confer exclusive nuclear localization.

3.3.2 All combinations of dimers are possible between HD2C and the HD2 family

The prospect of dimerization has been hinted previously from the discovery of the HD2

gene family in maize. Here, using an in planta method, it was shown that HD2C has the

potential to form HD2 protein homo- and heterodimers. The results obtained do not

allow for an interpretation beyond the dimer level. It can be postulated that HD2C is

able to form larger protein complexes involving several HD2 monomers or even other

proteins. Indeed, this postulate would be consistent with the ~400kDa complex

identified via native gel electrophoresis following extraction from maize embryonic

tissue.

The biological and functional relevance of the interactions with other members of the

HD2 family was not explored in this thesis. However, previous work gives an indication

of the possibilities such interactions can have, including enzymatic activity changes, an

influence on subcellular transport and determination of DNA binding specificity. It is

feasible to postulate that dimerization or multimerization of HD2 proteins contributes

to the regulation at the level of the enzyme, whereby protein-protein binding provides

control over the catalytic activity of the enzyme by either switching the activity state of

the enzyme between functional and non-functional, or affecting the substrate

specificity of the enzyme itself. Such an assumption would be in agreement with the

finding that dimerisation is a way in which the activity of a number of mammalian

62

HDACs is regulated. For example, mammalian HDAC1 complex formation precedes

activation of its catalytic activity and additionally mediates interaction with other

transcriptional regulators which are responsible for binding its target chromatin

substrate (de Ruijter, Van Gennip et al. 2003) . Currently, it is not known if complex

formation has a similar impact on HD2 activity and specificity. However, it is known

that HD2 proteins interact with other regulators such as HDAC6, DNA

methyltransferase 2 and ERF7 suggesting a similar kind of regulation for HD2C possibly

also requiring interaction with other HD2s (Chinnusamy, Gong et al. 2008; Song, Wu et

al. 2010). HD2C preferentially binds histone 2B but accept all histones as substrates in

vitro. This could indicate that HD2s are subject to specificity changes which may be

mediated by the ability to combine with other HD2 proteins as demonstrated in this

thesis. The potential for some level of target specificity or changes in histone

deacetylation patterns manifested through different combinations of HD2 isoform

complexes is a logical extension of this work. Indeed, mammalian histone deacetylases

harness the ability to bind various HDAC homologues to recognize specific targets

under various conditions. While not explored in any detail in the case of the HD2s, it is

anticipated that the protein itself is not solely responsible for recognizing and binding

the gene regions that it is likely to function upon. Rather, it is hypothesised that HD2s

act via interaction with other proteins such as transcription factors on specific

chromatin regions and hence genes in a response dependent manner. Similar

mechanisms were shown for other epigenetic models such as DNA and histone

methylation. Thus, it may be hypothesised that the interaction of various HD2

homologues to each other allows HD2s to fine tune their response to triggers through

the combinatorial accumulation of transcriptional regulators which allows recognition

of various specific chromatin regions. Given that HD2C was described as a protein

involved in abiotic stress and ABA responses such triggers could be found in

environmental conditions causing stress (Sridha and Wu 2006).

3.3.3 HD2C localization state is dynamic and responds to salt stress

In this study HD2C localization was compared as a GFP fusion protein with the

localization found in BiFC experiments. Originally, it was hypothesised that cytosolic

and nuclear localization had regulatory implications, given comparable models in

63

plants, mammals and in the context of the transcriptional regulatory machinery where

translocation between cytoplasm and nucleus influenced availability of the protein and

hence its biological activity. Cytosolic localisation was not observed for HD2C-GFP

fusions protein in either stably transformed Arabidopsis plants, or transiently

transformed N.benthamiana. This was consistent with previous studies showing that

HD2C-GFP accumulated in both the nucleus and nucleolus. A shift in localization to the

cytosol was also not observed in stress treatment experiments. This was not seen in

the case of HD2C-GFP expressed in stably transformed plants, either in the different

tissue types dissected and visualized or in the leaf tissue exposed to various under

stresses. When transgenic seedlings expressing HD2C-GFP were kept for 24 hours on

minimal media plus 150mM salt HD2C developed a nucleolar-enriched localization

pattern. Thus, salt treatment caused a shift from the mixed nuclear and nucleolar

pattern observed under control conditions to a more nucleolar appearance. Similar

treatment dependent nucleolar retention has been reported for stress-responsive

factors. For example the Arabidopsis Elf4A-III protein, a putative anchor protein of the

exon junction complex, when expressed as a GFP fusion protein was targeted to the

nucleus during normal growth, but quickly localized to the nucleolus and splicing

speckles in response to hypoxia (Koroleva, Calder et al. 2009). The most widely cited

mechanism for this regulation is via post-translational modifications such as

phosphorylation or ubiquination. Such mechanism was demonstrated for the

mammalian transcription factor RelA, where cytoplasmic and nuclear fractions of the

protein undergo a stress-induced nucleolar translocation which is preceded by

ubiquitination of the protein (Thoms, Loveridge et al. 2010). That post-translational

modifications of HD2 proteins occur was demonstrated for the maize HD2 orthologue

which can be tri-phosphorylated. This gives rise to the possibility that phosphorylation

may be a mechanism determining nucleolar targeting of HD2C. Identification and

mutation of phosphorylation sites in HD2C would be a way forward to test the

hypothesis that phosphorylation of HD2C results in nucleolar retention.

The nucleolus was shown to be involved in the plant stress response because it

contains genes that are responsive to stress response factors. Following salt stress

there is a concerted response that involves the recruitment of proteins to the

nucleolus (Guo, Yang et al. 2012). Similarly the morphology of the nucleolus changes,

64

with the influx and diversity of proteins following stress resulting in an increased size

and activity (Boulon, Westman et al. 2010; Shaw 2013). Another important insight into

the mechanism of nucleolar retention was the nucleolar only localization pattern that

was observed for the HD2 dimers using BiFC. This apparent contradiction between the

HD2C-GFP localization in the nucleus and nucleolus, and the BIFC result showing that

the HD2C dimer localizes to the nucleolus but not the nucleus, may be due to the

differences shown by the two approaches. The HD2C-GFP construct shows the

localization pattern of both monomeric and multimeric forms of HD2C. As in the stably

transformed Arabidospis plants, the fluorescent pattern shows both nuclear and

nucleolar accumulation. In contrast, BiFC analysis monitors only the presence of

dimers. This leads to a model whereby HD2C monomers are localized throughout the

nucleoplasm, hence found in the nucleus and nucleolus and the dimer or multimer

being restricted to the nucleolus only. Additionally, the stability of the reconstituted

YFP ensures that the dimers are locked together; thus even transient associations yield

strong fluorescence. Previously it was implied that the functional enzyme is active as a

large HD2 complex, further implying that the monomeric form of the enzyme is non-

active. Thus the model can be extended by assuming that a non-active HD2C monomer

is present throughout the nucleoplasm until activated, possibly by phosphorylation,

upon which it dimerizes and moves to the nucleolus. In the nucleolus, it could bind to

and deacetylate its specific histone substrate. Abiotic stresses, as shown here, trigger

nucleolar localisation and could hence be activators of HD2C function. While this

hypothesis leads to an attractive model, this study is sufficient only to highlight its

potential, rather than validate its accuracy. To resolve this pathway a number of

further problems need to be investigated. Principle among them is to determine the

dimerization domain of HD2C. A mutant form of the enzyme unable to dimerize will

allow firstly to determine whether the monomer itself can be targeted to the nucleolus

and secondly to investigate if the monomer retains catalytic activity or if dimerisation

is required. Finally it could be addressed whether plants over-expressing a non-

dimerizing HD2C retain the abiotic stress response that was reported for the over-

expression of wild type HD2C in Arabidopsis. Furthermore, the possible combinations

of various HD2 isoforms give rise to the possibility that various permutations yield

specific functions.

65

3.3.4 HD2C contains a critical KKAK domain necessary for exclusive nuclear

localization

A previously unreported HD2D-GFP fusion protein expression demonstrated a novel

HD2 localisation pattern. HD2D, in contrast to the other three HD2 isoforms had a

nuclear and cytoplasmic localization pattern, whereas HD2A-C was instead confined to

the nucleus and nucleolus. This suggests that some integral nuclear transport domain

conferring tight targeting to the nucleus has been lost through divergent evolution of

the HD2D gene sequence. The rationalization of this result was inferred from a HD2C

deletion analysis, which allowed the mapping of a region within the HD2C sequence

which was required for exclusive nuclear localization. A KKAK motif was found to be a

critical determinant of the nuclear localization pattern. The significance of this motif

was further highlighted by the absolute conservation of the sequence across a sample

of monocot and dicots via a multiple sequence alignment, suggesting that each residue

was important for the nuclear localization. HD2D contained a slightly modified KKNK

motif at this position, which may explain its non-nuclear exclusive localization pattern.

The KKAK consensus sequence identified here matches a previously reported core NLS

sequence, designated [K(K/R)XK]. This core sequence relates to both monopartite and

bipartite sequences and appears to be a significant binding site for importin-alpha.

3.3.5 Nucleolar localization is not tied to nuclear localization

The HD2C-GFP deletion analysis indicated that the minimal NLS did not confer

nucleolar localization. Furthermore, mutation of the KKAK motif to AAAA resulted in a

localization pattern that was similar to that observed for the localisation of GFP

expressed on its own. It is known that GFP, when expressed alone, is localised to the

cytosol and due to its small size, can also be found in the nucleus (Grebenok, Pierson

et al. 1997). Thus it could be assumed that the mutant behaved like GFP on its own.

However, the mutant HDAC retained a degree of nucleolar localization which is not

found when expressing GFP alone. This suggests that the nucleolar targeting is not

directly tied to the NLS, but rather exists at a further sequence at the C-terminal site

on the HD2C protein. This is not a novel finding, as there is increasing evidence to

support the notion that NLSs and nucleolar localization sequences (NoLSs) are

66

recognized as separate signals by the cell. An example of this is the accumulation of

small, non-nuclear proteins that accumulate at the nucleolus but do not have a specific

NLS. From the HD2C-GFP deletion analysis it can be postulated that HD2C contains

both a NLS and NoLS which overlap, but are discrete. The functional consequences of

this are also clear, since attempts to challenge the cell with abiotic stress to see if

localization could be shifted from nuclear to cytosolic instead resulted in a shift to

become more nucleolar with no noticeable cytoplasmic leakage. Further

characterization of the NoLS may be a future direction as, similar to the NLS, reverse

genetic approaches can be used to mutate specific amino acids which confer this

localization pattern and test to identify if there is a phenotype. Based on the shift in

localization in response to stress, it would be logical to hypothesise that this would

reduce the salt stress tolerance that has been observed in plants over-expressing

HD2C.

3.3.6 Dimerisation does not require nuclear localisation of HD2C.

Initially it was hypothesised that nuclear retention was maintained either through

active transport or through accumulation of molecular mass, e.g. a higher order

protein complex in the nucleus which prevents leakage into the cytoplasm. The link

between dimerization and nuclear transport has been shown in a number of contexts.

MAPKK, a MAP-kinase kinase involved in cell cycle progression undergoes nuclear

import that is dependent on its dimerization state, where dimerization leads to active

transport of the large >80kDa complex. The monomeric form instead relies on passive

diffusion across the nuclear membrane to account for the proteins nuclear fraction.

Similarly, the effector protein AvrBs3 forms dimers in the cytoplasm prior to its import

to the nucleus following infection from the bacterial phytopathogen Xanthomonas

campestris. In either case a NLS was required for nuclear import of the larger complex,

but was closely linked to its dimerization state.

The identification of a sequence that conforms to a monopartite consensus sequence

suggests that active transport is the preferred method of translocation which, given

the small size of the HD2s (<40kDa), suggests that formation of the complex may occur

in the cytoplasm. This was consistent with the comparison of results between

localisation of HD2D as a GFP fusion protein and as a dimer with HD2C in BiFC studies,

67

with localization shifting from predominantly cytoplasmic to singularly nuclear and

nucleolar.

3.3.7 Conclusion and future

This study originally aimed to identify whether subcellular targeting was employed as a

regulatory measure to limit HD2C access to its histone substrate. It is now clear that

cytoplasmic-nuclear trafficking is not utilized in this manner; rather it appears that the

shift between nucleus and nucleolus may form a dynamic equilibrium which may be

perturbed by various abiotic stresses such as salt, heat and cold. In line with this, the

evidence for HD2C-HD2C association was confirmed using in planta BiFC with this

interaction evidently confined to the nucleolus.

Future work will concentrate on elucidating the molecular cues which orchestrate this

relationship. From these results the regions necessary for nuclear and nucleolar

localization have provided an ideal starting position from which these results can be

pursued. It appears that the active transport of nuclear localization is less significant,

as no evidence could be generated to suggest that this is a target for regulation.

Rather, its identification allowed to test and determine that dimer formation may

occur in the cytoplasm, and hypothesise that complex formation precedes protein

import. More interesting is the identification of the minimal NoLS, whereby nucleolar

localization was conferred. If this is indeed an important regulatory mechanism,

mutation of this region will yield a biologically important phenotype that will develop

some insight to its function when expressed in HD2C knock-out plants.

75

Chapter 4 Characterization of HD2C

interaction with 14-3-3 proteins using Bimolecular Fluorescent

Complementation

76

4.1 Introduction

4.1.1 Possibility of 14-3-3 interaction with HD2C in Arabidopsis thaliana

The possibility of interaction between HD2A-C and 14-3-3 proteins has previously been

raised by Paul et al using an antibody affinity purification technique (Paul, Liu et al.

2009). They identified interactors of 14-3-3 proteins with a monoclonal antibody

specific for an exposed domain of multiple Arabidopsis 14-3-3s. This approach enabled

the precipitation of a pool of 14-3-3 isoforms and therefore the co-precipitation of a

greater and more diverse number of 14-3-3 binding proteins. However, this approach

was limited as each potential protein must be further characterized on a case by case

basis to specify which of the individual 14-3-3s the identified protein bound to.

Furthermore, there is a growing body of evidence that suggests that protein

interaction data obtained from high throughput screens such as co-

immunoprecipitation is only biologically relevant in 30-50% of instances (Bader,

Chaudhuri et al. 2003). This is largely due to the disregard of native expression

patterns and the sub-cellular localization of each protein due to the pooling of plant

tissue. Various 14-3-3 isoforms have been shown to have specific expression patterns

and subcellular localizations. For example 14-3-3 omega and phi are widely expressed

in pollen with a cellular presence in both cytoplasm and nucleus. In contrast, 14-3-3 nu

is most highly expressed in the carpel and root tissue and has a predominantly

cytosolic localization pattern which appears to be excluded from the nucleus. As the

study by Paul et al did not discriminate between these isoforms, the data presented

requires further characterization to determine whether each interactor conforms to

these parameters.

The possibility of 14-3-3 binding to HD2C is significant, as mammalian HDACs have

been similarly shown to bind various 14-3-3 isoforms which have a significant impact

on its regulation. The interplay between HDAC4 and 5 with 14-3-3 and their

translocation between nucleus and cytoplasm has previously been discussed in chapter

3. It is likely that an interaction between 14-3-3 and HD2C will have regulatory

implications that can be exploited for the purposes of manipulating a relevant cellular

response. It is therefore of importance to determine if the binding of 14-3-3 to HD2C is

biologically relevant, and then to characterize this interaction to demonstrate what

regulatory role it has on HD2C.

77

4.1.2 14-3-3 background

14-3-3 proteins were first described in a 1967 study to identify the abundant, soluble,

acidic proteins of the mammalian brain. It has since been determined that 14-3-3s

represent a ubiquitous protein family present in all eukaryotes. Their name is derived

from their unique fractionation pattern on DEAE cellulose and starch gel

electrophoresis.

Despite their early discovery, it was only in 1996 that Shaw and colleagues identified

the fundamental function of 14-3-3s; that they bind to target proteins in a

phosphorylation dependent manner (Muslin, Tanner et al. 1996). This discovery led to

a subsequent re-evaluation of the model of phosphorylation dependent signals. It

became clear that in some cases phosphorylation was not sufficient for protein

modification. Rather, it acted as a docking site for proteins such as 14-3-3s, with their

binding sufficient for the steric interaction required for modification of the protein

activity. Structurally 14-3-3 proteins are highly conserved, with sequence homology

between plants and animals ranging from ~40-90%. These proteins consist of an N-

terminal dimerization domain and a C-terminal binding groove which is specific for

phosphorylated serine and threonine binding sites. X-ray crystallography has resolved

the structure for several 14-3-3 isoforms, revealing a dimeric structure which has

diagonal symmetry along two L-shaped monomers to produce a functional W-shaped

protein (Gardino, Smerdon et al. 2006). Each of the L-shaped monomers contains a

functional binding groove, such that the protein dimer is able to bind two

phosphorylated targets simultaneously. Binding of two sites simultaneously was shown

to cause a significant increase in binding stability compared to the binding at a single

site alone. In line with this, a significant number of binding partners have been shown

to contain multiple 14-3-3 binding sites with a spatial separation consistent with the

theoretical length separating the dimers binding grooves. Alternatively, it has been

speculated that the 14-3-3 dimer may function as a molecular bridge to link two

subunits together to stabilize a complex. This has been shown in the H+ ATPase plant

protein, where 14-3-3 binds to two adjacent subunits to stabilize the formation of the

octameric complex.

