i
ISOLATION AND CHARACTERIZATION OF LYTIC
BACTERIOPHAGES AGAINST Escherichia coli ISOLATED FROM
DAIRY FARM SEWAGE
BY
SANEM SOMA SEKHAR GOUD B.V.Sc & A.H.
RVM/2014-003
THESIS SUBMITTED TO THE
P. V. NARASIMHA RAO TELANGANA VETERINARY
UNIVERSITY
IN PARTIAL FULFILMENT OF THE REQUIREMENTS
FOR THE AWARD OF THE DEGREE OF
MASTER OF VETERINARY SCIENCE
DEPARTMENT OF VETERINARY PUBLIC HEALTH AND EPIDEMIOLOGY
COLLEGE OF VETERINARY SCIENCE
RAJENDRANAGAR, HYDERABAD-500 030.
P.V. NARASIMHA RAO TELANGANA VETERINARY UNIVERSITY,
HYDERABAD-500 030
OCTOBER’ 2016
ii
CERTIFICATE
Dr. SANEM SOMA SEKHAR GOUD (RVM/14-003) has
satisfactorily prosecuted the course of research and that the thesis entitled “ISOLATION
AND CHARACTERIZATION OF LYTIC BACTERIOPHAGES AGAINST
Escherichia coli ISOLATED FROM DAIRY FARM SEWAGE” submitted is the
result of original research work and is of sufficiently high standard to warrant its
presentation to the examination. I also certify that the thesis or part of has not been
previously submitted by him for a degree of any University.
Date : (A. JAGADEESH BABU)
Place : Hyderabad Major Advisor
iii
CERTIFICATE
This is to certify that the thesis entitled “ISOLATION AND
CHARACTERIZATION OF LYTIC BACTERIOPHAGES AGAINST Escherichia
coli ISOLATED FROM DAIRY FARM SEWAGE” submitted in partial fulfilment of
the requirements for the degree of MASTER OF VETERINARY SCIENCE for P. V.
Narasimha Rao Telangana Veterinary University, Hyderabad is a record of the bonafied
research work carried out by Dr. SANEM SOMA SEKHAR GOUD, RVM/14-003
under my guidance and supervision. The subject of the thesis has been approved by
Student’s Advisory Committee.
No part of the thesis has been submitted for any other degree or diploma. All the
assistance and help received during course of investigation have been duly acknowledged
by the author of thesis.
(A.JAGADEESH BABU)
Chairman of the Advisory Committee
Thesis approved by the Student Advisory Committee
Chairman : Dr. A.JAGADEESH BABU
Associate Professor and Head
Department of Veterinary Public Health and
Epidemiology
College of Veterinary Science
Tirupati, Chittoor District, A.P.
Member : Dr. N. KRISHNAIAH
Professor and Head
Department of Veterinary Public Health and
Epidemiology
College of Veterinary Science
Rajendranagar, Hyderabad-500 030.
Member : Dr. P. KALYANI
Assistant Professor
Department of Veterinary Biotechnology
College of Veterinary Science
Rajendranagar, Hyderabad-500 030.
iv
CONTENTS
Chapter
No.
Title Page No.
I.
INTRODUCTION
1-3
II. REVIEW OF LITERATURE 4-56
III. MATERIALS AND METHODS 57-72
IV. RESULTS 73-110
V. DISCUSSION 111-130
VI. SUMMARY 131-135
LITERATURE CITED 136-175
ANNEXURE 176-190
v
LIST OF TABLES
Table
No.
Title Page
No.
2.1
ICTV classification of phages
48
3.1 List of equipment used in the study 59
3.2 Source and number of samples collected 59
3.3 Antimicrobial discs used to study the antimicrobial susceptibility
of the isolates 63
3.4 Details of oligonucleotide primers used in this study 65
4.1 Results of the biochemical tests for Escherichia coli isolates 74
4.2 Antimicrobial sensitivity/ intermediate/ resistant-patterns of
Escherichia coli from different sources 81
4.3 Antibiotic resistant among Escherichia coli (source wise) 82
4.4 Components of reaction mixture used in PCR assay 84
4.5 PCR conditions used for multiplex PCR assay 85
4.6 Screening and comparison of cultural method for detection of
Escherichia coli and multiplex PCR for detection of Shiga-toxin
producing E. coli
87
4.7 Effect of 400C temperature on the activity of phage 92
4.8 Effect of 600C temperature on the activity of phage 93
4.9 Effect of sunlight on the activity of phage 94
4.10 Effect of U.V light on the activity of phages 95
4.11 Effect of SDS (1%) on the activity of phages 96
4.12 Effect of SDS (0.1%) on the activity of phages 97
4.13 Effect of phenol (1%) on the activity of phages 98
4.14 Effect of phenol (5%) on the activity of phages 99
4.15 Effect of chloroform (5%) on the activity of phages 100
4.16 Effect of chloroform (10%) on the activity of phages 101
4.17 Effect of formalin (40%) on the activity of phages 102
4.18 Activity of bacteriophages against E. coli isolated from sewage
samples 109
vi
LIST OF ILLUSTRATIONS
Figure
No. Particulars
Page
No.
1.
Plate showing pink colonies of E. coli on MacConkey agar
plate
75
2. Plate showing green metallic sheen of E. coli on EMB agar plate 75
3. Picture showing gram negative coccobacillary rods of E. coli 76
4. Indole test showing red colour ring: positive for E. coli 76
5. Methyl red test showing red colour: positive for E. coli 77
6. Voges-Proskauer test showing no red colour formation: positive
for E. coli
77
7. Citrate test showing no blue colour formation: positive for E. coli 78
8. Triple sugar iron test showing acid slant, acid butt and gas
production: positive for E. coli
78
9. Urease test showing no pink colour formation: positive for E. coli 79
10. Motility test showing growth of organisms away from the line of
inoculation: positive for E. coli
79
11. Antibiotic sensitivity and resistance pattern of the E. coli
isolates (Ampicillin, Azithromycin, Chloramphenicol,
Gentamicin, Streptomycin, Penicillin-G and Tetracycline)
83
12. Antibiotic sensitivity and resistnace pattern of the E. coli
isolates (Ciprofloxacin, Meropenem, Tigecycline, Cefadroxil,
Cefotaxime, Cefoperazone and Ofloxacin)
83
13. Detection of stx1, stx2, eaeA and hlyA in sewage samples
collected from organized dairy farms
88
vii
14. Detection of stx1, stx2, eaeA and hlyA in sewage samples
collected from unorganized dairy farms
88
15. Detection of stx1, stx2, eaeA and hlyA in sewage samples
collected from animal sheds
89
16. Picture showing lytic bacteriophages against E. coli: spot test 103
17. Plaques on secondary streaking on the E. coli lawn gave the
clearing zone around the streak lines
103
18. Picture showing lytic bacteriophages against E. coli: Double agar
overlay method (circular plaques with diameter ranging from 0.1
to 3 mm)
104
19. Effect of heat on the activity of bacteriophages (%) 104
20. Effect of sunlight on the activity of bacteriophages (%) 105
21. Effect of U.V light on the activity of the bacteriophages (%) 105
22. Effect of SDS on the activity of bacteriophages (%) 106
23. Effect of phenol on the activity of bacteriophages (%) 106
24. Effect of chloroform on the activity of bacteriophages (%) 107
25. Effect of formalin on the activity of bacteriophages (%) 107
26. Determination of molecular weight of E. coliphage nucleic acid 108
27. Electron micrograph of phage by Scanning Electron Microscopy 110
viii
LIST OF ABBREVIATIONS
µg : micro gram
µl : micro litre
aw : Water activity
Bp : Base pair
Kbp : Kilo base pair
CDC : Centers for Disease Control and Prevention
Cfu : Colony forming units
Dntp : Deoxy ribo nucleoside triphosphate
DNA : Deoxy ribonucleic acid
EaeA : Intimin Gene
E. coli : Escherichia coli
EHEC : Enterohaemorrhagic E. coli
ETEC : Enterotoxigenic E. coli
EPEC : Enteropathogenic E. coli
EIEC : Enteroinvasive E. coli
EAEC : Enteroaggregative E. coli
DEAC : Diffuse-adhering E. coli
STEC : Shiga-toxin producing E. coli
VTEC : Verotoxin producing E. coli
EMB : Eosine Methylene Blue
Fig. : Figure
g, gm : Gram
HC : Haemorrhagic Colitis
HUS : Haemolytic Uremic Syndrome
TTP : Thrombotic thrombocytopenic purpura
ix
A/E : Attaching and Effacing
NM : Non motile
I.U : International Units
MCA : MacConkey agar
mg : milli gram
V : Volts
Ma : milli ampere
Min : Minute
H : Hour
Ml : Millilitre
mM : Millimolar
Pmol : Pico moles
M : Molarity
MR : Methyl red
VP : Voges-Proskauer
IMViC : Indole, Methyl red, Voges-Proskauer, Citrate
PCR : polymerase chain reaction
rpm : Rotations per minute
stx1 : Shiga toxin 1
stx2 : Shiga toxin 2
hlyA : Haemolytic Gene
SMAC : Sorbitol MacConkey agar
TAE : Tris -Acetate with EDTA
TBE : Tris-Borate with EDTA
TE : Tris EDTA buffer
Taq : Thermus aquaticus
x
TSB : Tryptic soya broth
TSI : Triple sugar iron agar
UV : Ultra Violet
V/cm : Volts per centimetre
v/v : Volume/volume
ICTV : International Committee on Taxonomy of
Viruses
SDS : Sodium do Decyl Sulphate
PFU : Plaque Forming Unit
SM buffer : Sodium magnesium
EDTA : Ethylene Diamine Tetra Acetic acid
SEM : Scanning Electron Microscopy
% : Per cent
0C : Centigrade / degree Celsius
NaCl : Sodium chloride
MgSO4 : Magnesium sulphate
HCl : Hydrochloric acid
et al. : And associates or co workers
xi
ACKNOWLEDGEMENT
I am very much fortunate and privileged to receive guidance and help from my major
advisor, DR. A. JAGADEESH BABU, Associate Professor & Head, Department of Veterinary
Public Health and Epidemiology, College of Veterinary Science, Tirupati, for his genuine co-
operation, guidance, encouragement and moral support from the initiation of the work to the ship-
shaping of the manuscript. I express my wholehearted indebtedness to him for his interesting
ideas and discussions that were profoundly fruitful. I consider myself fortunate to have worked
under him. I sincerely thank him for his transcendent suggestions and efforts to embellish this
research. The present work bears at every stage the impression of his work counsel, sustained
interest, careful and seasonal criticism and meticulous attention to details, for without his
guidance and valuable suggestions, this work could not have seen the light of the day. It was
indeed a rare privilege for me to work under his unending inspiration and indomitable spirit.
I deem it my honor to express my sincere thanks to Dr. N. KRISHNAIAH, Professor &
Head, Department of Veterinary Public Health and Epidemiology, College of Veterinary Science,
Rajendranagar, Hyderabad, for his valuable advice, inspiration, constant encouragement and
deliberate counsel during the course of investigation and execution of the thesis and moral
support to complete of research work.
I would like to place on records my heartfelt thanks to Dr. P. KALYANI, Assistant
Professor of Department of Veterinary Biotechnology, College of Veterinary Science,
Rajendranagar, Hyderabad and, member of my advisory committee, for their sumptuous
suggestions, generous help, affectionate guidance, constant encouragement and deliberate
counsel during the course of investigation and execution of the thesis.
I express my profound thanks to Dr. SUJATHA SINGH, Assistant Professor of
Veterinary Public Health and Epidemiology, college of veterinary science, Rajendranagar,
Hyderabad, DR. C. S. SWETHA, DR. A. SUPRIYA, Assistant Professor of Veterinary Public
Health and Epidemiology, College of Veterinary Science, Tirupati and DR. A. VIJAY KUMAR,
Assistant professor of Veterinary Public Health and Epidemiology, college of Veterinary Science.
Korutla, for their help and kind cooperation during my course of work. Their scientific acumen,
critical judgments and trust in my abilities has motivated me throughout the course of this
investigation and compilation of manuscript.
I am also thankful to Dr. D. Sreenivasulu, Professor and Head, Department of Veterinary
Microbiology and Dr. R. Venu, Associate Professor of Veterinary Parasitology, college of
Veterinary Science, Tirupati, for their kind cooperation during my course of work.
I am also thankful to Dr. P. Anusha, CTF, Department of Veterinary Public Health and
Epidemiology, college of Veterinary Science, Rajendranagar, Hyderabad.
xii
Inexplicable sense of reverence to my father, Sri. S. Prathap Goud, who in my life has
urged me on by way of his untiring support and seemingly unlimited belief in me and my mother,
Smt. S. Anasuyamma, who had always dreamt of my success and for her assiduous efforts in
shaping my life. They constantly educated, guided and moulded me into the present position and
whose boundless love, unparalleled affection, encouragement and moral support is a constant
source of motivation for me. I owe much to my beloved sister’s smt. Sujatha and smt. Anuradha
and brother-in-laws Mr. Suresh and Mr. Naresh, whose inspiring words and encouragement
rendered throughout my career.
From the inner core of my heart, I express my deep sense of gratitude to my colleagues,
Dr. Shylaja, Dr. Swapna, and Dr. Prasanthi, for their kind help and cooperation during the
entire research work throughout these two years.
I am very glad to acknowledge the encouragement, support and help offered by my
seniors Dr. Ramya, Dr. Rajesh Sahu, Dr. Subash, Dr. Praveen Kumar, Dr.Deepak,
Dr.Venkateshwar rao and Dr. Reshma. I also thank my junior colleagues Dr. Monika, Dr.
Sireesha and Dr. Gopi Reddy.
I owe my humble and heartfelt thanks to my friends Dr. Mary, Dr. Mahesh, Dr.
Raghavendra, Dr. Vamsi Krishna Yadav, Dr. Saleem Shabaz and my school friends for their
encouragement and support showed on me during my research period and cheering me up in my
bad times. Thank god for introducing these gifted people in my life.
I express my deep sense of gratitude to my TEACHERS, who teached me till date.
I thank the officials of P. V. NARASIMHA RAO TELANGANA VETERINARY
UNIVERSITY, HYDERABAD for providing all the necessities during my course work.
I thank the officials of SRI VENKATESWARA VETERINARY UNIVERSITY,
TIRUPATI for providing financial and all the necessities during my investigation.
I would like to extend my thanks to Non-teaching staff of Department of Veterinary Public
Health and Epidemiology, College of Veterinary Science, Hyderabad, and Tirupati for their help
in meticulous preparation of this manuscript. I apologize to all the wonderful people I have
missed of course I am indebted to all of them who did their best to improve my best.
(SANEM SOMA SEKHAR GOUD)
xiii
DECLARATION
I, Mr. SANEM SOMA SEKHAR GOUD (RVM/14-003) here by declared
that the thesis entitled “ISOLATION AND CHARACTERIZATION OF LYTIC
BACTERIOPHAGES AGAINST ESCHERICHIA COLI ISOLATED FROM
DAIRY FARM SEWAGE” submitted to P. V. Narasimha Rao Telangana Veterinary
University for the degree of MASTER OF VETERINARY SCIENCE is a result of
original research work done by me. It is further declared that the thesis or any part of
thereof has not been published earlier in any manner.
