1

A novel developmental role for dopaminergic signaling to specify hypothalamicneurotransmitter identity

Yu-Chia Chen 1,2, Svetlana Semenova1,2, Stanislav Rozov1,2, Maria Sundvik1,2, Joshua L.Bonkowsky3, and Pertti Panula 1,2*

From the 1Neuroscience Center and 2Department of Anatomy, University of Helsinki, Helsinki, Finlandand 3Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, Utah, UnitedStates of America

Running title: Dopamine regulates histaminergic and hypocretin neurons

To whom correspondence should be addressed: Prof. Pertti Panula, Neuroscience Center and,Department of Anatomy, POB 63 (Haartmaninkatu 8), 00014 University of Helsinki, Finland,Telephone +358-9-191 25263; Fax +358-9-191 25261; E-mail: pertti.panula@helsinki.fi

Keywords: Dopamine, histamine, hypothalamus, tyrosine hydroxylase, 5-hydroxytryptamine

ABSTRACTHypothalamic neurons expressing histamine andorexin/ hypocretin (hcrt) are necessary for normalregulation of wakefulness. In Parkinson’s diseasethe loss of dopaminergic neurons is associatedwith elevated histamine levels and disruptedsleep/wake cycles, but the mechanism is notunderstood. To characterize the role of dopaminein development of histamine neurons, weinhibited the translation of the two non-allelicforms of tyrosine hydroxylase (th1 and th2) inzebrafish larvae. We found that dopamine levelswere reduced in both th1 and th2 knockdown, butserotonin level and number of serotonin neuronsremained unchanged. Further, we demonstratethat th2 knockdown increased histamine neuronnumber and histamine levels, while increaseddopaminergic signaling using the dopamineprecursor L-DOPA or dopamine receptoragonists reduced the number of histaminergicneurons. Increases in the number of histaminergicneurons were paralleled by matching increases inthe numbers of hcrt neurons, supportingobservations that histamine regulates hcrt neurondevelopment. Finally, we show that histaminergicneurons surround th2-expressing neurons in thehypothalamus, and we suggest that dopamineregulates terminal differentiation of histamineneurons via paracrine actions or direct synapticneurotransmission. These results reveal a role fordopaminergic signaling in regulation ofneurotransmitter identity and a potentialmechanism contributing to sleep disturbances inParkinson’s disease.

Dopamine is a critically importantneurotransmitter in the vertebrate brain. It isinvolved in motor functions, conditionedbehaviors and hormone regulation (1). There isalso an increasing body of evidence to suggestthat dopamine has neurotrophic functions in thecentral nervous system (2,3). For example,dopamine from the brain promotes generation ofmotoneurons in zebrafish spinal cord (4). Inhuman disease conditions affecting thedopaminergic system marked changes in thehistaminergic system have been observed (5).Histamine, a modulatory neurotransmitter, isnecessary for sleep-wake cycle function,alertness, memory and hormonal regulation (6),and its functions are disrupted by neurologicaldiseases including narcolepsy, Gilles de laTourette (GTS) syndrome and schizophrenia (5).In Parkinson’s disease the nigrostriataldopaminergic system is severely damaged, and aconcomitant increase in brain histamine levels (7)and denser histaminergic fiber networks havebeen observed (8) in striatum and substantianigra. In schizophrenia, the modified dopaminehypothesis proposes decreased dopaminergicactivity in some brain regions (9), and an increasein histamine turnover has been reported (10). Thepotential regulatory role of dopamine forhistaminergic neuron development is difficult tostudy in mammals, because tyrosine hydroxylaseknockout mice do not survive (11,12). In zebrafish (Danio rerio) two non-allelicforms of th are expressed in the brain in a largelycomplementary manner (13-15). However, thebiological roles of the two th forms are not clear.

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.697466The latest version is at JBC Papers in Press. Published on August 18, 2016 as Manuscript M115.697466

Copyright 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

2

In this report, we studied the roles of th2 in thedeveloping zebrafish brain. We used antisensemorpholino oligonucleotides (MOs) to knockdown th2 gene expression and dopamine receptorligands to alter dopaminergic signalling, andanalysed the effects on catecholaminergic,histaminergic, serotonergic and hypocretinsystems. Our results show that th2 is essential indopamine production and reveal a novelregulatory role for th2-dependent dopaminergicsignalling during zebrafish development in thespecification of hypothalamic histamine andhypocretin neurons.

RESULTS Hypothalamic histaminergic and serotonergicneurons are distinct from th2 dopaminergicneurons-The Tg(f.TH:egfp) transgenic fishexpress green fluorescent protein (GFP) under thecontrol of the fugu th promoter (16). In 5-dpfzebrafish brain, GFP expression was seen inolfactory bulbs, preoptic region, paraventricularorgan and caudal periventricular hypothalamiczones (Fig. 1A). To further characterise theidentity of GFP-positive cells in thehypothalamus, we performed ISH with th2riboprobes followed by IHC using TH1, TH2,histamine or 5-HT antibodies on 5-dpfTg(f.TH:egfp) fish brain. We found that GFP-positive cells in caudal hypothalamus expressedth2 mRNA (Figs. 1B-D) and showed TH2immunoreactivity (Fig. 1E). Largermagnification of single-channel and mergedimages depicted the GFP and th2/ TH2colocalization in TH2 group 10b (Figs. 1D’ andE’), suggesting that GFP-ir cells co-expressingth2/TH2 in group 10b represent th2-containingpopulations (dopamine cell population 10/10b,the nomenclature used in this study based onSallinen et al. 2009 (17) and Chen et al. 2009(13);DC7 group in Rink and Wullimann 2002(18)).GFP-positive but TH2-negative cells were foundin the olfactory bulb, telencephalon, preopticregion and caudal hypothalamus (Figs. 1A-D,depicted by white arrows). This may be caused bythe differences and insufficiency of regulatorymotifs driving GFP expression between zebrafishand fugu. Histamine-immunoreactivity (his-ir), ahistaminergic neuron marker, was confined toneurons in the caudal hypothalamus around thecatecholaminergic cell group in the nucleus of theposterior recess (19,20). The his-ir cells werelocated peripherally surrounding the GFP-immunoreactive (ir) cells in the caudalhypothalamus region (Fig. 1F and larger

magnification shown in Fig. 1F’, dopamine cellpopulation 10/10b, the nomenclature used in thisstudy based on Sallinen et al. 2009 (17) and Chenet al. 2009 (13); DC7 group in Rink andWullimann 2002 (18) and no coexistence of GFPand histamine was found in any single opticalscanning frame. Serotonergic (5-HT) cells,which also reside in this region (19,21), did notshow any GFP-ir (Fig. 1G and a single sectionimage shown in Fig. 1G’). Furthermore, weperformed the triple immunostaining on 5-dpfzebrafish brains using anti-TH1, anti-TH2 andanti-5-HT antibodies (Fig. 1H). The stainingresult showed that none of the TH1-ir or TH2-ircells were immunoreactive for 5-HT (Fig. 1H’),suggesting that TH2-ir cells are distinct fromserotonergic neurons. In summary, GFP-ir-th2/TH2-expressing cells were surrounded byhistaminergic and intermingled with serotonergicneurons in the nucleus of the posterior recess inthe caudal hypothalamus. These results are alsoin agreement with TH2-ir distribution in adultzebrafish brain (22). Both TH1 and TH2 contribute tocatecholamine synthesis-Based on the amino acididentity and phylogenetic analysis amonginvertebrate and vertebrate species, zebrafish th1and th2 are classified as counterparts of themammalian th (23,24). However, it is stillunclear whether TH2 has tyrosine hydroxylaseactivity since Ren et. al reported that zebrafishth2 acts as tryptophan hydroxylase duringdevelopment (25). To investigate the impact ofth1 and th2 in catecholamine and 5-HTmetabolism, the concentration of dopamine,norepinephrine, epinephrine and 5-HT wasmeasured by HPLC using 5-dpf zebrafish headsfollowing translation inhibition of th1 or th2. Theefficacy of MOs used in this study was verifiedby Western blotting using the anti-TH2 antibodythat recognizes both zebrafish TH1 and TH2populations (22). The robust specific signalsaround 55kDa representing expected sizes of TH1and TH2 proteins were observed in the 5-dpf headhomogenate (Fig. S1). On the other hand, severalstrong bands between 40kDa and 55kDa thatwere detected in the 36-hpf whole embryohomogenate were clearly less prominent in the36-hpf deyolked embryo (Fig. S1), suggestingthat these non-specific signals can be due to theinteractions between the TH2 antibody and yolkproteins. In figure 2A, besides the specific bandsaround 55kDa of TH1/TH2, the uneven signalsbetween 40kDa and below 55kDa among groupsmay thus be due to yolk differences in different