78

In almost all eukaryotes, the 14-3-3 proteins comprise large multigene families -

humans contain 7 highly conserved isoforms while there are 13 expressed isoforms in

Arabidopsis. Based on structure they are divided into two distinct clades; Epsilon-like

and non-Epsilon like (DeLille, Sehnke et al. 2001). The large gene family which has been

conserved across species led many researchers to speculate that it is functional

specificity of the different isoforms which has driven the evolutionary conservation.

There is some evidence to support this; 14-3-3-GFP fusion proteins constitutively

expressed in Arabidopsis had differing localization patterns, suggesting that this was

being driven by differing binding partners. Similarly, a number of mutant Arabidopsis

plants containing T-DNA knockouts of 14-3-3 genes show a variety of quantifiable

phenotypes which appear to be isoform specific (Purwestri, Ogaki et al. 2009; Tseng,

Whippo et al. 2012). Despite this, there is no clear evidence of a binding partner being

specific to only one 14-3-3 isoform, thus suggesting that there is functional redundancy

between 14-3-3 isoforms.

In plants and animals, various techniques have been used to identify literally hundreds

of putative interaction partners for 14-3-3 proteins. Of these, only a fraction have been

characterized to determine essential information such as their binding site, effect on

protein structure or indeed the regulatory role on their binding partner. What is clear

from the evidence compiled so far is that the binding of 14-3-3 to their target may

cover critical protein regions such as import/export sequences or catalytic domains, or

the binding induces structural changes that induce exposure or burying of these critical

regions. These changes were shown to affect three primary actions; catalytic activity,

localization or degradation state. Briefly, catalytic activity may be either induced such

as the Arabidopsis kinase CPK1, or repressed such as in the case of sucrose synthase

(Camoni, Harper et al. 1998; Toroser, Athwal et al. 1998). Localization may either

suppress import into cellular compartments by blocking a localization sequence, such

as in the case of the human CDC25C kinase (Graves, Lovly et al. 2001). Alternatively its

binding can expose a localization signal such as the mammalian KSRP protein (Díaz-

Moreno, Hollingworth et al. 2009). Structural changes can additionally impact

degradation, as shown in the example of nitrate reductase, where 14-3-3 binding

79

induces protein degradation, thus facilitating loss of enzyme activity in the cell (Weiner

and Kaiser 1999).

4.1.3 14-3-3 binding site

Determination of the role of 14-3-3 regulation is dependent upon the elucidation of its

binding site. Resolving this will allow a reverse genetics approach, whereby gene

mutations result in measurable phenotypes which allow an insight into the function of

this interaction. The search for 14-3-3 binding motifs appears to be somewhat further

progressed in mammals than in plants. Two well conserved binding site motifs have

been characterized for mammalian 14-3-3 binding partners; these are motif 1

[RX(Y/F)Xp(S/T)XP] and motif 2 [RXX(Y/F)Xp(S/T)XP]. From the combination of screens

which have occurred in mammalian systems, it was estimated that >60% of putative

targets contain at least one of these motifs (Fu, Subramanian et al. 2000). However,

other, likely less common motifs, were also identified. One of those is a motif that is

not required to be phosphorylated to allow 14-3-3 binding (Aitken 2006). This is

evident in the minimal binding site WLDLE which has been shown to bind to 14-3-3s

despite the evident lack of a phosphorylated residue (Muslin and Xing 2000; Yaffe

2002). From the limited characterization of non-phosphorylated targets, it appears

that this is the exception rather than the rule.

In plants, the relationship between primary sequence and interaction domain is less

clear. Meek et al identified >100 targets in their immunoprecipitation screen for 14-3-3

targets and noted that only ~40% of these contained the conserved motif 1 or motif 2

which are putative binding sites (Moorhead, Douglas et al. 1999). In part this may be

due to novel, plant specific binding domains. The H+ATPase 2 protein contains one

such domain, with RpSP shown to be the minimal peptide required for 14-3-3 docking

(Fuglsang, Visconti et al. 1999). Due to the obvious limitations imposed on

characterizing each binding site in a protein case-by-case basis, Panni et al used a novel

approach to screen for putative binding domains. They constructed a chip containing

randomized phospho-serine oligomers of 12AA in size and screened for interaction

with 14-3-3 Epsilon (Panni, Montecchi‐Palazzi et al. 2011). Rather than identifying new

discrete binding domains, they published a set of ‘rules’ to characterize the binding

80

sites. From the results it became clear that 14-3-3s preferred to bind to targets

sequences with surrounding positively charged residues, and were less inclined to bind

to peptides containing a proline at the +1 site relative to the phosphorylated residue,

or aspartate or glutamate residues in the sites surrounding the phosphorylated

residue. Together, the conserved binding motifs, requirement of phosphorylated

binding sites and rules that determine the possibility of 14-3-3 binding in the residues

surrounding the phosphorylation site means that a rational approach to determining

14-3-3 binding sites can be used to target specific areas of a 14-3-3 binding protein.

4.1.4 Aims and Hypotheses

Phosphorylation was shown to be necessary for a maize HD2 homologue to exhibit any

catalytic activity on its histone H3 substrate. Given the pull down data which suggested

that HD2C was a target for 14-3-3 binding, together with this evidence of

phosphorylation, two clear hypotheses can be made. The first is that the pull down

data reflects a true, in planta interaction which can be monitored by BiFC. The second

is that 14-3-3 is imposing a functional change on HD2C that is affecting its catalytic

activity. Given the previously characterized C-terminal catalytic domain and N-terminal

NLS and zinc-finger domain, the location of the 14-3-3 binding site may give some

insight into the mechanism of 14-3-3 action. For example, an N-terminal 14-3-3 binding

site would suggest that 14-3-3 binding is directly affecting the catalytic domain of the

enzyme. To characterize the putative 14-3-3 interaction with HD2C, the following aims

were made:

1. Determine the biological relevance of 14-3-3 interaction with HD2C. Firstly it is

important to identify which 14-3-3s are likely to bind to HD2C, and secondly

whether all HD2Cs can bind to 14-3-3s. BiFC will be used to ensure that an in

planta context is assured, and that subcellular localization is a factor that

determines whether there is interaction.

2. Identification of the 14-3-3 binding site on HD2C is necessary so that

manipulations of this site can be used to determine the functional consequence

of 14-3-3 binding. Therefore, HD2C deletion constructs will be constructed and

81

tested using BiFC to determine what HD2C regions are important for 14-3-3

interaction. Site directed mutagenesis may then be employed to determine the

critical residue required for 14-3-3 interaction.

3. A C-terminal 14-3-3 binding site may be critical for catalytic regulation, whereas

an N-terminal site may control nuclear or nucleolar localization. HD2C mutants

unable to bind 14-3-3 will therefore be used to determine what regulatory

function 14-3-3 binding has on HD2C.

4.2 Results

4.2.1 14-3-3 isoforms bind to HD2C in planta

Paul et al identified HD2C as a putative target for 14-3-3s when using the 14-3-3

exposed domain shared by multiple 14-3-3 isoforms (Paul, Liu et al. 2009). It was

necessary to delineate this information to determine which, if any, 14-3-3 isoforms are

specific for the interaction with HD2C. Micro-array data were first investigated by

performing a hierarchal clustering analysis of a subset of 14-3-3 and HD2 isoforms to

determine the context of co-expression in Arabidopsis tissue (Figure 4.1). The micro-

array data suggested that multiple 14-3-3 isoforms have overlapping, developmentally

regulated expression with HD2C. Most evident is that HD2C is most highly expressed in

flower tissue with especially high expression in carpel and ovules. Furthermore, strong

HD2C expression was found in seeds and embryonic tissue and root tips with weaker

expression in the root apical meristem.

Higher HD2C expression clusters most closely with the 14-3-3 isoforms nu, epsilon, psi

and upsilon. The best correlation was found to be between HD2C and 14-3-3 upsilon

with high expression in almost all HD2C high expressing tissues except for root cells,

seedling culture, the stigma of flowers and the embryo. In cell culture,/primary cells

and seedling culture, the abscission zone of flowers and root tips high HD2C expression

correlated with higher expression of 14-3-3 nu and epsilon (Figure 4.1). Expression of

HD2C and 14-3-3 psi was high in cell culture/primary cells, seeds and embryos, roots

and root apical meristem.

Kappa, Phi and Omega were somewhat related with co-expression found for 14-3-3 phi

(root tip), kappa and omega (abscission zone). No correlation with HD2C expression

82

was found for 14-3-3 lambda, mu, pi, iota and omicron. The most significant overlap

between the other HD2 isoforms was in root and root tip, abscission zone and

hypercotyl. This overlapped with expression of 14-3-3 epsilon and omega isoforms.

The data suggested that interaction should be relevant in multiple biological contexts

and can be somewhat 14-3-3 isoform specific. With the knowledge of co-regulation,

four 14-3-3 proteins were chosen for in planta interaction studies using Bimolecular

Fluorescence Complementation (BiFC). The proteins selected were from the 14-3-3

epsilon branch of the 14-3-3 family (epsilon and mu) and from the non-epsilon branch

(nu and psi). Three of the chosen 14-3-3 proteins had good correlations with HD2C

expression (epsilon, nu and psi) and one; mu showed little correlation in the

expression data obtained from Genevestigator (Figure 4.1). Ideally, 14-3-3 upsilon

would have been chosen as it had the best correlation with HD2C expression but the

cDNA encoding for this protein was unavailable at the onset of these tests. The cDNAs

for the four proteins were cloned in frame to the N-terminal of YFP in the PG179NS-YN

vector and were used to transform Agrobacteria in preparation for injection to N.

benthamiana leaves. This work had previously been undertaken by a colleague who

cloned and prepared PG179NS-YN and PG179NS-YC vectors for 12 isoforms of the

Arabidopsis 14-3-3 family (Hung Chi Liu, PhD thesis, UWA 2009). Additionally, the

library also contained N-terminal truncated versions of the 14-3-3 proteins in the two

vectors. Such truncated 14-3-3 proteins are expressed as YN or YC fusion proteins but

cannot dimerise as the first 1-50 amino acids function as a dimerization domain for this

class of proteins. These N-terminal 14-3-3 truncations, when co-expressed with HD2C

fused to the corresponding YN or YC vector, were therefore appropriate controls to

ensure fluorescence was not observed as a result of native reconstitution of the YFP

fluorophore in the absence of protein binding.

The 14-3-3 isoforms were tested with HD2C in a BiFC interaction analysis in N.

benthamiana leaves. Confocal microscopy was used to visualize and capture the

fluorescence in the epidermal layer of the leaves that was caused by the reconstitution

of YFP (figure 4.2). Strong and widely distributed fluorescence was observed in the

nucleus and nucleolus of the plant cells for each of the 14-3-3 HD2C combinations in

each sample, suggesting that interaction was possible between the two tested proteins

in planta. The nuclear and nucleolar fluorescence observed in the cells, was consistent

83

with previous HD2C-GFP analyses. This suggested either that 14-3-3 binding is

required to maintain the localization state of HD2C, or that the interaction did not

influence its localization state.

4.2.2 HD2 isoforms bind 14-3-3 epsilon

Testing all permutations of HD2s and 14-3-3 was superfluous given the evident

redundancy observed between HD2C and the epsilon and non-epsilon 14-3-3

homologues. However, identifying an in planta binding between the remaining HD2

homologues and 14-3-3 epsilon may yield some insight into potential binding regions

given the sequence diversity in some regions of the protein sequences between

homologues, particularly for HD2D. HD2A, B and D were therefore tested for

interaction with 14-3-3 epsilon using BiFC. As previously, HD2-YN and 14-3-3 epsilon-

YC constructs were co-expressed in N.benthamiana leaf epidermal tissue and

interaction of proteins was visualized using confocal microscopy. The N-terminally

truncated 14-3-3 epsilon was again as before used as a control to ensure that

fluorescence was not due to non-14-3-3/HD2 driven YFP reconstitution. As shown in

figure 4.3 all 14-3-3 epsilon/HD2 constructs resulted in strong fluorescence compared

to no evident fluorescence between HD2/deltatruncated-14-3-3 epsilon. As expected

the cellular distribution of HD2A, HD2B and HD2D when bound to 14-3-3 epsilon

mirrored that of their GFP fusion patterns; fluorescence was confined to the nucleus

and nucleolus for HD2A-B and was cytoplasmic and nuclear in the case of HD2D.

Together this data suggests that all HD2 isoforms may bind in vivo to both the epsilon

isoforms of the 14-3-3 proteins. Given the redundancy observed for interactions

between HD2C and 14-3-3 proteins, one can postulate that all other 14-3-3 isoforms

will also interact with all four HD2 isoforms and non-epsilon 14-3-3 proteins.

4.2.3 Analysis of HD2C 14-3-3 binding domains

The reverse genetic analysis to determine the biological significance of 14-3-3 binding

to HD2C requires an elucidation of the binding site. Subsequent mutagenesis to

remove this binding site will allow a direct comparison between the mutated HD2C

unable to bind 14-3-3 and the wild type enzyme which can be compared in the context

84

of the enzyme’s activity, localization and the phenotypic changes to the plant. As

described in chapter 3, HD2C consists of an N-terminal enzymatic domain, a central

acidic region with a neighbouring NLS and a C-terminal zinc finger. Recent phospho-

proteomic screens have identified a C-terminal phosphorylation site that exists

between amino acids 275-287, which may be a relevant site for 14-3-3 binding. A

deletion analysis coupled to BiFC analysis to test for interaction or loss thereof was

used to determine whether the 14-3-3 binding site on HD2C could be narrowed down

to this C-terminal region. Two truncated versions of HD2C corresponding to the N-

terminal domain and the remaining C-terminal of the protein were amplified by PCR,

cloned into the pg179NS-YC vector and transferred to N benthamiana. A deletion

fragment of HD2C consisting of amino acids 226-295 was sufficient to bind 14-3-3

epsilon (figure 4.4) as there was evident fluorescence in both cytoplasm and nucleus

(Appendix 3). However, the remaining N-terminal fragment of HD2C consisting of

amino acids 1-225 also resulted in fluorescence localized to the nucleus and nucleolus.

The differences in localisation between the two deletion constructs can be explained

by the loss of the NLS in the construct 226-295 (see also chapter 3; identification of a

NLS). These results therefore suggest that there are multiple 14-3-3 binding sites in the

HD2C sequence.

The presence of multiple 14-3-3 binding sites within a protein is not unique, as it has

been widely cited both within mammalian HDACs as well other 14-3-3 client proteins.

To obtain a better resolution of the protein regions containing 14-3-3 binding sites

while simultaneously testing for additional binding regions , a so-called overlapping

series of ‘tiling deletions’ was constructed. This series consisted of DNA fragments of

HD2C encoding for short (45-70 amino acids long) peptides. Together, these short

DNA fragments and the encoded peptides cover the length of the HD2C protein twice

with interloping peptides always covering the adjacent borders (figure 4.4). Each ‘tile’

was cloned into the pg179NS-YC vector and tested with 14-3-3 epsilon pg179NS-YN for

interaction in tobacco leaves using BiFC. Fluorescence indicating interaction of the

HD2C fragment with 14-3-3 epsilon are summarized in figure 4.4, with individual

fluorescent images shown in appendix 3. Interestingly, six of the ten peptide

fragments are able to interact with 14-3-3 epsilon. Based on the assumption that any

positive peptide could contain a 14-3-3 binding site at any location within its sequence,

85

this indicated that a minimum of three 14-3-3 binding sites were present in HD2C.

These putative binding sites overlap with the C-terminal zinc finger which contains the

previously annotated phosphorylation site, the NLS sequence and a region between

the central acidic and catalytic domain (figure 4.4). These results are also in agreement

with the analysis using the two larger deletion fragments described above which

suggested that there were both N- and C-terminal 14-3-3 binding sites. Western blot

analysis was used to demonstrate presence of each peptide to ensure that the absence

of fluorescence reflected a lack of protein interaction rather than little or no

expression. As expression was evident in each case, these results suggest there are no

14-3-3 binding sites between amino acids 1-86 and 159-181 of the HD2C sequence

(Appendix 4).

4.2.4 Determining the site of 14-3-3 binding to a single AA resolution

The ultimate aim in identifying binding domains is to generate non-binding mutant

proteins which then allow determination of the minimal binding sequence. In the case

of 14-3-3 proteins, it is known that binding domains for these proteins usually contain

at least one phosphorylated serine or threonine residue. Although non-phosphorylated

motifs were described, the presence of a phosphorylated amino acid appears to be the

most common feature of 14-3-3 binding sites and hence a good target to search for

when trying to identify a 14-3-3 binding domain. HD2C is comprised of ~25% serine

and threonine residues of which 35 serines and 14 threonines are present within the

three potential binding areas identified using the tiling assay (FIGURE 4.4). This large

number allows for a significant number of permutations which would have to be

studied to identify three binding sites. Hence a global mutagenesis of single serine and

threonine residues appeared impractical. Instead mutagenesis was confined to the

most C-terminal tile which corresponds to a peptide between amino acids AA265-294

with the aim to determine a single binding site on the C-terminal end and then to

extend this analysis to eventually encompass the entire protein sequence.

86

4.2.4.1 C-terminal 14-3-3 binding site

The C-terminal tile corresponding to AA265-294 binds to 14-3-3 epsilon to produce a

strong cytoplasmic reconstituted YFP derive fluorescent signal (Figure 4.5). Its

sequence contains eight serine and seven threonine residues. To increase the scope of

binding site disruption and reduce the number of mutants that would need to be

generated, substitution of these residues to alanine was applied to clusters of serine

and threonine residues with a total of five clusters mutated and analysed, designated

HD2C mutation 1-5 (HCM1-5, figure 4.5A).