Date: (SANEM SOMA SEKHAR GOUD)
Place: Hyderabad
xiv
NAME OF THE
AUTHOR
: SANEM SOMA SEKHAR GOUD
TITLE OF THE
THESIS
: ISOLATION AND CHARACTERIZATION OF LYTIC
BACTERIOPHAGES AGAINST Escherichia coli
ISOLATED FROM DAIRY FARM SEWAGE
DEGREE TO WHICH
IT IS SUBMITTED
: MASTER OF VETERINARY SCIENCE
FACULTY : VETERINARY SCIENCE
DISCIPLINE : VETERINARY PUBLIC HEALLTH AND
EPIDEMIOLOGY
MAJOR ADVISOR : Dr. A. JAGADEESH BABU
UNIVERSITY : P.V. NARASIMHA RAO TELANGANA VETERINARY
UNIVERSITY
YEAR OF
SUBMISSION
: 2016
ABSTRACT
The present study was undertaken in developing alternatives to the antibiotics and
one such alternative is lytic bacteriophage against Escherichia coli isolated from sewage
and waste water samples. A total of 128 sewage samples were collected from organized,
unorganized dairy farms and also from animal sheds of small farms and isolated E. coli.
All the 128 isolates were confirmed as Escherichia coli by subjecting them to various
biochemical tests. The isolates were streaked on SMAC plates, which revealed that none
of the isolates have shown colourless colonies but 108 isolates have shown pink colonies.
Antibiogram pattern was studied for the isolates using 14 antibiotic discs, which
revealed varying degree of resistance to ampicillin (92.19%), penicillin-G (76.56%),
cefotaxime (71.10%), streptomycin (64.84%), gentamicin (64.06%), chloramphenicol
(57.81%), tetracycline (54.69%), cefoperazone (51.56%), ofloxacin (44.53%), cefadroxil
(39.06%), ciprofloxacin (38.28%), azithromycin (30.40%), meropenem (27.34%) and
tigecycline (20.31%).
xv
PCR assay was standerdized for detection of STEC using primers derived from
stx1, stx2, eaeA and hlyA genes. The PCR assay revealed that out of 28 samples from
organized dairy farms one (3.57%) was positive for stx1 gene, Out of 32 samples from
unorganized dairy farms, two (6.25%) samples were positive for STEC, of which one
(3.13%) carried stx1 gene and another (3.13%) carried stx1, stx2 and eaeA genes. Out of
68 samples from the animal sheds, eight (11.76%) samples were for STEC by PCR
method. Among the eight STEC, three (4.41%) samples carried stx1, four (5.88%)
samples carried stx2 and another one (1.47%) sample carried both stx1 and stx2 genes.
Bacteriophages isolated from dairy sewage and waste water samples against the
Escherichia coli, phages produced clear plaques on the TSA plates, which were discrete,
clear, circular plaques of diameter 0.1 to 3 mm.
Physico-chemical characterization of phages was carried out by subjecting them
to heat, sunlight, U V light, SDS, phenol, chloroform and formalin at different time
intervals. The phages were completely reduced when exposed at 400C for a period of 3 h,
whereas at 600C within 30 min. Complete reduction in the phage titre was noticed when
exposed to direct sunlight and U.V light for a period of 3h and 5 min respectively. The
phage concentration was completely reduced when exposed to 1% SDS, 0.1% SDS, 1%
phenol, 5% phenol, 5% chloroform, 10% chloroform and 40% formalin within a period
of 15 min, 15 min, 30 min, 15 min, 3 min, 5 min and 15 min respectively. The phage
DNA was isolated and subjected to restriction enzyme digestion analysis with EcoRI
enzyme and found that the bands formed by the phages were below 48.5 kb. The SEM
observations of phage revealed that the phage had icosahedral head with short tail. It was
found that based on morphology the phage exhibited non-contractile tail and belong to
the order Caudovirales and family Podoviridae. The invitro experiment showed that there
was a 100% reduction in the E. coli count after 10 h of incubation. All these elements
suggest that phages could be useful as natural antimicrobials against Escherichia coli.
1
CHAPTER I
INTRODUCTION
The world Health Organization (WHO) estimated that 5 million children die each
year as a consequence of acute diarrhoea (Snyder and Merson, 1982). Enteric bacteria
like Escherichia coli, shigella sps, salmonella sps, enterotoxigenic Escherichia coli
(ETEC), etc. (William et al., 2008) infect gastrointestinal tract of humans and animals.
Sewage from animal farms and wastewater streams are the major sources of these enteric
pathogens (Rene et al., 2007). The most common cause of worldwide food and water
borne human diarrhoea is ETEC. Due to ETEC in developing countries 650 million cases
per year of enteric diseases occur which result in 800,000 deaths (Susan et al., 2006).
Escherichia coli is the cause of a third of cases of childhood diarrhoea in developing and
threshold countries (Albert et al., 1995) and is also the most prominent cause of diarrhoea
in travellers to developing countries (Black, 1990). E. coli is also prominently associated
with diarrhoea in pet and farm animals. Due to its malleable genetic character, E. coli has
one of the widest spectra of disease of any bacterial species (Donnenberg, 2002). The
recent emergence of E. coli O157 as a major food pathogen is a lively reminder of its
dynamic character and also the emergence of antibiotic resistance among these
microorganisms.
Antibiotic-resistant pathogens constitute a worsening global health problem
exacerbated by interconnected travel, antibiotic overuse, horizontal gene transfer, and
bacterial evolution. New classes of antimicrobials are needed to treat these pathogens but
the drug development pipeline is dry (Walsh, 2003). As a result, there has been a renewed
interest in alternative antimicrobial treatments, including bacteriophages, antimicrobial
peptides and proteins, and nanoparticles. The discovery of bacteriophage particles that
seemed to ‘eat bacteria’ is generally attributed to Twort (1915) and D’Herelle (1917) in
2
the early 20th century. The therapeutic potential of ‘phages’ – members of the kingdom
of viruses and obligate predators of bacteria – was recognized soon thereafter and applied
for several decades before the discovery and widespread adoption of antibiotics
(Sulakvelidze et al., 2001).
Bacteriophages are viruses which range from 24-200 nm in size; infect bacterial
cells (Al-Mola et al., 2010). These are the obligate intracellular parasites which infect
bacteria, seize their replication machinery, replicate into thousands of new progenies and
lyses the cell for escape (Gu et al., 2012). Phages are the most abundant entities on earth,
(1030 to 1032) and help in regulating microbial balance in environment. In 1971, a
Canadian scientist, Felix d Herelle at Pasteur Institute of Science accidentally came across
phages as Fleming came across penicillin (Lawrence Broxmeyer, 2004). Phages lack their
own metabolic machinery and hence require bacterial host for replication. Phages are
highly host specific and can infect a specific species or strain of bacteria. But there are
some exceptions, like listeria A511, which can infect entire genus (Martin et al., 1993).
Like all viruses, genome of bacteriophages consist of nucleic acid (RNA or DNA)
surrounded by a protein coat, capsid. Capsid is made up of morphological subunits
capsomeres. These capsomeres are comprised of protein subunit protomeres. Some
phages also contain additional structures such as tail and fibres (Grabow, 2000). The
receptors on the host cell are recognized by the phage tail fibers. After adsorption phage
DNA will be incorporated into host cell, whereas capsid remains outside the cell. Host
cell envelope is weakened by lysozyme activity of tail base plate of phages (Hilla Hadas
et al., 1997). Inside host cell, gene expression and morphogenesis occur. New virion
progenies are produced and lyse the bacterial cell. Depending on the life cycle pattern,
bacteriophages are of two types, lytic or lysogenic. Lytic phages typically proceed with
replication immediately after infecting the host cell and new viruses are released in large
numbers by lysis of the host cell. Lysogenic phages integrate their nucleic acid into the
3
host cell where it remains until induced to become autonomous again and start replication
and cell lysis (Raghu et al., 2012).
The clinical use of phage therapy is faced with long product development and
approval timelines in Western regulatory frameworks. As a result, many companies and
researchers have pursued food safety, agricultural, industrial, and clinical diagnostic
applications instead. Several companies have successfully developed phage-based
products with EPA, USDA, and FDA approval. Such products have established a
favourable regulatory precedent in which individual components of phage cocktails can
be tailored towards bacterial targets. Products targeted at Listeria monocytogenes
represent one of the first examples of phage cocktails to obtain Generally Recognized As
Safe (GRAS) status from the FDA. These products are designed to be used as sterilizing
agents for processed foods (ListShieldTM and LISTEXTM P100). Another approved
product treats crop pathogens such as Xanthomonas campestris pv. vesicatoria and
Pseudomonas syringae pv. tomato (Omnilytics’ AgriphageTM). Further products are in
development against other bacterial pathogens, including Escherichia coli strains
(O157:H7) and Salmonella enterica (Abuladze et al., 2008)
Keeping in view of the public health significance of Shiga Toxin producing
Escherichia coli the work has been designed to study the isolation and characterization
of Shiga Toxin producing Escherichia coli and their specific phages present in the same
environment to develop new strategy for generalized control of bacterial populations,
especially pathogens in waste water that come out from animal farms with the following
objectives
1. Isolation, identification and molecular characterization of E. coli from the dairy
farm sewage.
2. Isolation and characterization of strongly lytic bacteriophages against the E. coli
isolated from the dairy farm sewage.
4
CHAPTER II
REVIEW OF LITERATURE
2.1 Escherichia coli
Escherichia coli (E. coli) belongs to the family Enterobacteriaceae, which is a
Gram negative, robust, facultatively anaerobic, motile, non-sporulating, rod shaped
bacteria (Vogt and Dippold, 2005). The bacterium was previously discovered by Theodor
Escherich, a German paediatrician in the year 1885 from the faecal sample of healthy
individual and named it as Bacterium coli because of the fact that it was found in the
colon. Early prokaryotic classification placed Bacterium coli in a genera based on their
motility and shape. Afterwards Emst Haeckel’s bacterial classification placed this
bacteria in the Kingdom Monera (Escherich, 1885). In 1895 Migula reclassified this
bacteria in the genus Escherichia which was named so after its discoverer (Castellani and
Chalmers, 1919). This genus belongs to the bacterial group formally called “coliforms”
which are the members of the “the enterics” known as Enterobacteriaceae family (George
and Garrity, 2005).They are the normal component of the microflora in the intestine of
warm-blooded organisms. Most of the E. coli strains inhabiting intestines of humans and
animals are harmless (Hartl and Dykhuizen, 1984). However, some E. coli strains such
as E. coli O157:H7, can make people sick, causing severe stomach cramps, diarrhoea and
vomiting (PHAC, 2015). The types of E. coli that can cause diarrhoea may be transmitted
through contaminated water or food, or through direct contact with animals or persons
(CDC, 2012).
Pathogenic E. coli represents a phenotypically and genotypically diverse group of
pathogens and there is no single method to enrich and to isolate for the various pathotypes
that exist. However, current evidence indicates that pathogenic E. coli strains are more
than one type. E. coli has been subdivided into six groups based on their ability to produce
5
toxins, to adhere and to invade epithelial cells (Kornacki and Marth, 1982; Doyle, 1991;
Donnenberg and Whittam, 2001). They are enterotoxigenic E. coli (ETEC),
enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterohemorrhagic E.
coli (EHEC), enteroaggregative E. coli (EAEC) and diffuse-adhering E. coli (DEAC),
among them EHEC is considered as most important one.
2.2. Enterohemorrhagic E. coli (EHEC)
In 1983, an E. coli strain serotype O157:H7, was identified in association with
outbreaks of bloody diarrhoea called hemorrhagic colitis (HC) leading to the recognition
of EHEC as a new and increasingly important class of enteric pathogens causing intestinal
and renal disease (Nataro and Kaper, 1998). The term enterohemorrhagic E. coli (EHEC)
is applied to those STEC serotypes that have the same clinical, epidemiological and
pathogenic features associated with the prototype strain E. coli O157:H7.
EHEC strains produce verocytotoxin or shiga like toxin, encoded by stx1 and stx2
and are referred as shiga toxin producing E. coli (STEC) or verotoxins producing strains
of E. coli (VTEC). Human infections with STEC can be variable from a simple or watery
diarrhoea to hemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS) (WHO,
1998). These cytotoxins are active on vero cells, known as verocytotoxins and they were
first described by Konowalchuk et al. (1977). Epidemiological evidence shows that
O157:H7 is the important serotype among the variety of EHEC serotypes, which have
been implicated in human foodborne diseases (Martinez-Freijo et al., 1999). The STEC
serogroups associated with human diseases are numerous and include O1, O2, O4,
O5,O6, O22, O23, O26, O38, O45, O48, O50, O55, O73, O75, O91, O100, O103, O104,
O105, O111, O113, O114, O115, O117, O118, O119, O121, O125, O126, O128, O132,
O145, O153, O163, O165, and O166, as well as untypeable isolates (DebRoy et al., 2004;
Heijnen and Medema, 2006; Erickson and Doyle, 2007; Lin et al., 2011). The toxins viz:
6
stx1 and stx2 have shown 55% of homology genetically and these toxins were
immunologically not cross reactive (Karmali, 1989), stx1 is genetically and
immunologically related to the shiga toxins produced by the Shigella dysenteriae type 1
strains (Jackson, et al., 1987). Interestingly, stx2 strains appear to be more commonly
responsible for HUS than those producing only stx1 (Kleanthous et al., 1990).
Among STEC serotypes, O157:H7 is associated with both outbreaks and sporadic
cases of severe disease, but it has been shown that other serotypes may also cause human
infections albeit variably (Coombs et al., 2011). This quantitative and qualitative
difference in disease association among STEC has given rise to various classification
schemes the simplest of which divides STEC into E. coli O157 and non-O157. However,
in view of the fact that the virulence potential of non-O157 might be genetically
determined a seropathotype (SPT) classification has been proposed in which prior
association with human epidemics, HUS and diarrhoea is considered (Coombs et al.,
2011). In this scheme, SPT-A includes O157:H7 and O157:NM, the most commonly
isolated serotypes from outbreaks and HUS. SPT-B strains differ from group A in the
frequency of isolation from outbreaks and HUS cases, SPT-C strains are only associated
with sporadic cases of HUS, SPT-D are isolated from diarrheal cases and have not been
encountered in outbreaks or HUS and SPT-E that have never been associated with human
disease (Karmali et al., 2003). Furthermore, data collected by using different methods of
comparative genomic have suggested that several discreet genotypes differing in
virulence exist within E. coli O157:H7 population and based on these data this serotype
has been subdivided into nine clades (Zhang et al., 2007; Manning et al., 2008).
2.3. GROWTH REQUIREMENTS
The environmental factors such as temperature, water activity (aw), pH and food
composition will influence the survival and growth of E. coli. The optimal temperature
7
for multiplication of E. coli is 37°C or 98.6°F but some of the laboratory strains can grow
up to 49°C (Fotadar et al., 2005), although there have been reports of some ETEC strains
growing at temperatures as low as 4°C. For the growth of E. coli, a near neutral pH is
optimum but the growth is possible even below pH 4.4. For growth of E. coli minimum
aw required is 0.95 (Adams and Moss, 2008). Multiplication can be driven by utilizing a
large number of redox pairs involving reduction of substrates like oxygen, fumerate,
trimethylamine N-oxide and dimethyl sulfoxide plus oxidation of substances like formic
acid, pyruvic acid and hydrogen (Ingledew and Poole, 1984).
Heat resistance of E. coli in foods is depended on the composition, pH and aw of
the food. The heat resistance of E. coli increases as the aw decreases. Also, E. coli is more
resistant to heat when it is in its stationary phase of growth compared to its log phase of
growth (Desmarchelier and Fegan, 2003). Low temperature has little effect on E. coli
survival.
STEC required an optimum temperature of 37°C for growth (ranging from 7°C to
50°C) but destroyed at 70°C by cooking (WHO, 2011). E. coli O157:H7 grows poorly at
temperatures above 44-45°C and these temperatures are often used for the detection of E.
coli in food samples, these conditions probably shows a negative impact on the recovery
of this serotype (Hui et al., 2001). The serotype O157:H7 is highly acid resistant food-
borne pathogen that survives in the acidic environment of stomach and colonise in the
gastrointestinal tract (Price et al., 2004). The doubling time of Escherichia coli O157:H7
increases by three fold in 4.5% NaCl in broth whereas at 6.5% a 36 h lag was noted with
a generation time of 31.7 h and no growth occurred at ≥ 8.5% NaCl (Jay, 2000).