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

3

morphants. Although the use of deyolked embryohomogenates is possible, the manual deyolkingprocedure of 5-dpf larvae is time-consuming andmay easily cause protein degradation duringsample preparation. To avoid preparation bias,we used whole larval protein lysates for thewestern analysis in this study. The western blotshowed that the TH1 protein was reduced 70% inthe th1 morphants while the amount of TH2protein was essentially unchanged. On the otherhand, only 45% of TH2 protein remained in 5-dpfth2 morphants. When th2 mRNA co-injected withth2 MO1+2 (th2 Rescue) in th2 morphants, a 40%increase of TH2 protein was detected in th2morphants compared with the control-injectedgroup (Fig. 2A). The th2 morphants developedwith a normal size of head, eyes, trunk (Fig. 2B,F(5, 169 )= 2.139, p = 0.0632) and notochordwithout any apparent defects or anydistinguishable gross phenotype (Fig. 2C). Thelevels of p53 and delta113p53, recognized as off-targeting markers induced usually by the MOknockdown (26), were not elevated in the th2morphants (Fig. 2D, F(3, 8 )= 1.216, p = 0.3648;Fig. 2E, F(2, 8 )= 1.394, p = 0.3106), suggestingthat th2 MOs specifically knocked down TH2protein expression without causing obvious off-targeting effects. The HPLC results showed thatthe dopamine, norepinephrine and epinephrinelevels were significantly decreased in th1morphants (Figs. 2F-I). A significant reductionof dopamine level was also detected in th2-morphant groups (Fig. 2F, F(7, 16)= 8.942, p =0.0002), but norepinephrine and epinephrinelevels were unaffected compared with those ofcontrol morphants (Fig. 2G, F(7, 16) = 9.372, p =0.0001; Fig. 2H, F(7, 16) = 6.754, p = 0.0008). 5-HT levels were unaffected in both th1 and th2morphants (Fig. 2I, F(7, 16)= 2.575, p = 0.0556).The pCPA (an inhibitor of tryptophanhydroxylase) treated group was used as a 5-HTintervention control. The MO efficiency wasdocumented here similarly as described in detailearlier (22). Our data show that TH1 isresponsible for catecholamine biosynthesisincluding dopamine, norepinephrine andepinephrine, whereas TH2 is responsible only fordopamine synthesis. This result is concordantwith the expression pattern of dopamine beta-hydroxylase (dbh); only th1 is expressed in cellsthat also express dbh (required for synthesis ofnorepinephrine and epinephrine) (19). Dopaminergic and serotonergic markers in th2morphants -To study whether loss of TH2function affects the development of

catecholaminergic neurons and neighbouringserotonergic neurons expressing tph1a, WISHwas performed on 5-dpf fish brains. Dopaminetransporter (slc6a3), responsible for dopaminereuptake from the synaptic cleft, is present inmany dopaminergic cells and commonly used asa marker of dopaminergic neurons (27). Asshown in Figs. 3A and B, the expression patternof slc6a3 mRNA was intact in th2 morphants.Vesicular monoamine transporter 2 (VMAT2) isresponsible for reuptake of monoaminesincluding dopamine, 5-HT, norepinephrine andhistamine in nerve terminals (28). The VMAT2mRNA expression pattern was not altered in th2morphants (Figs. 3C and D). Tryptophanhydroxylase (TPH) is involved in the biosynthesisof serotonin. The expression pattern of tph1a(Figs. 3E and F) and the number of serotonergicneurons in the ventrocaudal hypothalamus (5-HTgroup 4) (29) shown by 5-HTimmunohistochemistry (Figs. 3G-I; p = 0.7953,Student’s t-test) were largely unaffected in th2morphants, in agreement with the unchanged 5-HT concentration in 5-dpf morphant brains (Fig.2G), indicating that knockdown of th2 did notaffect the serotonergic system. TH2 plays a role in regulation of histaminergicneuron development-In order to study whetherth2 deficiency affects the development ofhistaminergic neurons, hdc ISH and double-labelling immunohistochemistry were performedon 5-dpf brains. The number of histaminergicneurons (Figs. 4A, B and G (F(5, 48)= 12.58, p<0.0001); Figs. 4D, E and H (F(5, 39) = 21.58, p<0.0001) was significantly higher in th2morphants than in control morphants. th2 mRNAco-injection efficiently normalized the number ofthe histaminergic neurons in th2 morphants (Figs.4C, F, G and H), showing that the phenotype wasspecific for th2 MO1+2. Moreover, the histaminelevel measured with HPLC was significantlyincreased in th2 morphants compared with that incontrol morphants or in the th2 morphant mRNArescued group (Fig. 4I; F(5, 12) = 8.649, p =0.0011).These data indicate that the development ofhistaminergic neurons is driven in part by thecatecholaminergic TH2 neurons in the zebrafishbrain. Effects of th2 knockdown on the orexin/hypocretin (hcrt) neuron development-It has beenreported that the histaminergic neurons regulatethe development of hcrt neurons throughhistamine receptor H1 in zebrafish (20). Here,lack of th2 expression was associated with anincreased number of histaminergic neurons. To

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

4

learn if the hcrt neuron development wasaffected, possibly as a consequence of thehistaminergic neuron alteration as describedearlier (20), in the th2 deficient morphants, hcrtISH was performed on 5-dpf fish brains. Asshown in Figs. 5A and B, a significant increase ofhcrt- positive cells was observed in th2 MO1+2injected fish (Fig. 5C, p =0.0313, Student’s t-test), as the histaminergic hdc-containing cellnumber was increased (Fig. 4). Dopamine receptor agonists inhibit thedevelopment of histaminergic neurons-Thedynamic changes of histaminergic neurons in th2morphants suggest that dopamine might beimportant for development of target neuronpopulations. Dopaminergic signalling ismediated by G protein-coupled dopaminereceptors, which are grouped into two mainsubtypes. The D1-like receptors comprise D1 andD5 receptors coupled to stimulatory G proteins toactivate adenylyl cyclase. The D2-like receptorsincluding D2, D3, and D4 receptors are coupledto inhibitory G proteins, and inhibit cAMPsynthesis (1). To study if dopamine or itsprecursor L-DOPA and specific subtypes ofdopamine receptors are involved in the regulationof the histaminergic neuron development, 24-hpffish embryos were treated with 10 mM L-DOPA(dopamine precursor), 10 μM SKF38393 (D1-like receptor agonist), 10 μM SCH23390 (D1-likereceptor antagonist), 7.5 μM quinpirole (D2-likereceptor agonist) and 7.5 μM haloperidol (D2-likereceptor antagonist) until 5 dpf. Relevant drugconcentrations were determined in preliminaryexperiments (data not shown) based on theprevious publications (4,30). The drug effect onhistaminergic system was studied by counting thehistamine-ir cells. We found that wild-typelarvae treated with L-DOPA, quinpirole andSKF38393 showed a significant reduction innumber of histaminergic hdc-expressing cellscompared with the untreated control fish (Figs.6A, D, G, J and O; F(7, 63) = 11.06, p <0.0001),whereas a significant increase of the TH1-ir cellswas observed in L-DOPA and quinpirole treatedgroups (Figs. 6B, E, H, K and M (F(7, 56) = 15.60,p <0.0001); N (F(7, 56) = 12.51, p <0.0001) in theposterior part of the paraventricular organ(PVOp) and diencephalic complex including TH1populations 10 and 13 where histaminergicneurons are neighbouring (population numberbased on earlier descriptions). Interestingly, thedopamine receptor antagonist treatmentnormalized the alterations of cell numbers causedby dopamine receptor agonist administrations

although antagonists alone did not affect thedopaminergic and histaminergic neurons (Fig6M-O). Furthermore, L-DOPA and quinpiroletreatment restored (normalized) the increasedhistaminergic neuron numbers in th2 morphants(Fig. 6P, F(3, 31) = 12.5, p <0.0001), indicating thathistaminergic neurons were affected by dopaminesignalling activity during zebrafish development.