Each mutant gene fragment was cloned into pg179NS-YC and tested with 14-3-3

epsilon pg179NS-YN in tobacco epidermal cells for interaction using BiFC (figure 4.5B).

Mutant constructs HCM1-4 had no impact on the fluorescence which was generated

by re-complementation of the YFP, suggesting that these are not required for 14-3-3

binding. Rather, modification of S284 and T286 to A284 and A286 (HCM5) significantly

reduced the level of fluorescence in each cell, such that fluorescent was no longer

detected at the same confocal microscope settings as in interaction studies of 14-3-3

epsilon with any of the other four cluster mutation peptides and the non-mutated 241

to 296 peptide. This suggests that this site is required for 14-3-3 binding. To further

resolve the site that is specifically required for 14-3-3 binding, the serine and threonine

residues were individually mutated to alanine residues and the mutant deletion

fragments were again tested using BiFC. Here, mutation of the T286 residue had no

effect on the fluorescent pattern, whereas mutation of S284 reverted to the low

fluorescence indicative of negative binding. These results therefore suggest that S284

is the site that is necessary for 14-3-3 binding to HD2C.

4.2.4.2 Second C-terminal 14-3-3 binding site

The tiling deletions presented in figure 4.4 suggest that a region between AA205-257 is

sufficient for 14-3-3 binding. It was therefore necessary to determine if the inclusion of

this region was sufficient to revert to the positive phenotype despite the HCM5

mutation. A deletion fragment consisting of residues 226-294 containing the H3M5

mutation was therefore constructed and cloned into the pg179NS-YN plasmid. It was

tested for interaction with 14-3-3 epsilon using BiFC in transiently transformed N

benthamiana leaf tissue. As shown in figure 4.6, fluorescence was detected, suggesting

87

that 14-3-3 interaction had been recovered. Candidate serine and threonine residues

were less abundant in this additional region, with only T235 and S239 present. These

sites were therefore the target for site directed mutagenesis, with substitutions to

alanine again used (figure 4.6).

BiFC was again used to trace interaction between the HD2C mutant and 14-3-3 epsilon.

As shown in figure 4.7B, a construct was cloned into the pg179NS-YN plasmid that

consisted of the 226-294 residues which contained alanine substitutions of T235, S239,

S284 and T286; this was designated HCM6. This construct was used to co-transform N

benthamiana leaf tissue via Agrobacteria injection along with 14-3-3 epsilon fused to

the C-terminal YFP fragment. After three days, it was evident from confocal

microscopic imaging that there was a significant reduction in fluorescence compared

to the non-mutated 226-294 HD2C fragment. This indicated that mutation of HCM6

resulted in the removal of a 14-3-3 binding site. Therefore, this suggests that this site is

required for 14-3-3 binding.

4.2.5 HD2C-mutants with disrupted C-terminal 14-3-3 binding do not have a clear

shift in localization pattern

14-3-3 binding affects target proteins function by modifying enzymatic activity,

subcellular localization and degradation state. Enzymatic activity was reported to

centrally involve the N-terminal of the protein, and was therefore unlikely to be

directly affected by these C-terminal sites. In chapter 3, a site central to nucleolar

localization was determined to lie between AA 206-257, thus overlapping with the 235-

TPHPS-239 putative 14-3-3 binding site. The potential role in regulating nucleolar

retention by 14-3-3 binding was therefore investigated by testing the mutated

constructs as GFP fusion proteins and tracing their subcellular distribution in tobacco

leaf tissue.

The HD2C full-length genes were mutated with the same serine- and threonine to

alanine substitutions as in HCM5 and HCM6 above. Mutation was imposed on the full

length HD2C protein so that the resulting localization pattern of the fusion protein

could be compared with the localization pattern of the wild type HD2C fused to GFP.

As shown in figure 4.8, mutating the 14-3-3 binding sites at either of the positions had

88

no evident effect on the subcellular localization of the HD2C protein. From these

results it was therefore assumed that regulation of HD2C by 14-3-3 must involve a

different form of regulation or if localization is affected by 14-3-3 binding, must require

a different 14-3-3 binding site.

4.3 Discussion

4.3.1 Summary

Here, the interaction of 14-3-3 and HD2C was investigated using Bimolecular

Fluorescent Complementation. It was shown that HD2C was able to bind both epsilon

and non-epsilon classes of 14-3-3 proteins in transiently transformed N.benthamiana

leaf tissue. Similarly, all HD2 isoforms were able to bind to the 14-3-3 epsilon isoforms

using the same approach. A deletion analysis of the HD2C protein was then used to

map the interaction of HD2C with 14-3-3 epsilon, revealing three distinct regions that

harbour a 14-3-3 binding site. Site directed mutagenesis of possible serine and

threonine residues that could correspond to the critical phosphorylated binding site on

the C-terminal region of the protein revealed that residue S284 and one of T235 and

S239, when substituted to alanine, abolished 14-3-3 binding. Lastly, the link between

14-3-3 binding and HD2C localization was investigated by comparing the fluorescent

pattern of a full length HD2C-GFP fusion that contained the mutants which perturbed

14-3-3 interaction with a wild type HD2C-GFP protein. No difference in localization was

observed, suggesting that these sites were not involved in controlling the localization

pattern of HD2C.

4.3.2 HD2C does not show preference to 14-3-3 isoforms

14-3-3 proteins function as dimers that bind phosphorylated peptides and coordinate a

regulatory change by modifying the protein structure of their bound target. It is

important to identity the target for each 14-3-3 isoform given the possibility of

functional specificity implied by the varying 14-3-3-GFP subcellular localizations,

varying expression patterns and the evolutionarily conserved large gene family.

Furthermore it is possible that specific heterodimers comprised of co-expressed 14-3-3

homologues can drive the interaction of targets specific for each homologue.

89

In this study, the interaction of HD2C and 14-3-3 epsilon was confirmed using BiFC in

transiently transformed N. benthamiana tissue. Given this result, and the fact that

HD2C contains a very specific nuclear and nucleolar localization pattern which is not

commonly observed in some 14-3-3 homologues, HD2C provided a model protein on

which to test the redundancy of 14-3-3 function. The combination of HD2C with

epsilon (epsilon and mu) and non-epsilon (nu and psi) 14-3-3 proteins in planta

resulted in a fluorescent pattern that was localized in the nucleus and nucleolus. This

result suggests that there is no 14-3-3 specificity between isoforms with regards to

HD2C binding, with both branches of the 14-3-3 family evidently capable of binding to

the HD2C. The significance of this result must be tempered by the obvious issues

relating to expression and the non-quantitative nature of the BiFC assay. Historically,

the debate into 14-3-3 target specificity has centred on the competing ideas of total

functional redundancy vs. recognition and binding of specific targets. However, more

recently studies have focussed on the gradient of target specificity, whereby target

proteins range from ideal to poor binding partners and it is this gradient which drives

specific responses from 14-3-3s within the cell. For example, 14-3-3 isoforms from

barley were tested using quantitative yeast 2-hybrid to measure their affinity to

sucrose phosphate synthase, revealing drastic differences in binding potential. This is

not an inherent 14-3-3 isoform specific binding affinity profile, as the binding affinity

for H+ATPase and nitrate reductase with an overlapping subset of Arabidopsis 14-3-3

isoforms were tested and shown to have unique preferences for 14-3-3 isoforms.

Similarly, the 14-3-3 isoforms chi and epsilon were shown to differentially bind client

proteins from developing Arabidopsis seed, suggesting functional specialization in this

developmental process (Swatek, Graham et al. 2011). These results appear to suggest

that there is no utility in defining functional redundancy as a binary bind/not bind

scenario. Rather, each 14-3-3 client has an intrinsic preference for 14-3-3 which is

defined by unique expression patterns and binding affinities for the 14-3-3s.

Consistent with this observation is that the BiFC assay used in this analysis is not

sufficiently quantitative to differentiate this level of functional specificity. CaMV-35S

promoter driven expression and subsequent translation of 14-3-3-NYFP fusion proteins

result in saturating levels of 14-3-3, ultimately causing fluorescence to be observed in

even weak protein-protein interactions. As such, this study alone can have little input

90

into the issue of functional redundancy within the 14-3-3 gene family. Despite this, it is

clear from the combination of this result, and that obtained by the pull-down data

(Paul, Liu et al. 2009), that the HD2 family is indeed a target for 14-3-3 binding. The

fact that binding was possible with each 14-3-3 isoform is significant, since the

ubiquitous expression of the 14-3-3 family and their localization to the nucleus means

that a phosphorylated HD2 is likely to always have access to a 14-3-3 pool with which it

may bind. This result therefore suggests it is not the 14-3-3 protein itself that is

limiting, but rather it is the phosphorylation which is the critical signalling step

required to induce any association of 14-3-3 and HD2C.

4.3.3 HD2C contains multiple 14-3-3 binding sites

From the tiling deletion assay it was evident that there were multiple 14-3-3 binding

sites on the C-terminus of HD2C. Using site directed mutagenesis it was shown that in

the context of the C-terminal domain, mutation from TPHPS-APHPA and SHT-AHA

resulted in loss of 14-3-3 binding to the 226-294 amino acid C-terminal HD2C

fragment. The occurrence of multiple 14-3-3 binding sites on a protein is not rare and

indeed has been proposed to be a principle mechanism by which 14-3-3 stabilizes non-

native conformations in its ligand (Yaffe 2002). The most overt hypothesis would be

that each serine binds each to one of the monomers of the 14-3-3 dimer to result in a

stable HD2C/14-3-3 complex. Indeed, it was calculated that 14-3-3 dimers that bind to

dual sites may result in cooperative binding that has several orders of magnitude

higher affinity than single sites. The 14-3-3 dimer has diagonal symmetry between its

monomeric parts, with the binding grooves which has been calculated to be separated

by approximately 34.4 Angstroms from the human 14-3-3 zeta crystal structure (Liu,

Bienkowska et al. 1995). Assuming a linear, extended peptide structure, this would be

sufficient to bridge a ~15 amino acid peptide. The two sites identified in HD2C are

more distantly linked, being at least 44 amino acids apart. This may suggest that a

single 14-3-3 dimer does not simultaneously bind these two serine residues. Assuming

that the two binding domains of the 14-3-3 dimer are binding phosphorylated targets,

this may be consistent with the hypothesis that 14-3-3s stabilize the association of two

proteins in a complex by acting as a molecular bridge. Given the findings presented in

91

section 3, the role of 14-3-3s in maintaining a HD2 multimer may be a direction of

future research.

Alternatively, the 14-3-3 binding sites may be within the critical 34.4 Angstroms

proximity in the context of a mature tertiary structure. For example, the mammalian

transcription factor FOXO4 has been shown to carry two 14-3-3 binding sites at Thr28

and Ser193, yet allow simultaneous binding as the two tails containing the binding

sites are occluded from its central forkhead domain (Obsilova, Vecer et al. 2005). No

HD2 structure is currently available from the pfam database, so a detailed analysis of

the structure was not able to be performed. However, the two 14-3-3 binding sites

occurred within and besides a well-defined TFIII-type zinc finger domain. This consists

of two cysteine residues arranged antiparallel with the two histidine residues, together

arranged to complex with a central zinc ion. The antiparallel fold between cys2 and

his2 can be modelled to show that, in isolation, the zinc finger motif may be conducive

to allow a single 14-3-3 motif to contact both serine residues. If this is the case,

simultaneous binding of the 14-3-3 dimer is probably functionally significant and will

require further characterization to elucidate whether binding is an independent event.

4.3.4 Identification of 14-3-3 binding sites on HD2C

Here a site-directed mutagenesis approach tied with BiFC to determine the 14-3-3

binding sites of HD2C. In Johnson et al’s bioinformatics survey of 14-3-3 binding sites,

they suggested that true 14-3-3 binding should be annotated following a defined

procedure that included (1) identification of phosphorylation of the critical residue in

vivo; (2) elimination of the critical serine or threonine residue by mutation or

dephoshorylation; (3) ensuring that in vitro phosphorylation was consistent with in

vivo phosphorylation; (4) structural analysis of 14-3-3 and its target protein binding;

and, (5) where there are multiple 14-3-3 binding sites, to ensure that mutation of one

14-3-3 binding site does not disrupt the binding of another 14-3-3 binding site

(Johnson, Crowther et al. 2010). The work presented in this thesis addressed each of

these criteria with varying degrees of sufficiency with respect to the binding of 14-3-3

to HD2C.

The link between phosphorylation and 14-3-3 binding was only investigated

circumspectly, with preferential investigation of serine and threonine residues as

92

putative 14-3-3 binding sites. Previously it was shown that phosphorylation occurred at

three sites in a maize HD2 homologue on serine residues (Wang, Kruhlak et al. 2000).

Assuming that this has been conserved, this result was consistent with the minimal

three 14-3-3 binding sites described from the tiling deletion analysis. Recently, it has

been shown using phospho-proteomic analyses that HD2C is phosphorylated between

AA270-290, a site that overlaps with the putative 284-SHT-286 14-3-3 binding site

(Durek, Schmidt et al. 2010). Given the fact that 14-3-3 binds to phosphorylated

residues in the vast majority of characterized cases, and that of all the mutated serine

and threonine residues contained on this peptide only the mutated SHT-AHA was not

able to bind, this suggests that the true 14-3-3 binding site has been modified. The

235-TPHPS-239 site has not been similarly characterized. As suggested by Johnson et

al, further characterization by identifying the site of phosphorylation to a single amino

acid resolution is required to lend support to the hypothesis that the two putative 14-

3-3 binding sites raised in this study are functionally significant.

N.benthamiana as opposed to Arabidopsis tissue was used to express the fusion

protein because it ensures a more consistent transformation efficiency, which has

been widely used and documented in literature. BiFC was used to validate protein

interaction and subsequently perturb this interaction by mutation. This ensured that

the protein was expressed in an in planta context rather than the traditional bacterial

expression and pull-down analysis. The advantage of this was that it ensured that

protein binding was biologically relevant with respect to protein co-localization and

that phosphorylation occurred in the correct context because it was a substrate for its

specific kinase. Furthermore, the fluorescence between mutated and wild-type HD2C

could be directly compared and semi-quantified using pixel saturation look-up tables

on the confocal microscope. The comparison between positive and negative

interaction was consistent with the difference in fluorescence observed between

positive and negative controls, with Western blot showing a comparable level of

expression in the two cases.

93

4.3.5 The HD2C 14-3-3 binding site does not correspond to any consensus 14-3-3

binding motif

In the analysis of 14-3-3 binding sites in the C-terminus of HD2C, regions were shown

to affect 14-3-3 binding. This site corresponded to a region of sequence conservation

between the Arabidopsis HD2A-C homologues and other HD2C homologues. Earlier in

their history, 14-3-3 targets were identified and characterized on a case basis which

fostered easy characterization of target proteins with similar binding sites. Mammalian

proteins were shown to bind 14-3-3 proteins in common consensus motifs designated

as motif 1 [RXXpS/pTXP] or motif 2 [RXXXpS/pTXP] (Yaffe 2002). In plants it was

reported that there is a minor modification of this binding motif, as the consensus

sequence [LX(R/K)SX(pS/pT)XP] is instead over-represented in a number of 14-3-3

binding proteins. Additionally the novel binding site on the penultimate

phosphorylated threonine of H+-ATPase AHA2 was shown to be dependent on the

tyrosine-threonine-proline sequence. However, approaches such as yeast-2-hybrid and

co-immunoprecipitation which screen blindly for 14-3-3 binding proteins have resulted

in lists of proteins that bind 14-3-3 proteins, yet contain no corresponding consensus

motif. For example in mammalian targets only ~60% contain a motif 1 or 2, while

Arabidopsis targets only contain the consensus motifs in ~40% of cases. From the large

number of motif 1 and 2 containing targets already resolved, it is clear that these sites

are significant 14-3-3 binding motifs. However, it is also clear that further work is

required to resolve the binding motifs in these non-consensus targets.

As mentioned previously, Panni et al attempted to resolve this using chip-based

approach where random 12-amino acid peptides were washed with purified 14-3-3

protein and assessed to determine whether binding had occurred (Panni, Montecchi‐

Palazzi et al. 2011). Rather than identifying any clear binding motifs, they suggested

that 14-3-3 binding was strongly inhibited by negatively charged amino acids in the -3

and -2 position relative to the phospho-serine, and binding was increasingly favoured

in cases where lysine or arginine occupied the -1 and +2 position relative to the

phospho-serine. Ignoring the biological prerequisite kinase to induce this state in

nature and the fact that it assessed binding of a mammalian 14-3-3 protein, this set of

rules can be applied here in the analysis of the HD2C binding site. The consensus motif

derived from orthologous HD2C protein sequences is [(A/G)LASH(S/T)KAKH] and

94

[H(V/I)ATPHP(S/A)K]. Consistent with the published rules, this motif contains no

inhibitory glutamate or aspartate residues, and it contains lysine residues on the C-

terminal end of the motif.

The accumulation of evidence therefore suggests that these putative 14-3-3 binding

motifs are at least important to 14-3-3 binding, with the evidence weighted towards

the hypothesis that it is the critical phosphorylated residue that binds 14-3-3 directly.

As outlined previously, future research must be directed to fully elucidating this site,

most critically to determine whether the critical residue is phosphorylated.