2.4. Significance of E. coli on the health of animals and human beings
2.4.1. Human beings
STEC related disease may involved either sporadic cases or large outbreaks
involving a common contaminated food source. In some cases individuals infected with
8
STEC may be asymptomatic, even though large numbers of organisms and free toxins
were found in the faecal samples of the individuals (Edelman et al., 1988; Brian et al.,
1992). Most of the infected individuals may suffer with watery diarrhoea initially but in
some cases this is progressed to bloody diarrhoea within one to two days and
haemorrhagic colitis (HC) (O’Brien et al., 1983; Riley et al., 1983; Riley, 1987). Also
frequently reported the severe abdominal pain. In a proportion of individuals, infection
progresses to haemolytic-uremic syndrome (HUS) and thrombocytopenia (Karmali et al.,
1983; Karmali et al., 1985).
2.4.1.1 Haemorrhagic colitis (HC)
Haemorrhagic colitis was first seen in 1982 in Oregon and Michigan, as a food
borne disease. It was associated with eating of sandwiches at a fast-food restaurant that
contained undercooked ground beef. All 43 individuals had bloody diarrhoea and severe
abdominal cramps, with 63% experiencing nausea, 49% vomiting, fever only in 7% of
the patients. The mean incubation period was 3.8-3.9 days and symptoms lasted for 3 to
more than 7 days (Riley et al., 1983).
Mead and Griffin, (1998); Tarr et al. (2005) reported that over 70% of the patients
developed bloody diarrhoea (HC) within one to three days and after onset though lower
frequencies have also been reported. The amount of blood in faeces varies from traces to
almost entirely blood.
The right side colonic inflammation in patients with STEC infection was observed
by using barium enema or colonoscopy by Pavia et al. (1990).
The shedding of E. coli O157:H7 in children has a median duration of 13 days
(range 2 to 62 days) in patients with diarrhoea (HC) and 21 days (range from 5 to 124
days) in patients with HUS was reported by Pennington, (2010).
9
2.4.1.2. Haemolytic-uremic syndrome (HUS)
HUS is a life-threatening sequelae, characterized by acute renal failure,
thrombocytopenia and microangiopathic haemolytic anaemia (Karmali et al., 1985).
Some individuals were experienced neurological symptoms including lethargy, severe
headache, convulsions and encephalopathy (Tesh and O’Brien, 1991). Death in acute
phase due to renal failure, severe hypertension, myocarditis, or neurological disease
(Robson et al., 1993).
The incidence of HUS is higher in infants, young children and elder peoples, even
though occurred in all age groups and it is the major cause of acute renal failure in
paediatric population (Karmali, 1989). It is because of immunological naivety in young
children and declining immune system function in the elder peoples. Improved clinical
management and paediatric renal dialysis techniques have reduced the mortality from
about 50% to less than 10% over the last two to three decades (Karmali, 1989).
Richardson et al. (1992) reported that invivo experiments with purified stxs have
reproduced the syndrome HUS, with damage to the intestine, kidney and CNS in rabbits
and mice.
The largest outbreak of E. coli O157 from ground beef was reported in four
western states in January 1993, involving more than 700 persons, mostly children. Among
the infected persons, more than one quarter were hospitalized, 7.5% of patients developed
HUS and four children died (Bell et al., 1994; Tuttle et al., 1999).
In 1995, CDC, Atlanta reported that in 1994, an outbreak of E. coli O157:H7 at
Washington and California, HUS was developed in 13% among the 23 persons involved
and epidemiological investigation revealed that eating of commercially distributed dry-
cured salami product was the reason of an outbreak.
Lopez et al. (1989) reported that in Argentina and Uruguay, E. coli infections are
endemic and shiga toxin HUS is a common cause of acute renal failure in children.
10
Centres for Disease Control and Prevention (CDC) estimations indicted that E. coli
O157:H7 is responsible for approximately 62,500 cases annually in the United States due
to food borne infection, which are largely associated with cases of paediatric HUS and a
leading cause of renal failure in children (Sanchez et al., 2002).
Karpman et al. (1998) conducted the study on the apoptotic cell death associated
with shiga-like toxin (stx) producing E. coli and revealed that renal cortices from children
with postenteropathic HUS and from mice infected with E. coli O157:H7 and paediatric
renal tubular epithelial cells stimulated with stx and E. coli extracts were examined for
apoptotic changes and were detected by terminal dUTP nick end labelling of tubuli and
glomeruli from HUS patients and from mice inoculated with stx2 positive and stx-
negative strains. Apoptosis was more extensive and severe ultramorphological nuclear
and cytoplasmic changes were seen in the stx2 positive group.
Rangel et al. (2005) reported that from 1982 to 2002, a total of 350 outbreaks,
accounting 8,598 cases of E. coli O157 infections were reported from 49 states of United
States. Among them, 354 (4.1%) cases of HUS and 40 (0.5%) deaths were reported.
Rivas (2009) conducted an investigation on HUS in children and reported that
Argentina had the highest incidence rate of HUS in children ≤ 5 years old (15 per 100,000
population).
Kiranmayi et al. (2010) worked on E. coli O157:H7 and reported that Escherichia
coli O157:H7 strains carrying stx2 gene along with enterohaemolysin gene are potentially
dangerous to human health and E. coli strains producing stx2 are appear to be more
commonly responsible for serious complications such as HUS than those producing only
stx1.
2.4.1.3. Thrombotic thrombocytopenic purpura (TTP)
STEC infection can also result in a variant form of HUS, referred as Thrombotic
thrombocytopenic purpura (TTP). The diarrhoea associated TTP is more common in
11
adults than in children but it differ from HUS, in that patients are more often febrile and
have marked neurological involvement (Morrison et al., 1985; Karmali, 1989) with
mortality rate as high as 50% (Griffin, 1995).
2.4.2. Animals
Cattle considered as the main reservoir for E. coli O157:H7 serotype, but sheep
are also considered as a significant source to human infections (La Ragione et al., 2009).
E. coli O157:H7 was also isolated from goats (Pritchard et al., 2000) and water buffaloes
(Conedera et al., 2004). STEC O157:H7 has been isolated from wild ruminants, are act
as a potential reservoir. The serotype O157:H7 has been isolated from wild deer (Renter
et al., 2001). Rarely, this bacteria has isolated from non-ruminant species like horse, dog,
rabbit, seagull, starling, wild boar and rat (jay et al., 2007; Wetzel and Lejeune, 2006)
and are not considered as hosts, but rather as vectors transiently colonized by the
bacterium following contact with ruminant faeces (Caprioli et al., 2005).
Studies have shown that up to 30% of all cattle are asymptomatic carriers for the
serotype E. coli O157:H7 (Callaway et al., 2006)
Boqvist et al. (2009) reported in 1996, in Sweden the survey to found the
prevalence of E. coli O157:H7 in slaughtered cattle was initiated and reported that 3,071
faecal samples collected between April, 1996 and August, 1997 and among them 37
(1.2%) faecal samples were positive for STEC.
Dean-Nystrom et al. (1997) worked on E. coli O157:H7 and reported that
experimentally produced infection with high doses of serotype O157:H7, causing
diarrhoea in neonatal calves with A/E lesions. Hancock et al., 2001 reported that cattle
normally harbour E. coli O157:H7 without showing signs of disease.
Grauke et al. (2002) worked on E. coli O157:H7 and reported that it has been
isolated from the entire gastrointestinal tract of bovines viz., from oral cavity to the
rectum, but lower part of the digestive tract is considered as more prevalent part of STEC.
12
Naylor et al. (2003) reported that the terminal rectum, 5 cm proximal to the rectal anal
junction (RAJ) in cattle is considered as the primary site for colonization of STEC and
this region also referred to as terminal mucosa. Nart et al. (2008) informed that the
bacteria E. coli O157:H7 attaches and forms microcolonies and A/E lesions in the
terminal mucosa. Low et al. (2005) and Cobbold et al. (2007) reported that colonization
of E. coli O157:H7 in the terminal mucosa has been correlated to high shedders.
Barkocy-Gallagher et al. (2003) reported that hides from cattle can also be
contaminated with O157:H7 and these are considered to be more important source of
carcass contamination than faecal matter at slaughter. Further his research has indicated
that the number of hides positive for E. coli O157:H7 is a more accurate predictor for
carcass contamination than is faecal prevalence.
Nart et al. (2008) revealed that the rumen, small intestine, proximal colon and in
particular a region of lymphoid-rich tissue immediately distal to the ileo-caecal valve of
the bovine digestive system, are identified as the minor site of VTEC O157:H7carriage.
Cornick et al. (2000) reported that STEC strains are better adopted for
colonization and persistence than other pathotypes of E. coli and also found that there is
no consistent differences among the pathotypes in the frequency, magnitude and
transmissibility of colonization in sheep and also reported that the STEC strains tend to
persist to two weeks and two months post-inoculation more frequently than other
pathotypes.
Dean-Nystrom et al. (2000) worked on VTEC and reported that neonatal piglets are
infected artificially with high doses of VTEC O157:H7 has induced severe disease and
A/E lesions.
Kolling and Matthews (2001) studied about the virulence of E. coli O157:H7 and
revealed that mice which were orally challenged with starvation-induced non-culturable
cells (FO46) or chlorine-induced non-culturable cells (43895 and FO46) and found that
13
non-culturable cells were not recovered from the faecal samples but mouse kidney were
receiving the cells and assayed for the presence of shiga toxin using the vero cell assay
and suggested a loss of virulence.
Booher et al. (2002) reported that experimental studies shown that pigs have no
innate resistance to colonization and can serve as a reservoir host, under suitable
conditions and further he reported that three month old pigs have been colonized after
receiving an infectious dose of 1010 CFU and shed the bacterium for up to 2 months.
Jordan et al. (2005) worked on colonization of E. coli O157:H7 and informed that
it has been demonstrated that, intimin is not necessary for persistent colonization in pigs.
2.5. EPIDEMIOLOGY
Doyle et al. (2006) worked on the epidemiology of STEC and reported that many
outbreaks of STEC O157 were recorded from the various countries in the past two
decades. In the early 1990s with more than 700 cases, an outbreak was occurred in the
western US and noticed three deaths, which was due to the consumption of undercooked
hamburger meat (ground beef), further he also reported that in 1996, an outbreak of STEC
O157:H7 was identified in Scotland and a total of 512 people were infected and 17 deaths,
were because of contaminated meat products and also another outbreak of O157:H7 was
occurred massively in Sakai city, Japan in the year 1996 and more than 10,000 people
were affected after white radish sprouts had been served at school canteens and resulted
in 12 deaths.
Hauswaldt et al. (2013) reported that a HUS outbreak with 501 cases, 151
hospitalization and 45 cases, in 1993 in US and was due to consumption of undercooked
hamburger at fast food restaurants. Epidemiological studies of CDC, 1996-2012 revealed
that STEC had been put under surveillance in the US, since 1996 and the reported
incidence rate was decreased from 1996 (0.91 to 2.62 per 100,000 people) to 2012 (1.12
per 100,000 people), whereas the incidence rate of STEC non-O157 was continuously
14
increased (ranged from 0.16 to 1.16 per 100,000 people) since it was put under
surveillance in 2000. CDC, 2011 reported that the incidence of STEC was peaked in
summer. Doyle et al. (2006) reported that in 2000 in Wisconsin, US there was an outbreak
of E. coli O157:H7 infection due to contaminated meat products and it results in 788 cases
with one death.
Jiao Yong et al. (2009) revealed that in 1999 to 2000, two waves of large
outbreaks of E. coli O157:H7 were occurred in China in three neighbouring provinces
viz., Jiangsu, Anhui and Henan and this outbreak was resulted in 208 deaths among the
thousands of the cases.
Doyle et al. (2006) reported that the massive outbreaks of STEC O157 had been
reported in 1995, 1999 and 2000 in Scotland, New York and Canada (Walkerton) with
633, more than 1000 and 2300 cases respectively and the source of these outbreaks was
identified to be due to water contamination.
Lim Esther et al. (2012) worked on STEC and reported that in New Zealand, the
incidence of STEC showed a significant increase since 2002 and a small peak was
observed in 2003 and highest incidence rate was found in 2011 (3.5 cases per 100,000
population).
The large outbreak of STEC O111: NM was identified in rural Oklahoma (buffet-
style restaurant), in August 2008. Totally 70 patients were hospitalized out of 341 cases
of gastroenteritis, among them HUS was developed in 25 patients and one died. The
epidemiological study was evidenced that cross-contamination of restaurant food from
food preparation equipment or surfaces, or from an unidentified infected food handler
(Bradley et al., 2012).
European Centre for Disease Prevention and Control, (2012) revealed that during
2002 to 2012, the incidence of STEC O157 infection in Canada was significantly
decreased from 3.80 to 1.39 per 100,000 people over a period from 2002 to 2012 whereas,
15
in case of EU countries the incidence of STEC was increased from 2006 to 2009 and
remained stable in 2010 and the reported rates ranged from 0.77 to 0.96 per 100,000
population. Further they reported that highest rate of incidence, 4.41 per 100,000
population was reported by Ireland in 2010, followed by Sweden (3.58 per 100,000
population) and Denmark (3.22 per 100,000 people) and more cases were reported in
summer similar to US.
Rangel et al. (2005) worked on epidemiology of E. coli O157:H7 in United States
and revealed that twenty four multistate E. coli O157 outbreaks were reported since 1992
and ranged from one to three per year, but in 1999, six were reported. Two to eight states
with a median of three were involved in these outbreaks and these outbreaks were due to
foodborne transmission (16 from ground beef and 6 from produce).
Conedera et al. (2007) reported that pork salami (meat from pigs) is the source of
outbreak in Italy, in 1994 and where two adults contracted bloody diarrhoea.
OzFoodNet Working Group, (2012) reported that the incidence of 0.4 cases per
100,000 population had been reported in Australia in 2010, which is comparable or lower
than other developed countries.
Vally et al. (2012) studied the epidemiology of STEC and reported that the
distribution of STEC infection was seasonal with a larger population of reported cases
occurring in the summer months and lower in winter.
2.6. ISOLATION AND IDENTIFICATION OF ESCHERICHIA COLI
2.6.1. Conventional/ culture methods
For isolation of any bacteria conventional method is still the only absolute method
for establishing the infection status. Isolation from a single animal is sufficient evidence
to establish the infection status of a herd and is considered to be the gold standard test.
But the isolation and identification of the non-STEC E. coli pathotypes are difficult due
to lack of a medium that can be used to enrich or to isolate a specific strain.
16
Zinnah et al. (2007) collected ten different biological (human faeces, and urine,
rectal swab of cattle, sheep and goat, cloacal swab of chicken, duck and pigeons) and
environmental samples (drain sewage and soil) and they were subjected to primary
isolation by propagating in nutrient broth followed by culture on different medias viz.
MacConkey agar, Brilliant green agar and EMB agar and observed the characteristic
colony morphology of bright pink colour, yellowish green colonies surrounded by an
intense yellow green zone and metallic sheen colonies respectively.
Bhat et al. (2008) collected faecal samples from the lambs and were immediately
inoculated on Mac Conkey’s agar and Eosin Methylene Blue agar and observed lactose
fermenting colonies and metallic sheen colonies respectively and for further confirmation
the isolates were subjected to biochemical tests.
Esseili et al. (2008) obtained water samples from Lake Eric Beach in Maumee Bay
State Park and were filtered through sterile nitrocellulose membrane and transferred the
membranes to modified m-TEC agar for isolation of E. coli and the isolates were
transferred to EMB agar.
