RED CELLS

Cell cycle–dependent chromatin loading of the Fanconi anemia core complexby FANCM/FAAP24Jung Min Kim,1 Younghoon Kee,1 Allan Gurtan,1 and Alan D. D’Andrea1

1Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA

Fanconi anemia (FA) is a genetic diseasecharacterized by congenital abnormali-ties, bone marrow failure, and cancersusceptibility. A total of 13 FA proteins areinvolved in regulating genome surveil-lance and chromosomal stability. The FAcore complex, consisting of 8 FA proteins(A/B/C/E/F/G/L/M), is essential for the mo-noubiquitination of FANCD2 and FANCI.FANCM is a human ortholog of the ar-chaeal DNA repair protein Hef, and itcontains a DEAH helicase and a nucleasedomain. Here, we examined the effect of

FANCM expression on the integrity andlocalization of the FA core complex.FANCM was exclusively localized to chro-matin fractions and underwent cell cycle–dependent phosphorylation and dephos-phorylation. FANCM-depleted HeLa cellshad an intact FA core complex but weredefective in chromatin localization of thecomplex. Moreover, depletion of theFANCM binding partner, FAAP24, dis-rupted the chromatin association ofFANCM and destabilized FANCM, leadingto defective recruitment of the FA core

complex to chromatin. Our results sug-gest that FANCM is an anchor requiredfor recruitment of the FA core complex tochromatin, and that the FANCM/FAAP24interaction is essential for this chromatin-loading activity. Dysregulated loading ofthe FA core complex accounts, at least inpart, for the characteristic cellular anddevelopmental abnormalities in FA.(Blood. 2008;111:5215-5222)

© 2008 by The American Society of Hematology

Introduction

The 13 identified Fanconi anemia (FA) proteins cooperate in acommon cellular pathway regulating the cellular response to DNAcross-linking agents, such as cisplatin (CDDP), diepoxybutane(DEB), and mitomycin C (MMC).1 Of these FA proteins, 8 (A, B,C, E, F, G, L, and M) are assembled into a core complex,2,3 whichcontains a ubiquitin E3 ligase activity (FANCL subunit)4 and aDNA translocase activity (FANCM).5 In response to DNA damage,or during S-phase progression, the FA core complex coordinatelymonoubiquitinates 2 downstream substrates, FANCD26,7 andFANCI.8-10 These monoubiquitinated proteins subsequently translo-cate to the chromatin where they are believed to interact withadditional downstream FA proteins, including FANCJ/BRIP1,11-13

FANCD1/BRCA2,14 and FANCN/PALB2.15,16 These downstreamproteins then regulate homologous recombination (HR) repair.Disruption of any of the proteins in the FA pathway accounts for thecommon cellular and clinical phenotype of FA patients.17 How thepathway participates in the process of DNA cross-link repairremains unknown.18 Some FA complementation groups also ex-hibit additional phenotypic variation, suggesting that some FAgenes have functions outside a simple linear FA pathway.19-22

The FA core complex may have additional functions beyond themonoubiquitination of FANCD2 and FANCI.8 A FANCD2-Ublinear fusion protein complements the MMC hypersensitivity ofFancd2-deficient chicken cells, but fails to correct the phenotype ofFA core complex–deficient cells.23 The FA core complex maytherefore have additional activities, such as the recognition ofspecific DNA substrates, the regulation of the DNA replicationmachinery, and/or the monoubiquitination of additional (unknown)

substrates. These additional functions may be explained, at least inpart, by the presence of FA core subcomplexes with variable sizesand variable subcellular distributions.3

When a replication fork encounters an interstrand DNA cross-link during replication, the replication fork arrests near the lesion,resulting in aberrant DNA structures. These abnormal structuresactivate checkpoint and repair pathways. FA cells, carryingmutations in FA genes, are highly sensitive to DNA cross-linking agents, compared with other DNA-damaging agents,such as ionizing radiation (IR), ultraviolet (UV), and hydroxyu-rea (HU). This hypersensitivity suggests that some componentsof the FA core complex may be involved in detecting andbinding the DNA lesions caused by treatment of DNA cross-linking agents.

The recently identified FANCM5 and FANCJ11-13 proteinssuggest a direct involvement of FA proteins at sites of DNA repair.FANCM is homologous to the archaeal protein Hef (helicase-associated endonuclease for fork-structured DNA), and is a mem-ber of the XP-F superfamily.24 The N-terminal region of FANCM isable to bind to single-stranded DNA.25 Moreover, FANCM has aDNA-dependent ATPase activity, and it can dissociate DNA triplehelices in vitro.5,25 FANCJ/BRIP1, which is thought to play a roledownstream in the FA pathway, is a 5� to 3� DNA helicase withsubstrate specificity toward specific DNA duplexes (Y-shapedDNA). Also, in support of a role for FA proteins in the processingof DNA structures, a recent study demonstrated that recombinantFANCD2 has direct DNA binding activity in vitro.26 Ciccia et al27

reported that recombinant FANCM is directed to branched DNA

Submitted September 17, 2007; accepted January 1, 2008. Prepublished online asBlood First Edition paper, January 3, 2008; DOI 10.1182/blood-2007-09-113092.

An Inside Blood analysis of this article appears at the front of this issue.

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page chargepayment. Therefore, and solely to indicate this fact, this article is herebymarked ‘‘advertisement’’ in accordance with 18 USC section 1734.