4.3.6 Conclusions and future

This work has contributed new understanding to both 14-3-3 and HD2C proteins by

characterizing a small aspect of their interaction. Here we show that multiple 14-3-3

isoforms may bind to HD2C at a minimum of three sites along its sequence.

Furthermore one of these sites was characterized as a novel binding site which

overlaps its zinc-finger motif and does not appear to impact on the proteins

localization.

As previously mentioned the C-terminal binding site is, from this data alone, a putative

interaction site that requires further investigation to determine whether it is a true

phosphorylation site that physically interacts with the 14-3-3 protein. Lusser et al’s

original characterization of the HD2 isoform purified active protein from maize

embryonic tissue which was analysed for phosphorylation using phospho-sensitive

antibodies by Western blot (Lusser, Brosch et al. 1997). Technological limitations at the

time prevented a higher resolution analysis which could resolve these phosphorylation

sites. Phosphoproteomics is a possible method of investigation. It relies on the

purification of HD2 protein from plant cells and fragmentation of protein followed by

mass spectrometric analysis to resolve the possible phosphorylation site by comparing

m/z of the various fragments with the expected m/z calculated by the amino acid

sequence alone. This has already been used to identify the phospho-peptide which

overlaps with the putative 14-3-3 binding site highlighted in this study. Assuming that

this approach confirms phosphorylation of the critical 14-3-3 binding site, this would

lend sufficient evidence to suggest that this is a true binding site for physical 14-3-3

95

binding to HD2C. Final confirmation necessitates x-ray crystallography to visualize this

interaction and would provide information on the structural implication of 14-3-3

binding on the zinc-finger domain.

The other unresolved information from this study was that no functional implications

of 14-3-3 binding could be determined. 14-3-3s have been shown to have a number of

functional implications on their target proteins, including regulation of localization,

enzyme activity, degradation state or regulation of tertiary structure. The prospect of

localization change has already been addressed in this study, suggesting that there is

no evident role from the mutation analysis when fused to GFP. The enzymatic

implications would appear to be irrelevant given the previous determination that only

the region from 1-120 amino acids is required for HDAC activity.

104

Chapter 5

Role of HD2C in salicylic acid and jasmonate response in Arabidopsis

thaliana

105

5.1 Introduction

5.1.1 Hormone signalling in plants

Plants are sessile and therefore require fast recognition and response to the various

environmental conditions that they are exposed to. One important mechanism to

achieve such responses is via plant signalling molecules, the so-called ‘plant

hormones’. Plant hormones are internally-secreted chemicals that occur at low

concentrations and function as signalling molecules to regulate plant growth and other

responses. Unlike the traditional mammalian hormones, plant hormones may be

synthesised in a range of tissues or cell types and may act either in the same tissue or

cell type of synthesis, or be transported throughout the plant for a holistic response to

specific stimuli (Moore 1979; Davies 2010).

The broad definition of plant hormones has led to significant discussion over the

classification of various chemicals as a hormone. The consensus appears to be that

there are five major hormone groups; auxin, abscisic acid, gibberellins, ethylene and

cytokines, while several other chemicals including jasmonates, polyamines, salicylic

acid and brassinosteroids are widely accepted as fulfilling the parameters to be termed

plant hormones(Kende and Zeevaart 1997; Davies 2010). For the purposes of clarity in

this thesis, all the listed chemical classes will be referred to as plant hormones.

5.1.2 Possible role of HD2C signalling in response to salicylic and jasmonic acids

Experimental evidence suggests that HD2s may have a role in salicylic acid (SA) and

jasmonic acid (JA) signalling. In barley the expression of HvHDAC2-1 was shown to

increase in response to exogenously applied SA and JA (Zhou, Labbe et al. 2004).

Furthermore HD2C was shown to interact with HDA19, which itself was shown to be

centrally involved in SA and JA signalling (Choi, Song et al. 2012; Luo, Wang et al.

2012). For example expression of HDA19 corresponded to repression of SA

biosynthesis and SA responsive genes, while conversely leading to an upregulation of

ERF1 and expression of jasmonic acid and ethylene regulated PATHOGENESIS-RELATED

genes, Basic Chitinase and β-1,3-Glucanase (Choi, Song et al. 2012). ERF1 was similarly

shown to bind a HD2 homologue in Longan, suggesting a common mechanism of

control that may exist between the two HDAC families (Kuang, Chen et al. 2012).

106

Identifying firstly whether HD2C is involved in SA and JA signalling and secondly

elucidating the mechanism of this pathway is clearly required.

5.1.3 Salicylic acid

Salicylic acid is a critical signalling molecule whose production is induced by biotrophic

pathogens (pathogens that infect and feed on a living host cell) and modulates the

activation of defence related genes (Métraux, Signer et al. 1990; Cameron, Paiva et al.

1999). Its primary roles are to firstly to enable plants to survive the pathogenic

infection and secondly to stimulate the induction of a longer lasting systemic acquired

resistance (SAR) (Lawton, Weymann et al. 1995). Irrespective of its source of induction,

SAR primes the entire plant for subsequent defence against a broad range of

pathogens including pathogenic bacteria, fungi and viruses (Cameron, Paiva et al.

1999). Exogenously applied SA leads to the onset of SAR, while the removal of SA by

ectopic expression of salicylic hydroxylase prevents the onset of SAR (Lawton,

Weymann et al. 1995). This led to the realization that SA is both sufficient and

necessary for the physiological induction of SAR in a number of SA-dependent

pathways and is therefore a critical component of plant stress response (Shah 2003).

The SA mode of action is fundamentally tied to its activation of defence genes, which

itself is tied directly to the action of the SA response protein NPR1 (Shah and Klessig

1999). T-DNA insertion knockouts of NPR1 accumulate SA but are unable to induce SAR

and are more susceptible to a wide range of pathogens (Schenk, Kazan et al. 2000;

Zhang, Tessaro et al. 2003; Zhang, Francis et al. 2010). Conversely, over-expression of

NPR1 leads to enhanced capacity for induction of SA mediated plant defence and

enhanced disease resistance to a wide range of pathogens (Zhang, Francis et al. 2010).

NPR1 exists as oligomers in the cytoplasm an its structure is stabilised/maintained via

covalent attachment of disulfide bridges (Tada, Spoel et al. 2008). SA accumulation in

the cytoplasm leads to an alteration in the redox state, leading to the monomerization

of NPR1 and subsequent import into the nucleus (Mou, Fan et al. 2003). Here, NPR1

interacts directly with a number of TGA transcription factors (TGA1to 6) and WRKY

transcription factors 18, 53, 54 and 70 (Zhang, Fan et al. 1999; Després, DeLong et al.

2000; Dong 2004; Eulgem and Somssich 2007). Binding by NPR1 appears to activate

107

these factors, leading to the immediate activation of SA-early response genes,

followed by the sustained induction of SA-late response genes.

Identification of the SA-early response genes following SA induction is of current

research interest as it is expected to reveal insight into the early pathogen response of

the plant (Uquillas, Letelier et al. 2004). The best characterized examples include

GLUTATHIONE-S-TRANSFERASE 6 (GST6) and (IEGT) (Chen and Singh 1999; Uquillas,

Letelier et al. 2004). From analyses it is evident that these early response genes are

responsible for mediating changes such as recovery of the cell redox balance,

intracellular stress signalling, improvement of pathogen recognition and metabolic

changes (Schenk, Kazan et al. 2000; Galis and Matsuoka 2007). The SA-late response

genes assist in the latter stages of pathogen response and induction of SAR for the

entire plant. The best characterized example of this are the PATHOGEN RELATED (PR)

gene family, of which PR-1 is commonly used as a marker of SA activated SAR (Eulgem

2005).

5.1.4 Jasmonic acid and methyl-jasmonate

Similar to salicylic acid, jasmonic acid and its jasmonate derivative methyl-jasmonate

(MeJA) are critical signalling molecules that are induced by plant stress (Xu, Chang et

al. 1994). However whereas SA is induced by biotrophic pathogens, JA production is

locally stimulated by plant wound response following mechanical damage or herbivory

(Thaler 1999). Additionally the application of exogenous JA or MeJA induced

expression of defence related genes and a correspondingly increased resistance to

herbivorous challenge. The molecular mechanism of plant defence activation by JA

appears to centrally involve three players: ubiquitin ligase complex, SCFCOI1 and JAZ1/3

(Chini, Fonseca et al. 2007; Thines, Katsir et al. 2007; Fernández-Calvo, Chini et al.

2011). In summary, prior to JA stimulation JAZ1/3 is bound to JIN1 and represses its

ability to activate JA response genes. Upon JA stimulation, SCFCOI1 complex binds

JAZ1/3, leading to the ubiquitination and subsequent degradation of JAZ1/3. This frees

JIN1 and thus allows activation of the expression of JA-responsive genes (Manners,

Penninckx et al. 1998; Thomma, Eggermont et al. 1998) . The most widely studied JA-

responsive gene is PDF1.2, which accumulates rapidly in response to exogenous JA

application (Manners, Penninckx et al. 1998).

108

Aside from the evident role in defence response, the effect of jasmonates on a plant

development and growth are broad. Inhibition of plant growth, seed germination, root

growth and photosynthesis and promotion of senescence, tuber and pollen formation,

tendril coiling and fruit ripening have been correlated to increased endogenous JA

(Creelman and Mullet 1995).

5.1.5 SA/JA crosstalk

SA and JA are centrally involved in the plant defence response but are activated by

differing stimuli; SA by biotrophic pathogens and JA by necrotrophic pathogens and

insect herbivory (Pieterse and van Loon 1999; Glazebrook 2005). Activation of the

defence response by these differing stimuli results in an initial activation of distinct

pathways, although there is significant overlap of factors further down the defence

pathway (Traw and Bergelson 2003). In order to produce a response that is specific to

the pathogen that initially stimulates the response there needs to be cross-talk

between the two pathways to ensure that co-activation is not initiated which may

dilute the defence response and cost unnecessary energy for the plant (Pieterse and

van Loon 1999).

There appears to be a significant amount of crosstalk between the SA and JA response

pathways, with most evidence pointing to an antagonistic imposition between the

pathways. A superficial observation is that increased biotrophic resistance results in

decreased necrotroph resistance; conversely increased necrotroph resistance results in

decreased biotroph resistance (Robert-Seilaniantz, Grant et al. 2011). There is a

molecular basis for this observation. For example in tobacco, JA responsive basic PR1

genes were inhibited by exogenously applied SA while SA responsive acidic PR1 genes

were inhibited by exogenously applied MeJA (Malamy and Klessig 1992). Determining

the players of this crosstalk between each pathway is necessary to rationalize the

subtle defence response that plants use to combat their pathogens.

The SA antagonism towards JA-responsive genes appears to centre on the action of

NPR1 (Spoel, Koornneef et al. 2003). Treatment of Arabidopsis with both SA and MeJA

resulted in activation of SAR, but simultaneous repression of JA-responsive genes. This

phenotype was altered when NPR1 was knocked out by T-DNA insertion, as JA

109

responsive genes where instead activated (Shah, Kachroo et al. 1999). This suggested

that NPR1 was required for SA mediated JA-responsive gene repression. The

mechanism is still being determined; however, it appears that NPR1 can directly block

JA synthesis in the cytoplasm as well as interact with transcription factors in the

nucleus to directly repress JA-responsive genes expression. For example WRKY70 and

WRKY33 were shown to activate the SA-responsive PR1 and PR2 genes while

simultaneously repressing the JA-responsive PDF1.2 gene after activation by NPR1 (Li,

Brader et al. 2004). Additionally, NPR1 interacts with clade II TGA transcription factors

(TGA2, TGA5 and TGA6) which induce expression of some JA-responsive genes, but

repress these same genes when bound to NPR1 (Després, DeLong et al. 2000;

Ndamukong, Abdallat et al. 2007). Because of these dual roles, it has been suggested

that TGA factors intersect with the SA and JA defence pathways as both antagonistic

and synergistic factors to both direct and fine tune the plant defence response.

5.1.6 Aims and Hypotheses

HD2s were shown to be involved in hormone signalling via the ABA abiotic stress

pathway. Expression of HD2C was repressed by ABA and the expression of several

ABA-responsive genes was under-expressed compared to Col-0 in 35S:HD2C-GFP

plants (Luo, Wang et al. 2012). Here it is hypothesised that HD2C may be similarly

involved in the biotic plant defence response, where HD2C mediates the expression of

genes related to JA- or SA- response genes. Underlying changes in gene expression are

evident in related plant phenotypes, therefore it is likely that if HD2C has a role in SA

and/or JA response pathways, there will be a measurable phenotype. Therefore, the

aims of this section are:

1. Determining whether the expression of HD2C is controlled by SA or JA levels in

the cell by treating Arabidopsis plants exogenously with SA or MeJA and

measuring the expression of HD2C by RT-PCR.

2. Use the two constitutively expressing HD2C-GFP lines prepared during the work

described in chapter three to compare the growth of these Arabidopsis lines to

the wild type in response to SA and MeJA.

110

3. Determine the molecular mechanism of HD2 action on the SA and JA pathway

by testing interaction with proteins that are predicted to bind HD2C and which

are related to the plant defence response.

5.2 Results

5.2.1 Expression of HD2 proteins when exposed to SA, INA and MeJA

Accumulation of plant hormones in a cell is associated with the induction or repression

of the associated hormone response genes, allowing a combinatorial response from

the stimuli. Given the possible role in SA and JA responses, it was important to

determine if the exogenous application of SA and JA had an effect on the mRNA

accumulation of HD2 genes. Previously it was shown that 50 μM SA was sufficient to

induce a stress response in Arabidopsis seedlings. The methyl-ester of jasmonic acid,

MeJA, is a more active effector of the jasmonic acid pathway and was also applied at

50 μM concentrations to induce plant stress. Col-0 Arabidopsis seedlings were grown

on 0.5MS for two weeks before transferring to MS plates containing 50µM SA, 50µM

MeJA or no treatment. RNA was extracted and semi-quantitative RT-PCR used to

measure gene expression of HD2C (figure 5.1). As a positive control to ensure that

induction of the plant defence response had occurred, the SA responsive PR1 and

MeJA responsive PDF1.2 were amplified in parallel. The housekeeping gene actin was

used as a control to ensure that any differences were attributed to the effects of

hormone rather than the starting quantity of cDNA.

The actin housekeeping gene expression did change only slightly between individual

samples indicating that starting amounts of RNA were about equivalent between the

treatments (figure 5.1). Hence, any difference observed for the other genes could have

been attributed to the treatment differences. Comparing HD2C expression after

hormone treatment with the MS control treatment showed that there was no obvious

effect on the expression of HD2C in response to either SA or MeJA (figure 5.1).

Expression of PR1 was visibly increased in response to SA treatment, while PDF1.2

appeared to be slightly induced by MeJA treatment. This suggested that despite the

positive control markers indicating that the plant defence response had been

activated, there was no clear evidence to suggest that HD2C expression had been

altered in response to the treatments.

111

5.2.2 HD2C expression has no impact on root growth when exposed to SA or MeJA

Both SA and MeJA have a retarding effect on the root growth of Arabidopsis plants.

Furthermore, the role of HD2C expression was shown to have a statistically significant

effect on root growth in Arabidopsis seedlings when grown on 50µM ABA, with over-

expressing lines having reduced root growth (Sridha and Wu 2006). This therefore

demonstrates that HD2C plays a role in root development and growth. Here, it was

tested if a link exists between the expression of HD2C and the root growth of

Arabidopsis seedlings when exposed to 50 µM SA or50 µM MeJA (Staswick, Tiryaki et

al. 2002). 35S:HD2C-GFP line 1 and line 2, together with Col-0 seeds were germinated

and grown on vertical plates containing half-strength MS until roots had reached ~1cm

in length. Seedlings were then transplanted to vertical plates with half strength MS

containing either 50mM SA, 50mM MeJA or no hormone additive (control). Root

lengths were measured after eight days using the Neural-J plugin from Image-J picture

software (Abràmoff, Magalhães et al. 2004). Both SA and MeJA treatments caused

reduced root growth in each of the Arabidopsis lines. Root lengths were compared

between each transgenic line and the Col-0 wild type for each media by collecting

images of each plate and measuring the distance in pixels between start and end root

length.

As shown in figure 5.2, after eight days the root growth in the wild type on control

media was 845 px, on SA media it was 423 px and on media containing MeJA it was

253px. Compared to this, the roots of 35S:HD2C-GFP line 1 grew 981px on control

media, 438 px on SA media and 254px in the presence of MeJA.The second transgenic

line, 35S:HD2C-GFP line 2, had root growth of 840px on control media, 511px on SA

and 238 px on MeJA media. Thus the relative root growth for the wild type were2:1

(control:SA) and 3.3:1 (control:MeJA). This was similar to the values for the transgenic

line 1 with ratios of 2.2:1 (control:SA) and 3.9:1 (control:MeJA) and for line 2 with

ratios of 1.6:1 (control:SA) and 3.5:1 (control:MeJA). The relative growth rates

between both transgenic lines compared to the wild type were statistically not-

significant at a p-value<5. Together these data suggest that HD2C expression does not

affect root growth in response to SA or MeJA hormone treatment.

