1

2 3 4

5

6

7

8

Identify the name of each enzyme or nucleic acid for numbers 1-8

All late work due by Monday Feb 1st

From Genes to Proteins - Translation

Ch. 14

AP Biology Plans for the week of January 25th through January 29th, 2016 Monday 1-25-16: Ch. 14 part 1 notes Tuesday 1-26-16: Ch. 14 part 2 notes Wednesday 1-27-16: big group diagram of transcription and

translation Thursday & Friday 1-28 & 1-29: Review and practice questions

for Ch. 13 and 14 Homework: Study Fig 14.24 on page 287 for a diagram quiz on MONDAY 2-1-16

To assist you in your note taking…

Key vocabulary terms are in green, bold, underlined font

Overview of Concepts1. The genetic code is a triplet

code2. Translation is directed by

RNA molecules3. RNA plays many different

roles in protein synthesis4. Point mutations may affect

protein formation

ObjectiveDescribe the process of

translations

Identify the role each type of RNA plays in the process

The triplet codeThere are 20 amino

acids (the monomers of proteins) but only 4 nucleotides (the monomers of nucleic acids)

How can just 4 bases code for 20 different amino acids?

The triplet codeThe genetic code is

based on triplets of bases: a series of non-overlapping, three nucleotide “words”

We call these base triplets in the mRNA codons

How did scientists figure out it was 3 bases for each codon?

The triplet code4 nucleotides (A,C,T,G) x 1 in a sequence =

4 different combinations

4 nucleotides x 2 in a sequence = 16 different combinations

4 different nucleotides x 3 in a sequence = 64 different combinations (for 20 AA’s) Many AA’s can be coded for up to 6 ways

The triplet codeThe code is redundant

but unambiguousEach codon codes for

only 1 amino acid - unambiguous

Some amino acids are coded for by more than one codon - redundant

Only UGG codes for tryptophan

AGU, AGC, UCA, UCC, UCG, UCU all code for serine

How did scientists figure out what amino acid each codon

codes for? 1960s - Nierenberg & Mathaei

Used artificial RNA triplets in tubes with the components for building proteins

Made chains of uracil first - UUUUUUUUUGot all phenylalanines in a chain, so

UUU must code for phenylalanine.Within a few years, they had

decoded all 64 codons

What is translation?Translation is

the process by which a cell interprets the codons along an mRNA molecule and builds a polypeptide

Who translates the code?Transfer RNA

(tRNA) is the interpreter of the genetic codetRNA is the molecule

responsible for converting the genetic code of nucleotides toto the protein code of amino acids

How does tRNA work?The cell already has all 20

amino acids in its cytoplasm (either makes them itself or they are taken in through the organism’s diet)

Each tRNA is a strand about 80 bases long

Some bases are complementary to each other so it can hydrogen bond to itselfTakes on a clover-leaf shape

tRNAOn one end of the

tRNA is an amino acid

On the other end is an anticodonThe anticodon is

complementary to the codon in the mRNA

So codon by codon, the tRNAs deposit amino acids in the prescribed order, and the ribosome joins them into a polypeptide chain

Some practice DNA template strand:

ACCGGTCAGTAC1. Make the mRNA from this

template2. What will be the tRNA

anticodons?

Which of the following is NOT true of a codon?

A. It consists of three nucleotides.

B. It is the basic unit of the genetic code.

C. It never codes for more than one amino acid.

D. It may code for the same amino acid as another codon.

E. It extends from one end of a tRNA molecule.

The anticodon of a particular tRNA molecule is __________.

A. complementary to the corresponding triplet in rRNA

B. complementary to the corresponding mRNA codon

C. catalytic, making the tRNA a ribozyme

D. changeable, depending on the amino acid that attaches to

the tRNA

E. the part of tRNA that bonds to a specific amino acid

Which of the following is NOT true of RNA processing?

A. RNA splicing can be catalyzed by spliceosomes.

B. A primary transcript is often much longer than the final

RNA molecule that leaves the nucleus.

C. Nucleotides may be added at both ends of the RNA.

D. Ribozymes may function in RNA splicing.

E. Exons are cut out before mRNA leaves the nucleus

RibosomesRibosomes are the sites

of protein synthesis

They are made up of ribosomal RNA (rRNA) & protein

Composed of 2 subunits: large & smallSubunits are made in the

nucleolusThey join together at the

mRNA to make a functional ribosome

Quick ThinkWhat are the 3 types of RNA and

what do they do?

RibosomesRibosomes bring

together the mRNA and the tRNAs bearing the correct amino acids and bond those amino acids in the correct order

There are 3 sites on the ribosome that function in this capacity: the E site, the P site, and the A site

A site - holds the tRNA with the next amino acid to be added to the chain

P site - holds the tRNA carrying the growing polypeptide chain

E site - releases tRNAs from the ribosome here

PA

Let’s practice

• mRNA reads:

AUGCCCGACUACGGACGACGGUUUACGUGGGGCCUC

• What amino acids do we need?