Wnt signalling affects the dopaminergic andhistaminergic neuron development-Wntsignalling cascade is essential for hypothalamicprogenitor differentiation (31), andoverexpression of the Wnt antagonist dickkopf 1(dkk1) mRNA elevates the number ofdopaminergic th1 expressing neurons in 2-dpfzebrafish brains (32) To study whether Wntsignalling is involved in regulation of thehistaminergic neuron development, his-ir andTH1-ir cells were counted following doublestaining of histamine and TH1 in 5-dpf fish brainsafter DKK1 mRNA injections in the yolk at one-cell stage. The inhibition effect on Wnt signallingwas verified by testing the expression of Wntdownstream targets, zic2a and zic5 (33). Adecreased signal of zic2a (Fig. 7I) and zic5 (datanot shown) in telencephalon, midbrain andhindbrain was detected in the DKK1 mRNAinjected group. We next found that TH1-ir cellswere robustly increased in PVOp anddiencephalic complex in TH1 cell populations 10and 13 (Figs. 7B, E, J and K; p<0.0001, Student’st-test), which supports the result of Russek-Blum(32). Moreover, a significant increase of th2-containing cell numbers was detected in TH2 cellpopulation 10b and 8b-9b (Figs. 7G-H; p<0.0001and p=0.0096, Student’s t-test). These cellpopulations are relevant for the histaminergicneurons because these dopaminergic neurons aresurrounded by the histaminergic neurons (Fig.1F). In contrast to the effect on TH1 populations,the histaminergic neurons were significantlydecreased in number in PVOp (Figs. 7A, D andL; p =0.0033, Student’s t-test), the only site wherehistaminergic neurons are found in zebrafishbrain. An overlay image of histamine-ir andTH1-ir is shown in Figs. 7C and F. We further used qPCR to examine theexpression levels of representative genes of thehistaminergic, hypocretin and dopamine systems,including receptors and neurotrophic factorsimportant for the dopaminergic system. The th1and th2 transcripts in the larval heads were notaltered although the TH1 and th2-containing cellnumbers in cell groups 10/10b and 13/8-9b wereincreased by about 36% and 15%, respectively,

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

5

following DKK1 overexpression. The reason forthe evident discrepancy between the cell countingresult and the qPCR may be that only twopopulations adjacent to histaminergic neuronswere counted in the brain, but the qPCR was doneon the whole head so that the total change couldsimply be too subtle to be detected in the overallth expression. A significant reduction of drd3mRNA was also detected (Fig. 7P, p=0.0258),and the expression level of hdc and hcrttranscripts declined significantly (Fig. 7P,p=0.0368 and p=0.026, respectively), confirmingto the reduction of the His-ir and hcrt neurons.Mesencephalic astrocyte derived neurotrophicfactor (MANF) is recognized as a dopaminergicneurotrophic factor (34,35). Remarkably, asignificant increase of manf transcripts was foundin the DKK1-overexpression group (Fig. 7P,p<0.001). To study whether MANF affectshistaminergic neuron development, we knockeddown manf expression by MOs and compared thenumber of hdc-expressing cells between control,MO-injected and mRNA rescued morphantgroups. We found that the number of hdc-containing cells was significantly higher in theMANF-deficient morphants than that in the ctrlMO group and manf mRNA rescue morphants(Fig. 7O, F(2, 29) = 6.104, p =0.0061). MANFdeficiency thus not only causes the reduction ofth1 and th2-containing cells (35), but also leads toa significant increase of the hdc-expressing cellnumbers found in this study. Moreover, DKK1overexpression associated with a robust increaseof manf transcripts and TH1-containing cells anda reduction of the histaminergic cell number,suggests that MANF has an impact onhistaminergic system development.

DISCUSSION Here we report that dopaminergic signallingcontrols the numbers of histaminergic andhypocretin neuron in the vertebrate CNS. Usingdifferential knockdown of the zebrafish th genes,th1 and th2, we show that TH2 acts as themammalian tyrosine hydroxylase in dopaminesynthesis, and is involved in the regulation ofhistaminergic and hcrt neuron numbers. Weconfirm our findings using experimentalmanipulations of dopaminergic signalling,including use of dopamine agonists and Wntantagonism. The anatomy of the catecholaminergic systemsin both larval and adult zebrafish brain has beenwell studied by tract tracing (18), in situhybridization (27) and immunohistochemistry

using TH and dopamine antibodies(15,17,19,21,27,36-39). In the embryoniczebrafish brain, th1 and th2 show acomplementary expression pattern and th1expression is more widespread than th2 (13,14).th1 shares higher amino acid sequence similaritywith mammalian th genes, and comparativeanalysis of TH1-ir populations between zebrafishand mammals has revealed many conservedfeatures and some differences (17-19). Ren et al. (25) used Tg(ETvmat2:GFP)transgenic line having GFP expression in vmat2neurons as a reference marker to indirectly showthat th2 and 5-HT were co-localized in the ventraldiencephalon and the caudal hypothalamus. Theconclusion is contradictory to our current findingsand several other reports, which confirm the factthat zebrafish th2 has tyrosine hydroxylaseactivity in dopamine synthesis (39,40). Inaddition, VMAT2 is found in all aminergicneurons including dopaminergic, histaminergic,noradrenergic and serotonergic neurons (28,41).Based on the conserved structure and functionaldomain comparison of tyrosine hydroxylaseamong species (22), the coexistence ofdopaminergic cell markers with th2 (14,15,27),the intensive dopamine immunoreactivity inneurons which express th2 (22,27,40) andfunctional assays provided in this study stronglyindicate that TH2 has tyrosine hydroxylaseactivity and contributes to synthesis of dopamine.Moreover, no specific colocalization existsamong TH2-ir, histaminergic and serotonergicmarkers in the caudal hypothalamus in 5-dpf andadult zebrafish brain (22). In this study, weprovide high-resolution images with multiplelabels using Tg(f.TH:egfp) transgenic fish havingGFP expressed in th2-expressing cells to provethat th2 and serotonin containing cells are distinctin the caudal hypothalamus. We also measuredendogenous brain catecholamine and 5-HT levelsby HPLC. The 5-HT level and tph1a mRNAexpression were not affected in th2MO1+2morphants, whereas dopamine levels declined,and the effects were rescued by th2 mRNA co-injection. On the other hand, in Ren’s study,neither endogenous tph1a activity, expressionlevel nor dopamine concentration in th2morphants were analysed. Additionally, we havealso analyzed and reported the primary structureof zebrafish TH1 and TH2 (22). Shortly, TH2possesses the arginine residues needed forfeedback inhibition by dopamine, and the Leu,Trp and Asp residues required for substrate(tyrosine) binding are conserved. Importantly, the