© 2008 by The American Society of Hematology

5215BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

structures by a novel FA core complex member, FAAP24. Consis-tent with these studies, some branched DNA structures activateFANCD2 monoubiquitination in vitro.28 Deficiency of eitherFANCM or FAAP24, but not FANCJ, inhibits FANCD2 monoubiq-uitination. These results suggest that the DNA-binding affinity ofthe FANCM/FAAP24 complex may regulate the ubiquitin ligaseactivity or the localization of the FA core complex.

Here, we show that FANCM recruits the FA core complex tochromatin but is not essential for the assembly of the FA coresubunits. Cells depleted of FANCM by siRNA, or cells in whichboth FANCM alleles are mutated, are defective in the chromatinassociation of the FA core complex. In addition, we found that theinteraction of the FANCM with FAAP24 is required for their stableassociation in chromatin.

Methods

Cell culture

HeLa cells were maintained in Dulbecco modified Eagle medium (DMEM)with 15% fetal calf serum (FCS). EUFA867 (FANCM-deficient lympho-blasts) and GM02254A.L (wild-type lymphoblasts) were maintained inRPMI-1640 medium with 15% FCS. For generation of FLAG-FANCLHeLa cell lines, pMMP-puro-Flag-FANCL construct was used for theretrovirus production.

Cell synchronization

For synchronization of cells in G1/S phase, HeLa cells were incubated with2.5 mM thymidine for 18 hours twice with an intervening 10 hours ofincubation in fresh medium without thymidine.29 For synchronization ofcells in M phase, HeLa cells were incubated with 2.5 mM thymidine for20 hours, and then incubated for 12 hours with 200 ng/mL nocodazolewithout thymidine. The cell-cycle synchronization was confirmed by flowcytometry after propidium iodide staining.

Cell extraction and fractionation

For whole-cell extracts, cell pellets were directly lysed with SDS samplebuffer. For biochemical cell fractionation, cells were first lysed with 0.1%Triton X-100 CSK buffers (10 mM PIPES [pH 6.8], 100 mM NaCl,300 mM sucrose, MgCl2, 1 mM EGTA, 1 mM EDTA, 1 mM PMSF,1 �g/mL leupeptin, 1 �g/mL aprotinin, 50 mM NaF, 0.1 mM NaVO4, and0.1% Triton X-100) for 5 minutes on ice. After centrifugation (1500g for5 minutes), the supernatant was labeled “S.” The pellet was washed oncemore with the same buffer and labeled “P.”

Antibodies

Rabbit anti-FANCM was kindly provided by Dr Weidong Wang (NationalInstitutes of Health, Baltimore, MD),5 and anti-FAAP24 was kindlyprovided by Dr Steve West (London Research Institute, London, UnitedKingdom).27 Rabbit anti-FANCA, anti-FANCG, anti-FANCE antibodieswere described previously.30 Affinity-purified anti-FANCG antibody wasgenerated for immunofluorescent (IF) studies. Other reagents used in thisstudy were as follows: anti-FANCJ (Novus, Littleton, CO), anti-FANCD2,monoclonal anti-FLAG M2, M2-agrarose beads and �-tubulin (Santa CruzBiotechnology, Santa Cruz, CA), CHK1-p345 (Cell Signaling Technology,Danvers, MA), MUS81 and MCM3 (Bethyl Laboratories, Montgomery,TX), RPA70 (EMD Biosciences, San Diego, CA), Histone H3 (UpstateBiotechnology, Charlottesville, VA), and Orc2 (BD Pharmingen, SanDiego, CA).

In addition, a new anti-FANCM antibody was raised against aminoacids 1190 to 1273 of FANCM. This polypeptide fused to maltose bindingprotein was expressed in Escherichia coli and purified as instructed in themanufacturer’s protocol (New England Biolabs, Ipswich, MA), prior toantibody generation in New Zealand white rabbits.

Immunoprecipitation

Whole cells were lysed with 0.5% TX-300mCSK containing 300 mM NaClfor 30 minutes on ice. After centrifugation (15 294g for 20 minutes), thesupernatant was diluted to 150 mM NaCl before immunoprecipitation. Cellextracts were incubated with 15 �L anti-FLAG M2 agarose overnight at4°C on a rocker, and washed 3 times with 0.1% TX-150mCSK buffer. Theprecipitates were analyzed on 3% to 8% Tris-acetate SDS–polyacrylamidegel electrophoresis (PAGE; Invitrogen, Carlsbad, CA).

siRNA transfection

siRNAs were synthesized by Qiagen (Valencia, CA). The target sequencesof LacZ, FANCM, FAAP24-1, FAAP24-2, FANCA, and UBE2T areaacgtacgcggaatacttcga, aagctcataaagctctcggaa, attttcgaggatggcttgaca, tgcat-tctttatgtcaccgaa, cagcgttgagatatcaaagat, and gatctaagttgcctaccttga, respec-tively. Control siRNA is designed and provided by Qiagen.

MMC survival assay

HeLa cells transfected with siRNAs were seeded in duplicate in 96-wellmicroplates at a density of 400 cells/well in appropriate medium. MMC wasadded at a final concentration of 0 to 200 nM. Cells were then incubated at37°C in a 5% CO2 incubator for 5 days, and cell survival was thendetermined by staining nucleic acids with a proprietary dye (CyQUANT;Molecular Probes, Eugene, OR) and subsequently analyzed by a fluores-cence microplate reader (FL � 800; Bio-Tek Instruments, Winooski, VT)according to the manufacturer’s protocol. Alternatively, HeLa cells weretransfected with the indicated siRNAs for 48 hours, and then exposed to theindicated concentration of MMC for 5 days. Viable cells were counted bytrypan blue exclusion.