Singh and Prakash, (2008) used the lactose broth as enrichment medium for E. coli
and the inoculum was streaked on the Levine Eosin Methylene Blue Agar and observed
typical green metallic sheen and for confirmation of the isolates they conducted various
biochemical tests and various sugar fermentation tests like glucose, mannitol, lactose,
salicin and sucrose.
Oliveira et al. (2009) collected specimens viz. liver, spleen and lung of the infected
commercial birds with typical lesions of colibacillosis for the isolation of Escherichia coli
and the specimens were emulsified in sterile solution of 0.85% NaCl and supernatant was
plated in MacConkey agar and observed the pink-red colour colonies and for further
confirmation used the Analytical Profile Index (API) strips.
17
Kumar and Prasad (2010) used the peptone water for the enrichment and after 24
hours of incubation they streaked on MacConkey Lactose Agar (MLA) and observed the
pink coloured colonies and for confirmation of cultural characteristics i.e. green metallic
sheen again streaked on the EMB agar and subjected the isolates to various biochemical
tests.
Kesava Naidu et al. (2011) inoculated the faecal samples from diarrheic farm
animals, sewage, water from ponds and bore wells, ground beef and meat in Sorbitol
MacConkey’s agar plates with cefixime-tellurite supplements (CT-SMAC agar) for the
isolation of STEC. Sorbitol negative colonies were further tested for the β-Glucoronidase
production, cellobiose fermentation and growth in the presence of potassium cyanide by
standard techniques to differentiate STEC strains from other strains of E. coli as they are
unable to ferment sorbitol and MUG.
Dastmalchi saei and Ayremlou, (2012) collected faecal samples from 2-6months
old healthy and diarrheic calves and resuspended one gram of sample in 10 ml 0.85%
NaCl and the same was inoculated in MacConkey lactose agar plates and observed lactose
positive (rose pink) colonies and they were further streaked on to EMB agar and observed
green metallic sheen colonies produced by E. coli.
Karadeniz et.al. (2012) used water samples from public housing for the isolation of
Escherichia coli by making use of Endo-C agar and it was resulted in colonies with
metallic green sheen and confirmed by using MCA, EMB agars.
Inu Rawal et al. (2013) collected water samples from two of the lakes (Pichhola
and Fateh sagar) of Udaipur city and isolated the E. coli by using the MacConkey agar
and EMB agar and they confirmed them after conducting Gram staining and various
biochemical tests viz. Indole production and citrate utilization.
18
Robati and Gholami (2013) inoculated the samples in EBC medium for enrichment
after incubation for differentiation of sorbitol fermenting and non-sorbitol fermenting E.
coli samples and a loopfull of inoculum was streaked on the Sorbitol MacConkey agar
(SMAC) which was supplemented with Cefixime and potassium tellurite and also for
identification of lactose fermenting E. coli they used EMB and VRBA medium.
Virpari, et al., (2013) used MacConkey broth for the enrichment and the streaking
was carried on MacConkey agar and Eosin Methylene Blue agar, after confirming the
colonies of E. coli they conducted various biochemical tests such as IMViC tests and
urease test.
Bakhshi et al. (2014) isolated the Escherichia coli from stool samples of calves with
diarrhoea by streaking on MacConkey agar and suspected colonies were subjected to
biochemical tests viz. gram staining, oxidase, indole, simmons citrate, urease and
hydrogen sulphide.
Neher et al. (2016) streaked the different samples (faecal, intestinal content, rectal
swab and heart blood of apparently healthy and clinically ill/ dead animals and birds) on
MacConkey’s lactose agar plates and EMB agar plates and observed the lactose
fermenting colonies and metallic sheen respectively.
Panahee and Pourtaghi (2016) collected different samples like minced beef, mutton,
chicken meat, chicken feet and mechanically separated chicken meat aseptically and were
transferred on to MacConkey agar and the suspected colonies were subjected to
biochemical tests for further confirmation.
2.6.2. Biochemical characterization of Escherichia coli
Kobori et al. (2004) determined the E. coli at species level using cytochrome
oxidase, triple sugar iron agar, urea and indole tests.
19
Zinnah et al. (2007) reported biochemical characterization of Escherichia coli as
acid and gas production by fermenting sugars (dextrose, maltose, lactose, sucrose and
mannitol) and gave positive reaction to catalase, methyl red and indole tests whereas
negative reaction to voges-proskauer test and H2S production.
Barati, et al. (2012) performed biochemical tests to confirm the Escherichia coli
and revealed Gram negative, oxidase negative, indole positive, Simon’s citrate negative
and urease negative.
Inu Rawal et al. (2013) conducted the various biochemical tests viz. Gram
staining, indole production and citrate utilization for the confirmation of Escherichia coli.
Jakaria et.al. (2012) reported biochemical characterization of Escherichia coli as
production of acid and gas by fermenting sugars (dextrose, sucrose, lactose, maltose and
mannitol) and gave positive reaction to indole, methyl red (MR) and catalase tests, but
were negative to Voges-Proskauer (VP) test.
Karadeniz et.al. (2012) performed biochemical characterization of Escherichia
coli and revealed that the isolates were motile, catalase, indole and methyl red positive,
urea, Voges-Proskauer, citrate, H2S negative and on TSI agar it produced acid on butt and
slant.
Momtaz et al. (2012) confirmed the Escherichia coli by performing various
biochemical tests viz. TSI, Lysine iron agar (LIA), oxidative/ fermentative degradation
of glucose, citrate utilization, urease production, indole fermentation, tryptophan
degradation, glucose degradation (methyl red test) and motility.
Zakeri and Kashefi, (2012) confirmed the Escherichia coli using TSI, sulphide
indole motility (SIM), methyl red and Voges-Proskauer (MR-VP), and indole and citrate
(IMVIC) tests.
Dutta et al. (2013) conducted various biochemical tests and reported that indole
production and acid slant, butt and no H2S production on the TSI agar.
20
Momtaz and Jamshidi (2013) tested E. coli isolates biochemically for growth on
triple sugar iron agar and Lysine iron agar, oxidative / fermentative degradation of
glucose, citrate utilization, urease production, indole fermentation, tryptophan
degradation, glucose degradation (methyl red test) and motility.
Zende et al. (2013) biochemically tested the isolates of E. coli obtained from
chicken muscles for indole production, glucose degradation, tryptophan degradation,
citrate utilization, urease production and for motility and growth on triple sugar iron agar.
Rasheed et al. (2014) confirmed E. coli by using gram staining, motility and
standard biochemical tests Viz., catalase, oxidase, fermentation of lactose and glucose
and IMViC tests.
Panahee and Pourtaghi (2016) biochemically tested the isolates obtained from
different meat samples and identified as indole and methyl red tests positive, Voges-
Proskauer and citrate utilization test were negative.
2.6.3. Molecular methods (PCR)
Kobori et al., (2004) conducted the studies on the virulence properties of shiga
toxin producing E. coli in milk samples obtained from dairy cows with mastitis and they
reported that 31 samples were positive for E. coli out of 528 milk samples and further
these isolates were subjected to PCR for the detection of different virulence factors of E.
coli and the results revealed that 20 (64.5%) isolates have shiga toxin producing genes,
among them 13 isolates were positive for stx1 and 3 for stx2 and 4 isolates were carried
both stx1and stx2 and 3 (9.6%) isolates of non shiga toxin producing E. coli were also
positive for eaeA gene.
Kumar et al. (2004) used the PCR technique for the detection of stx1 and stx2
genes for the isolates obtained from seafood, beef and a patient with bloody diarrhoea and
the results revealed that the sea food isolates have produced either stx2 or both stx1 and
stx2, beef isolates produced stx1 alone.
21
Paton and Paton (2005) developed a trivalent PCR assay for the detection of the
novel toxin A subunit gene subA, as well as stx1 and stx2 and the three primer pairs used
in the assay do not interfere with each other and generate amplification products of 556,
180, and 255 bp respectively. Further he reported that the assay can be used for
determining the toxin genotype of STEC isolates, as well as for direct detection of toxin
genes in primary faecal culture extracts.
Cho et al. (2006) performed a PCR using Robocycler thermal system for each
agglutination positive isolates to detect virulence marker genes using by specific primers:
stx1, stx2, eae and hlyA and the results revealed that 17 (43%) isolates have both stx1 and
stx2 genes and 21 (53%) strains havestx2 gene only.
Bhat et al., (2008) detected the virulence genes viz., stx1, stx2, eae and ehxA by
multiplex PCR assay and reported that 16 (45.71%) of 35 STEC isolates carried both stx1
and stx2, 15 (42.85%) isolates havestx1 alone and 4 (11.42%) havestx2 alone and they
also reported that one (2.85%) and 28 (80%) of STEC isolates possessed eae and ehxA
genes respectively.
Dhanashree and Mallya (2008) screened the diarrheagenic stool samples and meat
samples for STEC using PCR method and reported that out of 142 biochemically positive
E. coli from stool samples, 110 isolates were positive for only eae gene and two of the
eae positive E. coli stool isolates were carried hlyA genes and none of the eae positive
isolates were positive for stx1 and stx2, whereas among 80 biochemically positive E. coli
from meat samples, 40 were positive foreaeA gene and one of the eae positive isolate
carried all the four genes viz., stx1, stx2, rfb O157, eae and hlyA.
El-Jakee et al. (2009) characterized the isolated E. coli strains from water sources
using virulence genes (hly, fliCh7, stx1, stx2 and eae ) by PCR assay and results revealed
22
that 8 isolates were carried stx1, 4 possessed stx2 genes and also reported that 21.4%,
21.4% and 28.6% of eae, fiCh7 and hly genes respectively.
Bonyadian et al., (2010) detected the shiga toxin-producing E. coli by using the
virulence genes stx1, stx2, hly and eae and the results showed that, out of 58 E. coli
isolates 16 (27.6%) isolates were positive for stx1, 4 (6.9%) isolates carried stx2 and 8
(13.8%) isolates harboured both stx1 and stx2and 12 (20.7%) isolates were positive for
hly and none of the isolate carried eae gene.
Sahilah et al. (2010) examined Escherichia coli O157:H7 from 20 beef samples for
the detection of stx1 and stx2 genes by mPCR and characterized using RAPD-PCR
fingerprinting and revealed that 14 isolates were positive for both stx1 and stx2, 5 isolates
were carried stx1 alone and one isolate was negative for stx1 or stx2 genes.
Bosilevac and Koohmaraie (2011) observed the prevalence and characterization
of non-O157 STEC in commercial ground beef samples, and reported that 7.8% of
samples were positive for only stx1, 53% isolates carried stx2 alone, 41.5% samples were
positive for eaeA gene and hlyA gene was present in 55.5% isolates.
Dutta et al. (2011) screened the phenotypically characterized samples for the
detection of virulence genes stx1, stx2, eaeA and hlyA by multiplex PCR assay and the
results revealed that 24 isolates out of 42, belongs to three serogroups (O64, O89 and
O91) and remaining 18 were recorded as untypable (UT) and further they reported that
altogether, 14 (33.33%) isolates carried at least one virulence gene, of which 10 (23.81%)
and four (9.52%) were recorded as STEC and EPEC, respectively and among the 10
STEC isolates, one carried only stx2, one carried both stx2 and hlyA, four carried stx1,
stx2 and hlyA, two carried stx1, eaeA and hlyA genes and two carried stx1 and eaeA,
among the four EPEC isolates, two carried eaeA and hlyA, one carried only eaeA gene
and one carried only hlyA gene.
23
Botkin et al. (2012) performed multiplex PCR assay for the differentiation of
enterohemorrhagic E. coli (EHEC), shiga toxin-producing E. coli (STEC) and
enteropathogenic E. coli (EPEC) using selected biomarkers associated with each strain’s
respective virulence genotype. They demonstrated consistent amplification of genes
specific to the prototype EHEC O157:H7 EDL933 and EPEC O127:H6 E2348/69 strains
using the optimized multiplex PCR protocol with purified genomic DNA. A screen of
gDNA from isolates in a diarrheagenic E. coli collection revealed that the multiplex PCR
assay was successful in predicting the correct pathotype of EPEC and EHEC clones
grouped in the distinctive phylogenetic disease clusters EPEC1 and EHEC1 and was able
to differentiate EHEC1 and EHEC2 clusters.
Dastmalchi saei and Ayremlon (2012) screened the E. coli isolates by PCR assay
for the presence of virulence genes and reported that among 26 STEC isolates, six
(23.1%) isolates carried stx1 gene, seven (26.92%) isolates possessed stx2 gene and 13
(50%) isolates gave positive amplicon both for stx1 and stx2 and also reported that out of
26 stx positive isolates, seven were positive for eaeA gene and 15 were positive for the
hlyA gene.
Virpari et al., (2013) used PCR technique and analysed the presence of virulence
associated genes and reported that out of 80 E. coli isolates, 25 (31.25%) were positive
for stx genes, of which seven (8.75%) isolates were positive for stx1, 12 (15%) isolates
have stx2 gene alone and five (6.25%) isolates carried both stx1 and stx2 genes and seven
(8.75%) isolates were positive for eaeA gene.
Bakhshi et al., (2014) observed the presence of shiga toxin genes (stx1 and stx2)
and intimin (eaeA) genes in the stool samples of calves with diarrhoea, and 21 (4.3%)
isolates were identified as EHEC with stx1, stx2 and eaeA genes and amplification bands
of 422 bp, 894 bp and 478 bp were obtained for eae, stx1 and stx2 genes respectively.
24
Rasheed et al. (2014) determined the distribution of virulent genes viz., stx1, stx2
and hlyA among STEC isolated from food samples like raw egg surface, raw chicken,
unpasteurized milk of buffalo, fresh raw meat of sheep, cooked chicken fried rice from
street vendors, cooked chicken noodles from street vendors, snacks such as chaat/ pav
bhaji-street vendors, drinking water from street vendors and hand washing water from
street venders and results revealed that, of the 31 STEC positive strains, 25.8% of isolates
were positive to only stx1 gene, 54.8% carried both stx1 and stx2, 9.6% of isolates were
possessed both stx1 and hlyA genes, 3.2% of isolates were carried both stx2 and hlyA
genes and 7.1% of isolates were positive for all the three genes viz., stx1, stx2 and hlyA.
Son et al. (2014) developed a 75-min conventional multiplex PCR assay, IS-5P,
targeting the four virulence factors stx1, stx2, eae and ehxA plus the O157:H7 specific
+93 uidA single nucleotide polymorphism to assess the potential pathogenicity of STEC
isolates and observed the amplicon size of 306 bp for stx1, 482 bp for stx2, 245 bp for
eae, 136 bp for ehxA and 382 bp for +93 uidA.
Sudershan, et al. (2014) performed PCR assay for identification of different strains
of E. coli in stool samples of children’s (6 months to 5 years of age) suffering from acute
diarrhoea.
Neher et al. (2016) screened all the E. coli strains obtained from the samples viz.,
faeces, intestinal content, rectal swab and heart blood of different clinically affected
healthy animals and birds for the detection of virulence genes viz., stx1, stx2 and eae and
reported that among the 36 (26.08%) STEC isolates, 15 (41.67%), 14 (38.89%) and one
(2.78%) were exhibited eae, stx2 and stx1 alone respectively, whereas four (11.11%) and
two (5.56%) isolates were carried both stx1 and stx2, stx2 and eae respectively.
Panahee and Pourtaghi (2016) detected the shiga toxin genes (stx1 and stx2) and
intimin (eaeA) gene in different kinds of meat and products by using PCR assay and the
25
results indicated that 21 (72.4%) and 4 (13.7%) isolates carried stx2 and eaeA genes
respectively.