112

5.2.3 35S:HD2C-GFP plants have a delayed germination response to SA and MeJA

Germination is the growth of the embryonic seedling and marks the transition

between dormancy and growth (Bradford and Nonogaki 2007). The hormones SA and

MeJA were shown to have an inhibitory effect on this process in concentrations

>0.05mM, manifested by an increase in time after sowing to observe perforation of

the seed coat by the plants radical. To determine the effect that HD2C-GFP

overexpression has on this, Col-0, HD2C-GFP:LI and HD2C-GFP:L2 seeds were each

germinated on half strength MS agar plates supplemented with 0µM, 250µM, 500µM

and 750µM either SA or MeJA. This range of concentrations has been widely used and

shown to repress germination in Col-0 wild type plants (Colville, Alhattab et al. 2011).

Germination was analysed under a light microscope at 5x magnification and scored

based on the presence of the radical protruding from the seed coat. Germination

scores after 60 hours of incubation were accumulated for three separate experiments.

These scores were compared between each transgenic line and its corresponding wild

type for each media tested using a one tailed, independent t-test. This determined if

there was any statistically significant difference between germination rate for Col-0

and the 35S:HD2C-GFP plants on SA or MeJA media relative at each concentration

(figure 5.3). The results suggest that there was no difference between the germination

scores for any of the Arabidopsis lines on 0mM or 0.1mM SA or MeJA growth media

(p<0.05 for all four conditions in relation to MS). However on 0.25mM and 0.5mM for

both SA and MeJA media there was a statistically significant inhibition of germination

at the p<0.05 level when compared to germination rates of the same line on MS media

alone (figure 5.2A). At 0.25mM SA, germination was 95.66% for the Col-0 line

compared to 81.37% for HD2C-L1 and 67.53% for HD2C-L2. A further, more dramatic

reduction of germination was seen for the three lines on 0.5mM SA, germination was

21.13% for the Col-0 line compared to 6.16% for HD2C-L1 and 2% for HD2C-L2. The

effect of MeJA on seed germination was more obvious (figure 5.2B). Germination

scores for Col-0 were 86% for 0.25mM MeJA and 9.1% for 0.5mM MeJA, whereas

HD2C-L1 germinated at a frequency of 55.36% and 4.21% on the two media

respectively and HD2C-L2 germinated with frequencies of 47.21% and 0% respectively.

No germination was evident for any line after 60 hours when 0.75mM MeJA was

present in the media (data not shown). Together these results indicate that 35:HD2C-

113

GFP plants have reduced germination rates; i.e. show increased sensitivity in response

to SA and MeJA when compared to the wild type.

5.2.4 HD2C binds TGA6 transcription factor

The discovery that over-expression of HD2C in Arabidopsis resulted in SA and MeJA

with increased sensitive phenotypes in germination suggest that there is an underlying

molecular mechanism which may be common to the two hormone signalling

pathways. It was hypothesised that transcription factors may bind to HDACs and guide

them to their promoter cis-elements to negatively regulate gene expression(Luo,

Postigo et al. 1998; Doetzlhofer, Rotheneder et al. 1999). A bioinformatics approach

was used to Interrogation of the Predicted Arabidopsis Interactome Resource (PAIR)

database to identify putative HD2C binding proteins which may have a role in SA and

JA. PAIR predicts interactions by integrating indirect evidences for interaction (Lin, Shen et al.

2011). It identified the basic leucine zipper transcription factor TGA6 as a potentially

HD2C interacting protein. The confidence score for this prediction of ~1.3 was greater

than 1 and could therefore represent a true interaction (Lin, Zhou et al. 2011). TGA6 is

involved in the activation of genes related to plant defence and has been shown to

regulate SA and MeJA responsive genes in response to exogenous application of these

hormones (Zhou, Trifa et al. 2000; Zander, La Camera et al. 2010). Interaction of TGA6

with HD2C would rationalize the SA and MeJA response seen in the HD2C-GFP

transgenic plants. It was therefore an obvious candidate to test for in planta

interaction using BiFC.

TGA6 was cloned into the PG179NS-YN vector and transiently expressed with HD2C-YC

in N benthamiana leaf epidermal tissue as previously described (3.2.2). An N-terminal

HD2C fragment (AA1-60) corresponding to the enzymatic portion of HD2C was also

used to test whether the activity domain can interact with TGA6. Strong fluorescence

was detected in the nucleus and nucleolus of transformed cells when investigating

TGA6 interaction with the full length HD2C (figure 5.4) suggesting that interaction

between HD2C and TGA6 was possible. The N-terminal HD2C fragment together with

TGA6 had no significant fluorescence, suggesting that the observed YFP reconstitution

was driven by interaction between the two proteins independent of the activity

domain of HD2C. A Western blot was used to show that, in each case, proteins were

114

expressed so that the lack of fluorescence was not due to lacking or lower expression

levels (Appendix 5)

5.2.5 Expression of TGA6 overlaps with HD2C in some tissues and developmental

stages

The possibility of binding is only biologically relevant if the proteins are present in the

same location and at the same time. TGA6 is a transcription factor that binds NPR1 in

the nucleus, thus its localization overlaps with HD2C (Zhang 2011). To determine the

temporal and tissue specific expression of the gene, a database mining of micro-array

data was used to determine co-expression. As TGA6 and TGA2 and TGA5 are often

associated with the same response and as all three must be knocked out to produce

any phenotype, the expression of these genes were also investigated. Genevestigator

was used to compile the expression data of TGA2, TGA5 and TGA6 together with

HD2A-D in different Arabidopsis tissue (figure 5.5). The expression of HD2C and the

location of its highest expression were previously outlined in a similar analysis in

chapter 4 (4.2.2). TGA6 expression overlapped with HD2C most evidently in lateral root

primordial protoplasts, seedling culture and in seeds. In addition to the tissue specific

expression, developmental stages were also investigated (figure 5.6). Interestingly the

expression of HD2C was highest in senescing tissue, which correlated with highest

expression of TGA2, TGA5 and TGA6. Together these results suggest that the

interaction of TGA6 and HD2C may be most relevant in the seed and senescing tissue.

Considering the possible redundancy of interaction which could exist between other

HD2 isoforms and TGA isoforms, it was interesting to note that HD2A, HD2B, HD2D and

TGA6 shared expression in lateral root tissue (figure 5.5). Similarly, HD2A, HD2B, HD2D

and TGA2 shared expression in the hypocotyl. Together these results suggest that

TGA6 interaction with HD2C should be biologically relevant given the shared sub-

cellular localization pattern and the overlapping gene expression.

5.2.6 Analysis of the expression of genes controlled by TGA6 in HD2C modified

plants

A model for HDAC action suggests that the enzymatic deacetylation activity is directed

to specific chromatin regions by facilitating proteins that recognize specific DNA cis-

115

elements (Luo, Postigo et al. 1998; Doetzlhofer, Rotheneder et al. 1999). TGA6 is

known to bind to the as-1-like motif in the promoter in SA and JA related genes

(Niggeweg, Thurow et al. 2000) and to regulate expression of a number of SA and JA

regulated genes (Zhou, Trifa et al. 2000; Zander, La Camera et al. 2010). Based on the

validated interaction between HD2C and TGA6, it was next necessary to test the

hypothesis that HD2C regulates those same genes. A selection of genes related to the

plant defence response were chosen for an expression analysis using RT-PCR.

Arabidopsis lines Col-0, HD2C-L1 and HD2C L2 were grown for 2 weeks on 0.5MS plates

before RNA was extracted, converted to cDNA which was used to perform a RT-PCR.

Actin and ATPase were amplified in parallel as housekeeping gene controls. Results

indicated that there was no change in the intensity of PCR product in the actin and

ATPase housekeeping controls (figure 5.7) The expression of EDS5, ORA, SID2, EIGT,

UGT and GST6 were not affected by the overexpression of HD2C (figure 5.7). The most

obvious change in intensity indicating a difference in expression was observed for USP,

where expression was much higher in the two 35S:HD2C-GFP lines compared to Col-0.

There was also a visible increase in the expression of PR1 compared to Col-0, although

this was less obvious from the band intensities (figure 5.7). PDF1.2 and RFLK appeared

to be expressed in lower amounts in the 35S:HD2C-GFP lines compared to Col-0.

Together these results indicate that HD2C overexpression alters the expression of USP,

PR1, PDF1.2 and RFLK, but has no effect on EDS5, ORA, SID2, EIGT, UGT or GST6.

5.3 Discussion

5.3.1 Summary

Here, it was investigated what role HD2C may have in the salicylic acid and jasmonate

response pathway. Initially it was shown in Col-0 wild type plants that exogenous

application of salicylic acid was sufficient to induce expression of the salicylic response

gene PR1, but have no evident effect on HD2C expression. Similarly, exogenous

application of methyl-jasmonate was sufficient to induce expression of the jasmonate

response gene PDF1.2, but had no evident effect on HD2C expression. Next, two lines

over-expressing a HD2C-GFP construct in Arabidopsis plants were compared with Col-0

wild type plants to determine if there was any quantifiable phenotypic evidence that

116

HD2C had a role in either SA or JA response. A root length analysis on either media did

not produce any significant difference between the Arabidopsis lines. However a

germination analysis showed that over-expression of HD2C-GFP yielded a sensitive

response phenotype compared to wild type at 0.25mM, 0.5mM and 0.75mM SA and

0.25mM and 0.5mM MeJA. Next, interaction between HD2C and TGA6, a transcription

factor involved in both SA and JA signalling, was shown using BiFC. Micro-array data

suggested that there was some overlap in expression between these two proteins in

seed tissue and in the developmental progression of senescence. To test the

hypothesis that TGA6 directed HD2C to its as-1 like promoter cis-elements, RT-PCR was

used as a semi-quantitative measure of various genes that were shown to be regulated

by TGA6. A slight decrease in the JA responsive PDF1.2 expression, as well as in the SA

and JA-responsive RLK1 expression was observed, suggesting that HD2C may be


5.3.2 Plants expressing 35S:HD2C-GFP have altered development in response to SA

and MeJA

It was unknown at the onset of this analysis if HD2C had a role in either the SA or JA

signalling pathways, therefore germination and root length data were obtained for

transgenic lines exposed to SA and MeJA, a biological more active form of the JA

hormone. Despite some overlapping mechanisms with respect to the defence

pathway, each hormone elicits a distinct molecular response and hence the extent of

the response was further evaluated using gene expression studies.

Germination is the process where an embryonic plant contained within its seed

transitions from dormancy to growth. This is mediated by sensitive signal transduction

pathways which induce growth in response to critical conditions such as water

availability, temperature, light and oxygen. Imbibition, where the embryonic tissue

swells sufficiently to break the seed coat, leads to the release of the embryonic root

(radicle) and is an effective marker of germination. The link between HD2 expression

and germination was previously explored in relation to salt and ABA tolerance, where

it was found that overexpression of HD2C leads to an increase in the germination

frequency compared to wild type on 150mM salt as well as in the presence of 15mM

ABA (Sridha and Wu 2006). This is consistent with the very high HD2 expression in

117

barley embryos which led to the suggestion that HD2C is involved in germination.

Germination is controlled principally through the balance between ABA and GA

hormones, whereby dormancy is maintained by ABA until activation of GA biosynthesis

and signalling occur. Aside from the well-defined balance between ABA and GA, other

plant hormones have been shown to impact on seed germination. For example, SA and

MeJA were shown to inhibit germination of Col-0 Arabidopsis seeds at concentrations

>0.1mM.

Given the established link between HD2C expression and germination, the role of SA

and MeJA in delaying germination and the possible role of HD2C in signalling, it was

not surprising to find that HD2C-GFP over-expressing seeds showed an altered

response when germinated on SA or MeJA containing media. Here, in contrast to the

ABA treatment where HD2C:GFP overexpression led to a resistance phenotype, MeJA

and SA treatment of 0.25mM, 0.5mM and 0.75mM resulted in sensitivity phenotype,

as germination was evidently inhibited when compared to the wild type. This

suggested that the germination pathway is affected in different ways by ABA and SA.

This is difficult to rationalize, as previous studies appear to suggest that SA uses an

identical pathway to suppress germination. In monocots, this occurs by suppressing

the GA activated alpha-amylase (Xie, Zhang et al. 2007). The effect on germination by

SA (250µM ) required more than 10 times the molar concentration compared to ABA

(20µM). In the literature, the higher sensitivity to ABA is commonly accounted for by

the fact that SA affects the mRNA accumulation of alpha-amylase through the action

of WRKY38 negative regulation of its gene expression whilst ABA in addition to

negative transcription regulation, it directly decreases amylase secretion and

enzymatic activity, thereby effectively blanketing the cue to initialize germination. In

dicots it appears that salicylic acid inhibition of root growth is mediated by the defence

response. This pathway transfers energy from growth and reallocates it towards

fighting off pathogen attack (Heil, Hilpert et al. 2000).

The question remains therefore as to why the germination data suggest that plants

over-expressing HD2C-GFP are more tolerant to ABA as shown by (Sridha and Wu

2006), yet less tolerant to SA and JA as demonstrated in the study here.

118

The answer may lie in the antagonistic relationship that exists between ABA and SA. It

was shown earlier that pathogenesis by P. syringae is marked by pathogen induced

stimulation of ABA accumulation, leading to a decrease in the SA-mediated defence

(de Torres, Bennett et al. 2009). Similarly exogenous application of small amounts of

SA was shown to null the effect of abiotic stresses such as salt which are controlled by

the ABA pathway (Borsani, Valpuesta et al. 2001). Moreover, the molecular basis of

ABA response and SA response appears consistent with this. 35S:HD2C-GFP plants

showed decreased expression of ABA response genes, therefore the antagonistic

crosstalk with GA is reduced, leading to an increase in expression. Results from the

analysis presented here showed that the SA responsive genes PR1 and EDS5 were

increased in 35S:HD2C-GFP plants. Therefore repression of germination by the

aforementioned inhibition of alpha-amylase is more likely following the alpha-amylase

pathway. This hypothesis clearly requires further investigation, as the data presented

offers only a tentative link between any cross talk of ABA and SA pathways.

5.3.3 HD2C binds TGA6 transcription factor

To rationalize the biological link of SA and MeJA with HD2C, an analysis of putative

binding partners revealed that HD2C interacted with TGA6 in planta. TGA6 belongs to

the TGA family of transcription factors, so-named because they bind to promoter cis-

elements designated as-1 like sequences which are composed of two tandem repeats

of TGACG (Idrovo Espín, Peraza-Echeverria et al. 2012). TGA6 and its redundant

homologues TGA2 and TGA5 were shown to be involved in both the SA and JA induced

plant defence response (Fan and Dong 2002). In the salicylic acid pathway TGA6 binds

NPR1 in the nucleus and activates SA-response genes such as PR1. In the jasmonic acid

pathway, TGA6 activates the jasmonate responsive PDF1.2 and b-chi genes (Zander, La

Camera et al. 2010). However it is also involved in antagonistic crosstalk between the

two pathways, with co-stimulation of SA and MeJA resulting in clade II TGAs binding

ROXY19/GRX480 and repressing the JA-responsive genes, thereby blocking the JA-

defence pathway (Zander, Chen et al. 2012; Gatz 2013).

Sensitive phenotypes in the 35S:HD2C-GFP plants when exposed to SA or MeJA suggest

that HD2C has a role in both of the pathways. Given the binding of a transcription

factor to a negative regulator of gene expression, the possibility that TGA6 was

119

mediating negative regulation of its target through interaction was explored. On the

surface, this hypothesis was not consistent with the data- TGA6 has been shown to

activate SA- and JA-responsive genes, how then did HD2C factor into this relationship?

Indeed, the RT-PCR data was not overwhelmingly supportive of this hypothesis. Of the

TGA targets measured, the most obvious difference in expression was a large induction

of expression for the VSP1 gene, although there was slight induction in expression of

PR1. This clearly suggested that HD2C was not catalytically active on these promoters.

This was surprising given that HD2C was shown to bind HDA19, and that HDA19 was

involved in repressing PR1 expression (Choi, Song et al. 2012). This suggests that HD2C

is involved in a different process than HDA19, and that binding probably mediates a

different process. Similarly there was no obvious change in the expression of ORA,

SID2, EIGT, UGT or GST6; this suggests that HD2C was similarly not active on these

promoters. Given the diverse range of target genes that were targeted by TGA6, this

suggested that HD2C was not binding TGA6 to negatively regulate these targets.

Rather than engaging in the regulation of SA- and JA- responsive genes singularly,

HD2C may be involved in the cross-talk between the two pathways. The mechanism

for this cross talk has not yet been established. Given the repressive role of HD2C on

gene expression, and this unknown negative regulation on JA-responsive genes when

challenged with SA, TGA6 may direct HD2C to JA-responsive genes when stimulated by

SA. Consistent with this, RT-PCR analysis of 35S:HD2C-GFP showed that PDF1.2 and

RLK1 expression was repressed compared to the Col-0 wild type. Although there was

no salicylic induction, this may demonstrate some element of SA-JA crosstalk. These

are JA-responsive factors, with PDF1.2 being the classic example of SA mediated JA-

responsive gene repression. However, this hypothesis is tempered by a study on the

repression of the core JA-responsive element PDF1.2, where it was revealed that its

repression by the SA pathway was not mediated directly by its chromatin acetylation

state (Koornneef, Rindermann et al. 2008). Assuming that HD2C is using TGA6 to

deacetylate the PDF1.2 promoter, this suggests that it is not involved in SA-JA

crosstalk, but is active on the promoter through interaction with another pathway.