Immunofluorescence staining

HeLa cells were transfected with siRNAs for 48 hours before seeding into4-well culture slide at a density of 20 000 cells per well. Cells werepre-extracted with phosphate-buffered saline (PBS) containing 0.3% TritonX-100 for 2 minutes and then fixed with 3.7% paraformaldehyde for10 minutes on ice. After blocking with 5% goat serum/0.1% NP-40/PBS,the cells were incubated with the affinity purified rabbit polyclonalanti-FANCG antibody (1:400 dilution) overnight at 4°C. The Alexa Fluor488 goat anti–rabbit IgG (Molecular Probes) was used as a secondaryantibody at 1:500 dilution. After incubation with secondary antibody,samples were washed and mounted in Vectashield mounting media withDAPI (Vector Laboratories, Burlingame, CA). Cells were observed with a63� objective lens (NA 1.4, oil) on a Zeiss Axiovert 200 M microscope(Thornwood, NY) equipped with a CoolSnap HQ camera (Photometrics,Tucson, AZ). Images were acquired and analyzed using SlideBook 4.0 soft-ware (Intelligent Imaging Innovations, Denver, CO).

Phosphatase treatment

Cell extracts were incubated with 400 U of � phosphatase at 30°C for40 minutes and then analyzed by Western blotting.

Results

FANCM localizes to chromatin and is phosphorylated followingDNA damage

To examine the cellular localization of FANCM, cells were lysed ina low-salt (100 mM NaCl) and detergent-containing buffer, yield-ing a soluble fraction (S) and an insoluble pellet (P; Figure 1A).The S fraction contained cytoplasmic and nucleoplasmic proteins,and the P fraction contained proteins stably bound to nuclearstructure (eg, chromatin and nuclear matrix proteins). FANCM wasexclusively detected in the P fractions, and cellular localization didnot change following DNA damage with MMC or replication block

5216 KIM et al BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

with HU (Figure 1B). MMC and HU activated phosphorylation ofthe chromatin-bound FANCM, consistent with previous studies.5

Monoubiquitinated FANCD2 was found primarily in the P fraction,as previously described,31 and FANCA was found in both fractions.

The P fraction was further extracted with 1% Triton or 250 mMNaCl (Figure 1C). FANCM was insoluble in 1% Triton (Figure 1Clanes 5-8), whereas more than 70% of FANCM was soluble in

250 mM NaCl (Figure 1C lanes 9-12). After MMC treatment,highly phosphorylated FANCM remained in the pellet after 250 mMNaCl extraction. The FANCM mobility shifts were abolished bytreatment with lambda phosphatase (Figure 1D, compare lanes9-12). These results imply that FANCM stably associates withchromatin and that MMC activates the phosphorylation of FANCM,thus increasing its binding affinity for chromatin.

Figure 2. FANCM undergoes cell cycle–dependent phosphorylation. (A) Asynchronously growing cells (lane 1), cells arrested in G1/S phase with double thymidineblocking and released into S phase (lanes 2-7), or cells arrested in metaphase with nocodazole and released into G1 phase (lanes 8-12) were fractionated into S and P andimmunoblotted for the indicated proteins. Asyn indicates asynchronous cells. Synchrony was monitored by flow cytometric analysis. The SDS-PAGE gel used here was 4%Tris-glycine. (B) Experimental protocol used to prepare cell extracts described in panels C and D. (C) Either exponentially growing Flag-FANCL HeLa cells (Asyn; lanes 1-4),cells released from double thymidine block for 3 hours (S phase; lanes 5-8), or cells arrested in mitotic phase with nocodazole (M phase; lanes 9-12) were fractionated intoS100 and S300. As a negative control for immunoprecipitation with FLAG antibody, parental HeLa cells (lanes 13-16) were used. Each fraction was immunoprecipitated withFLAG-M2 agarose beads, and the precipitates were immunoblotted for the indicated proteins. (D) Cells were arrested in the G1/S phase by double thymidine block (lanes 1-4)and released into S phase (lanes 5-16). Alternatively, cells were arrested in mitotic phase with nocodazole (laness 17-20) and fractionated into S100 and S300. Proteins fromeach fraction were immunoprecipitated with FLAG-M2 agarose beads, and the precipitates were immunoblotted with the indicated antibodies. Note that for the Western blots ofFlag-FANCL (fourth row), immunoprecipitation samples were exposed for a shorter time than for input samples. This is indicated by the vertical lines in between. This wasnecessitated by the fact that the intensity of IgG bands that appeared on immunoprecipitation samples was substantially greater than that of the input Flag-FANCL bands.Entire images come from the identical gel.

Figure 1. FANCM is detected exclusively in the chro-matin-containing fraction. (A) Experimental protocolfor cell fractionation described in this study. (B) HeLacells were treated with MMC (50 ng/mL for 17 hours) andHU (2 mM for 17 hours) and then fractionated into thecytosol and nucleoplasmic fraction (S) and the chromatin-containing fraction (P). (C) HeLa cells were fractionatedinto S and P as in Figure 1A. The pellet was furtherextracted with 1% Triton X-100 (lanes 5-8) or 250 mMNaCl (lanes 9-12). After centrifugation, the supernatantand pellet were analyzed by Western blotting. (D) Cellextracts were incubated with lambda phosphatase andimmunoblotted for the indicated proteins.