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

6

Leu residue Leu294 is present in zebrafish TH1and TH2, whereas in tryptophan hydroxylase thisis replaced by a Tyr residue. Our findingsstrongly support that TH2 can function as anactive tyrosine hydroxylase, a conclusion thatcould be further verified by studying a stable th2mutant fish when one becomes available. The hypothalamus is responsible for regulatingmetabolic processes, sleep and circadian cycles inwhich dopamine is also involved (42). Here wefirst reported that loss of th2 expression caused asignificant increase of histaminergic andhypocretin cells as well as histamine level inlarval brains, suggesting that th2-expressingneurons affect development of the adjacentneurons possibly by direct innervation throughsynaptic neurotransmission or paracrine actions.This provides evidence that dopamine activelylimits the number of histaminergic neurons andfibers that is in agreement with findings reportedin postmortem brains with Parkinson’s disease.The density of histaminergic fibers in thesubstantia nigra pars compacta is increased (8)and an increase of histamine level is restricted tothose brain areas that are affected by lack ofdopamine (7). There is good evidence of dopaminergicregulation of histamine neurons from rodentstudies (43). This study showed that rodenthistamine neurons are excited by L-DOPA andboth dopamine D1 and D2 receptors agonists andexpress both D1 and D2 type dopamine receptors.These results are in full agreement with ourresults on zebrafish. There is also a growing bodyof evidence indicating that histamine receptor 3directly interacts with dopaminergicneurotransmission and forms heterodimers withdopamine receptors in the rodent dorsal striataltarget neurons. In zebrafish, it is still unclearwhether similar interactions occur inhypothalamus where histamine receptor 3 anddopamine receptors are found. To our knowledge, the developmentalregulation of hdc expressing neurons is largelyunknown except that γ-secretase activityregulates histamine cell numbers through notch1activity (44). We found that the dopamine-mediated reduction of the hdc neuron number wasspecific, since no effects on the serotonergicsystem or slc6a3 containing cells in preoptic area,posterior tuberculum and caudal hypothalamusarea were found. It is useful to point out thatslc6a3 is an important transporter indopaminergic neurons but not a reliable marker ofthese cells, because slc6a3 develops late in the

caudal hypothalamus area (27,45). In addition todopamine signalling, Wnt signalling and MANF,known to regulate dopaminergic systemdevelopment, were also found to affect thehistaminergic neuron development in this study,although it is unclear if the regulation is direct oroccurs through the imbalance of dopaminesignalling. The changes in histaminergic neuronswere verified using several methods, includinghdc ISH, histamine immunocytochemistry,HPLC and qPCR, which render the resultsreliable. Notably, knockdown of th2 wasfollowed by an increase of both histaminergic andhcrt neurons. We have previously shown thathistamine regulates the number of developinghcrt neurons in a bidirectional manner through H1receptor (20). The most likely mechanism is thatdopamine or histamine, for histaminergic and hcrtneurons, respectively, can act as paracrine factorsregulating neuronal specification duringembryonic neurogenesis. Previous studies have shown that dopamine canaffect cell proliferation and differentiation in theembryonic mouse telencephalon (46) and in theadult subventricular zone (47,48). In zebrafishsuppression of D2 receptor signalling through theAkt pathway reduces the number of GABAergicneurons. In this study, dopamine receptorantagonists did not alone affect cell numbers.However, they normalized the changes caused bythe agonists. The effects on target neurons of L-DOPA could also be in part mediated by L-DOPAwhich is produced by TH and which alone alsohas an effect as seen in Fig. 6. L-DOPA exciteshistaminergic neurons in rodent brain (43). Ourfinding of dopaminergic regulation ofneurotransmitter identity specification isconsistent with two potential mechanisms. First,th2 deficiency may disturb dopaminergic controlof hypothalamic neurogenesis (31,49). Alteredneurogenesis ratios of different neuronpopulations could lead to an increase in hcrt-expressing neurons. Second, th2 deficiency couldaffect transmitter specification. This could in turngive rise to remodelling of the neurotransmittercircuits so that an increase of histamine leads toincreased hcrt-expressing neurons (20). Thesefindings may have implications in mechanismsunderlying changes observed in the brains ofpatients suffering from Parkinson's disease andschizophrenia, since both the histaminergic anddopaminergic systems are abnormal in thesedisease states (7,10). The abnormally highnumbers of histamine neurons in narcolepticpatients (50-52) and notch1-mediated increase in

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

7

histamine neurons in adult presenilin1-deficientzebrafish (44) suggest that histamine neuronspecification occurs also in adult vertebrates (53).

EXPERIMENTAL PROCEDURES Zebrafish strain and maintenance-Zebrafishwere obtained from our breeding line maintainedin the laboratory for more than a decade(17,19,29,54). Fish were raised at 28°C andstaged in h post-fertilization (hpf) or days post-fertilization (dpf) as described previously (55).The Tg(f.TH:egfp) transgenic line was reportedpreviously (Tg(f.TH.A:egfp)zc56 ) in Fujimoto etal. (16); ZFIN nomenclature isTg(Tru.Th:EGFP)zc56. The permits for theexperiments were obtained from the Office of theRegional Government of Southern Finland inagreement with the ethical guidelines of theEuropean convention. Characterization of rabbit TH2 antibody -TheTH2 antibodies used in this study have beenproduced against a recombinant proteincontaining a 150-amino acid N-terminal fragmentof TH2 tagged by glutathione-S-transferase(GST) at the N-terminus (22). The crudeantiserum (TH2 169C) reacted with both forms ofzebrafish TH (TH1 and TH2). The TH2antiserum can be used in combination with amonoclonal antibody targeting TH1 to allowidentification of single-stained TH2 cells anddouble-stained TH1 cells. The fullcharacterization of the antibodies is described indetail elsewhere (22).

Western blotting-Western blot analysis wasperformed as described previously (22). Briefly,5-dpf zebrafish larvae were collected andmanually homogenized on ice in 0.05 M Tris-HClbuffer, pH7.5, containing Complete Miniprotease inhibitors (Roche) and 0.3 mM PMSF.40μg of proteins was loaded on each lanefollowed by blotting onto PVDF membranes andthe membrane was stained with ProActMembrane Stain (M282-1L; Amresco Inc., Ohio,USA) as the loading control. Rabbit TH2antiserum was pre-adsorbed on PFA-fixed 1-dpfembryos, and primary and secondary antibodieswere diluted 1:3000. Intensities of the Westernblot bands were measured by ImageJ 1.49c. High performance liquid chromatography(HPLC)- Heads of 5-dpf larvae were analysedfollowing removal of eyes and trunks on ice.Fifteen dissected heads were grouped and lysedin 150 ml of 2% perchloric acid with sonication.After centrifugation, 10 ml of supernatant wasassessed for monoamine concentration by HPLC.

Three individual groups per treatment conditionwere measured as a blinded experiment. Thedetection details are described in Sallinen et al.(17,29). RNA isolation and cDNA synthesis-Forquantitative real-time PCR analysis, total RNAwas extracted from fifteen pooled fish headscollected at 5 dpf (RNeasy mini Kit; Qiagen,Valencia, CA, USA). To synthesize cDNA, 2μgof total RNA was reverse-transcribed usingSuperScriptTM III reverse transcriptase(Invitrogen, Carlsbad, CA, USA) according toinstructions provided by the manufacturer. Theprimers for cloning tph1a, zic2a and zic5 were:tph1a 5’-CCATGAACCTCGGAATGACTT-3’and 5’-CCTGAAACGTGGTGATGATGCA-3’;zic2a 5’- GGATGTGATCGACGCTTTGC-3’and 5’- AAATGCCCCTGTTTAGCCCA-3’;zic5 5’- ACAATAGCGTTGAGCGTGGA-3’and 5’- ATTTCCTGTCGCAGCCATCA-3’. Morpholino oligonucleotide (MO) design, useand mRNA injections-Antisense MOs (GeneTools LLC, Philomath, OR, USA) were designedto target the splice-donor sites of exon 2 and exon4 of th1 (th1 MO1, 5’-ATTATGTTAGCCTACCTCGAAAACC-3’ andth1 MO2, 5’-TAATCCAGCACTTACTGGGTGATCC-3’),the splicing-donor sites of exon 3 and exon 7 ofth2 (th2 MO1, 5’-CTGTTGTTCACTTACAGGGTGATCC-3’ andth2 MO2, 5’-TTATGCATTGTACGTACGGTTCAGG-3’)and splicing-donor sites of exon2 and exon3 ofmanf (manf MO1, 5’-GACGGGTACTTACAAATCGGTTTTC-3’ andmanf MO2, 5’-TGCAAACAACTCACCGTATTTGAGT-3’).The working concentration was determined byinjecting serially diluted MOs. The injection doseof th2 MO1 or th2 MO2 was 8ng. Thecombination doses of 3.5 ng of each th1 MO1 andth1 MO2 (th1 MO1+2), 4 ng of each th2 MO1 andth2 MO2 (th2 MO1+2) and 4 ng of each manfsplice-blocking MOs (manf MO) were found toproduce the most effective inhibition (22,35). Astandard control MO (ctrl MO, 5'-CCTCTTACCTCAGTTACAATTTATA-3')purchased directly from Gene-Tools was injectedat 8 ng per embryo. The th2 full-length open-reading frame cDNA constructs were prepared byRT-PCR using Phusion High-Fidelity PCRMaster mix (Finnzymes, Espoo, Finland). Theprimers for th2 cloning were th2F-5’-ATAAGAATGGAATTCCCACCATGAAGTC