A significant amount of effort for this study was directed towards establishing a link

between HD2C action and the plant defence response. Partly this was instigated by the

broad role of TGA19 salicylic and jasmonate plant defence (Zhou, Zhang et al. 2005;

120

Choi, Song et al. 2012). Additionally the already established link between HD2C and the

ABA mediated abiotic stress response provided a tentative link which suggested that

there may be a role linking HD2C with the biotic stress response (Sridha and Wu 2006).

Lastly, there is a significant current interest in linking epigenetic pathways with various

stress responses in an effort to improve plant tolerance to various harsh

environmental conditions. From the data however there is not sufficient evidence to

lead to this conclusion. Although HD2C appears to be involved in SA and JA responses,

the molecular mechanism does not appear to involve binding AS-1 like cis-factors via

TGA interaction. This may partly be due to a confounding effect caused by HD2C

interaction with other factors involved in these pathways. Principally, HD2C interaction

with ERF1 was described in relation to Longan. Assuming that this is conserved in

Arabidopsis, it is likely that this interaction would also produce the SA and MeJA

phenotypes that were observed. Future studies into this interaction may instead look

to the expression data presented in figures 5.5 and 5.6. Interestingly, HD2C and TGA6

overlap most strongly in senescing tissue and seeds. This suggests that interaction is

most likely relevant during these developmental stages.

5.3.4 Conclusions and future work

The most significant aspect of this study was the identification of HD2C interaction

with TGA6, as it provides further evidence that there is significant cross-talk between

general transcriptional regulation elements and the epigenetic pathway. As previously

mentioned, this interaction is evolutionarily practical given the specificity of

transcription factors to significant subsets of genes and the passive but stable ability

for acetylation state to control gene expression. Given the inability to trace any

overwhelming evidence that HD2C is targeting as-1 like cis binding sites to act on,

further characterization into its role is required. The possibility of a role in senescence

was suggested from micro-array data. Both SA and JA have been shown to mediate this

developmental stage.

128

TGA6-YC/ HD2C-YN

TGA6-YC/ Δ HD2C-

YN

YFP CHLOROPHYLL DAPI MERGE A

B

Mouse anti-cmyc

Mouse anti-HA

Figure 5.8: BiFC analysis to determine HD2C interaction with TGA6 IN N benthamiana leaf tissue (A) Interaction of HD2C with TGA6 was evident by fluorescence caused by reconstitution of the split YFP fused to each HD2 protein. The YFP emission of each dimer overlaps with the DAPI stained nucleus in a discrete nucleolar compartment. No signal could be detected in the YFP channel for interaction between TGA6 and the 60AA N-terminal region of HD2C. A negative control consisting of the N-terminal (1-60 amino acids) of HD2C was tested for interaction. It yielded no fluorescence. (B) Expression was measured using western blot against the c-myc epitope from the YN vector and HA epitope from the YC vector. Expression was present in both tissues. Scale bar represents 20μm.

129

Chapter 6

Final Discussion

130

6.1 Summary

In this thesis the original aims were to characterize putative interactions to develop

insight into possible regulatory pathways that had not previously been identified.

Initially, localization of HD2C was analysed to trace the accumulation of HD2C in the

cell. HD2C was present in the nucleus and nucleolus when fused to GFP. Next, HD2C

dimers were tested to determine their fluorescent localization pattern. This revealed a

predominantly nucleolar pattern, distinct from HD2C-GP. it appears that this

localization may be dynamic, as stably transformed 35S:HD2C-GFP plants showed

increased accumulation of nucleolar fluorescence after 24 hours of salt stress. The

mechanism of this accumulation remains unknown; however a hypothesis is that

dimerization of HD2s appears to be involved based on the similar localization between

HD2C dimers and the pattern observed in salt treatment. Next two domains of HD2C

were shown to be necessary for nuclear and nucleolar localization. The nuclear

localization was shown to be dependent on an evolutionarily conserved KKAK motif,

while this did not disrupt nucleolar localization.

The interaction of 14-3-3 and HD2C was also investigated using Bimolecular

Fluorescent Complementation. It was shown that HD2C bound to both epsilon and

non-epsilon classes of 14-3-3 proteins, while the other HD2 isoforms were able to bind

to 14-3-3 epsilon. To identify the region required for this interaction, a deletion

analysis of the HD2C protein mapped out the interaction of HD2C with 14-3-3 epsilon.

Three distinct regions were found which enable interaction. Site directed mutagenesis

of possible serine and threonine residues that could correspond to the critical

phosphorylated binding site on the C-terminal region of the protein revealed that

residue S284 and one of T235 and S239, when substituted to alanine, abolished 14-3-3

binding

Lastly, interaction was investigated between TGA6 and HD2C. A link between HD2C

and SA and JA mediated plant defence was tried to be established. However,

exogenous application of salicylic acid and jasmonic acid had no evident effect on

HD2C expression. In addition two lines over-expressing a HD2C-GFP construct in

Arabidopsis plants were compared with Col-0 wild type plants to determine if there

was any phenotypes that suggest that HD2C had a role in either SA or JA response.

There was no statistically significant change in root growth on either media, however a

131

sensitivity phenotype was evident for both hormones in a germination assay. Finally,

HD2C was tested for its ability to regulate as-1 like promoter cis-elements related to

stress response. A slight decrease in the JA responsive PDF1.2 expression, as well as in

the SA and JA-responsive RLK1 expression was observed, suggesting that HD2C may be


6. 2 Results suggest new model of HD2 action

Prior to this thesis a HD2 model describing its functionality had not been explicitly

stated, but could be derived by amalgamating several key studies from the past 20

years (figure 6.1A). HD2C is expressed in the cytoplasm as a protein containing an N-

terminal HDAC domain, central acidic domain and C-terminal zinc finger domain. The

functional protein is part of a large, 400kDa protein complex, phosphorylated at

multiple sites and capable of removing acetyl-groups from histone H3 which was

related to down-regulating gene expression. Accumulation in the nucleus and

nucleolus was driven by an unknown mechanism. The enzymatic activity was targeted

to various genes relating to ABA response, rRNA expression and development by an

unknown mechanism. It has been speculated that molecular interactions with different

factors of the transcriptional machinery may mediate interactions of HD2C with

specific histone areas. However only the ethylene response transcription factor ERF7

was experimentally shown to bind a Longan HD2 homologue.

The work of this thesis has expanded this model by focusing on the missing elements

of the regulatory pathway. As shown in figure 6.1B, the nuclear and nucleolar

accumulation were shown to be independent signalling events, where nuclear

accumulation was mediated by a bipartite NLS and the nucleolar accumulation was

driven by a further C-terminal region. Furthermore the nucleolar targeting appeared to

be stress responsive, as nucleolar accumulation was increased in response to salt

stress. It appears that formation of the complex may have a role here, as HD2C-HD2

dimers were shown to accumulate in the nucleolus compared to the nuclear and

nucleolar pattern of the HD2C-GFP. The role of 14-3-3 binding to the C-terminal end of

the protein was shown not be a critical determinant of nuclear or nucleolar

localization, as mutation of these sites resulted in the same localization pattern as the

non-modified version of the enzyme. Lastly, the role of HD2C towards SA and JA

132

signalling was investigated. Results indicated that HD2C expression was linked to SA

and MeJA sensitivity in the context of root growth and germination with

overexpression causing greater sensitivity to these enzymes during germination.

Binding of TGA6 was initially hypothesised to be a critical determinant of this

phenotype; however semi-quantitative analysis of SA and JA-responsive factors that

were shown to be controlled by clade II TGA factors did not show any significant

repression despite heightened HD2C presence in the cell.

Together these results contribute new knowledge to HD2C regulation. Firstly, this

revealed and characterized differences in HD2C localization. Specifically, the difference

between HD2C:HD2 dimers and stress induced HD2C-GFP nucleolar fluorescent

patterns are distinct from the patterns observed in non-stressed HD2C-GFP, HD2C:14-

3-3 and HD2C:TGA6 interaction studies. Together this suggests that HD2C localization

is dynamic and can be manipulated by external conditions. Secondly, characterization

of three different classes of proteins interacting with HD2C extends our current

knowledge of the diversity of the HD2Cs interactome.

6.3 HD2C for use in genetically modified plants

A significant motivation for plant molecular biology research is the potential for its

insights to be harnessed towards manipulating crop plants to yield more food for less

human input. The potential for histone deacetylases to be modified to alter plant

growth and cropping has been documented. For example it was shown that the

acetylation state of the genome is dynamic, with acetylation of specific areas related

to growth and development shifting from acetylated to deacetylated in response to

various stages of plant growth (Kouzarides 1999; Tian, Fong et al. 2005). In Arabidopsis

non-specific blocking of histone deacetylation activity resulted in pleiotropic effects on

growth and development which could be traced to its inability to operate as an

acetylation antagonist (Tian and Chen 2001). Similarly knocking out various individual

HDAC genes results in a number of growth and developmental defects. From these

studies it is clear that acetylation per se is central to growth and development, which

necessitates understanding of the deacetylation component of this system. Precisely

how the HD2 family of histone deacetylases fits into this and how manipulation of their

pathways may lead to a genetically superior crop has not yet been established.

133

Modified expression of HD2s by a constitutive promoter or by gene knockout does not

appear to be the answer. Plants over-expressing HD2C are resistant to salt and drought

stress during germination, survival rate and root growth assays. However the plants

inherent pay-back for this phenotype was evident in a higher proportion of sterility.

Similarly, it was reported that Arabidopsis plants over-expressing HD2A developed

pleiotropic growth defects manifested by altered leaf and flower morphology. Plants

with HD2 knockouts were similarly deficient; HD2C knockouts were correspondingly

sensitive to salt and drought stress and germinated poorly on sucrose media. Together

these results suggest that a simple over- or under-expression of HD2 is not suitable as

a crop modification tool. The results of this thesis provide a starting point for a non-

expression driven alteration in HD2C which has the potential to impact on plant

growth, development and stress response.

This thesis focused on identifying aspects of the enzyme’s regulation that may be

modified to produce a more pathway specific response. For example, this study

showed that it was the nucleolar retention rather than the nuclear translocation which

was the most relevant mechanism in localization control. This was evident both from

the apparent nucleolar targeting which took place following salt stress and the

nucleolar localization of the functional HD2 complex. The region required for nucleolar

retention was narrowed to a C-terminal portion of the protein which did not wholly

overlap with the nuclear targeting sequence. Further analysis of this region yielded the

identification of a 14-3-3 binding site; however mutation of this site did not yield any

evident shift in localization pattern when the mutated HD2C protein was tested as a

GFP-fusion. Together these data suggest that the regulation of nucleolar localization is

a possible site for manipulation. The next step is likely the identification of factors

which mediate this regulation so that the HD2 sequence dependent on these

interactions could be altered to only respond to specific factors. This would achieve an

imposed specificity for nucleolar localization that occurs only in response to

predetermined conditions. This is obviously an ambitious hypothesis given the number

of unknown regulatory factors and the potential diversity of the signal transduction

event. The impact of chemicals on targeting specific interactions in the context of a

whole cell were seen most exquisitely in the context of 14-3-3 binding to H+ATPase in

tomato by fusicoccin. Here fusicoccin locked together the subunits of the H+ATPase.

134

This was shown to cause hyperpolarization of the cell membrane and lead to an

induced pathogen response.

An alternative approach is focussing on the interaction with transcription factors which

mediate contact between HD2 and DNA. This thesis determined that there was

interaction between TGA6 and HD2C. Although it appears that this is not significant in

the context of mediating regulation of SA or JA responsive factors, the developmental

implications of this interaction have yet to be determined. Whatever the biological

consequence of this interaction, it is now clear that interaction with transcription

factors is possible, given the interactions of HD2C with ERF1 and TGA6. The next step is

to determine the HD2C binding site that mediates this contact. Given this information,

modification of the HD2 sequence would enable a direct manipulation on the pathway

that involves the transcription factor. Given the inherent ability for HD2s to regulate

large subsets of genes via its chromatin condensation ability, this would enable a large

scale manipulation on genetic interactions with external stimuli which could be

harnessed to modify plant growth and response to the environment.

6.4 C-terminal domain appears to be necessary for protein binding

Throughout this thesis there were several lines of evidence to suggest that the C-

terminal domain of HD2C was significant in the context of protein-protein interaction.

Most overt was the direct mapping of a 14-3-3 epsilon binding sites, where two

different sites were mapped to the C-terminal end of HD2C. Similarly, the N-terminal

1-60AA fragment of HD2C was used both in dimerization experiments of HD2s and in

the interaction study with TGA6 and failed to interact with either of the two. This

suggests that interaction with other proteins does not reuiqre the N-termianl part of

HD2C. A spin-off of this discovery is the application of the N-terminal fragment as a

negative control for protein interaction experiments. . Furthermore, the tiling deletion

analysis that was performed on HD2C to map 14-3-3 binding sites was performed for

TGA6, mapping a region that it required for binding to a C-terminal site overlapping

the NLS (study not completed, data not shown). The significance of this is two-fold:

Firstly it hints at a fundamental domain structure within the protein, where the N-

terminus contains a conserved enzymatic domain and functional diversity is

135

manifested by the C-terminal end where various subsets of interactors bind. In The

RPD3-like superfamily in Arabidopsis contains a similar domain structure. There, the N-

terminal HDAC site is highly conserved and diversity is most evident in the C-terminal

end.

Secondly, it suggests that there is a co-operation between the two domains. It suggests

that the C-terminal domain is necessary for protein interaction which guides the HDAC

initially into the nucleus and nucleolus, and subsequently to its chromatin targets. Next

the N-terminal end performs its HDAC function. The fact that this relationship is both

synergistic and essential is clear from each study in this thesis. Firstly, the NLS and

nucleolar retention signal are located in the C-terminus which is essential for

colocalization of HD2 with its substrate. Secondly, specific chromatin regions are the

focus of the HDAC activity, which is probably provided via interaction with TGA and

ERF transcription factors and possibly others. Lastly, the enzyme requires

phosphorylation to form an active complex. Initially it was hypothesised that this

suggested N-terminal phosphorylation sites which would stabilize the active domain

and control enzyme activity. However a phosphorylation site was found in the N-

terminus by phosphoproteomics and two 14-3-3 sites which bind phosphorylation sites

were similarly found in this region (Durek, Schmidt et al. 2010). Therefore it is possible

that enzyme regulation is dependent upon secondary mechanisms. Although the

results do not provide clear insight, it may be speculated that phosphorylation

regulates formation of the active HD2 complex or mediates contact with substrate.

Moreover, the presence of the zinc-finger domain in HD2A and HD2C isoforms is a

feature of the C-terminus which remains uncharacterized. It was suggested that the

single zinc finger of HD2C cannot interact with DNA, instead it would provide a domain

for protein or RNA interactions. However, hetero- and Homo- dimers of HD2s raise the

possibility that multiple Zinc-fingers from HD2A and HD2C isoforms make direct DNA

contact possible in such complexes. . Its overlap with a 14-3-3 binding site similarly

suggests that its role may be dynamically regulated by phosphorylation. Whatever its

role, its evolutionary conservation suggest that this domain is a critical feature of this

C-terminus whose function is yet to be determined.

136

6.5 Future

HD2s principle role is to modify gene expression. So far this has been traced by testing

the expression of genes of interest in plants with over- or under-expressing HD2C

genes. For example this approach was used to confirm the impact of HD2C expression

on various ABA responsive genes to rationalize the observation that plants with

modified HD2C expression had different responses to salt, drought and ABA. These

small scope studies shed light on specific pathways that relate to HD2C expression and

function. The risk of this is that the holistic role of HD2C function is diluted by specific

research areas where time is more heavily invested. An alternative approach is the so-

called ‘-omic’ analyses which allow a large scale interpretation of protein activity by

offering a holistic monitoring of responses.

HD2C is an enzyme that affects transcription of genes, and does this by modifying the

chromatin structure of the genome. Two ‘-omic’ approaches are immediately relevent

here.

Micro-array measures mRNA amounts for large subsections of the coded genome (Ball,

Sherlock et al. 2002). In a case relevant to this thesis, it was used to identify novel

functions of a clade II TGA isoform in response to salicylic acid (Thibaud‐Nissen, Wu et

al. 2006). It is anticipated that a similar approach could be used in plants with modified

HD2C expression to identify novel pathways related to HD2C function.

Secondly, various chromatin immune-precipitation (ChIP) techniques such as chip

hybridization (ChIP-chip) (Buck and Lieb 2004; Park 2009) or next generation

sequencing (ChIP-seq) have been developed to screen for modified acetyl-chromatin

states in response to development, stress or mutation. The advantage of this over

micro-array analysis is that it allows the direct visualization of HD2C activity. Thus it

would provide direct evidence relating to the binding targets of HD2C enzyme and

enable an insight to be made into the core function of HD2C.

137

Chapter 7 References

138

Abràmoff, M. D., P. J. Magalhães, et al. (2004). "Image processing with ImageJ." Biophotonics international 11(7): 36-42.

Aitken, A. (2006). 14-3-3 proteins: a historic overview. Seminars in cancer biology, Elsevier. Aravind, L. and E. V. Koonin (1998). "Second Family of Histone Deacetylases." Science

280(5367): 1167. Atchley, W. R. and B. K. Hall (1991). "A model for development and evolution of complex

morphological structures." Biological Reviews 66(2): 101-157. Aufsatz, W., M. F. Mette, et al. (2002). "HDA6, a putative histone deacetylase needed to

enhance DNA methylation induced by double-stranded RNA." The EMBO journal 21(24): 6832.

Bader, J. S., A. Chaudhuri, et al. (2003). "Gaining confidence in high-throughput protein interaction networks." Nature biotechnology 22(1): 78-85.