FANCM RECRUITS FA CORE COMPLEX 5217BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

Phosphorylation of FANCM is dynamically regulatedduring the cell cycle

To detect possible changes in the association of FANCM withchromatin during the cell cycle (Figure 2A), HeLa cells weresynchronized at the G1/S boundary by double thymidine block(Figure 2A lanes 1-7) or in M phase by nocodazole treatment(Figure 2A lanes 8-12). Cells were collected at the indicated timepoints and fractionated prior to immunoblotting. All FANCM wasfound in P fractions (chromatin fractions) and no significantchanges in FANCM levels were detected during the cell cycle.Monoubiquitinated FANCD2 was found in the P fractions during Sphase, consistent with previous studies.31 FANCG levels werefound in S and P fractions throughout the cell cycle, although thelevels in the chromatin fraction were decreased in mitosis (lanes8-12), consistent with previous studies indicating that the FA corecomplex is excluded from condensed mitotic chromosmes.32

Mobility shifts of FANCM were observed throughout the cellcycle, and these mobility shifts were removed with lambdaphosphatase (Figure S1, available on the Blood website; see theSupplemental Materials link at the top of the online article). Theseresults suggest that all or most of the posttranslational modificationof FANCM resulted from phosphorylation. We cannot rule out thepossibility of other posttranslational modifications (ie, acetylations,methylations) that may not significantly alter the electrophoreticmobility of FANCM. FANCM was moderately phosphorylatedduring S phase (Figure 2A lanes 2-6), extensively phosphorylatedduring mitosis (Figure 2A lanes 7-10), and dephosphorylated aftermitotic exit (Figure 2A lanes 11,12). FANCM phosphorylationreached maximum levels during mitosis when FANCD2 monoubiq-uitination was not detectable and when FANCG levels in chromatinwere decreased. These results suggest that hyperphosphorylation ofFANCM may negatively regulate the E3 ubiquitin ligase activity ofthe FA core complex in mitotic cells.

Chromatin localization of FA core complex is regulated in acell cycle–dependent manner

To investigate the function of FANCM phosphorylation during cellcycle, we examined the assembly of the FA core complex in HeLacells in either M phase or S phase (Figure 2B-D). For these studies,we used HeLa cells stably expressing an epitope-tagged Flag-FANCL protein. Cells were fractionated into S100 and S300fractions (Figure 2B), and FA proteins were analyzed. FA corecomplex protein levels did not vary during cell cycle. Flag FANCLcoimmunoprecipitated with FANCM, FANCG, and FANCA inS-phase cells (Figure 2C lanes 5-8); however, in mitotic cells (lanes9-12), FANCM remained chromatin-bound while FANCG andFANCA still coimmunoprecipitated from the soluble fraction(Figure 2C). To examine the dynamic changes in the interactionbetween FANCM and remaining FA core proteins during cell cycle,cells were collected at various times after release from G1/S arrest(Figure 2D). At G1/S (Figure 2D lanes 1-4), late S (Figure 2D lanes13-16), and G2/M (Figure 2D lanes 17-20) phases, an interactionamong the FANCM-FANCA-FANCG-FANCL proteins was de-tected in the soluble fractions. In contrast, in early S (Figure 2Dlanes 5-8) and mid-S (Figure 2D lanes 9-12) phases, the interactionwas preferentially detected in the insoluble fraction. Taken to-gether, these results confirm that the intact FA core complex ispresent throughout the cell cycle but is released from the chromatin-bound FANCM protein in mitosis.

FANCM is required for chromatin association of the FAcore complex

We next asked whether the stability and nuclear localization of FAcore complex is dependent on FANCM (Figure 3). EUFA867(FANCM-deficient) lymphoblasts and wild-type lymphoblasts werefractionated, and the cellular localization of the FA core complexwas determined by immunoblotting (Figure 3A). In EUFA867, thelevels of FANCA and FANCG were reduced, and FANCD2

Figure 3. The chromatin association of the FA core complexis impaired in FANCM-depleted cells. (A) EUFA867 lympho-blast and wild-type cells (GM02254A.L) were treated with MMC(150 ng/mL for 17 hours) and fractionated into S and P. �-tubulinand histone H3 are loading controls for S and P fractions,respectively. (B) HeLa cells transfected with the indicatedsiRNAs were analyzed by immunoblotting to insure FANCM orFANCA protein knockdown. (C) HeLa cells treated with theindicated siRNAs for 72 hours were treated with MMC(50 ng/mL for 17 hours). The whole-cell extracts were immuno-blotted for the indicated proteins. The �-tubulin is a loadingcontrol for S fraction, and MCM3 was used as a loading controlfor P fraction. The crossreactive band are labeled with asterisksin panels A and C. (D) HeLa cells transfected with indicatedsiRNA for 72 hours were incubated without or with MMC(50 ng/mL for 17 hours) and then stained with anti-FANCGantibody, either without or with 0.3% Triton X-100 pre-extractionbefore fixation.

5218 KIM et al BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

monoubiquitination was not detected. Importantly, FANCA wasundetectable in the chromatin-containing fraction comparedwith wild-type cells. These results demonstrate that FANCMdepletion affects the stability and chromatin association of theFA core complex.

We next depleted FANCM in HeLa cells by siRNA transfection(Figure 3B). FANCM siRNA efficiently depleted FANCM, and thedepletion was sustained for 7 days (Figure S2). In FANCA-depleted HeLa cells, the FANCG level was strongly reduced,confirming that the direct association between FANCA and FANCGis required for their stability.33,34 In contrast, in FANCM-depletedHeLa cells, levels of FANCA and FANCG were not significantlyreduced, but the chromatin localization of FANCA, FANCG, andFANCE was disrupted compared with control siRNA–treated cells(Figure 3B,C). There was no change in FANCJ expression levels orcellular localization following FANCM knockdown (Figure 3C).Also, siRNA knockdown of other FA proteins in the FA pathway,such as the E2 enzyme, UBE-2T,35 did not affect localization of theFA core with chromatin (Figure S3).