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

8

GGACAGTATAGCGCAG and th2R-5’-ATAAGAATGGGATCCATTATTTCTGTCCCAGTCTCCCCAAG. The PCR amplicons werecloned into the pGEM-T Easy vector (Promega,Madison, WI) and verified by sequencing. Theinsert sequence with no mutations was subclonedinto the expression vector pMC containinguntranslated repeats and polyadenylation whichcan enhance mRNA stability and translationefficiency. pMC was kindly given by Dr.ThomasCzerny (56). The plasmid was linearized withApaI for mRNA synthesis. Capped full-lengthopen-reading frame transcripts were generated bythe mMESSAGE mMACHINE kit (Ambion,Austin, TX, USA) using T7 RNA polymerase.For the mRNA rescue experiment 500 pg of th2mRNA with th2MO1+2 were coinjected intoembryos at one-cell stage. The MOs werethoroughly characterized for targeting andspecificity (22). The th1 MO and th2 MOabolished TH1 immunoreactivity and TH2 signalin immunocytochemistry, respectively (22). Inthis study all essential th2 morphant phenotypeswere rescued by th2 mRNA coinjection. Quantitative real-time PCR (qPCR)-qPCR wasperformed in the LightCycler 480 instrument(Roche, Mannheim, Germany) using theLightcycler®480 SYBR GreenI Master Mix(Roche). Primers for amplification weredesigned by Primer-BLAST (NCBI). Twohousekeeping genes, b-actin and ribosomalprotein L13a (rpl13a) were used as referencecontrols. All primer sets were confirmed toamplify only a single product of the correct size.Sequences of primers were: b-actin, 5’-CGAGCAGGAGATGGGAACC-3’ and 5’-CAACGGAAACGCTCATTGC-3’; rpl13a, 5’-AGAGAAAGCGCATGGTTGTCC-3’ and 5’-GCCTGGTACTTCCAGCCAACTT-3’; p53, 5’-ATGAGGAGATCTTTACCCTGCAG-3’ and 5’TGAGGCAGGCACCACATC-3’; Δ113p53, 5’-ATATCCTGGCGAACATTTGGAGGG-3’ and5- CCTCCTGGTCTTGTAATGTCAC-3’; th1,5’-GACGGAAGATGATCGGAGACA and 5’-CCGCCATGTTCCGATTTCT-3’; th2, 5’-CTCCAGAAGAGAATGCCACATG and 5’-ACGTTCACTCTCCAGCTGAGTG-3’; hdc, 5’-TTCATGCGTCCTCTCCTGC-3’ and 5’-CCCCAGGCATGATGATGTTC-3’; hcrt, 5’-TCTACGAGATGCTGTGCCGAG and 5’-CGTTTGCCAAGAGTGAGAATC-3’; drd1, 5’-TGCCATGGAAAGCCGCCACG-3’ and 5’-TGGCCCAGTAGCGGTCCACA-3’; drd2a, 5’-ACCTCCATCGCCTGAAGCTGGT-3’ and 5’-

TTGCCGGTGGGGGAGACCTG; drd2b, 5’-GGTTCTACGCAAGCGGCGGA-3’ and 5’-GGCAGGTACACCCCCGTTGG-3’; drd3, 5’-CCACGGTTTGGGTCCTCGCC-3’ and 5’-AGGGTCACCGCAAACGGCAA-3’; manf, 5’-AGATGGAGAGTGTGAAGTCTGTGTG-3’and 5’-CAATTGAGTCGCTGTCAAACTTG-3’. Cycling parameters were as follows: 95ºC for5 min and 45 cycles of the following, 95ºC for 10s, 60ºC for 15 s. and 72ºC for 20 s. Fluorescencechanges were monitored with SYBR Green afterevery cycle. Dissociation curve analysis wasperformed (0.1 ºC per s increase from 60ºC to95ºC with continuous fluorescence readings) atthe end of cycles to ensure that only singleamplicon was obtained. All reactions wereperformed in duplicates and three individualreplicates. Results were evaluated with theLightCycler 480 software. The data werecalculated by the comparative method using Ctvalues of b-actin and rpl13a, respectively, as thereference control (57). Since the gene expressionchanges showed the same trend when normalizedto different housekeeping genes (data not shown),the result referred to b-actin was shown in thisstudy. Whole mount in situ hybridization (WISH)-Whole-mount in situ hybridization (WISH) wasperformed on 4% paraformaldehyde (PFA) fixed5-dpf dissected brains as described earlier (13).Antisense and sense digoxigenin (DIG)-labeledRNA probes were generated using the DIG RNAlabelling kit (Roche Diagnostics, Germany),following the instructions of the manufacturer.The WISH procedure followed Thisses’ protocol(58). The prehybridization and hybridizationwere conducted at 65ºC for all riboprobes. In situhybridization signals were detected with sheepanti-digoxigenin-AP Fab fragments (1:10,000;Roche Diagnostics, Germany). The colourstaining was carried out with chromogensubstrates (nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate). For th2-fluorescentin situ hybridization (FISH), samples wereincubated in 2% H2O2 in methanol for 20 min toinactivate endogenous peroxidase (POD) activity.A th2-DIG-labeled probe was used forhybridization. To visualize the hybridized probe,samples were incubated in POD-conjugated anti-DIG antibody (1:500; Roche 11207733910)followed by the bench-made carboxyfluoresceintyramide reaction (FAM-tyramide)(59). Immunocytochemistry-Immunostaining wasperformed on 2% PFA or 4% 1 -ethyl-3 (3-dimethylaminopropyl)-carbodiimide fixed

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

9

zebrafish. For 5-dpf fixed larvae, brains weredissected to enhance antigen presentation andimprove image quality. Antibody incubationswere carried out with 4% normal goat serum and1% Dimethyl sulfoxide in 0.3% Triton X-100/phosphate buffered saline for 16 h at 4 ºC withgentle agitation. Primary antibodies werechicken anti-green fluorescent protein (1:1000;A10263, Invitrogen, Eugene, OR, USA), rabbitanti-histamine 19C (1:10,000; (20,60)), rabbitanti-TH2 antibody (1:2000; (22)), rabbit anti-serotonin antibody (1:1000; S5545, Sigma, St.Louis, MO, USA), rat anti-serotonin antibody(1:250; MAB352, EMD Millipore) and anti-tyrosine hydroxylase monoclonal mouseantibody (1:1000; Product No 22941,Immunostar, Hudson, WI, USA). Thespecificities of the histamine, commercial mousemonoclonal TH and serotonin antibodies havebeen verified previously (19). The followingsecondary antibodies were applied: Alexa Fluorâ488, 568 or 647 goat anti-chicken, anti-mouse oranti-rabbit IgG (1:1000; Invitrogen, Eugene, OR,USA). Imaging-Bright-field images were taken with aLeica DM IRB inverted microscope with a DFC480 charge-coupled device camera and z-stackswere processed with Leica Application Suitesoftware and Corel DRAW X3 software (13).Immunofluorescence samples were examinedusing a Leica TCS SP2 AOBS confocalmicroscope. For excitation, an Argon laser (488nm), green diode laser (561 nm) and red HeNelaser (633nm) were used. Emission was detectedat 500-550 nm, 560-620 nm and 630-680 nm,respectively. Cross-talk between the channels