Suganya et al. (2016) screened the stool samples by PCR assay for the genetic
characterization of enteroaggregative E. coli (EAEC), enteropathogenic E. coli (EPEC),
enterotoxigenic E. coli (ETEC), enterohemorrhagic E. coli (EHEC) and enteroinvasive E.
coli (EIEC) and among them only one ETEC gene was detected
2.7. Antibiotic resistance
2.7.1. Ampicillin
Zinnah et al. (2008) conducted the studies on the antimicrobial resistance pattern
of Escherichia coli isolated from different biological and environmental sources and
showed that 59% of the isolates were resistant to ampicillin.
Eryulmaz et al., (2010) observed the antibiotic resistance pattern of ampicillin for
the urinary Escherichia coli isolates and reported that 56% of isolates were shown
resistance to ampicillin.
Habrun et al., (2010) observed the antimicrobial sensitivity of E. coli isolated from
the different organs of pigs in breeding farm and reported that 85% isolates were resistant
to ampicillin.
Vinita et al., (2010) analysed the antimicrobial resistance of E. coli isolated from
the urinary tract infected patients and reported that 94.29% of isolates were resistant to
ampicillin.
Cergole-Novella et al. (2011) conducted the studies on the antimicrobial resistance
pattern of STEC isolated from human infections and cattle faeces and revealed that 34.4%
of the isolates were resistant to ampicillin.
Arabi and Banazadehi (2013) observed the antibiotic resistance pattern of E. coli
isolated from the urinary tract infected patients and their results showed that 100% of the
isolates were resistance to ampicillin.
26
Niranjan and Malini (2014) analysed the antimicrobial resistance pattern of E. coli
causing urinary tract infection from in-patients and revealed that 88.4% of the isolates
were resistant to ampicillin.
Nitika et al. (2014) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples of outpatients and reported that 18.3% of the isolates were sensitive
to ampicillin.
Aasmae et al. (2015) conducted the studies on the antimicrobial resistance pattern
of intestinal E. coli in clinically healthy dogs and reported that out of 68 isolates three
(4.4%) were resistant to ampicillin
Anago et al. (2015) observed the antibiotic resistance pattern of E. coli isolated
from various biological samples and showed that 97.6% of the isolates were resistance to
ampicillin whereas 2.4% were susceptible.
Atere et al. (2015) determined the antimicrobial resistance pattern of pathogenic
Escherichia coli isolated from liver and trachea and revealed that 89.6% of the isolates
were resistance to ampicillin.
Bonnedahl et al. (2015) analysed the antimicrobial resistance pattern of E. coli
isolated from gull samples and reported that 30.1% of the isolates were shown resistance
to ampicillin.
El-Rahman et al. (2015) conducted the studies on the antibiotic resistance pattern
of the E. coli isolated from environmental sources polluted with waste water and reported
that 100% of the isolates were resistance to ampicillin.
Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates
obtained from human and food samples and revealed that 20.2% of E. coli isolates were
resistant to ampicillin
27
Mustika et al. (2015) conducted the studies on the antimicrobial resistance pattern
of E. coli isolated from faecal samples and showed that 80% of the isolates were resistant
to ampicillin.
Adenaike et al. (2016) observed the antibiotic resistance pattern of E. coli isolated
from zoborodo drink and showed that 69% of E. coli isolates were resistant to ampicillin.
Mahmud et al. (2016) determined the antimicrobial resistance pattern of bacteria
isolated from nasal and lung swab from healthy and sick cattle and reported that high
resistance of E. coli isolates against ampicillin.
2.7.2. Penicillin-G
Jeyasanta et al. (2012) analysed the antibiotic resistance pattern of E. coli
isolated from sea foods and their results revealed that 82.41% of isolates were
resistant to penicillin-G.
Chandrasekaran et al. (2014) analysed the antibiotic resistance pattern of E. coli
isolated from mastitis milk in dairy cows and they reported that 63% of isolates were
resistant to penicillin-G.
Maloo et al. (2014) observed the antimicrobial sensitivity of E. coli isolated from
water samples of Veraval coast and their results revealed that 100% of isolates were
resistant to penicillin-G.
Nontongana et al., (2014) observed the antibiotic resistance pattern E. coli isolated
from water samples of Kat river and the Fort Beaufort abstraction water and they reported
that 100% isolates were resistant to penicillin-G.
Sabir et al. (2014) observed the antibiotic resistance pattern of E. coli isolated
from urinary tract infected patients and they reported that 100% of isolates were resistant
to penicillin.
28
Mustika et al. (2015) conducted the studies on the antimicrobial resistance pattern
of E. coli isolated from faecal samples and revealed that 100% of the E. coli isolates were
shown resistance to penicillin-G
2.7.3. Cefadroxil
Kumar et al. (2013) analysed the antibiotic resistance pattern for clinically
isolated E. coli and their results showed that 88.52% of isolates were resistant to
cefadroxil.
Mishra et al. (2013) observed the antibiotic resistance pattern of E. coli isolated
from water samples of river Mahanandi and their results revealed that 58.33% of isolates
were shown resistance to cefadroxil.
Khan et al. (2014) observed the antimicrobial resistance pattern of clinically
isolated E. coli and reported that 97.62% of isolates were shown resistance against
cefadroxil.
Rahim et al. (2014) observed the antibiotic resistance pattern of clinically isolated
E. coli and reported that 85.71% of isolates were resistant to cefadroxil.
Sundvall et al. (2014) analysed the antibiotic resistance pattern of urinary
pathogenic E. coli and reported that 2.6% of isolates were resistant to cefadroxil.
Bonnedahi et al. (2015) analysed the antimicrobial resistance pattern of E. coli
isolated from gull samples and reported that 15.1% of the isolates were shown resistance
to cefadroxil.
2.7.4. Cefotaxime
Vinita et al. (2010) conducted studies on antimicrobial resistance pattern of E. coli
isolated from the urinary tract infected patients and reported that 78.51% of isolates were
resistant to cefotaxime.
29
Arabi and Banazadehi (2013) observed the antibiotic resistance pattern of E. coli
isolated from the urinary tract infected patients and their results showed that 81.9% of the
isolates were resistance to cefotaxime.
Kumar et al. (2013) analysed the antibiotic resistance pattern for clinically isolated
E. coli and their results showed that 90.16% of isolates were resistant to cefotaxime.
Ali et al. (2014) analysed the antibiotic resistance pattern of uropathogenic E. coli
isolated from the non-hospitalized patients and reported that 58.5% of isolates were
resistant to cefotaxime.
Manikandan and Amsath (2014) observed the antimicrobial resistance of E. coli
isolated from urine samples and they reported that 58% of isolates were resistant to
cefotaxime.
Raihan et al. (2014) studied the antibiogram pattern of the E. coli strains isolated
from the diarrheic samples of calves and their results showed that 60% of the isolates
were resistant to cefotaxime.
Aasmae et al. (2015) observed the antimicrobial pattern of E. coli and their results
showed that 100% of E. coli isolates were susceptible to cefotaxime
Anago et al. (2015) studied the antibiotic resistance pattern of E. coli isolated from
various biological samples and their results revealed that 56.5% of the isolates were
resistance to cefotaxime.
El-Rahman et al. (2015) conducted the studies on the antibiotic resistance pattern
of the E. coli isolated from environmental sources polluted with waste water and revealed
that 40 % of the isolates were shown resistance to cefotaxime.
Ferdosi et al. (2015) observed the antimicrobial resistance pattern of E. coli
isolated from urine samples and reported that 45.6% of the isolates were shown resistance
to cefotaxime.
30
Hussain et al. (2015) observed the antimicrobial resistance of clinically isolated
E. coli and reported that 67% of the isolates were resistant to cefotaxime.
Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates
obtained from human and food samples and revealed that 1.2% of E. coli isolates were
resistant to cefotaxime.
Munsi et al. (2015) analysed the antimicrobial resistance pattern of E. coli isolated
from milk samples collected from local vendors and reported that the isolates were highly
sensitive to cefotaxime.
Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic E.
coli and their results showed that out of 244 E. coli isolates 72 (29.50%) isolates were
resistance to cefotaxime.
Akter et al. (2016) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples and reported that 75% of the isolates were sensitive to cefotaxime.
Preethishree et al. (2016) conducted the studies on antimicrobial susceptibility
pattern of uropathogenic E. coli and their results revealed that 35.56% of the isolates were
shown sensitivity to cefotaxime.
Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary tract
infections from outpatients and revealed that 71.42% of E. coli isolates were shown
resistance to cefotaxime.
2.7.5. Cefoperazone
Saeed et al. (2009) observed the antibiotic resistance pattern of E. coli isolated from
the surgical wound infections and they reported that 65.5% of isolates were shown
resistance to cefoperazone.
31
Tanvir et al. (2012) analysed the antibiotic resistance pattern of E. coli isolated from
urinary tract infected patients and they reported that 86.8% isolates were sensitive to
cefoperazone.
Asati (2013) analysed the antibiotic resistance pattern of E. coli isolated from urine
samples of urinary tract infected patients and reported 79% of isolates were shown
sensitivity to cefoperazone.
Mishra et al. (2013) conducted the studies on the antibiotic resistance pattern of
E. coli isolated from water samples of river Mahanandi and showed that 66.66% of
isolates were resistant to cefoperazone.
Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic
Escherichia coli and their results showed that out of 244 E. coli isolates 72 (29.50%)
isolates were resistance to cefoperazone.
Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary tract
infections from outpatients and revealed that 75.97% of E. coli isolates were shown
resistance to cefoperazone.
2.7.6. Meropenem
Toroglu et al. (2005) observed the antibiotic resistance pattern of E. coli isolated
from water samples of Aksu river and they reported that 25% isolates were resistant to
meropenem.
Tanvir et al. (2012) analysed the antibiotic resistance pattern of uropathogenic E.
coli and they reported that 77.2% isolates were sensitive to meropenem.
Mishra et al. (2013) analysed the antibiotic resistance pattern of E. coli isolated
from water samples of river Mahanandi and their results revealed that 41.66% of isolates
were shown resistance to meropenem.
32
Biswas et al. (2014) conducted the antibiogram studies on the urinary isolates and
reported that 100% of the E. coli isolates were resistance to meropenem.
Nitika et al. (2014) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples of outpatients and their results showed that 74.6% of the isolates were
sensitive to meropenem.
Vij et al. (2014) observed the antibiotic resistance pattern of E. coli isolated from
urinary tract infected patients and their results showed that 62.7% of isolates were
resistant to meropenem.
Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic E.
coli and their results showed that out of 244 E. coli isolates three (1.22%) isolates were
resistance to meropenem.
Akter et al. (2016) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples and their results revealed that 100% of the isolates were shown
sensitivity to meropenem.
2.7.7. Gentamicin
Zinnah et al. (2008) conducted the studies on the antimicrobial resistance pattern
of Escherichia coli isolated from different biological and environmental sources and
showed that 32% of the isolates were resistant to gentamicin.
Alshara (2010) observed the antimicrobial resistance pattern of E. coli isolated
from paediatric patients and reported that 17.3% of isolates were shown resistance to
gentamycin
Eryulmaz et al. (2010) analysed the antibiotic resistance pattern of gentamycin for
the urinary E. coli isolates and their results showed that 9% of isolates were resistant to
gentamycin.
33
Vinita et al. (2010) conducted studies on antimicrobial resistance pattern of E. coli
isolated from the urinary tract infected patients and reported that 70.86% of isolates were
resistant to gentamycin.
Arabi and Banazadehi (2013) observed the antibiotic resistance pattern of E. coli
isolated from the urinary tract infected patients and their results showed that 82.5% of
isolates were resistant to gentamycin.
Ali et al. (2014) analysed the antibiotic resistance pattern of uropathogenic E. coli
isolated from the non-hospitalized patients and reported that 5% of isolates were resistant
to gentamycin.
Biswas et al. (2014) analysed the antimicrobial resistance pattern among the
urinary isolates and their results revealed that 94.11% of the E. coli isolates were
resistance to gentamicin.
Manikandan and Amsath (2014) observed the antimicrobial resistance of E. coli
isolated from urine samples and reported that 62.5% of isolates were resistant to
gentamycin.
Raihan et al. (2014) studied the antibiogram pattern of the E. coli strains isolated
from the diarrhoeic samples of calves and their results showed that 80% of the isolates
were sensitive to gentamicin.
Anago et al. (2015) conducted the studies on the antibiotic resistance pattern of
E. coli isolated from various biological samples and revealed that 45.2% of the isolates
were resistance to gentamicin.
Atere et al. (2015) determined the antimicrobial resistance pattern of pathogenic
Escherichia coli isolated from liver and trachea and their results showed that 68.8% of
the E. coli isolates were resistance to gentamicin.
34
El-Rahman et al. (2015) conducted the studies on the antibiotic resistance pattern
of the E. coli isolated from environmental sources polluted with waste water and showed
that 10% of E. coli strains were resistant to gentamicin.
Ferdosi et al. (2015) observed the antimicrobial resistance pattern of E .coli
isolated from urine samples and reported that 36.8% of the isolates were resistance to
gentamicin.
Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates
obtained from human and food samples and showed that 2.3% of the isolates were
resistant to gentamicin.
Oluyege et al. (2015) analysed the antimicrobial resistance pattern of E. coli
isolated from faecal swabs collected from healthy infants below five months of age and
revealed that 5.9% of the isolates were shown resistance to gentamicin.
Pant et al. (2015) conducted the studies on the antimicrobial resistance pattern of
E. coli from children suspecting urinary tract infections and revealed that 25% of the
isolates were shown sensitivity to gentamicin.
Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic
E. coli and their results showed that out of 244 E. coli isolates 47 (19.26%) isolates were
resistance to gentamicin.
Akter et al. (2016) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples and their results revealed that 100% of the isolates were shown
sensitivity to gentamicin.
Mahmud et al. (2016) determined the antimicrobial resistance pattern of bacteria
isolated from nasal and lung swab from healthy and sick cattle and reported that E. coli
isolates were shown highly resistance to gentamicin.
35
Preethishree et al. (2016) conducted the studies on antimicrobial susceptibility
pattern of uropathogenic E. coli and their results revealed that 60.83% of the isolates were
shown sensitivity to gentamicin.
Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary
tract infections from outpatients and revealed that 56.98% of E. coli isolates were shown
resistance to gentamicin.
2.7.8. Streptomycin
Stephan and Schumacher (2000) observed the antibiotic sensitivity pattern of E.
coli isolated from animals, food and asymptomatic human carriers and they reported that
17.07% of isolates were susceptible to streptomycin.
Saeed et al. (2009) observed the antibiotic resistance pattern of E. coli isolated from
the surgical wound infections and they reported that 72.4% of isolates were shown
resistance to streptomycin.
Habrun et.al. (2010) observed the antimicrobial sensitivity of E. coli isolated from
the different organs of pigs in breeding farm and reported that 91% isolates were resistant
to streptomycin.
Cergole-Novella et al. (2011) conducted the studies on the antimicrobial
resistance pattern of STEC isolated from human infections and cattle faeces and revealed
that 78.1% of the isolates were shown resistance to streptomycin.
Nontongana et al. (2014) analysed the antibiotic resistance pattern of E. coli
isolated from water samples of Kat river and the Fort Beaufort abstraction water and they
reported that 77% of isolates were susceptible to streptomycin.
Sabir et al. (2014) studied the antibiotic resistance pattern of E. coli isolated from
urinary tract infected patients and they reported that 30% of isolates were resistant to
streptomycin.
36
Aasmae et al. (2015) studied the antimicrobial resistance pattern of intestinal E.
coli in clinically healthy dogs and revealed that out of 68 isolates three (4.4%) were
resistant to streptomycin.
El-Shatoury et al. (2015) observed the antimicrobial resistance pattern of STEC
isolated from different water sources and reported that 11% of the isolates were resistance
to streptomycin.