We next performed immunofluorescence with an anti-FANCGantibody to detect the FA core complex in chromatin (Figure 3D).For this purpose, we generated an affinity-purified anti-FANCGantibody suitable for detecting endogenous FANCG protein inHeLa cells. To our knowledge, this is the first anti-FANCGantibody capable of detecting endogenous FANCG protein byimmunofluorescence, as opposed to overexpressed FANCG pro-tein. In the absence of MMC exposure, very little FANCG nuclearstaining was observed. Following MMC exposure, increasedFANCG nuclear staining was observed; however, this staining didnot depend on the presence of the FANCM protein, since siRNA toFANCM did not decrease this staining. We next performed a tritonpre-extraction of nuclei, prior to staining with the anti-FANCGantibody. Triton pre-extraction removed FANCG protein that wassoluble in the nucleus or was only loosely bound to chromatin.Interestingly, MMC activated the chromatin association of FANCGprotein, and siRNA to FANCM decreased this chromatin associa-tion. These results further support the hypothesis that FANCM isrequired for recruitment of FANCG and perhaps other FA corecomplex proteins to chromatin.

FANCM is not required for assembly or stability of thenucleoplasmic FA core complex

We further examined the assembly of the FA core complex inFANCM-depleted cells (Figure 4). To immunoprecipitate the FAcore complex, we again used the stable HeLa cell line express-ing Flag-FANCL. Cells transfected with control siRNA orFANCM siRNA were extracted with a high-salt-containingbuffer and analyzed by immunoprecipitation (Figure 4A). Theamount of FANCA and FANCG coimmunoprecipitated withFlag-FANCL did not differ significantly between control siRNA–and FANCM siRNA–treated cells (Figure 4B). These resultsdemonstrate that FANCM is not essential for assembly of the FAcore complex.

The chromatin localization of FAAP24 depends on FANCM

FAAP24 was recently identified as an integral member of the FAcore complex.27 FANCM binds directly to FAAP24, and thisinteraction appears to be mediated by the carboxy terminal domainof FANCM.27 Moreover, FAAP24 exhibited direct DNA-bindingactivity, and showed preferential binding for branched chain DNAstructures mimicking replication forks. Cellular depletion of either

FANCM or FAAP24 reduces FANCD2 monoubiquitination.Taken together, these results suggest that FAAP24 (and FANCM)can anchor the FA core complex at stalled replication forksduring S phase.

FAAP24 was detected in S and P fractions (Figure 5A). Theabundance of FAAP24 was slightly decreased by FANCMdepletion (Figure 5A lanes 7-12), and FANCM depletiondisrupted the chromatin association of FAAP24 (Figure 5A lanes8,10,12). In contrast, FANCA depletion did not affect the levelor chromatin association of FAAP24, but the level of FANCGwas significantly reduced (Figure 5B). These results demon-strate that chromatin-bound FAAP24 associates with FANCMdirectly, and its localization depends on FANCM but not onother FA core complex subunits.

FAAP24 depletion reduces the level of FANCM and impairschromatin association of FANCM

To examine the effect of FAAP24 depletion on FANCM, we used2 different sets of FAAP24 siRNAs. HeLa cells transfected withsiRNAs were fractionated and analyzed by Western blotting(Figure 6A). FAAP24 depletion moderately reduced the level ofFANCM, and decreased the monoubiquitination of FANCD2(Figure 6B). FAAP24 depletion also inhibited FANCM phosphory-lation following DNA damage. FAAP24 siRNA also rendered thecells hypersensitive to MMC (Figure S4). Importantly, FAAP24depletion reduced the level of FANCM in chromatin and disruptedchromatin association of FANCM, resulting in defective chromatinrecruitment of FANCA and FANCG (Figure 6C). These resultsindicate that FAAP24 is required for stable chromatin associationand stability of FANCM. The effects of various FA proteins on thechromatin association of the FA core complex are summarized inFigure 7A.

Discussion

Previous studies have suggested that FANCM is an essentialcomponent of the FA core complex. Lymphoblasts derived from a

Figure 4. FANCM is not essential for the assembly of the FA core complex.(A) Parental HeLa cells (lane 1) and Flag-FANCL HeLa cells (lanes 2,3) transfectedwith indicated siRNAs for 72 hours were incubated with MMC (50 ng/mL for 17 hours)and harvested and immunoblotted for the indicted protein. (B) Cells treated as inpanel A were extracted with 300 mM NaCl-CSK buffer and immunoprecipitated withFLAG-M2 agarose beads. The precipitates (lanes 1-3) and input (lanes 4-6) wereimmunoblotted for the indicated proteins.

FANCM RECRUITS FA CORE COMPLEX 5219BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

patient with FA-M (EUFA867) have decreased levels of other FAcore complex proteins, such as FANCA and FANCG.5 In contrast,our results show that the FA core complex (A, B, C, E, F, G, and L)is stable and assembled, even when FANCM protein is depleted toundetectable levels by FANCM siRNA.