and background noise were eliminated withsequential scanning and frame averaging asdescribed earlier (17). Stacks of images taken at0.2 - 1.2 μm intervals were compiled, and themaximum intensity projection algorithm wasused to produce final images with Leica ConfocalSoftware and Imaris imaging software version 6.0(Bitplane AG, Zurich, Switzerland). Cellnumbers were counted in each 1.0 μm opticalslice using ImageJ 1.46r software (NationalInstitutes of Health, Bethesda, USA) and all cellcounts were performed by an investigator blindedto the sample type Pharmacological treatments -Twenty-four-hpfwild-type or morphant embryos were manuallydechorionated and 20 embryos per group wereraised in six-well plates containing 3 ml of E3medium (5 mM NaCl, 0.17 mM KCl, 0.33 mMCaCl2, 0.33 mM MgSO4 with or without drugadditions (L-DOPA, D9628; SKF38398, S101;quinpirole, Q102; haloperidol, H1512;SCH23390, D054; Sigma-Aldrich, St. Louis,MO, USA). The incubation medium wasreplaced daily until 5 dpf. For the serotoninmeasurement control, 4-dpf fish were exposed to100 μM p-chlorophenylalanine (pCPA, 25920,Sigma-Aldrich, St. Louis, MO, USA) for 24h. Statistical analysis-Data analysis wasperformed by GraphPad Prism v.4.1 software(San Diego, CA, USA). p-values were generatedby one-way analysis of variance (ANOVA) formultiple comparisons using Tukey’s multiplecomparison test and Student’s t test (unpairedtest) for comparison of two groups. Data werepresented as mean ± SEM. p value <0.05 wasconsidered statistically significant.

Acknowledgments: Supported by the Academy of Finland and Sigrid Juselius Foundation; and DP2MH100008 to JLB. We thank Henri Koivula, BSc, and Reeta Huhtala, MSc, for expert technical help.

Conflict of interest: The authors declare no competing interests.

Author contributions: YCC PP conceived and designed the experiments. YCC SS SR MS performedthe experiments and analysed the data. JLB contributed the transgenic fish. YCC PP wrote themanuscript with input from all authors.

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

10

REFERENCES1. Beaulieu, J. M., and Gainetdinov, R. R. (2011) The physiology, signaling, and pharmacology

of dopamine receptors. Pharmacological reviews 63, 182-2172. Todd, R. D. (1992) Neural development is regulated by classical neurotransmitters: dopamine

D2 receptor stimulation enhances neurite outgrowth. Biological psychiatry 31, 794-8073. Schmidt, U., Beyer, C., Oestreicher, A. B., Reisert, I., Schilling, K., and Pilgrim, C. (1996)

Activation of dopaminergic D1 receptors promotes morphogenesis of developing striatalneurons. Neuroscience 74, 453-460

4. Reimer, M. M., Norris, A., Ohnmacht, J., Patani, R., Zhong, Z., Dias, T. B., Kuscha, V.,Scott, A. L., Chen, Y. C., Rozov, S., Frazer, S. L., Wyatt, C., Higashijima, S., Patton, E. E.,Panula, P., Chandran, S., Becker, T., and Becker, C. G. (2013) Dopamine from the brainpromotes spinal motor neuron generation during development and adult regeneration.Developmental cell 25, 478-491

5. Panula, P., and Nuutinen, S. (2013) The histaminergic network in the brain: basicorganization and role in disease. Nature reviews. Neuroscience 14, 472-487

6. Haas, H., and Panula, P. (2003) The role of histamine and the tuberomamillary nucleus in thenervous system. Nature reviews. Neuroscience 4, 121-130

7. Rinne, J. O., Anichtchik, O. V., Eriksson, K. S., Kaslin, J., Tuomisto, L., Kalimo, H., Roytta,M., and Panula, P. (2002) Increased brain histamine levels in Parkinson's disease but not inmultiple system atrophy. Journal of neurochemistry 81, 954-960

8. Anichtchik, O. V., Rinne, J. O., Kalimo, H., and Panula, P. (2000) An altered histaminergicinnervation of the substantia nigra in Parkinson's disease. Experimental neurology 163, 20-30

9. Winterer, G., and Weinberger, D. R. (2004) Genes, dopamine and cortical signal-to-noiseratio in schizophrenia. Trends in neurosciences 27, 683-690

10. Prell, G. D., Green, J. P., Kaufmann, C. A., Khandelwal, J. K., Morrishow, A. M., Kirch, D.G., Linnoila, M., and Wyatt, R. J. (1995) Histamine metabolites in cerebrospinal fluid ofpatients with chronic schizophrenia: their relationships to levels of other aminergictransmitters and ratings of symptoms. Schizophrenia research 14, 93-104

11. Zhou, Q. Y., and Palmiter, R. D. (1995) Dopamine-deficient mice are severely hypoactive,adipsic, and aphagic. Cell 83, 1197-1209

12. Kobayashi, K., Morita, S., Sawada, H., Mizuguchi, T., Yamada, K., Nagatsu, I., Hata, T.,Watanabe, Y., Fujita, K., and Nagatsu, T. (1995) Targeted disruption of the tyrosinehydroxylase locus results in severe catecholamine depletion and perinatal lethality in mice.The Journal of biological chemistry 270, 27235-27243

13. Chen, Y. C., Priyadarshini, M., and Panula, P. (2009) Complementary developmentalexpression of the two tyrosine hydroxylase transcripts in zebrafish. Histochemistry and cellbiology 132, 375-381

14. Filippi, A., Mahler, J., Schweitzer, J., and Driever, W. (2010) Expression of the paralogoustyrosine hydroxylase encoding genes th1 and th2 reveals the full complement ofdopaminergic and noradrenergic neurons in zebrafish larval and juvenile brain. The Journal ofcomparative neurology 518, 423-438

15. Yamamoto, K., Ruuskanen, J. O., Wullimann, M. F., and Vernier, P. (2010) Two tyrosinehydroxylase genes in vertebrates New dopaminergic territories revealed in the zebrafish brain.Molecular and cellular neurosciences 43, 394-402

16. Fujimoto, E., Stevenson, T. J., Chien, C. B., and Bonkowsky, J. L. (2011) Identification of adopaminergic enhancer indicates complexity in vertebrate dopamine neuron phenotypespecification. Developmental biology 352, 393-404

17. Sallinen, V., Torkko, V., Sundvik, M., Reenila, I., Khrustalyov, D., Kaslin, J., and Panula, P.(2009) MPTP and MPP+ target specific aminergic cell populations in larval zebrafish.Journal of neurochemistry 108, 719-731

18. Rink, E., and Wullimann, M. F. (2002) Connections of the ventral telencephalon and tyrosinehydroxylase distribution in the zebrafish brain (Danio rerio) lead to identification of anascending dopaminergic system in a teleost. Brain research bulletin 57, 385-387

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

11

19. Kaslin, J., and Panula, P. (2001) Comparative anatomy of the histaminergic and otheraminergic systems in zebrafish (Danio rerio). The Journal of comparative neurology 440,342-377

20. Sundvik, M., Kudo, H., Toivonen, P., Rozov, S., Chen, Y. C., and Panula, P. (2011) Thehistaminergic system regulates wakefulness and orexin/hypocretin neuron development viahistamine receptor H1 in zebrafish. The FASEB journal : official publication of theFederation of American Societies for Experimental Biology 25, 4338-4347

21. McLean, D. L., and Fetcho, J. R. (2004) Relationship of tyrosine hydroxylase and serotoninimmunoreactivity to sensorimotor circuitry in larval zebrafish. The Journal of comparativeneurology 480, 57-71

22. Semenova, S. A., Chen, Y. C., Zhao, X., Rauvala, H., and Panula, P. (2014) The tyrosinehydroxylase 2 (TH2) system in zebrafish brain and stress activation of hypothalamic cells.Histochemistry and cell biology 142, 619-633

23. Candy, J., and Collet, C. (2005) Two tyrosine hydroxylase genes in teleosts. Biochimica etbiophysica acta 1727, 35-44