Bae, M. S., E. J. Cho, et al. (2003). "Analysis of the Arabidopsis nuclear proteome and its response to cold stress." The Plant Journal 36(5): 652-663.

Ball, C. A., G. Sherlock, et al. (2002). "Standards for microarray data." Science (New York, NY) 298(5593): 539.

Berger, S. L. (2007). "The complex language of chromatin regulation during transcription." Nature 447(7143): 407-412.

Berger, S. L., T. Kouzarides, et al. (2009). "An operational definition of epigenetics." Genes & Development 23(7): 781-783.

Berman, M. and T. DeJong (1996). "Water stress and crop load effects on fruit fresh and dry weights in peach (Prunus persica)." Tree Physiology 16(10): 859-864.

Bogdanović, O. and G. J. C. Veenstra (2009). "DNA methylation and methyl-CpG binding proteins: developmental requirements and function." Chromosoma 118(5): 549-565.

Borsani, O., V. Valpuesta, et al. (2001). "Evidence for a role of salicylic acid in the oxidative damage generated by NaCl and osmotic stress in Arabidopsis seedlings." Plant Physiology 126(3): 1024-1030.

Boulon, S., B. J. Westman, et al. (2010). "The nucleolus under stress." Molecular Cell 40(2): 216-227.

Bradford, K. J. and H. Nonogaki (2007). Seed development, dormancy and germination, Blackwell publishing.

Brooks, A. R., R. N. Harkins, et al. (2004). "Transcriptional silencing is associated with extensive methylation of the CMV promoter following adenoviral gene delivery to muscle." The journal of gene medicine 6(4): 395-404.

Brosch, G., A. Lusser, et al. (1996). "Purification and characterization of a high molecular weight histone deacetylase complex (HD2) of maize embryos." Biochemistry 35(49): 15907-15914.

Buck, M. J. and J. D. Lieb (2004). "ChIP-chip: considerations for the design, analysis, and application of genome-wide chromatin immunoprecipitation experiments." Genomics 83(3): 349-360.

Cameron, R. K., N. L. Paiva, et al. (1999). "Accumulation of salicylic acid and PR-1 gene transcripts in relation to the systemic acquired resistance (SAR) response induced by Pseudomonas syringae pv. tomato in Arabidopsis." Physiological and molecular plant pathology 55(2): 121-130.

Camoni, L., J. F. Harper, et al. (1998). "14-3-3 proteins activate a plant calcium-dependent protein kinase (CDPK)." FEBS letters 430(3): 381.

Carmo-Fonseca, M. (2002). "The contribution of nuclear compartmentalization to gene regulation." Cell 108(4): 513-522.

Chen, L.-T., M. Luo, et al. (2010). "Involvement of Arabidopsis histone deacetylase HDA6 in ABA and salt stress response." Journal of experimental botany 61(12): 3345-3353.

Chen, W. and K. B. Singh (1999). "The auxin, hydrogen peroxide and salicylic acid induced expression of the Arabidopsis GST6 promoter is mediated in part by an ocs element." The Plant Journal 19(6): 667-677.

139

Chini, A., S. Fonseca, et al. (2007). "The JAZ family of repressors is the missing link in jasmonate signalling." Nature 448(7154): 666-671.

Chinnusamy, V., Z. Gong, et al. (2008). "Abscisic Acid‐mediated Epigenetic Processes in Plant Development and Stress Responses." Journal of Integrative Plant Biology 50(10): 1187-1195.

Choi, S. M., H. R. Song, et al. (2012). "HDA19 is required for the repression of salicylic acid biosynthesis and salicylic acid‐mediated defense responses in Arabidopsis." The Plant Journal 71(1): 135-146.

Cokol, M., R. Nair, et al. (2000). "Finding nuclear localization signals." EMBO reports 1(5): 411-415.

Collura, V. and G. Boissy (2007). From Protein—Protein Complexes to Interactomics. Subcellular Proteomics, Springer: 135-183.

Colville, A., R. Alhattab, et al. (2011). "Role of HD2 genes in seed germination and early seedling growth in Arabidopsis</i&gt." Plant Cell Reports 30(10): 1969-1979.

Costa, F. F. (2008). "Non-coding RNAs, epigenetics and complexity." Gene 410(1): 9-17. Covello, P. S. and M. W. Gray (1989). "RNA editing in plant mitochondria." Creelman, R. A. and J. E. Mullet (1995). "Jasmonic acid distribution and action in plants:

regulation during development and response to biotic and abiotic stress." Proceedings of the National Academy of Sciences 92(10): 4114-4119.

Dangl, M., G. Brosch, et al. (2001). "Comparative analysis of HD2 type histone deacetylases in higher plants." Planta 213(2): 280-285.

Dathan, N., L. Zaccaro, et al. (2002). "The Arabidopsis SUPERMAN protein is able to specifically bind DNA through its single Cys2–His2 zinc finger motif." Nucleic Acids Research 30(22): 4945-4951.

Davies, P. J. (2010). Plant hormones: biosynthesis, signal transduction, action!, Springer. Davies, P. J. (2010). The plant hormones: their nature, occurrence, and functions. Plant

hormones, Springer: 1-15. de Ruijter, A. J., A. H. Van Gennip, et al. (2003). "Histone deacetylases (HDACs):

characterization of the classical HDAC family." Biochemical Journal 370(Pt 3): 737. de Torres, Z. M., M. Bennett, et al. (2009). "Antagonism between salicylic and abscisic acid

reflects early host-pathogen conflict and moulds plant defence responses." The Plant journal: for cell and molecular biology 59(3): 375.

DeLille, J. M., P. C. Sehnke, et al. (2001). "The Arabidopsis 14-3-3 family of signaling regulators." Plant Physiology 126(1): 35-38.

Demetriou, K., A. Kapazoglou, et al. (2009). "Epigenetic chromatin modifiers in barley: I. Cloning, mapping and expression analysis of the plant specific HD2 family of histone deacetylases from barley, during seed development and after hormonal treatment." Physiologia Plantarum 136(3): 358-368.

DeRisi, J. L., V. R. Iyer, et al. (1997). "Exploring the metabolic and genetic control of gene expression on a genomic scale." Science 278(5338): 680-686.

Després, C., C. DeLong, et al. (2000). "The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors." The Plant Cell Online 12(2): 279-290.

Dez, C., M. Dlakić, et al. (2007). "Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation." Rna 13(9): 1516-1527.

Díaz-Moreno, I., D. Hollingworth, et al. (2009). "Phosphorylation-mediated unfolding of a KH domain regulates KSRP localization via 14-3-3 binding." Nature Structural & Molecular Biology 16(3): 238-246.

Doetzlhofer, A., H. Rotheneder, et al. (1999). "Histone deacetylase 1 can repress transcription by binding to Sp1." Molecular and cellular biology 19(8): 5504-5511.

Dong, X. (2004). "NPR1, all things considered." Current opinion in plant biology 7(5): 547-552.

140

Durek, P., R. Schmidt, et al. (2010). "PhosPhAt: the Arabidopsis thaliana phosphorylation site database. An update." Nucleic Acids Research 38(suppl 1): D828-D834.

Eberharter, A. and P. B. Becker (2002). "Histone acetylation: a switch between repressive and permissive chromatin." EMBO reports 3(3): 224-229.

Eden, A., F. Gaudet, et al. (2003). "Chromosomal instability and tumors promoted by DNA hypomethylation." Science 300(5618): 455-455.

ERARD, M. S., P. Belenguer, et al. (1988). "A major nucleolar protein, nucleolin, induces chromatin decondensation by binding to histone Hl." European Journal of Biochemistry 175(3): 525-530.

Eulgem, T. (2005). "Regulation of the Arabidopsis defense transcriptome." Trends in Plant Science 10(2): 71-78.

Eulgem, T. and I. E. Somssich (2007). "Networks of WRKY transcription factors in defense signaling." Current opinion in plant biology 10(4): 366-371.

Fahrenkrog, B. and U. Aebi (2003). "The nuclear pore complex: nucleocytoplasmic transport and beyond." Nature Reviews Molecular Cell Biology 4(10): 757-766.

Fan, W. and X. Dong (2002). "In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid–mediated gene activation in Arabidopsis." The Plant Cell Online 14(6): 1377-1389.

Fernández-Calvo, P., A. Chini, et al. (2011). "The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses." The Plant Cell Online 23(2): 701-715.

Fischle, W., F. Dequiedt, et al. (2002). "Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR." Molecular Cell 9(1): 45-57.

Fu, H., R. R. Subramanian, et al. (2000). "14-3-3 proteins: structure, function, and regulation." Science Signaling 40(1): 617.

Fuglsang, A. T., S. Visconti, et al. (1999). "Binding of 14-3-3 protein to the plasma membrane H+-ATPase AHA2 involves the three C-terminal residues Tyr946-Thr-Val and requires phosphorylation of Thr947." Journal of Biological Chemistry 274(51): 36774-36780.

Galis, I. and K. Matsuoka (2007). Transcriptomic analysis of salicylic acid-responsive genes in tobacco BY-2 cells. Salicylic Acid: A Plant Hormone, Springer: 371-396.

Gardino, A. K., S. J. Smerdon, et al. (2006). Structural determinants of 14-3-3 binding specificities and regulation of subcellular localization of 14-3-3-ligand complexes: a comparison of the X-ray crystal structures of all human 14-3-3 isoforms. Seminars in cancer biology, Elsevier.

Gatz, C. (2013). "From Pioneers to Team Players: TGA Transcription Factors Provide a Molecular Link Between Different Stress Pathways." Molecular plant-microbe interactions 26(2): 151-159.

Gill, S. S. and N. Tuteja (2010). "Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants." Plant Physiology and Biochemistry 48(12): 909-930.

Ginisty, H., H. Sicard, et al. (1999). "Structure and functions of nucleolin." Journal of Cell Science 112(6): 761-772.

Glazebrook, J. (2005). "Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens." Annu. Rev. Phytopathol. 43: 205-227.

Goldberg, A. D., C. D. Allis, et al. (2007). "Epigenetics: a landscape takes shape." Cell 128(4): 635.

Görlich, D., S. Kostka, et al. (1995). "Two different subunits of importin cooperate to recognize nuclear localization signals and bind them to the nuclear envelope." Current Biology 5(4): 383-392.

Graves, P. R., C. M. Lovly, et al. (2001). "Localization of human Cdc25C is regulated both by nuclear export and 14-3-3 protein binding." Oncogene 20(15): 1839.

Grebenok, R. J., E. Pierson, et al. (1997). "Green‐fluorescent protein fusions for efficient characterization of nuclear targeting." The Plant Journal 11(3): 573-586.

141

Grozinger, C. M., C. A. Hassig, et al. (1999). "Three proteins define a class of human histone deacetylases related to yeast Hda1p." Proceedings of the National Academy of Sciences 96(9): 4868-4873.

Grozinger, C. M. and S. L. Schreiber (2000). "Regulation of histone deacetylase 4 and 5 and transcriptional activity by 14-3-3-dependent cellular localization." Science Signaling 97(14): 7835.

Grunstein, M. (1997). "Histone acetylation in chromatin structure and transcription." Nature 389(6649): 349-352.

Guo, M., A. Yang, et al. (2012). "The new understanding of Arabidopsis thaliana proteins associated with salinity." Journal of Plant Interactions 7(4): 348-355.

Hannon, G. J. (2002). "RNA interference." Nature 418(6894): 244-251. Harootunian, A., S. Adams, et al. (1993). "Movement of the free catalytic subunit of cAMP-

dependent protein kinase into and out of the nucleus can be explained by diffusion." Molecular biology of the cell 4(10): 993.

Heil, M., A. Hilpert, et al. (2000). "Reduced growth and seed set following chemical induction of pathogen defence: does systemic acquired resistance (SAR) incur allocation costs?" Journal of Ecology 88(4): 645-654.

Hinshaw, J. E., B. O. Carragher, et al. (1992). "Architecture and design of the nuclear pore complex." Cell 69(7): 1133-1141.

Hirayama, T. and K. Shinozaki (2007). "Perception and transduction of abscisic acid signals: keys to the function of the versatile plant hormone ABA." Trends in Plant Science 12(8): 343-351.

Hirota, K., T. Miyoshi, et al. (2008). "Stepwise chromatin remodelling by a cascade of transcription initiation of non-coding RNAs." Nature 456(7218): 130-134.

Hollender, C. and Z. Liu (2008). "Histone deacetylase genes in Arabidopsis development." Journal of Integrative Plant Biology 50(7): 875-885.

Holliday, R. (1987). "The inheritance of epigenetic defects." Science 238(4824): 163-170. Holliday, R. (1990). "Mechanisms for the control of gene activity during development."

Biological Reviews 65(4): 431-471. Holliday, R. (2006). "Epigenetics: a historical overview." Epigenetics 1(2): 76-80. Idrovo Espín, F. M., S. Peraza-Echeverria, et al. (2012). " In silico cloning and

characterization of the TGA (TGACG MOTIF-BINDING FACTOR) transcription factors subfamily in Carica papaya." Plant Physiology and Biochemistry 54: 113-122.

Imamura, T., S. Yamamoto, et al. (2004). "Non-coding RNA directed DNA demethylation of Sphk1 CpG island." Biochemical and Biophysical Research Communications 322(2): 593-600.

Ito, M., A. Koike, et al. (2003). "Methylated DNA-binding proteins from Arabidopsis." Plant Physiology 133(4): 1747-1754.

Iuchi, S. (2001). "Three classes of C2H2 zinc finger proteins." Cellular and Molecular Life Sciences CMLS 58(4): 625-635.

Jaenisch, R. and A. Bird (2003). "Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals." Nature genetics 33: 245-254.

Jans, D. A., C. Y. Xiao, et al. (2000). "Nuclear targeting signal recognition: a key control point in nuclear transport?" Bioessays 22(6): 532-544.

Johnson, C., S. Crowther, et al. (2010). "Bioinformatic and experimental survey of 14-3-3-binding sites." Biochemical Journal 427(Pt 1): 69.

Jönsson, H., M. Heisler, et al. (2005). "Modeling the organization of the WUSCHEL expression domain in the shoot apical meristem." Bioinformatics 21(suppl 1): i232-i240.

Kadonaga, J. T. (1998). "Eukaryotic transcription: an interlaced review network of transcription factors and chromatin-modifying machines." Cell 92: 307-313.

Kende, H. and J. Zeevaart (1997). "The Five" Classical" Plant Hormones." The Plant Cell 9(7): 1197.

142

Kim, C. A. and J. M. Berg (1996). "A 2.2 Å resolution crystal structure of a designed zinc finger protein bound to DNA." Nature Structural & Molecular Biology 3(11): 940-945.

Kim, J.-M., T. K. To, et al. (2008). "Alterations of lysine modifications on the histone H3 N-tail under drought stress conditions in Arabidopsis thaliana." Plant and cell physiology 49(10): 1580-1588.

Klug, A. and D. Rhodes (1987). "‘Zinc fingers’: a novel protein motif for nucleic acid recognition." Trends in Biochemical Sciences 12: 464-469.

Koltunow, A. M., J. Truettner, et al. (1990). "Different temporal and spatial gene expression patterns occur during anther development." The Plant Cell 2(12): 1201.

Koornneef, A., K. Rindermann, et al. (2008). "Histone modifications do not play a major role in salicylate-mediated suppression of jasmonate-induced PDF1. 2 gene expression." Communicative & integrative biology 1(2): 143-145.

Koroleva, O., G. Calder, et al. (2009). "Dynamic behavior of Arabidopsis eIF4A-III, putative core protein of exon junction complex: fast relocation to nucleolus and splicing speckles under hypoxia." The Plant Cell Online 21(5): 1592-1606.

Kouzarides, T. (1999). "Histone acetylases and deacetylases in cell proliferation." Current opinion in genetics & development 9(1): 40-48.

Kouzarides, T. (2007). "Chromatin modifications and their function." Cell 128(4): 693-705. Kuang, J.-f., J.-y. Chen, et al. (2012). "Histone deacetylase HD2 interacts with ERF1 and is

involved in longan fruit senescence." Journal of experimental botany 63(1): 441-454. Lagace, M., S. C. Chantha, et al. (2003). "Fertilization induces strong accumulation of a histone

deacetylase (HD2) and of other chromatin-remodeling proteins in restricted areas of the ovules." Plant Molecular Biology 53(6): 759-769.

Laity, J. H., B. M. Lee, et al. (2001). "Zinc finger proteins: new insights into structural and functional diversity." Current opinion in structural biology 11(1): 39-46.

Lange, A., R. E. Mills, et al. (2007). "Classical nuclear localization signals: definition, function, and interaction with importin α." Journal of Biological Chemistry 282(8): 5101-5105.

Larsen, F., G. Gundersen, et al. (1992). "CpG islands as gene markers in the human genome." Genomics 13(4): 1095-1107.

Lawrence, R. J., K. Earley, et al. (2004). "A Concerted DNA Methylation/Histone Methylation Switch Regulates rRNA Gene Dosage Control and Nucleolar Dominance." Molecular Cell 13(4): 599-609.

Lawton, K., K. Weymann, et al. (1995). "Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene." MPMI-Molecular Plant Microbe Interactions 8(6): 863-870.

Lee, B. J., A. E. Cansizoglu, et al. (2006). "Rules for nuclear localization sequence recognition by karyopherinβ2." Cell 126(3): 543-558.