Taken together, our results indicate that FANCM depletionimpairs the association of the FA core complex with chromatin but

has no effect on the assembly of the FA core complex. Wedemonstrated that the chromatin recruitment of FA core complexrequires chromatin-bound FANCM, but the assembly of FA corecomplex does not. There are conflicting reports regarding the roleof FANCM in the core complex. FANCM-deficient human lympho-blasts (EUFA867) display reduced levels of FANCA and FANCGprotein, compared with wild-type lymphoblasts. In contrast, inFANCM siRNA–treated cells, the levels of FA core complexproteins were not significantly different compared with controlsiRNA–treated cells. Also, the interaction between FANCA andFANCL is defective in EUFA867, whereas in FANCM siRNA–treated cells, the interaction between these 2 proteins does not differ.This discrepancy can be explained by the following possibilities. First,siRNA-mediated silencing of FANCM may display the acute defects ofFANCM depletion, whereas a patient-derived FANCM-mutant lympho-blast cell line, EUFA867, may reflect developmental defects of FANCMdeficiency. It should be noted that functional complementation ofEUFA867 with FANCM cDNA has not been accomplished yet,suggesting that FANCM may not be the only gene-defective EUFA867.Second, the cellular localization of FANCM may be different betweenlymphoblasts and fibroblasts, possibly accounting for the differentphenotypes resulting from FANCM depletion. Consistent with thispossibility, when lymphoblasts such as GM02254A.L (wild-type cells)and EUFA121 (FA-F) were fractionated with the same procedure(Figure 1A), a significant amount of FANCM was detected in thesoluble fraction. In contrast, a corrected FANCG mutant fibroblast line,EUFA326 � FANCG, exhibited a similar cellular localization ofFANCM to HeLa cells (data not shown). Regardless of the mechanism,our results support a model of regulated interaction of the FA corecomplex with FANCM.

Previous studies have shown that a complex of FAAP24 and aC-terminal domain of FANCM binds to branched DNA molecules.These studies have led to a model in which the FAAP24 proteinrecruits the FA core complex to DNA.27 Our results demonstratethat FANCM is constitutively bound to chromatin (Figures 1,2),and it is tethered to chromatin by the FAAP24 anchor protein.SiRNA disruption of FAAP24 leads to a release of FANCM proteinfrom chromatin (Figure 6C). The FA core complex, in contrast,translocates in and out of the chromatin. These translocation eventsare highly regulated and depend on FANCM and perhaps on thephosphorylation state of FANCM. The FA core complex associatesmore strongly with chromatin after DNA damage and during the Sphase of the cell cycle. The FA core complex is released from

Figure 6. FANCM requires FAAP24 for its stableassociation in chromatin. (A) HeLa cells were trans-fected with indicated siRNAs for 72 hours, and thenwhole-cell extracts were immunoblotted. (B) HeLa cellstransfected with indicated siRNAs for 72 hours weretreated with MMC (50 ng/mL for 17 hours) or HU (2 mMfor 17 hours), and whole-cell extracts were immunoblot-ted for the indicated proteins. (C) HeLa cells transfectedwith indicated siRNAs for 72 hours, and then incubatedwith MMC (50 ng/mL) for 7 hours, 12 hours, and 20 hours.Cells were then extracted and fractionated, and eachfraction was immunoblotted for the indicated proteins.

Figure 5. The chromatin association of FAAP24 depends on FANCM. (A) HeLacells transfected with control or FANCM siRNA for 72 hours were treated with MMC(50 ng/mL for 17 hours) or HU (2 mM for 17 hours) and harvested. Fractionatedextracts were immunoblotted for the indicated proteins. Mus81 was used a loadingcontrol for both fractions. (B) HeLa cells transfected with the indicated siRNAs for72 hours were treated with MMC (50 ng/mL for 17 hours) and harvested. Fractionatedextracts were immunoblotted for the indicated proteins. RPA70 was used a loadingcontrol for both fractions.

5220 KIM et al BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

chromatin during mitosis. FA core complex binding to chromatinafter DNA damage, or in S phase, depends on the presence of theFANCM protein.

How FANCM regulates the binding of the FA core complex tochromatin is unknown, and several models are possible. First, theFANCM protein may provide a direct “landing pad” for the FA corecomplex. The increased phosphorylation of FANCM during Sphase may account for the direct binding of the FA core complex.Hyperphosphorylation of FANCM in mitosis may account for therelease of the FA core complex. Second, the FANCM protein maytranslocate through replicating DNA during S phase, thus “open-ing” the chromatin and allowing the FA core complex to load. Inthis case, the ATPase activity of the FANCM protein, required forthe translocase activity of the FANCM protein, may also berequired for FA core complex loading.

Consistent with this latter model, FANCM appears to havehomology and activity similar to members of the Snf2-family ofSF2 helicases.36 Snf2-family proteins can translocate on double-stranded DNA but do not display strand displacement activitytypical of a helicase. These proteins can translocate across complexDNA structures during S phase and can load protein complexes.Interestingly, one Snf2-family member, CSB, binds to chromatinand plays a critical role in transcription-coupled DNA repair. CSBrecruits a complex of proteins, containing CSA and an E3ligase,37-39 perhaps analogous to the E3 ligase of the FA corecomplex, ultimately leading to the regulated degradation of CSB. Itwill be interesting to determine whether the FA core complexbinding to FANCM regulates the polyubiquitination and degrada-tion of a subfraction of FANCM.

Several questions are raised regarding the function of FANCMin loading the FA core complex in chromatin. First, it remainsunclear whether the FA core complex loads specifically at sites ofstalled replication forks after DNA damage or more generallyacross a wider range of double-helical DNA. Second, it remainsunknown whether the ATPase activity of FANCM is critical forcore complex loading. Third, it remains unknown how FA corecomplex loading leads to DNA repair and resolution of DNAinterstrand crosslinks.

The properties of FANCM protein described here lead us topropose a model of the FA pathway (summarized schematically inFigure 7B). During S phase, moderately phosphorylated FANCM,interacting with FAAP24, recruits the FA core complex to chroma-tin, promoting the accumulation and activation of FA core complexand resulting in FANCD2 monoubiquitination. In G2/M phase,FANCM is extensively phosphorylated by unknown kinases,thereby releasing the FA core complex from chromatin and“shutting off” the pathway. At the same stage, the deubiquitinatingenzyme, USP1, is activated and deubiquitinates FANCD2 andFANCI. In the subsequent G1 phase, the dephosphorylated FANCM-FAAP24 complex remains in chromatin, and the FA core complexremains in the soluble nuclear fraction.