24. Yamamoto, K., and Vernier, P. (2011) The evolution of dopamine systems in chordates.Frontiers in neuroanatomy 5, 21

25. Ren, G., Li, S., Zhong, H., and Lin, S. (2013) Zebrafish tyrosine hydroxylase 2 gene encodestryptophan hydroxylase. The Journal of biological chemistry 288, 22451-22459

26. Robu, M. E., Larson, J. D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S. A., andEkker, S. C. (2007) p53 activation by knockdown technologies. PLoS genetics 3, e78

27. Yamamoto, K., Ruuskanen, J. O., Wullimann, M. F., and Vernier, P. (2011) Differentialexpression of dopaminergic cell markers in the adult zebrafish forebrain. The Journal ofcomparative neurology 519, 576-598

28. Eiden, L. E., and Weihe, E. (2011) VMAT2: a dynamic regulator of brain monoaminergicneuronal function interacting with drugs of abuse. Annals of the New York Academy ofSciences 1216, 86-98

29. Sallinen, V., Sundvik, M., Reenila, I., Peitsaro, N., Khrustalyov, D., Anichtchik, O.,Toleikyte, G., Kaslin, J., and Panula, P. (2009) Hyperserotonergic phenotype aftermonoamine oxidase inhibition in larval zebrafish. Journal of neurochemistry 109, 403-415

30. Irons, T. D., Kelly, P. E., Hunter, D. L., Macphail, R. C., and Padilla, S. (2013) Acuteadministration of dopaminergic drugs has differential effects on locomotion in larvalzebrafish. Pharmacology, biochemistry, and behavior 103, 792-813

31. Wang, X., Kopinke, D., Lin, J., McPherson, A. D., Duncan, R. N., Otsuna, H., Moro, E.,Hoshijima, K., Grunwald, D. J., Argenton, F., Chien, C. B., Murtaugh, L. C., and Dorsky, R.I. (2012) Wnt signaling regulates postembryonic hypothalamic progenitor differentiation.Developmental cell 23, 624-636

32. Russek-Blum, N., Gutnick, A., Nabel-Rosen, H., Blechman, J., Staudt, N., Dorsky, R. I.,Houart, C., and Levkowitz, G. (2008) Dopaminergic neuronal cluster size is determinedduring early forebrain patterning. Development 135, 3401-3413

33. Nyholm, M. K., Wu, S. F., Dorsky, R. I., and Grinblat, Y. (2007) The zebrafish zic2a-zic5gene pair acts downstream of canonical Wnt signaling to control cell proliferation in thedeveloping tectum. Development 134, 735-746

34. Lindholm, P., and Saarma, M. (2010) Novel CDNF/MANF family of neurotrophic factors.Developmental neurobiology 70, 360-371

35. Chen, Y. C., Sundvik, M., Rozov, S., Priyadarshini, M., and Panula, P. (2012) MANFregulates dopaminergic neuron development in larval zebrafish. Developmental biology

36. Rink, E., and Wullimann, M. F. (2002) Development of the catecholaminergic system in theearly zebrafish brain: an immunohistochemical study. Brain research. Developmental brainresearch 137, 89-100

37. Rink, E., and Wullimann, M. F. (2004) Connections of the ventral telencephalon (subpallium)in the zebrafish (Danio rerio). Brain research 1011, 206-220

38. Schweitzer, J., and Driever, W. (2009) Development of the dopamine systems in zebrafish.Advances in experimental medicine and biology 651, 1-14

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

12

39. McPherson, A. D., Barrios, J. P., Luks-Morgan, S. J., Manfredi, J. P., Bonkowsky, J. L.,Douglass, A. D., and Dorsky, R. I. (2016) Motor Behavior Mediated by ContinuouslyGenerated Dopaminergic Neurons in the Zebrafish Hypothalamus Recovers after CellAblation. Current biology : CB 26, 263-269

40. Mu, Y., Li, X. Q., Zhang, B., and Du, J. L. (2012) Visual input modulates audiomotorfunction via hypothalamic dopaminergic neurons through a cooperative mechanism. Neuron75, 688-699

41. Kukko-Lukjanov, T. K., and Panula, P. (2003) Subcellular distribution of histamine, GABAand galanin in tuberomamillary neurons in vitro. Journal of chemical neuroanatomy 25, 279-292

42. Machluf, Y., Gutnick, A., and Levkowitz, G. (2011) Development of the zebrafishhypothalamus. Annals of the New York Academy of Sciences 1220, 93-105

43. Yanovsky, Y., Li, S., Klyuch, B. P., Yao, Q., Blandina, P., Passani, M. B., Lin, J. S., Haas, H.L., and Sergeeva, O. A. (2011) L-Dopa activates histaminergic neurons. The Journal ofphysiology 589, 1349-1366

44. Sundvik, M., Chen, Y. C., and Panula, P. (2013) Presenilin1 regulates histamine neurondevelopment and behavior in zebrafish, danio rerio. The Journal of neuroscience : the officialjournal of the Society for Neuroscience 33, 1589-1597

45. Holzschuh, J., Ryu, S., Aberger, F., and Driever, W. (2001) Dopamine transporter expressiondistinguishes dopaminergic neurons from other catecholaminergic neurons in the developingzebrafish embryo. Mechanisms of development 101, 237-243

46. Popolo, M., McCarthy, D. M., and Bhide, P. G. (2004) Influence of dopamine on precursorcell proliferation and differentiation in the embryonic mouse telencephalon. Developmentalneuroscience 26, 229-244

47. Freundlieb, N., Francois, C., Tande, D., Oertel, W. H., Hirsch, E. C., and Hoglinger, G. U.(2006) Dopaminergic substantia nigra neurons project topographically organized to thesubventricular zone and stimulate precursor cell proliferation in aged primates. The Journal ofneuroscience : the official journal of the Society for Neuroscience 26, 2321-2325

48. O'Keeffe, G. C., Barker, R. A., and Caldwell, M. A. (2009) Dopaminergic modulation ofneurogenesis in the subventricular zone of the adult brain. Cell Cycle 8, 2888-2894

49. Maggi, R., Zasso, J., and Conti, L. (2014) Neurodevelopmental origin and adult neurogenesisof the neuroendocrine hypothalamus. Frontiers in cellular neuroscience 8, 440

50. Valko, P. O., Gavrilov, Y. V., Yamamoto, M., Reddy, H., Haybaeck, J., Mignot, E.,Baumann, C. R., and Scammell, T. E. (2013) Increase of histaminergic tuberomammillaryneurons in narcolepsy. Annals of neurology 74, 794-804

51. John, J., Thannickal, T. C., McGregor, R., Ramanathan, L., Ohtsu, H., Nishino, S., Sakai, N.,Yamanaka, A., Stone, C., Cornford, M., and Siegel, J. M. (2013) Greatly increased numbersof histamine cells in human narcolepsy with cataplexy. Annals of neurology 74, 786-793

52. Sundvik, M., and Panula, P. (2015) Interactions of the orexin/hypocretin neurones and thehistaminergic system. Acta Physiol (Oxf) 213, 321-333

53. Panula, P., Sundvik, M., and Karlstedt, K. (2014) Developmental roles of brain histamine.Trends in neurosciences 37, 159-168

54. Kaslin, J., Nystedt, J. M., Ostergard, M., Peitsaro, N., and Panula, P. (2004) Theorexin/hypocretin system in zebrafish is connected to the aminergic and cholinergic systems.The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 2678-2689

55. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., and Schilling, T. F. (1995)Stages of embryonic development of the zebrafish. Developmental dynamics : an officialpublication of the American Association of Anatomists 203, 253-310

56. Fink, M., Flekna, G., Ludwig, A., Heimbucher, T., and Czerny, T. (2006) Improvedtranslation efficiency of injected mRNA during early embryonic development. Developmentaldynamics : an official publication of the American Association of Anatomists 235, 3370-3378

57. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

13

58. Thisse, C., and Thisse, B. (2008) High-resolution in situ hybridization to whole-mountzebrafish embryos. Nature protocols 3, 59-69

59. Lauter, G., Soll, I., and Hauptmann, G. (2014) Sensitive whole-mount fluorescent in situhybridization in zebrafish using enhanced tyramide signal amplification. Methods Mol Biol1082, 175-185