Mustika et al. (2015) conducted the studies on the antimicrobial resistance pattern
of E. coli isolated from faecal samples and showed that 20%of the isolates were resistant
to streptomycin.
2.7.9. Ciprofloxacin
Zinnah et al. (2008) conducted the studies on the antimicrobial resistance pattern
of Escherichia coli isolated from different biological and environmental sources and
showed that 8% of the isolates were resistant to ciprofloxacin.
Alshara (2010) observed the antimicrobial resistance pattern of E. coli isolated from
paediatric patients and reported that 14.5% of isolates were shown resistance to
ciprofloxacin.
Eryulmaz et al. (2010) conducted the studies about the antibiotic resistance pattern
of urinary Escherichia coli isolates and reported that 15% of isolates were resistant to
ciprofloxacin.
Arabi and Banazadehi (2013) observed the antibiotic resistance patterns of E. coli
isolated from the urinary tract infected patients and their results showed that 78% of
isolates were resistant to ciprofloxacin.
Kumar et al. (2013) analysed the antibiotic resistance pattern for clinically isolated
E. coli and their results showed that 54.10% of isolates were resistant to ciprofloxacin.
37
Ohieku and Magaji (2013) observed the antimicrobial resistance of E. coli isolated
from urinary tract infected patients and reported that 58% of isolates were shown
resistance against ciprofloxacin.
Biswas et al. (2014) conducted the antibiogram studies on the urinary isolates,
among them 88.23% of the E. coli isolates were resistance to ciprofloxacin.
Nitika et al. (2014) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples of outpatients and reported that 32.3% of the isolates were sensitive
to ciprofloxacin.
Raihan et al. (2014) studied the antibiogram pattern of the E. coli strains isolated
from the diarrhoeic samples of calves and their results showed that 100% of the isolates
were sensitive to ciprofloxacin.
Aasmae et al. (2015) analysed the antibiotic resistance pattern of intestinal E. coli
isolated from clinically healthy dogs and reported that two isolates (2.9%) were shown
resistance to ciprofloxacin.
Aminu and David (2015) analysed the antibiotic resistance pattern of E. coli
isolated from the faeces of apparently healthy white Fulani cattle and reported that 10.6%
of isolates were resistant to ciprofloxacin.
Anago et al. (2015) observed the antibiotic resistance pattern of E. coli isolated
from various biological samples and their results reported that 91.7% of the isolates were
resistance to ciprofloxacin.
Atere et al. (2015) determined the antimicrobial resistance pattern of pathogenic
Escherichia coli isolated from liver and trachea and showed that 47.9% of the isolates
were resistance to ciprofloxacin.
38
El-Rahman et al. (2015) conducted the studies on the antibiotic resistance pattern
of the E. coli isolated from environmental sources polluted with waste water and showed
that 10% of E. coli strains were resistant to ciprofloxacin.
El-Shatoury et al. (2015) observed the antimicrobial resistance pattern of STEC
isolated from different water sources and reported that none of the isolate was resistance
to ciprofloxacin.
Ferdosi et al. (2015) observed the antimicrobial resistance pattern of E .coli
isolated from urine samples and their results showed that 24.6% of the isolates were
resistance to ciprofloxacin.
Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates
obtained from human and food samples and revealed that 4.7% of the isolates were shown
resistance to ciprofloxacin.
Munsi et al. (2015) isolated the E. coli from milk samples collected from local
vendors, observed the antimicrobial resistance pattern and reported that the isolates were
highly sensitive to ciprofloxacin.
Pant et al. (2015) conducted the studies on the antimicrobial resistance pattern of
E. coli from children suspecting urinary tract infections and reported that 28% of the
isolates were shown sensitivity to ciprofloxacin.
Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic E.
coli and their results showed that out of 244 E. coli isolates 82 (33.60%) isolates were
resistance to ciprofloxacin.
Adenaike et al. (2016) observed the antibiotic resistance pattern of E. coli isolated
from zoborodo drink and reported that 100% of the isolates were susceptible to
ciprofloxacin.
39
Akter et al. (2016) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples and their results revealed that 85% of the isolates were shown
sensitivity to ciprofloxacin.
Mahmud et al. (2016) determined the antimicrobial resistance pattern of bacteria
isolated from nasal and lung swab from healthy and sick cattle and reported that E. coli
isolates were shown mild resistance to ciprofloxacin.
Preethishree et al. (2016) conducted the studies on antimicrobial susceptibility
pattern of uropathogenic E. coli and their results revealed that 28.33% of the isolates were
shown sensitivity to ciprofloxacin.
Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary
tract infections from outpatients and revealed that 84.91% of E. coli isolates were shown
resistance to ciprofloxacin.
2.7.10. Ofloxacin
Ibrahim et al. (2010) observed the antimicrobial resistance of uropathogenic E. coli
and their results revealed that 93.1% of isolates were sensitive to ofloxacin.
Ibrahim et al. (2012) analysed the antimicrobial resistance of E. coli isolated from
clinical samples and they reported that 55.1% of isolates were resistant to ofloxacin.
Mary and Usha (2013) observed the antimicrobial resistance of E. coli isolated from
panipuri and their results revealed that 97% of isolates were resistance to ofloxacin.
Mishra et al. (2013) analysed the antibiotic resistance pattern of E. coli isolated
from water samples of river Mahanandi and their results revealed that 83.33% of isolates
were shown resistance to ofloxacin.
Ohieku and Magaji (2013) observed the antimicrobial resistance of clinically
isolated E. coli and they reported that 71% of isolates were shown resistance against
ofloxacin.
40
Manikandan and Amsath (2014) observed the antimicrobial resistance of E. coli
isolated from urine samples and they reported that 64.5% of isolates were resistant to
ofloxacin.
Atere et al. (2015) determined the antimicrobial resistance pattern of pathogenic
Escherichia coli isolated from liver and trachea and their results revealed that 52.1% of
the E. coli isolates were resistance to ofloxacin.
Ferdosi et al. (2015) observed the antimicrobial resistance pattern of E .coli
isolated from urine samples and their results showed that 8.8% of the isolates were
resistance to ofloxacin.
Oluyege et al. (2015) analysed the antimicrobial resistance pattern of E. coli
isolated from faecal swabs collected from healthy infants below five months of age and
revealed that 3.9% of the isolates were shown resistance to ofloxacin.
Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic E.
coli and their results showed that out of 244 E. coli isolates 82 (33.60%) isolates were
resistance to ofloxacin.
2.7.11. Azithromycin
Zinnah et al. (2008) conducted the studies on the antimicrobial resistance pattern
of Escherichia coli isolated from different biological and environmental sources and
showed that 33% of the isolates were resistant to azithromycin.
Chayani et al. (2009) conducted the studies on the antibiotic resistance pattern to
the clinically isolated E. coli and their results showed that 60.37% of E. coli isolates were
resistant to azithromycin.
Aly et al. (2012) analysed the antibiotic resistance pattern of E. coli isolated from
clinical samples and food samples and their results revealed that 31% isolates of clinical
samples and 37% isolates of food samples were resistant to azithromycin
41
Raihan et al. (2014) studied the antibiogram pattern of the E. coli strains isolated
from the diarrhoeic samples of calves and reported that 100% of the isolates were
sensitive to azithromycin.
Aminu and David (2015) observed the resistance pattern of E. coli isolated from
the faeces of apparently healthy white Fulani cattle and their results showed that 76.6%
of isolates were resistant to azithromycin.
Munsi et al. (2015) analysed the antimicrobial resistance pattern of E. coli isolated
from milk samples collected from local vendors and their results revealed that the isolates
were moderately sensitive to azithromycin.
Pant et al. (2015) conducted the studies on the antimicrobial resistance pattern of
E. coli from children suspecting urinary tract infections and revealed that 29% of the
isolates were shown sensitivity to azithromycin.
Akter et al. (2016) observed the antimicrobial resistance pattern of E. coli isolated
from urine samples and their results revealed that 89% of the isolates were shown
sensitivity to azithromycin.
2.7.12. Chloramphenicol
Saeed et al. (2009) observed the antibiotic resistance pattern of E. coli isolated from
the surgical wound infections and they reported that 58.6% of isolates were shown
resistance to chloramphenicol.
Vinita et al. (2010) analysed the antimicrobial resistance of E. coli isolated from
the urinary tract infected patients and they reported that 61.14% of isolates were resistant
to chloramphenicol.
Ibrahim et al. (2012) analysed the antimicrobial resistance of E. coli isolated from
clinical samples and they reported that 22.4% of isolates were resistant to
chloramphenicol.
42
Joshi et al. (2012) conducted studies on the antibiotic resistance pattern of E. coli
isolated from the colibacillosis in layers and they reported that 100% of the isolates were
sensitive to chloramphenicol.
Rehman et al. (2013) observed the antibiotic sensitivity pattern of isolates of Shiga
toxin producing E. coli isolated from faecal samples of bovines and stool samples of
bovine handlers and they reported that 86.6% of isolates were shown sensitivity to
chloramphenicol.
Nontongana et al. (2014) analysed the antibiotic resistance pattern of E. coli
isolated from water samples of Kat river and the Fort Beaufort abstraction water and they
reported that 73% of isolates were susceptible to chloramphenicol.
Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates
obtained from human and food samples and revealed that 4.7% of the isolates were
resistant to chloramphenicol.
Pant et al. (2015) conducted the studies on the antimicrobial resistance pattern of
E. coli from children suspecting urinary tract infections and revealed that 30% of the
isolates were shown sensitivity to chloramphenicol.
2.7.13. Tetracycline
Stephan and Schumacher (2000) observed the antibiotic sensitivity pattern of E.
coli isolated from animals, food and asymptomatic human carriers and reported that
17.07% of isolates were susceptible to tetracycline.
Zinnah et al. (2008) conducted the studies on the antimicrobial resistance pattern
of Escherichia coli isolated from different biological and environmental sources and
showed that 60% of the isolates were resistant to tetracycline.
Cergole-Novella et al. (2011) conducted the studies on the antimicrobial resistance
pattern of STEC isolated from human infections and cattle faeces and revealed that 100%
of the isolates were resistant to tetracycline.
43
Ibrahim et al. (2012) analysed the antimicrobial resistance of E. coli isolated from
clinical samples and reported that 77.1% of isolates were resistant to tetracycline.
Nontongana et al. (2014) analysed the antibiotic resistance pattern of E. coli
isolated from water samples of Kat river and the Fort Beaufort abstraction water and
reported that 75% of isolates were susceptible to tetracycline.
Sabir et al. (2014) worked on the antibiotic resistance pattern of E. coli isolated
from urinary tract infected patients and reported that 69.4% of isolates were resistant to
tetracycline.
Aasmae et al. (2015) analysed the antibiotic resistance pattern of intestinal E. coli
isolated from clinically healthy dogs and their results revealed that two isolates (2.9%)
were resistance to tetracycline.
Aminu and David (2015) observed the resistance pattern of E.coli isolated from
the faeces of apparently healthy white Fulani cattle and reported that 40.4% of isolates
were resistant to the tetracycline.
El-Shatoury et al. (2015) observed the antimicrobial resistance pattern of STEC
isolated from different water sources and reported that 7% of the isolates were resistance
to tetracycline.
Oluyege et al. (2015) analysed the antimicrobial resistance pattern of E. coli
isolated from faecal swabs collected from healthy infants below 5 months of age and
revealed that 88.2% of the isolates were shown resistance to tetracycline.
Pant et al. (2015) conducted the studies on the antimicrobial resistance pattern of
E. coli from children suspecting urinary tract infections and revealed that 100% of the
isolates were shown resistance to tetracycline.
44
Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates
obtained from human and food samples and their results revealed that 26.0% of E. coli
isolates were resistant to tetracycline.
Adenaike et al. (2016) observed the antibiotic resistance pattern of E. coli isolated
from zoborodo drink and showed that 54% of E. coli isolates were resistant to
tetracycline.
Nsofor et al. (2016) studied the antimicrobial susceptibility pattern of Escherichia
coli isolated from faecal samples obtained from humans, poultry and cattle and the results
revealed that 100% of the isolates were resistant to tetracycline.
2.7.14. Tigecycline
Rossi et al. (2008) conducted studies on the antibiotic resistance pattern of E. coli
isolated from the various clinical samples and their results revealed that 100% of the
isolates were sensitive to tigecycline.
Behera et al. (2009) conducted studies on the antibiotic resistance pattern of
clinically isolated E. coli and they reported that 100% isolates were sensitive to
tigecycline.
Ali et al. (2014) analysed the antibiotic resistance pattern of uropathogenic E. coli
isolated from the non-hospitalized patients and they reported that 2.5% of isolates were
resistant to tigecycline.
Nandi et al. (2014) observed the antibiotic sensitivity of E. coli isolated from
various samples of patients and they reported that 100% of isolates were sensitive to
tigecycline.
Mantzourani et al. (2015) analysed the antibiotic resistance pattern of E. coli isolated
from clinical and environmental samples and they reported that 100% of the isolates were
resistant to tigecycline.
45
2.8. Bacteriophages
2.8.1. History of Bacteriophage
Bacteriophages or phages are viruses that infect bacteria. They are now believed
to represent the most abundant biological entities with an estimated range of 1030 to 1032
total phage particles on the earth and assuming that they out number the bacteria about
10-folds (Emond and Moineau, 2007). The antimicrobial activity of the some components
against Vibrio cholera from Indian river water was observed by Hankin in the year 1896,
Gamaleya confirmed the Hankin’s observation with Bacillus subtilis in 1898. These
bacteriophages were first discovered against Staphylococcus aureus by Frederick Twort,
a bacteriologist, in 1915 and characterized the viral nature of the phage independently in
1917 by the microbiologist Felix d’Herelle (Sulakvelidze et al., 2001) and called his
discovery “bacteriophage”; a term he derived from the Greek word “phagein” (eater)
(Kutter and Sulakvelidze, 2004; Brovko et al., 2012). D’Herelle subsequently published
extensively on phages and helped to establish the International Bacteriophage Institute in
Tbilisi, Georgia in 1923 (Summers, 1999 and Sulakvelidze, 2001).
2.8.2. Classification of bacteriophages
About 150-1,000 new phage particles are produced after infecting a single
bacterial cell, which contributes the most abundant form of life on earth (Ackermann,
2003). Phages are highly diverse structurally and genetically including shape, nucleic acid
composition, presence/absence and properties of their tails, genera and families.
Therefore, phages have been classified in many different ways.
D‟Herelle (1918) stated and classified bacteriophages as a single species, the
“Bacteriophagum intestinale”, with many races. The forerunners of phage classification
were the great Australian microbiologist, Sir Macfarlane Burnet, who proved in 1937 that
phages were differed in size and resistance against physicochemical agents (Burnet,
46
1933). Ruska (1943), who proved that phages were morphologically diverse and proposed
a classification of viruses in 1943 by using electron microscopy.
In 1948, Holmes classified the viruses into three families based on host range and
symptoms of disease, Phages constituted the family Phagineae. Lwoff et al. (1962)
classified the viruses based on the properties of the virion and its nucleic acid and
proposed a system with a latinised nomenclature that included several phages. In 1965 a
Provisional Committee on Nomenclature of Viruses (PCNV) was founded, later became
the International Committee on Taxonomy of Viruses (ICTV) and issued its first report
in 1971, which included six phage “genera” and the “ribophage group” and groups were
listed with type species and properties (Wildy, 1971). The ICTV has biolt on the
Bradley’s basic classification scheme to structure what is known as the modern phage
classification systems or the ICTV classification. Bradley recognized six basic types:
tailed phages, filamentous phages and cubic phages with ssDNA, dsDNA, ssRNA or
dsRNA (Ackermann, 2003; Weinbauer, 2004). New phage groups have been introduced
over time, with the most recent development being the establishment of the order
Caudovirales for tailed phages containing 15 genera (Ackermann, 2003).