Acknowledgments

We would like to thank Weidong Wang for the human FA-Mlymphoblast line (EUFA867) and Steve West for the anti-FAAP24antibody. We also thank Carrie Ruit for technical assistance.

Figure 7. Model for the role of FANCM in regulatingthe FA pathway. (A) HeLa cells silenced for the indicatedproteins by siRNA (columns) were analyzed for MMCsensitivity, FANCD2 monoubiquitination, presence of FAcore complex, and chromatin localization of FA corecomplex (rows). � indicates indistinguishable from con-trol siRNA–treated cells; and �, defective. (B) Schematicmodel describing the function of FANCM in the chromatinrecruitment of the FA core complex. The FANCM-FAAP24 complex associates with chromatin throughoutthe cell cycle. Early in the cell cycle (G1 phase), the FAcore (A/B/C/E/F/G/L complex) is assembled but does notassociate with FANCM-FAAP24 complex in chromatin. InS phase, phosphorylated FANCM can recruit the FA corecomplex to chromatin, possibly to replication forks, andinduce E3 ubiquitin ligase activity, resulting in monoubiq-uitination of FANCD2 and FANCI. In G2/M phase, hyper-phosphorylated FANCM may promote the release of theFA core complex, and USP1 may deubiquitinate FANCD2and FANCI monoubiquitination.

FANCM RECRUITS FA CORE COMPLEX 5221BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

This work was supported by National Institutes of Health grantsDK43889-15, HL52725-13, and U19A1067751-02.

Authorship

J.M.K. designed and performed entire experiments, analyzed thedata, and wrote the manuscript with the direction of A.D.D. Y.H.K.

contributed the experiment for Figure 4. A.G. provided the stablecell line and affinity-purified antibody.

Conflict-of-interest disclosure: The authors declare no compet-ing financial interests.

Correspondence: Alan D. D’Andrea, Department of RadiationOncology, Division of Genomic Stability and DNA Repair, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney St,Boston, MA 02115; e-mail: alan_dandrea@dfci.harvard.edu.

References

1. Grompe M, van de Vrugt H. The Fanconi familyadds a fraternal twin. Dev Cell. 2007;12:661-662.

2. Medhurst AL, Huber PA, Waisfisz Q, de WinterJP, Mathew CG. Direct interactions of the fiveknown Fanconi anaemia proteins suggest a com-mon functional pathway. Hum Mol Genet. 2001;10:423-429.

3. Medhurst AL, Laghmani el H, Steltenpool J, et al.Evidence for subcomplexes in the Fanconi ane-mia pathway. Blood. 2006;108:2072-2080.

4. Meetei AR, de Winter JP, Medhurst AL, et al. Anovel ubiquitin ligase is deficient in Fanconi ane-mia. Nat Genet. 2003;35:165-170.

5. Meetei AR, Medhurst AL, Ling C, et al. A humanortholog of archaeal DNA repair protein Hef isdefective in Fanconi anemia complementationgroup M. Nat Genet. 2005;37:958-963.

6. Garcia-Higuera I, Taniguchi T, Ganesan S, et al. In-teraction of the Fanconi anemia proteins and BRCA1in a common pathway. Mol Cell. 2001;7:249-262.

7. Collis SJ, Barber LJ, Ward JD, Martin JS, BoultonSJ. C. elegans FANCD2 responds to replicationstress and functions in interstrand cross-link re-pair. DNA Repair (Amst). 2006;5:1398-1406.

8. Smogorzewska A, Matsuoka S, Vinciguerra P, etal. Identification of the FANCI protein, a monou-biquitinated FANCD2 paralog required for DNArepair. Cell. 2007;129:289-301.

9. Dorsman JC, Levitus M, Rockx D, et al. Identifica-tion of the Fanconi anemia complementationgroup I gene, FANCI. Cell Oncol. 2007;29:211-218.

10. Sims AE, Spiteri E, Sims RJ 3rd, et al. FANCI is asecond monoubiquitinated member of the Fan-coni anemia pathway. Nat Struct Mol Biol. 2007;14:564-567.

11. Levitus M, Waisfisz Q, Godthelp BC, et al. TheDNA helicase BRIP1 is defective in Fanconi ane-mia complementation group J. Nat Genet. 2005;37:934-935.

12. Levran O, Attwooll C, Henry RT, et al. TheBRCA1-interacting helicase BRIP1 is deficient inFanconi anemia. Nat Genet. 2005;37:931-933.

13. Litman R, Peng M, Jin Z, et al. BACH1 is criticalfor homologous recombination and appears to bethe Fanconi anemia gene product FANCJ. Can-cer Cell. 2005;8:255-265.

14. Howlett NG, Taniguchi T, Olson S, et al. Biallelicinactivation of BRCA2 in Fanconi anemia. Sci-ence. 2002;297:606-609.

15. Xia B, Dorsman JC, Ameziane N, et al. Fanconianemia is associated with a defect in the BRCA2partner PALB2. Nat Genet. 2007;39:159-161.

16. Reid S, Schindler D, Hanenberg H, et al. Biallelicmutations in PALB2 cause Fanconi anemia sub-type FA-N and predispose to childhood cancer.Nat Genet. 2007;39:162-164.