AUGCCCGACUACGGACGACGGUUUACGUGGGGCCUCUAGAUG = methionine

CCC = proline

GAC = aspartic acid

UAC = tyrosine

GGA = glycine

CGA = arginine

CGG = argnine

UUU = phenylalanine

ACG = threonine

UGG = tryptophan

GGC = glycine

CUC = leucine

UAG = stop

Come forward• Would the tRNA with methionine please come

up and bring the amino acid for this protein?– What is the anticodon?

• UAC

AUGCCCGACUACGGACGACGGUUUACGUGGGGCCUC

AUG = methionineCCC = prolineGAC = aspartic acidUAC = tyrosineGGA = glycineCGA = arginineCGG = argnineUUU = phenylalanineACG = threonineUGG = tryptophanGGC = glycineCUC = leucineUAG = stop – release factor

Translation has 3 stagesInitiationElongationTermination

InitiationmRNA, the first tRNA with the first

amino acid, and the large & small subunits of the ribosome come together

The first amino acid is methionine (codon AUG, the start codon)

This establishes the reading frameThe whole thing is called a “translation initiation complex” and GTP energy is required to build it

Elongation More amino

acids are added to the growing chain

There are 3 steps catalyzed by protein elongation factors

STEP 1 - Codon Recognition

the anticodon on the tRNA H-bonds with the codon in the A site

1. 2 GTPs for energy are used up here

2. An elongation factor protein catalyzes this step

STEP 2 - Peptide Bond FormationThe large subunit catalyzes the formation of a

peptide bond between the amino acid in the A site and the amino acid in the P site

STEP 3 - Translocation

The ribosome moves the tRNA in the A site to the P site

The empty tRNA in the P site is moved to the E site and released

GTP energy is required here

TerminationHappens when one of the 3 stop

codons reaches the A site on the ribosome

A release factor protein binds to the stop codon & hydrolysis occurs to free the polypeptide chain

Which component is NOT directly involved in translation?

A. mRNA

B. DNA

C. ribosomes

D. tRNA

E. GTP

Which of the following mutations would be most likely to have a harmful effect on an organism? A. a single nucleotide deletion near the end of the coding sequenceB. a deletion of three nucleotides near the middle of a geneC. a single nucleotide deletion in the middle of an intronD. a nucleotide-pair substitutionE. a single nucleotide insertion downstream of, and close to, the start of the coding sequence

PolyribosomesSeveral ribosomes

can be working at the same mRNA strand at the same time

Strings of these ribosomes are called polyribosomes

This helps the cell make more proteins more quickly

ProteinsAs the polypeptide

chain is being formed, it will begin to coil & fold in to its 3-D shape

The gene determines the order of the amino acids - the primary structure

The primary structure determines the secondary and tertiary structure

ProteinsProteins may be further

modified by the addition of sugars, lipids, or phosphate groups

Enzymes may cleave the polypeptide chain into smaller chains

2 or more polypeptide chains may join to make the quaternary structure of a functional protein

ProteinsAll translation begins in the cytosol on

free ribosomesIf the protein is destined to become

part of an organelle or is to be shipped outside the cell, the ribosome will move to the ER and become an attached ribosome

Proteinssignal recognition particle (SRP)brings the ribosome to the ER and

translation continues there

Types of RNAmRNA - messenger RNA

(the code)tRNA - transfer RNA

(brings amino acids)rRNA - ribosomal RNA (the

ribosome)Pre-mRNA - the primary

transcript before editingsnRNA - part of

sliceosomesSRP RNA - part of the

signal recognition particle& others

What makes RNA so versatile?1. It can H-bond to

itself & to other nucleic acids

2. It has functional groups that allow it to act as an enzyme

Point MutationsA point mutation is a

change in a single base pair in a gene

They can have catastrophic consequence, or none at all

There are 3 main types:SubstitutionInsertionDeletion

Substitution mutationsA base pair is replaced with a different

base pairBecause there is redundancy in the

genetic code, this may cause no problem at all

It could also lead to a malformed protein and be the difference between life and death

SubstitutionThink of it like a sentence:

Normal sentence would read THE DOG BIT THE CAT

A point mutation might make the sentence read:THE DOG BIT THE CAR

This changes the meaning of the sentence, but not dramatically.

Changing a single base can cause a dramatic change:The base change codes for a different

amino acid, making a different proteinExample: sickle cell anemia

Changing a single base may not cause any change at all:The changed base may

still code for the same amino acid

Proline is coded for by CCC, CCA, CCG, and CCU,

So a change in the last base won’t make any difference to the amino acid that is added to the protein chain.

Insertions & Deletions•These mutations add an extra letter or two or delete letters

•These mutations disrupt the reading frame and are usually more severe

•Because of this they are called frameshift mutations

Frameshift MutationsThink of it as a sentence again:

THE DOG BIT THE CAT

Adding an extra letter makes it:THH EDO GBI TTH ECA T

It changes the entire sentence to nonsense. This kind of mutation has a more dramatic effect on the DNA sequence and is usually lethal