Lee, M. S., G. P. Gippert, et al. (1989). "Three-dimensional solution structure of a single zinc finger DNA-binding domain." Science 245(4918): 635-637.

Li, J., G. Brader, et al. (2004). "The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense." Science Signaling 16(2): 319.

Lin, M., X. Shen, et al. (2011). "PAIR: the predicted Arabidopsis interactome resource." Nucleic Acids Research 39(suppl 1): D1134-D1140.

Lin, M., X. Zhou, et al. (2011). "The predicted Arabidopsis interactome resource and network topology-based systems biology analyses." The Plant Cell Online 23(3): 911-922.

Liu, D., J. Bienkowska, et al. (1995). "Crystal structure of the zeta isoform of the 14-3-3 protein."

Loidl, P. (2004). "A plant dialect of the histone language." Trends in Plant Science 9(2): 84-90. Luger, K. and T. J. Richmond (1998). "The histone tails of the nucleosome." Current opinion in

genetics & development 8(2): 140-146. Luo, M., Y.-Y. Wang, et al. (2012). "HD2C interacts with HDA6 and is involved in ABA and salt

stress response in Arabidopsis." Journal of experimental botany 63(8): 3297-3306.

143

Luo, M., Y.-Y. Wang, et al. (2012). "HD2 proteins interact with RPD3-type histone deacetylases." Plant Signaling & Behavior 7(6): 608-610.

Luo, R. X., A. A. Postigo, et al. (1998). "Rb interacts with histone deacetylase to repress transcription." Cell 92(4): 463-473.

Lusser, A., G. Brosch, et al. (1997). "Identification of maize histone deacetylase HD2 as an acidic nucleolar phosphoprotein." Science 277(5322): 88-91.

Malamy, J. and D. F. Klessig (1992). "Salicylic acid and plant disease resistance." The Plant Journal 2(5): 643-654.

Mancini, D. N., S. M. Singh, et al. (1999). "Site-specific DNA methylation in the neurofibromatosis (NF1) promoter interferes with binding of CREB and SP1 transcription factors." Oncogene 18(28): 4108.

Manners, J. M., I. A. Penninckx, et al. (1998). "The promoter of the plant defensin gene PDF1. 2 from Arabidopsis is systemically activated by fungal pathogens and responds to methyl jasmonate but not to salicylic acid." Plant Molecular Biology 38(6): 1071-1080.

Margueron, R. and D. Reinberg (2010). "Chromatin structure and the inheritance of epigenetic information." Nature Reviews Genetics 11(4): 285-296.

Margueron, R., P. Trojer, et al. (2005). "The key to development: interpreting the histone code?" Current opinion in genetics & development 15(2): 163-176.

Marras, E. and E. Capobianco (2008). "A Multiscale Tour in Protein Interactomics." Martin, W. (2010). "Evolutionary origins of metabolic compartmentalization in eukaryotes."

Philosophical Transactions of the Royal Society B: Biological Sciences 365(1541): 847-855.

Mattick, J. S. (2001). "Non-coding RNAs: the architects of eukaryotic complexity." EMBO reports 2(11): 986-991.

McGonigle, B., K. Bouhidel, et al. (1996). "Nuclear localization of the Arabidopsis APETALA3 and PISTILLATA homeotic gene products depends on their simultaneous expression." Genes & Development 10(14): 1812-1821.

Métraux, J., H. Signer, et al. (1990). "Increase in salicylic acid at the onset of systemic acquired resistance in cucumber." Science 250(4983): 1004-1006.

Mitsuda, N. and M. Ohme-Takagi (2009). "Functional analysis of transcription factors in Arabidopsis." Plant and cell physiology 50(7): 1232-1248.

Moore, M. S. (1998). "Ran and nuclear transport." Journal of Biological Chemistry 273(36): 22857-22860.

Moore, T. C. (1979). Biochemistry and physiology of plant hormones, Springer-Verlag. Moorhead, G., P. Douglas, et al. (1999). "Plant proteins containing phosphopeptide motifs that

bind to 14-3-3 proteins." Plant J 18: 1-12. Morris, J. (2001). "Genes, genetics, and epigenetics: a correspondence." Science 293(5532):

1103-1105. Mou, Z., W. Fan, et al. (2003). "Inducers of plant systemic acquired resistance regulate NPR1

function through redox changes." Cell 113(7): 935-944. Muslin, A. J., J. W. Tanner, et al. (1996). "Interaction of 14-3-3 with signaling proteins is

mediated by the recognition of phosphoserine." Cell 84(6): 889-897. Muslin, A. J. and H. Xing (2000). "14-3-3 proteins: regulation of subcellular localization by

molecular interference." Cellular signalling 12(11): 703-709. Ndamukong, I., A. A. Abdallat, et al. (2007). "SA‐inducible Arabidopsis glutaredoxin interacts

with TGA factors and suppresses JA‐responsive PDF1. 2 transcription." The Plant Journal 50(1): 128-139.

Niggeweg, R., C. Thurow, et al. (2000). "Tobacco transcription factor TGA2. 2 is the main component of as-1-binding factor ASF-1 and is involved in salicylic acid-and auxin-inducible expression of as-1-containing target promoters." Journal of Biological Chemistry 275(26): 19897-19905.

Noll, M. (1974). "Subunit structure of chromatin." Nature 251(5472): 249-251.

144

Obsilova, V., J. Vecer, et al. (2005). "14-3-3 Protein interacts with nuclear localization sequence of forkhead transcription factor FoxO4." Biochemistry 44(34): 11608-11617.

Pabo, C. O. and R. T. Sauer (1992). "Transcription factors: structural families and principles of DNA recognition." Annual review of biochemistry 61(1): 1053-1095.

Panni, S., L. Montecchi‐Palazzi, et al. (2011). "Combining peptide recognition specificity and context information for the prediction of the 14‐3‐3‐mediated interactome in S. cerevisiae and H. sapiens." Proteomics 11(1): 128-143.

Park, P. J. (2009). "ChIP–seq: advantages and challenges of a maturing technology." Nature Reviews Genetics 10(10): 669-680.

Paul, A.-L., L. Liu, et al. (2009). "Comparative interactomics: analysis of Arabidopsis 14-3-3 complexes reveals highly conserved 14-3-3 interactions between humans and plants." Journal of proteome research 8(4): 1913-1924.

Pedone, P. V., R. Ghirlando, et al. (1996). "The single Cys2-His2 zinc finger domain of the GAGA protein flanked by basic residues is sufficient for high-affinity specific DNA binding." Proceedings of the National Academy of Sciences 93(7): 2822-2826.

Penfield, S., Y. Li, et al. (2006). "Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm." The Plant Cell Online 18(8): 1887-1899.

Peng, S., J. Huang, et al. (2004). "Rice yields decline with higher night temperature from global warming." Proceedings of the National Academy of Sciences of the United States of America 101(27): 9971-9975.

Pérez-Núñez, M., R. Souza, et al. (2009). "Detection of a SERK-like gene in coconut and analysis of its expression during the formation of embryogenic callus and somatic embryos." Plant Cell Reports 28(1): 11-19.

Perez‐Terzic, C., M. Jaconi, et al. (1997). "Nuclear calcium and the regulation of the nuclear pore complex." Bioessays 19(9): 787-792.

Pieterse, C. M. and L. C. van Loon (1999). "Salicylic acid-independent plant defence pathways." Trends in Plant Science 4(2): 52-58.

Pollard, V. W., W. M. Michael, et al. (1996). "A novel receptor-mediated nuclear protein import pathway." Cell 86(6): 985.

Purwestri, Y. A., Y. Ogaki, et al. (2009). "The 14-3-3 protein GF14c acts as a negative regulator of flowering in rice by interacting with the florigen Hd3a." Plant and cell physiology 50(3): 429-438.

Razin, A. and A. D. Riggs (1980). "DNA methylation and gene function." Science 210(4470): 604-610.

Robert-Seilaniantz, A., M. Grant, et al. (2011). "Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism." Annual review of phytopathology 49: 317-343.

Sasai, N., M. Nakao, et al. (2010). "Sequence-specific recognition of methylated DNA by human zinc-finger proteins." Nucleic Acids Research 38(15): 5015-5022.

Saslowsky, D. E., U. Warek, et al. (2005). "Nuclear localization of flavonoid enzymes in Arabidopsis." Journal of Biological Chemistry 280(25): 23735-23740.

Saxonov, S., P. Berg, et al. (2006). "A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters." Proceedings of the National Academy of Sciences of the United States of America 103(5): 1412-1417.

Schenk, P. M., K. Kazan, et al. (2000). "Coordinated plant defense responses in Arabidopsis revealed by microarray analysis." Proceedings of the National Academy of Sciences 97(21): 11655-11660.

Schijlen, E. G., C. Ric de Vos, et al. (2004). "Modification of flavonoid biosynthesis in crop plants." Phytochemistry 65(19): 2631-2648.

Shaffer, K. L., A. Sharma, et al. (2005). "Regulation of protein compartmentalization expands the diversity of protein function." Developmental cell 9(4): 545-554.

145

Shah, J. (2003). "The salicylic acid loop in plant defense." Current opinion in plant biology 6(4): 365-371.

Shah, J., P. Kachroo, et al. (1999). "The Arabidopsis ssi1 mutation restores pathogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent." The Plant Cell Online 11(2): 191-206.

Shah, J. and D. Klessig (1999). "Salicylic acid: signal perception and transduction." New Comprehensive Biochemistry 33: 513-541.

Shaw, P. (2013). The Plant Nucleolus. Plant Genome Diversity Volume 2, Springer: 65-76. Sittka, A., S. Lucchini, et al. (2008). "Deep sequencing analysis of small noncoding RNA and

mRNA targets of the global post-transcriptional regulator, Hfq." PLoS genetics 4(8): e1000163.

Song, Y., K. Wu, et al. (2010). " Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity." Biochemical and Biophysical Research Communications 396(2): 187-192.

Song, Y. A., K. Q. Wu, et al. (2010). "Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity." Biochemical and Biophysical Research Communications 396(2): 187-192.

Spoel, S. H., A. Koornneef, et al. (2003). "NPR1 modulates cross-talk between salicylate-and jasmonate-dependent defense pathways through a novel function in the cytosol." The Plant Cell Online 15(3): 760-770.

Sridha, S. and K. Q. Wu (2006). "Identification of AtHD2C as a novel regulator of abscisic acid responses in Arabidopsis." Plant Journal 46(1): 124-133.

Staswick, P. E., I. Tiryaki, et al. (2002). "Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of the firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation." The Plant Cell Online 14(6): 1405-1415.

Swatek, K. N., K. Graham, et al. (2011). "The 14-3-3 isoforms chi and epsilon differentially bind client proteins from developing Arabidopsis seed." Journal of proteome research 10(9): 4076-4087.

Tada, Y., S. H. Spoel, et al. (2008). "Plant immunity requires conformational charges of NPR1 via S-nitrosylation and thioredoxins." Science 321(5891): 952-956.

Tajrishi, M. M., R. Tuteja, et al. (2011). "Nucleolin: The most abundant multifunctional phosphoprotein of nucleolus." Communicative & integrative biology 4(3): 267-275.

Thaler, J. S. (1999). "Jasmonate-inducible plant defences cause increased parasitism of herbivores." Nature 399(6737): 686-688.

Theunissen, O., F. Rudt, et al. (1992). "RNA and DNA binding zinc fingers in Xenopus TFIIIA." Cell 71(4): 679-690.

Thibaud‐Nissen, F., H. Wu, et al. (2006). "Development of Arabidopsis whole‐genome microarrays and their application to the discovery of binding sites for the TGA2 transcription factor in salicylic acid‐treated plants." The Plant Journal 47(1): 152-162.

Thines, B., L. Katsir, et al. (2007). "JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling." Nature 448(7154): 661-665.

Thomma, B. P., K. Eggermont, et al. (1998). "Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens." Proceedings of the National Academy of Sciences 95(25): 15107-15111.

Thoms, H. C., C. J. Loveridge, et al. (2010). "Nucleolar targeting of RelA (p65) is regulated by COMMD1-dependent ubiquitination." Cancer research 70(1): 139-149.

Tian, L. and Z. J. Chen (2001). "Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development." Proceedings of the National Academy of Sciences 98(1): 200-205.

146

Tian, L., M. P. Fong, et al. (2005). "Reversible histone acetylation and deacetylation mediate genome-wide, promoter-dependent and locus-specific changes in gene expression during plant development." Genetics 169(1): 337-345.

Toroser, D., G. S. Athwal, et al. (1998). "Site-specific regulatory interaction between spinach leaf sucrose-phosphate synthase and 14-3-3 proteins." FEBS letters 435(1): 110-114.

Traw, M. B. and J. Bergelson (2003). "Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis." Plant Physiology 133(3): 1367-1375.

Tseng, T.-S., C. Whippo, et al. (2012). "The role of a 14-3-3 protein in stomatal opening mediated by PHOT2 in Arabidopsis." The Plant Cell Online 24(3): 1114-1126.

Uquillas, C., I. Letelier, et al. (2004). "NPR1-independent activation of immediate early salicylic acid-responsive genes in Arabidopsis." Molecular plant-microbe interactions 17(1): 34-42.

Verdel, A., S. Curtet, et al. (2000). "Active maintenance of mHDA2/mHDAC6 histone-deacetylase in the cytoplasm." Current Biology 10(12): 747-749.

Wang, A. H., M. J. Kruhlak, et al. (2000). "Regulation of histone deacetylase 4 by binding of 14-3-3 proteins." Molecular and cellular biology 20(18): 6904-6912.

Wang, R. and M. G. Brattain (2007). "The maximal size of protein to diffuse through the nuclear pore is larger than 60kDa." FEBS letters 581(17): 3164-3170.

Watt, F. and P. L. Molloy (1988). "Cytosine methylation prevents binding to DNA of a HeLa cell transcription factor required for optimal expression of the adenovirus major late promoter." Genes & Development 2(9): 1136-1143.

Weiner, H. and W. M. Kaiser (1999). "14-3-3 proteins control proteolysis of nitrate reductase in spinach leaves." FEBS letters 455(1): 75-78.

Wu, K. Q., L. N. Tian, et al. (2000). "Functional analysis of HD2 histone deacetylase homologues in Arabidopsis thaliana." Plant Journal 22(1): 19-27.

Wu, K. Q., L. N. Tian, et al. (2003). "Repression of gene expression by Arabidopsis HD2 histone deacetylases." Plant Journal 34(2): 241-247.

Xie, Z., Z.-L. Zhang, et al. (2007). "Salicylic acid inhibits gibberellin-induced alpha-amylase expression and seed germination via a pathway involving an abscisic-acid-inducible WRKY gene." Plant Molecular Biology 64(3): 293-303.

Xiong, L., K. S. Schumaker, et al. (2002). "Cell signaling during cold, drought, and salt stress." The Plant Cell Online 14(suppl 1): S165-S183.

Xu, Y., P.-F. L. Chang, et al. (1994). "Plant defense genes are synergistically induced by ethylene and methyl jasmonate." The Plant Cell Online 6(8): 1077-1085.

Yaffe, M. B. (2002). "How do 14-3-3 proteins work?–Gatekeeper phosphorylation and the molecular anvil hypothesis." FEBS letters 513(1): 53-57.

Zander, M., S. Chen, et al. (2012). "Repression of the Arabidopsis thaliana jasmonic acid/ethylene-induced defense pathway by TGA-interacting glutaredoxins depends on their C-terminal ALWL motif." Molecular plant 5(4): 831-840.

Zander, M., S. La Camera, et al. (2010). "Arabidopsis thaliana class‐II TGA transcription factors are essential activators of jasmonic acid/ethylene‐induced defense responses." The Plant Journal 61(2): 200-210.

Zeng, L. and M.-M. Zhou (2002). "Bromodomain: an acetyl-lysine binding domain." FEBS letters 513(1): 124.

Zhang, D. (2011). "The structure of arabidopsis NPR1: its function as a salicylic acid receptor and a metal-binding protein."

Zhang, X. (2008). "The epigenetic landscape of plants." Science 320(5875): 489-492. Zhang, X., M. I. Francis, et al. (2010). "Over-expression of the Arabidopsis NPR1 gene in citrus

increases resistance to citrus canker." European journal of plant pathology 128(1): 91-100.

147

Zhang, Y., W. Fan, et al. (1999). "Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene." Proceedings of the National Academy of Sciences 96(11): 6523-6528.

Zhang, Y., M. J. Tessaro, et al. (2003). "Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance." The Plant Cell Online 15(11): 2647-2653.

Zhou, C., H. Labbe, et al. (2004). "Expression and function of HD2‐type histone deacetylases in Arabidopsis development." The Plant Journal 38(5): 715-724.

Zhou, C., L. Zhang, et al. (2005). "HISTONE DEACETYLASE19 is involved in jasmonic acid and ethylene signaling of pathogen response in Arabidopsis." The Plant Cell Online 17(4): 1196-1204.

Zhou, C. H., H. Labbe, et al. (2004). "Expression and function of HD2-type histone deacetylases in Arabidopsis development." Plant Journal 38(5): 715-724.

Zhou, J.-M., Y. Trifa, et al. (2000). "NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid." Molecular plant-microbe interactions 13(2): 191-202.

148

Chapter 8 Appendices

Characterization of HD2C and its interaction with novel ......14-3-3 interaction with HD2C was...

Documents

Transcript of Characterization of HD2C and its interaction with novel ......14-3-3 interaction with HD2C was...