The ICTV is the only international body concerned with virus taxonomy and
presently classifies viruses into group into 7 orders and 96 families. Bacteriophages form
one order, 13 families and 30 genera (Ackermann, 2003; Ackermann, 2011). Originally
viruses were classified based on morphological properties and host type. At present,
ICTV may considered the every available property for classification. The current trend
utilizes sequence information, which can provide fine mapping of related viruses. Still
used the genome type (RNA or DNA, single or double standed) to provide fundamental
classification criteria. A viral species is defined by a set of properties, some of which may
be absent in a particular member (Ackermann, 2003).This is also called the “polythetic
species concept”, which defines viral species as a polythetic class of viruses constituting
47
a replicating lineage and occupying specific ecological niches (Weinbauer, 2004). Greek
or Latin roots ending in –virales, -viridae, and virus are labels used to construct taxonomic
names of orders, families, and genera, respectively (Ackermann, 2003).
Shapes of the bacteriophages are diverse, include cubic, lemon-shaped, spindle,
filamentous or pleomorphic viruses (Ackermann, 2003). A diversity of other structures
such as head appendages, collar and tail fibres or spikes are also found in some
bacteriophages. It is not uncommon for the capsid diameter and the genome size to vary
by a factor of ten between viruses (Weinbauer, 2004). The majority of described phages
have a head diameter usually ranging from 30 to 60 nm (Mathias et al., 1995). However,
giant viruses with head sizes ranging from 200 to over 700nm have been reported
(Gowing, 1993).
Ackermann, (2007) has studied 5,500 phages by electron microscopy and revealed
that 96.2% tailed phages and only 3.7% were polyhedral, filamentous or pleomorphic.
Species belonging to the order: Caudovirales have a double-stranded DNA as genetic
material and are divided into three families: Siphoviridae (long, non-contractile tail and
isometric head), Myoviridae (contractile tail with isometric head) and Podoviridae (short,
non-contractile tail and isometric head) (Ackermann, 2007)
Based on the ICTV classification, the phages are placed according to their
respective order, families, genome type and genome size as shown in Table 2.1.
2.9. Isolation of bacteriophages against Escherichia coli
Jann et al. (1971) isolated a bacteriophage against Escherichia coli O8 strains
from Freiburg sewage, while adding the same at high multiplicity, he reported that the
phages could not multiply in E. coli O93 but able to kill them.
48
Table 2.1. ICTV classification of phages (Harper, 2011)
Virus family Genome
type
Genome
size (kb) Structure Example
Caudovirales
Myoviridae ds DNA 33.6-170 Non-enveloped, icosahedral head (50-110 nm, may be
elongated) with long contractile tail Enterobacteria phage T4
Podoviridae ds DNA 40-42+ Non-enveloped, icosahedral head (60 nm) with short,
non-contractile tail Enterobacteria phage T7
Siphoviridae ds DNA 48.5 Non-enveloped, icosahedral head (60 nm) with long,
non-contractile tail Enterobacteria phage
Other families
Tectiviridae ds DNA 147-157 Icosahedral, contains lipid, 63 nm with 20 nm spikes Enterobacteria phage
PRD1
Corticoviridae ds DNA 9-10 Icosahedral, contains lipid 60 nm+ Pseudoalteromonas phage
PM2
Plasmaviridae ds DNA 12 Enveloped, spherical/ pleomorphic, 80 nm Acholeplasma phage L2
Inoviridae ss DNA 4.4-8.5 Non-enveloped, filamentous, 6-8 nm x 760-1950 nm Enterobacteria phage
M13
Microviridae ss DNA 4.4-5.4 Non-enveloped, icosahedral, 26 nm Enterobacteria phage ϕX
174
Leviviridae ss DNA 3.4-4.2 Non-enveloped, icosahedral, 26 nm Enterobacteria phage
MS2
Cystoviridae ds RNA
(segmented)
13.4
(3 segments) Enveloped, spherical, 86 nm with 86 nm spikes Pseudomonas phages ϕ6
49
Calci et al. (1998) compared the prevalence of lytic bacteriophages to E. coli in
faecal samples from different animal species and the study reported positive phage
isolation in beef cattle, sheep and goats, although it was noted that sheep and goats have
the lowest mean density of bacteriophage, based on the number of plaque-forming units
per gram of faeces.
Jensen et al. (1998) isolated bacteriophages by following soft agar overlay method
and reported that among them two bacteriophages, BHR1 and BHR2 were capable of
lysing both P. aeruginosa PAO303 and E. coli AB1157 and three bacteriophages were
lytic for both S. natans ATCC 13338 and E. coli AB1157, BHR3, BHR4 and BHR5.
Sheng et al. (2006) isolated phage SH1 by a standard enrichment procedure from
raw sewage taken from a municipal sewage treatment system and that phage was highly
lytic and formed large clear plaques in all 12 E. coli O157:H7 strains tested.
Jamalludeen et al. (2009) worked on avian E. coli strains and isolated seven
phages against Escherichia coli serogroups O1, O2 and O78 from waste water and faecal
samples, collected from poultry processing plants by using double agar overlay method.
Mahadevan et al. (2009) isolated the host specific bacteriophages by using five
bacterial pathogen isolates obtained from sewage water and observed that bacteriophages
against Escherichia coli and Salmonella typhi were able to infect its original host
bacterium, whereas the phages of Pseudomonas aeruginosa was able to infect both
Pseudomonas and Escherichia coli.
Olieveira et al. (2009) isolated five bacteriophages (CphiF78E, PhiF258E,
PhiF2589E, PhiF61E and PhiF5318E) against Escherichia coli from samples of poultry
sewage. They used the spot test method as an initial test for the presence of phage and
later performed double layer plaque technique and phages were purified by successive
single plaque isolation from the higher dilutions plates where plaques were still distinct.
50
Shukla and Hirpurkar (2011) studied the presence of bacteriophage in sewage
material at different depths of the tanks located in livestock farms of different species i.e.,
cattle, pig, goat and poultry and subjected to rapid detection by streak plate method and
isolated the bacteriophages against two most common environmental bacteria namely
B.subtilis and E. coli by double agar layer method. Further they reported that 67, 63, 50
and 13 percentages of phages were isolated from pig faeces, dairy cattle farm waste,
buffalo farm waste and goat farm waste respectively.
Manjunath et al. (2013) used the sewage sample originated from hospital,
domestic, municipal waste and the water from water treatment plant as source to isolate
the phage ϕDMEC-1 against the multidrug resistant E. coli (DMEC-1) by double agar
layer method.
Gunathilaka (2014) isolated and purified phages specific to E. coli O157 and
Salmonella from two out of 35 water samples and she reported that none of the river water
samples were positive for E. coli O157 and Salmonella specific phage and all phages were
isolated from wastewater treatment plants.
Beheshti Maal et al. (2015) isolated two novel bacteriophages from Zayandehrood
river water against Escherichia coli SBSWF27 and E. coli PTCC1399 by spot test and on
BHA showed big phage plaques after overnight incubation at 37°C.
Duraisamy et al. (2015) isolated 46 bacteriophages by processing 10 hospital
effluent samples against 20 different MDR and ESBL strains by double layer agar
method.
Mulani et al. (2015) conducted research on isolation and characterization of
bacterial species and their specific phages present in the same environment to develop
new strategy for generalized control of bacterial populations, especially regarding the
pathogens in waste water and reported that potential activity of bacteriophages against
51
target bacteria has shown 100% reduction in CFU/ml for both E. coli and Salmonella
species at 9thhour.
2.10. Physico-chemical characterization of isolated bacteriophages
2.10.1. Physical characterization
2.10.1.1. Effect of temperature on the activity of bacteriophages
Although tests indicate that phages are capable of tolerating broad temperature
ranges whereas in natural systems phages appear only to occur within constrained
temperature ranges. Temperature sensitivity can therefore be a characteristic of a phage
population found in a particular environment. For example, marine bacteriophages have
been shown to be more sensitive to heat than phages from other environments (Spencer,
1955).
Al-Mola and Al-Yassari (2010) determined the sensitivity of phages at different
temperatures (37°C, 50°C and 65°C) by exposing to different time intervals (10, 20, 30,
40, 50 and 60 min.) and revealed that the effect of temperature on phage titre, was
significantly increased (P<0.05) at the temperature of 37°C comparing with phage titre at
50°C and 65°C.
Allue-Guardia et al. (2012) conducted heat stability tests of phages and reported
that the resistance of the two Cdt phages and SOM23 phages to high temperatures (60
and 70°C) and the results revealed that when treated at 60°C, inactivation of infectious
particles was of 1.3log10 units at 60min, whereas treatment at 70°C showed inactivation
greater than 2.4log10 units at 30 min and greater than 4.5 log10 units at 60 min was
observed with SOM23 phages whereas Cdt phage particles were still detectable by qPCR
and there was no remarkable reduction at any time interval or temperature, which
confirms that the phage DNA was remained intact.
52
Chachra et al. (2012) subjected the brucellaphage to the different temperatures of
-20°C, 4°C, 37°C, 50°C, 70°C and 100°C for a period of 20 min. and observed that there
was no growth when exposed to 70°C and 100°C for a similar time period of 20 min.
Zaman and Arip (2012) characterized the ability of bacteriophage when exposed
to overnight incubation at temperature ranging from 10°C to 80°C and reported that
isolated phages were stable in a temperature range of 10°C to 37°C and became less stable
following exposure to 40°C and 50°C and the region of optimum stability was at close to
body temperature 37°C and further they reported that the isolated phages do not have the
ability to survive at temperature above 50°C.
Manjunath et al. (2013) examined the stability of the phage lysates at room
temperature, - 400C, -200C, 40C, and 200C and also in presence of 20% (v/v) glycerol at
-400C and -200C and Phage titres maintained at various conditions were examined after
3, 6, 9 and 12 months of storage by double agar layer technique and the results revealed
that there was no significant decrease in the level of phage titre after 3 months storage at
all the tested temperatures, except at room temperature, where the titre was reduced by
30%, whereas ΦDMEC-1 was highly sensitive to higher temperature (600C) for 15
minutes, with a 100-fold decrease in titre.
Pandey et al. (2013) reported that the effect of heat on the activity of phage
revealed that at 40°C phage titre gradually decreased from 1340 to 110 PFU/ml (8.2%)
within three hours and at 60°C temperature treatment phages were completely inactivated
within 10 min.
Taj et al. (2014) worked on the effect of various ranges of dilution, temperature
and pH on T4 bacteriophage lytic activity against Escherichia coli and reported that T4
bacteriophage did lysis from 10-1 to 10-7 dilutions, while at 15°C, 25°C and 30°C there
was lysis but with little delay. Similarly at 41°C T4 bacteriophage were developed and
53
performed lysis on its host but at temperature regimes of 45°C, 55°C and 70°C, the T4
bacteriophage was completely inactive.
2.10.1.2. Effect of UV light on the activity of bacteriophages
Allue-Guardia et al.(2012) worked on Cdt Phages and reported that the Cdt
phages were very sensitive to the UV treatment used and showed reductions of infectious
phages of 3.5 (125), 3.1(62) and4.0(SOM23)log10 units after30min,but they were still
more resistant than the Cdt-STEC strain, which showed a reduction of 5 log10 units after
only 5 min.
Chachra et al. (2012) examined the stability of the phage lysates towards the UV
light by exposing them for a period of 15 min. to 90 min. and revealed that UV light killed
the brucellaphage within the first 15 min. of exposure.
Pandey et al. (2013) determined the effect of UV light on the activity of phage
and revealed that UV light had drastic effect on the phage survivability and the phage gets
completely inactivated within 3 min.
2.10.1.3. Effect of sun light on the activity of bacteriophages
Chachra et al. (2012) worked on brucellaphages and reported that brucellaphage
which were subjected to sunlight for a period of 15 min. to 90 min., revealed that the
survivability was gradually decreased from 95.8% (on exposure for 15 min) to 73% over
a 90 min. period.
Pandey et al. (2013) described the effect of sunlight on activity of phage and
revealed that exposure to direct sunlight gradually decreased the phage concentration and
within 3 h, the brucellaphage titre was reduced by 93.99%.
54
2.10.2. Chemical characterization
2.10.2.1. Effect of SDS on the activity of bacteriophages
The effect of 10% SDS on the phage activity was shown by Chachra et al. (2012)
by subjecting the phage for a period of 15 min. to 3h and revealed that complete
destruction of the phage was observed within 15 min.
Pandey et al. (2013) determined the stability of the brucellaphage by subjecting
them to SDS (0.1%) and revealed that complete inactivation of phage within 15 min.
when exposed to 0.1% SDS.
2.10.2.2. Effect of phenol (aqueous) on the activity of bacteriophages
Pandey et al. (2013) determined the stability of brucellaphages and reported that
complete inactivation of the phage was observed within 15 min after exposure to
5%phenol at 37°C.
2.10.2.3. Effect of chloroform on the activity of bacteriophages
Al-Mola and Al-Yassari (2010) determined the sensitivity of phages to
chloroform by exposing them at different time intervals (5, 10, 15, 20, 25, 30, 35 and 40
min.) and reported that chloroform completely inactivated the phage within 5min.
Manjunath et al. (2013) reported that there was no decrease in the phage titre in
chloroform treated sample after 4 and 24 h of incubation at room temperature.
Pandey et al. (2013) determined the effect of 10% chloroform on the activity of
brucellaphage and revealed that complete inactivation was observed within 5 min.
55
2.10.2.4. Effect of formalin on the activity of bacteriophages
Pandey et al. (2013) determined the stability of the brucellaphage by subjecting
them to 40% formalin and revealed that complete inactivation of phage within 15 min.
when exposed to 40% formalin.
2.11. Molecular characterization of phage by Restriction endonucleases digestion
analysis
Goodridge et al. (2003) performed restriction enzyme analysis with four enzymes
(EcoRV, SspI, NdeI and TaqI) and confirmed the phages LG1 and AR1 isolated against
Escherichia coli were distinct. The results revealed that the restriction enzymes SspI,
NdeI, and TaqI completely digested AR1 DNA and these results were coincided with
those observed when the same enzymes were used to digest T4 DNA. Further they
reported that phageLG1 DNA was partially degraded by NdeI, and completely digested
by EcoRV, SspI and TaqI and both AR1 and LG1 DNA were readily digested by several
restriction enzymes indicates that both phages possess double-stranded DNA.
Lappe et al. (2009) observed that the Podoviridae and Siphoviridae (PFGE-A)
were approximately 42 kb while there was size variation among the Myoviridae and the
Podoviridae subdivided into three groups, Pa (SETP1, 8 and 10), Pb (SETP15 and 16)
and Pc (SETP14). Likewise the Siphoviridae subdivided into Sa (SETP3, 5 and12), Sb
(SETP7 and 11) and Sc (SETP13), and the Myoviridae also divided into three groups, Ma
(SETP4and 9), Mb (SETP2) and Mc (SETP6). Their further studies revealed that
Salmonella enteritidis Typing Phage (SETP) 2, 4 and 9 were about 36.5 kb and SETP6
was approximately 27 kb. They also reported that Hind III digestion of phage DNA
produced 9 distinct patterns of 8 to 11 bands that showed correlation with morphotype.
Jamalludeen et al. (2009) determined the genome size of isolated phages EC-Nid1
and EC-Nid2 by using restriction enzymes, EcoRI and AccI and this restriction analysis
56
demonstrated the genome size of phages EC-Nid1 and EC-Nid2 were 67.06 kb and 68.04
kb respectively.