17. Kennedy RD, D’Andrea AD. The Fanconi Anemia/BRCA pathway: new faces in the crowd. GenesDev. 2005;19:2925-2940.

18. Dronkert ML, Kanaar R. Repair of DNA inter-strand cross-links. Mutat Res. 2001;486:217-247.

19. Berwick M, Satagopan JM, Ben-Porat L, et al.Genetic heterogeneity among Fanconi anemiaheterozygotes and risk of cancer. Cancer Res.2007;67:9591-9596.

20. Offit K, Levran O, Mullaney B, et al. Shared ge-netic susceptibility to breast cancer, brain tumors,and Fanconi anemia. J Natl Cancer Inst. 2003;95:1548-1551.

21. Hirsch B, Shimamura A, Moreau L, et al. Associa-tion of biallelic BRCA2/FANCD1 mutations withspontaneous chromosomal instability and solidtumors of childhood. Blood. 2004;103:2554-2559.

22. Rahman N, Seal S, Thompson D, et al. PALB2,which encodes a BRCA2-interacting protein, is abreast cancer susceptibility gene. Nat Genet.2007;39:165-167.

23. Matsushita N, Kitao H, Ishiai M, et al. A FancD2-monoubiquitin fusion reveals hidden functions ofFanconi anemia core complex in DNA repair. MolCell. 2005;19:841-847.

24. Niedernhofer LJ. The Fanconi anemia signalo-some anchor. Mol Cell. 2007;25:487-490.

25. Mosedale G, Niedzwiedz W, Alpi A, et al. The ver-tebrate Hef ortholog is a component of the Fan-coni anemia tumor-suppressor pathway. NatStruct Mol Biol. 2005;12:763-767.

26. Park WH, Margossian S, Horwitz AA, Simons AM,D’Andrea AD, Parvin JD. Direct DNA binding ac-tivity of the fanconi anemia d2 protein. J BiolChem. 2005;280:23593-23598.

27. Ciccia A, Ling C, Coulthard R, et al. Identificationof FAAP24, a Fanconi anemia core complex pro-tein that interacts with FANCM. Mol Cell. 2007;25:331-343.

28. Sobeck A, Stone S, Costanzo V, et al. Fanconianemia proteins are required to prevent accumu-lation of replication-associated DNA double-strand breaks. Mol Cell Biol. 2006;26:425-437.

29. Taniguchi T, Garcia-Higuera I, Andreassen PR,Gregory RC, Grompe M, D’Andrea AD. S-phase-specific interaction of the Fanconi anemia protein,FANCD2, with BRCA1 and RAD51. Blood. 2002;100:2414-2420.

30. Taniguchi T, Garcia-Higuera I, Xu B, et al. Con-vergence of the fanconi anemia and ataxia telan-giectasia signaling pathways. Cell. 2002;109:459-472.

31. Montes de Oca R, Andreassen PR, MargossianSP, et al. Regulated interaction of the Fanconianemia protein, FANCD2, with chromatin. Blood.2005;105:1003-1009.

32. Qiao F, Moss A, Kupfer GM. Fanconi anemia pro-teins localize to chromatin and the nuclear matrixin a DNA damage- and cell cycle-regulated man-ner. J Biol Chem. 2001;276:23391-23396.

33. Garcia-Higuera I, Kuang Y, Denham J, D’AndreaAD. The fanconi anemia proteins FANCA andFANCG stabilize each other and promote thenuclear accumulation of the Fanconi anemiacomplex. Blood. 2000;96:3224-3230.

34. Kuang Y, Garcia-Higuera I, Moran A, Mondoux M,Digweed M, D’Andrea AD. Carboxy terminal re-gion of the Fanconi anemia protein, FANCG/XRCC9, is required for functional activity. Blood.2000;96:1625-1632.

35. Machida YJ, Machida Y, Chen Y, et al. UBE2T isthe E2 in the Fanconi anemia pathway and un-dergoes negative autoregulation. Mol Cell. 2006;23:589-596.

36. Heyer WD, Li X, Rolfsmeier M, Zhang XP. Rad54:the Swiss Army knife of homologous recombina-tion? Nucleic Acids Res. 2006;34:4115-4125.

37. Groisman R, Kuraoka I, Chevallier O, et al. CSA-dependent degradation of CSB by the ubiquitin-proteasome pathway establishes a link betweencomplementation factors of the Cockayne syn-drome. Genes Dev. 2006;20:1429-1434.

38. Henning KA, Li L, Iyer N, et al. The Cockaynesyndrome group A gene encodes a WD repeatprotein that interacts with CSB protein and a sub-unit of RNA polymerase II TFIIH. Cell. 1995;82:555-564.

39. Fousteri M, Vermeulen W, van Zeeland AA, Mul-lenders LH. Cockayne syndrome A and B pro-teins differentially regulate recruitment of chroma-tin remodeling and repair factors to stalled RNApolymerase II in vivo. Mol Cell. 2006;23:471-482.

5222 KIM et al BLOOD, 15 MAY 2008 � VOLUME 111, NUMBER 10

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom

online January 3, 2008 originally publisheddoi:10.1182/blood-2007-09-113092

2008 111: 5215-5222  

Jung Min Kim, Younghoon Kee, Allan Gurtan and Alan D. D'Andrea complex by FANCM/FAAP24

dependent chromatin loading of the Fanconi anemia core−Cell cycle 

http://www.bloodjournal.org/content/111/10/5215.full.htmlUpdated information and services can be found at:

(1159 articles)Red Cells    Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

  Copyright 2011 by The American Society of Hematology; all rights reserved.of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society

For personal use only.on December 18, 2018. by guest www.bloodjournal.orgFrom