60. Panula, P., Airaksinen, M. S., Pirvola, U., and Kotilainen, E. (1990) A histamine-containingneuronal system in human brain. Neuroscience 34, 127-132

61. Sallinen, V., Kolehmainen, J., Priyadarshini, M., Toleikyte, G., Chen, Y. C., and Panula, P.(2010) Dopaminergic cell damage and vulnerability to MPTP in Pink1 knockdown zebrafish.Neurobiology of disease 40, 93-101

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

14

FIGURE LEGENDS

FIGURE 1. Multiple labelling of catecholaminergic, histaminergic, serotoninergic neurons and GFPdistributions in 5-dpf brains of Tg(f.TH:egfp) transgenic line and Turku wild type (WT). (A) Aventral view of GFP distribution in 5-dpf brain. The specimens initially hybridized (ISH) with th2antisense riboprobes were processed for double immunostaining with chicken GFP and mouse TH1antibodies shown in (B-D). (B) A ventral view of triple staining showing GFP-ir in green, TH1-ir inblue and th2 mRNA expression pattern in red. (C) A lateral view of (B). The distribution patterns indiencephalic and hypothalamic regions of GFP and TH1 with TH2, histamine (His) or 5-HT areshown in (E), (F) and (G), respectively. A triple immunostaining image with anti-TH1, anti-TH2 andanti-5HT on a 5-dpf brain is shown in (H and H’). Larger magnification and single section images ofgroup10b (white rectangle) in (D), (E), (F), (G) and (H) are shown in (D’), (E’), (F’), (G’) and (H’),respectively. The GFP-ir signal is shown in green, TH1-ir in blue and th2-ish, TH2-ir, His-ir and 5-HT-ir is in red in the transgenic line (D-G). 5-HT-ir is in green in (H). White arrows indicate GFP-positive but th2/TH2 -negative populations. Cells labelled with both TH1 and th2 are shown inmagenta. Cells labelled with both GFP and TH2 are shown in yellow. Olfactory bulb (OB). 3b,preoptic group (Po). 8b, paraventricular organ. 9b, nucleus of lateral recess. 10b, caudalhypothalamus (Hc). TH2 group numbers are based on (13). Scale bar is 50 mm.

FIGURE 2. Western blotting, body length, and the concentration of catecholamines and serotonin inmorphants. (A) The western blot analysis using 5-dpf larvae with anti-TH2 antibody The ProActmembrane stain was used as the loading control. (B) The quantification of the body length. Thesample number of each group and mean ± SEM is indicated in the graph. (C) A bright-field image ofthe morphants . (D-E) qPCR analysis of p53 and delta113p53 transcript levels (N=3 each group,Student’s t test). Catecholamine and serotonin concentration was measured using HPLC. Fifteen of5-dpf heads were homogenized for each group and three individual groups (N=3) per treatment wereanalysed. (F) dopamine (G) norepinephrine (H) epinephrine (I) serotonin. th2 rescue is th2 MO1+2co-injected with th2 mRNA. * p<0.05, ** p<0.01 and ***p<0.001 by one-way ANOVA withTukey’s test. Scale bar is 500 mm.

FIGURE 3. The expression pattern of slc6a3, VMAT2, tph1a and the distribution of 5-HT-ir cells inthe 5-dpf ctrlMO, and th2MO1+2 morphant brains. (A and B) slc6a3 ISH; (C and D) VMAT2 ISH, (Eand F) tph1a ISH; (G and H) double staining of TH1 and 5-HT. (I) The quantification of 5-HT-ircellsin posterior part of paraventricular organ (PVOp, 5-HT group 4).TH1-labelled cells are shown in redand 5-HT-positive cells in green. Scale bar is 100 mm.

FIGURE 4. A significant change of histaminergic neuron numbers in th2 deficient fish brains. Thenumber of histaminergic neurons and histamine level is elevated in th2 morphants. hdc ISH andhistamine (his) immunostaining were carried out on 5-dpf fish brains. (A-C) hdc ISH in 5-dpf brainsof ctrl MO, th2 MO1+2 and th2 Rescue. (D-F) Immunostaining with histamine in ctrl MO, th2MO1+2 and th2 Rescue brains. (G) The quantification of the hdc cell number. (H) The quantificationof his-ir cell number. (I) The histamine level measured by HPLC. Large magnification of hdc-ish(A’, B’ and C’) and His-ir cell images (D’, E’, and F’) are depicted. The histamine-containing cellsare labelled in green. The number of brains analysed and the mean values of the cell numbers areshown in the columns. Scale bar is 100 mm. * p<0.05, ** p<0.01 and *** p<0.001 by one-wayANOVA with Tukey’s test.

FIGURE 5. A significant increase of hcrt cell numbers in th2 deficient fish brains. hcrt ISH wascarried out on 5-dpf dissected brains. The number of brains analysed and the mean value of the cellnumber is shown in the columns. * p<0.05 by Student’s t test. Scale bar is 100 mm.

FIGURE 6. Dopamine receptor agonists affect the histaminergic and dopaminergic neuron numbersin 5-dpf fish brains. The cell numbers were quantified following histamine and TH1 co-immunostaining. (A-C) Untreated (D-F) 10 mM L-dopa treatment (G-I) 7.5 μM quinpirole treatment

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

15

(J-L) 10 μM SKF38393. The quantification of TH1-ir cell numbers after dopamine receptor agonistand antagonist administration is shown in (M) PVOp (TH1 group 10) and (N) in the diencephaliccomplex (TH1 group 13). The quantification of His-ir cell numbers is shown in (O). Thequantification of his-ir cell numbers in th2 MO1+2 morphant brains after drug treatments is shown(P). PVOp, posterior part of the paraventricular organ. TH1 group numbers 10 and 13 are based on(61); corresponding to DC7 and DC6 in (36). His-ir positive cells are in green. TH1-labelled cellsare in red. The number of brains analysed and the mean value of the cell number is shown in thecolumns. * p<0.05, ** p<0.01 and *** p<0.001 by one-way ANOVA with Tukey’s test. Scale bar is100 mm.

FIGURE 7. Dynamic effects of Wnt signalling on dopaminergic and histaminergic neurons. Theimages of His-ir and TH1-ir cells are depicted in (A-C) the wild-type group and (D-F) the DKK1 mRNAoverexpression group. The images of th2-FISH distributions are shown in (G and H). (I)Overexpression of Dkk1 mRNA down regulates the zic2a expression in telencephalon (tel), midbrain(m) and hindbrain (H) regions compared with the WT. The comparisons of TH1 -ir cell numbersbetween WT and DKK1 mRNA overexpression brains in PVOp (TH1 group 10) and in the diencephaliccomplex (TH1 group 13) are shown in (J) and (K). The quantification of His-ir cell numbers is shownin (L). The quantification of th2-expression cell numbers in PVOp (TH2 group 10b) and in thediencephalic complex (TH2 group 8b and 9b)) are shown in (M) and (N). The quantification of hdc-positive cell number in the ctrlMO, manf MO and manf Rescue morphant brain is demonstrated in (O).(J) Levels of mRNA expression by qPCR (N=3). Fold changes were calculated relative to the averageexpression of wild-type groups. PVOp, posterior part of the paraventricular organ. TH1 and TH2 groupnumbers are based on (61). TH1-lablled cells are in red. His-ir positive cells are in green. Arrowsindicate the regions where the zic2a expression is reduced. The number of brains analysed (n) and themean value of the cell number is shown in the columns. * p<0.05, ** p<0.01 and *** p<0.001 byStudent’s t test or one-way ANOVA with Tukey’s test. Scale bar is 100 mm.

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Bonkowsky and Pertti PanulaYu-Chia Chen, Svetlana Semenova, Stanislav Rozov, Maria Sundvik, Joshua L.

neurotransmitter identityA novel developmental role for dopaminergic signaling to specify hypothalamic

published online August 18, 2016J. Biol. Chem. 

  10.1074/jbc.M115.697466Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2016/08/18/M115.697466.DC1

by guest on January 12, 2020http://w

ww

.jbc.org/D

ownloaded from