Bao et al. (2011) performed restriction enzyme analysis with EcoRI and HindIII
to digest genomes of the bacteriophages and their results indicated that the restriction
patterns of bacteriophage PSPu-95 obtained with enzymes EcoRI or HindIII were
absolutely different from PSPu-4-116 and bacteriophage genome was estimated to be
58.3 kbp in length for PSPu-95 and 45.2 kbp in length for PSPu-4-116.
Jamalludeen (2012) isolated Phages EC-NJ4 and EC-NJ7 against Escherichia coli
appears to have similar profiles of the nucleic acid fragments generated by digestion of
their DNAs with AccI and EcoRI.
2.12. Scanning Electron Microscopy (SEM)
Mulani et al. (2015) examined bacteriophage particles by scanning electron
microscopy and observed the hexagonal symmetry of head with a size of 100-150 nm.
57
CHAPTER III
MATERIALS AND METHODS
The research work was carried out in the department of Veterinary Public Health
and Epidemiology, College of Veterinary Science, Tirupati. During the course of this
study glassware of Borosil make and plastic ware of Torsons make were used.
Microbiological culture media was prepared with double glass distilled water. All the
media used in the present study were sterilized by autoclaving at 1210C at 15psi pressure
for 15 minutes unless otherwise specified. Sterility of the media was checked by
incubating at 370C for 24 hours. The buffers and all other chemical reagents were
prepared with triple distilled water. Chemicals used during this study were obtained from
M/s Merck, Qualigens, SD Fine Chemicals and Hi-Media. Readymade microbiological
media, sugars and antibiotic discs were procured from Hi-Media Laboratories Limited,
Mumbai. All the molecular grade chemicals used for PCR work were obtained from
Thermo Scientifics, Bangalore. The oligonucleotide primers used in the molecular
characterization of the isolates were supplied by Eurofins Genomics India Private
Limited, Bangalore.
3.1 Media, chemicals, glassware, plasticware and equipments
Tryptone soya broth (TSB), Nutrient agar (NA), Tryptic soya agar (TSA),
MacConkey agar (MLA), Eosine Methylene Blue (EMB) agar and other selective and
differential dehydrated media were obtained from HiMedia laboratories, Mumbai. All the
molecular grade chemicals used for PCR work were obtained from Thermo Scientifics,
Bangalore. Glassware’s (conical flasks 500 ml, 250 ml, 100 ml, Graduated reagents
bottles wide mouth screw cap, test tubes etc) were procured from Borosil, India while
plasticware (5 ml tubes, 1.5m ependorff tubes, 2-200 µl and 200-1000 µl microtips) from
Tarsons, India.
58
3.1.1 Preparation and sterilization of glassware and plastic ware
3.1.1.1 Glassware
Glassware was soaked overnight in Labolene. The next day they were thoroughly
cleaned, washed and rinsed three times in running tap water. After overnight soaking in
double glass distilled water, the glassware was dried and then sterilized in hot air oven at
1600C for one hour.
3.1.1.2 Plastic ware and rubber items
Plastic ware and rubber items were sterilized by autoclaving at 1210C at 15 psi
pressure for 15 minutes.
3.2. Equipment
Equipment from National and International firms were used in this study especially
during the molecular characterization of the isolates are given in the Table. 3.1.
3.3. Bacterial strains
The reference strain for Shiga Toxin producing Escherichia coli (MTCC 1699) was
obtained from the department of Veterinary Public Health and Epidemiology, College of
Veterinary Science, Tirupati, Andhra Pradesh.
3.4. Collection of samples
The specimens selected for this study were dairy farm sewage and wastewater. The
sewage and wastewater samples were collected from different organized and unorganized
dairy farms and animal sheds in and around Tirupati, aseptically in sterilized plastic
containers. A total of 128 samples from different sources viz: Organized dairy farms
59
(n=28), unorganized dairy farms (n=32) and animal sheds (n=68) were collected
aseptically in sterilized plastic containers. The collected specimens were processed within
2 to 24 hours of collection. The source and number of samples collected in this study is
given in Table. 3.2.
Table 3.1. List of equipment used in the study
S.No Name of the Equipment Company/ firm
1. Ultra centrifuge Beckman, Optima TLX 120
2. Thermocycler Eppendorf, MC gradient
3. U.V transilluminator B.Genei, MD-20,312 nm
4. Gel documentation unit Syngene, GBOX HR
5. Gel electrophoresis B.Genei
6. Micro centrifuge Minispin, Genei, India
7. Water bath Inlab equipment (Madras) pvt. ;td
8. Deep freezer Sanyo, MDF-U333
9. Weighing balance Essae Teraoka ltd., DS-852G
10. Hot air oven York Scientific Industries Pvt.Ltd.,
India, Yorco Hot Air Sterilizer (Oven)
11. Bacteriological incubator Micro Teknik, India
12. Microscope Olympus India Pvt. Ltd., Binocular
Microscope, Model CH20BIMF
Table. 3.2. Source and number of samples collected
S. No Source of the sample Number collected
1. Organized dairy farms 28
2. Unorganized dairy farms 32
3. Animal sheds 68
TOTAL 128
60
3.5. Isolation and Identification of Escherichia coli
3.5.1. Isolation
Tryptone soy broth (TSB) was used for enrichment of inoculum and incubated at
370C for 24h. After overnight incubation, the cultures were streaked on MacConkey agar
and Eosine Methylene Blue (EMB) agar plates and the plates were incubated at 370C for
24h. After incubation the plates were observed for lactose fermenting colonies and
greenish metallic sheen colonies respectively. The colonies thus obtained were
transferred to nutrient agar slants in duplicate and incubated at 370C for 24 h and stored
at 40C for further identification. The composition of media and any specific procedure
followed in its preparation are presented in Annexure I.
3.5.2. Identification
A bacterial smear was prepared on a clean microscope slide and heat fixed. The
smear was entirely covered with Crystal Violet solution and allowed to stand for one
minute. The slide was rinsed with water and flooded with gram’s iodine. After one
minute, the slide was rinsed with water and destained with 95% ethyl alcohol for
15seconds. Counter staining was done with Carbol fuschin for one minute. The slide was
gently blotted dry and viewed under oil immersion objective of the light microscope.
Purple coloured cells are interpreted as gram positive and red or pink coloured cells are
interpreted as gram negative bacteria according to the method described by Merchant and
Packer, (1967).
3.6. Biochemical characterization
For confirmation of Escherichia coli, the biochemical tests conducted were triple
sugar iron agar test, urease test, motility test and IMViC tests. The procedures used for
the conduction of biochemical tests are given in Annexure II.
61
3.7. Preservation of isolates
A loop full of the isolated organism was added to the sterile Luria-Bertani glycerol
broth vials and mixed well in vortex mixer. The vials were then labelled and stored until
further use.
3.8. Antimicrobial susceptibility test
The modified disc diffusion method of Bauer et al. (1966) was employed and the
interpretation was made as per the interpretation chart provided by the manufacturer using
panel of 14 antibiotics.
3.8.1. Preparation of inoculum
Transferred 4-5 colonies from primary isolated medium i.e. MacConkey agar and
EMB agar plates to 5 ml of Tryptic soya broth by touching the top of the colonies with a
flame sterilized and cooled platinum loop and incubated the bacterial suspension at 370C
for 8 h. After incubation, the resulted culture was compared with the turbidity standard
prepared separately for adjustment of bacterial suspension.
3.8.2. Preparation of turbidity standard
The turbidity standard was prepared by adding 0.5 ml of (1.17% w/v) of barium
chloride dehydrate (BaCl2 2H2O) solution to 1% sulphuric acid. The turbidity standard
was placed in the tube identical to the one used for the broth sample and was stored in the
dark at room temperature. The turbidity was equivalent to 108 CFU/ml which is half the
density of a Mac Farland 0.5 standard. The standard was agitated on a vortex mixer
immediately before use. If the culture was found less turbidity than the turbidity standard,
it was further incubated for 2-8 h at 370C until turbidity was equivalent to the standard. If
the turbidity exceeds that of the standard the culture solution was diluted with tryptic soya
broth to equitate with the standard.
62
3.8.3. Antimicrobial discs
Commercially available standard antimicrobial discs (Hi-Media) were procured
and stored at 2-80C in the refrigerator. Unopened disc containers were removed from the
refrigerator 1-2 h before use, to bring them to room temperature. The antimicrobial discs
with known concentrations as noted in micrograms (µg) or International Units (I.U) per
disc were used to study the antimicrobial susceptibility of the isolates. The antimicrobial
discs used in this study are given in Table 3.3.
3.8.4. Medium for antimicrobial susceptibility test
Muller-Hinton (MH) agar, the recommended medium for disc diffusion test was
used in the present study. Medium was prepared according to protocol provided by
manufacturer and autoclaved at 1210C, 15 lbs for 15 min. When the temperature of the
medium was reached between 45-500C it was mixed well and approximately 15-20 ml of
medium was added to the sterilized petriplates and incubated overnight at 370C for
sterility testing and the uncontaminated plates were wrapped with aluminium foil and
they were stored at 40C till use.
3.8.5 Preparation of inoculum
The sterile cotton swab was dipped in the standardized bacterial suspension and rotated
several times. Then the cotton swab was gently pressed on the upper inside wall of the
test tube to remove excess inoculum. The swab was then streaked over the entire surface
of the MH agar plate for three times. The plate was turned at 600 angle between each
streak to ensure even distribution of the inoculum. A final sweep of the swab was made
around the agar rim.
Allowed the inoculated plates to dry for 5 to 15 min and placed the selected
antimicrobial discs with a distance of 24 mm apart by using a disc dispenser and gently
63
Table.3.3. Antimicrobial discs used to study the antimicrobial susceptibility of the isolates
S.No Name of the
antimicrobial disc
Quantity of
antimicrobial substance
per disc
Diameter of zone of inhibition
in mm (as per the manufacturer guidelines)
Sensitive Intermediate resistant
1 Ampicillin 10 mcg > 17 14-16 < 13
2 Gentamycin 10 mcg > 17 13-14 < 12
3 Streptomycin 10 mcg > 15 12-14 < 11
4 Ciprofloxacin 05 mcg > 21 16-20 < 15
5 Chloramphenicol 30 mcg > 18 13-17 < 12
6 Penicillin-G 10 units > 29 --- < 28
7 Cefoperazone 75 mcg > 21 16-20 < 15
8 Cefotaxime 30 mcg > 23 15-22 < 14
9 Tigecycline 15 mcg > 16 13-15 < 12
10 Meropenem 10 mcg > 23 20-22 < 19
11 Azithromycin 15 mcg > 18 14-17 < 13
12 Cefadroxil 15 mcg > 18 15-17 < 14
13 Ofloxacin 05 mcg > 16 13-15 < 12
14 Tetracycline 30 mcg > 19 15-18 < 14
64
pressed down on to the agar surface to provide uniform contact. The inoculated plates
were inverted and incubated at 370C for 24 to 48 h. Each plate was examined after
incubation for the diameter of zones of complete inhibition including the diameter of the
discs were measured up to the nearest whole millimetre with ruler in non-reflecting
background. The zone margin was the area where no obvious growth was visible and the
readings were compared with that specified readings in the interpretive chart supplied by
the manufacturer of the antibiotic discs and the results were documented as sensitive (S),
intermediate resistant (I) and resistant (R).
3.9. Confirmation of Shiga toxin producing Escherichia coli by using Sorbitol
MacConkey agar (SMAC)
40.00gms of Sorbitol MacConkey agar part I and 10 gms of part II were added to
1000 ml of distilled water and gently heated to dissolve the medium completely and
sterilized by autoclaving at 1210C for 15 minutes and then cooled to room temperature.
The contents were mixed well and 15 -20 ml of media was added to the sterile petridish
and incubated over night at 370C for sterility testing.
The isolates were streaked on SMAC agar plates and incubated the plates at 370C
for 24 hours. After incubation the plates were observed for the colonies. Colourless
colonies were the characteristic growth of E. coli O157:H7 whereas pink colour colonies
were the E. coli Non O157:H7 organisms.
3.10. Multiplex Polymerase Chain Reaction for detection of virulence genes of STEC
(stx1, stx2, eaeA and hlyA)
3.10.1 Oligonucleotide primers
The primers used for the detection of shiga toxin producing Escherichia coli were
custom synthesized by M/s Eurofins Genomics, Bangalore, India. The details of the
primers are given in Table 3.4.
65
Table 3.4: Details of oligonucleotide primers used in this study
Primer Target
gene Primer sequence (51-31)
Expected
amplicon
size(bp)
Refere
nce
stx 1: F stx1
5’-ATA AAT CGC CAT TCG TTG ACT AC-3’ 180
Paton
and
Paton
(1998)
stx 1: R AGAACGCCCACTGAGATCATC
stx 2: F stx2
GGCACTGTCTGAAACTGCTCC 255
stx 2: R TCGCCAGTTATCTTGACATTCTG
eaeA: F eaeA
GACCCGGCACAAGCATAAGC 384
eaeA: R CCACCTGCAGCAACAAGAGG
hlyA: F hlyA
GCATCATCAAGCGTACGTTCC 534
hlyA: R AATGAGCCAAGCTTGTTAAGCT
3.10.2. Reference strains
The reference strain for Shiga Toxin producing Escherichia coli (MTCC 1699)
was obtained from the department of Veterinary Public Health and Epidemiology,
College of Veterinary Science, Tirupati, Andhra Pradesh.
3.10.3. Template DNA preparation by boiling and snap chilling method
Preparation of template DNA from Escherichia coli strains was carried out as per
Lee et al. (2003) with slight modifications. About 2 ml of overnight grown culture was
taken in micro centrifuge tube and centrifuged at 12,000 rpm for 10 minutes. The pellet
was suspended in 200 µl of nuclease free water and boiled for 15 min in a boiling water
bath. The micro centrifuge tubes were transferred immediately on to ice. After 20 min,
the tubes were centrifuged at 12,000 rpm for 10 min at 40C and the supernatant was used
as template for multiplex PCR assay.
66
3.10.4. Standardization of Multiplex PCR assay for detection of virulence genes
(stx1, stx2, eaeA and hlyA genes)
The multiplex PCR protocol was followed as per the method described by Paton
and Paton (1998) with some modifications. In brief, the multiplex PCR protocol was
standardized in a volume of 25.0 µl of reaction mixture containing 1X PCR buffer, 0.25
µM each of the 8 primers (4 primer pairs), 0.2mM each deoxynucleoside triphosphate
(dATP, dUTP, dGTP, and dCTP) (Thermo, USA), 1.0 U of Taq DNA polymerase
(Thermo, USA), template DNA and magnesium chloride (MgCl2). Sterile nuclease free
water was added accordingly to make up the 25 µl reaction mixture. The template DNA
volume was evaluated from 2 µl to 8 µl. The MgCl2 concentration was evaluated for
1.0mM, 1.5 mM, 2.0 mM, 2.5 mM and 3.0 mM.
PCR tube containing the reaction mixture was flash spun in a micro centrifuge
tube to settle the reactants at the bottom. Thermal cycling was performed in a 96-well
Eppendorf gradient Thermal cycler with a heated lid. It consisted of an initial denaturation
at 950C for 5 min, followed by 35 cycles of denaturation at 940C for 45 sec, 45 sec of
annealing temperature (temperature standardized) and initial extension at 720C for one
min and a final extension at 720C for 6 min followed by maintenance at 40C. The
annealing temperature was evaluated between 58 to 630C by performing gradient
multiplex PCR.
3.10.5. Analytical Agar Gel Electrophoresis:
DNA amplified by PCR was subjected to 1% agarose gel electrophoresis as
described by Sambrook and Russel (2001). Agarose gel (1%) was prepared by boiling
agarose in an appropriate volume of 1 X TBE buffer and allowed to cool to 500C. After
cooling for about 3 minutes, ethidium bromide (10 mg/ml) stock was added to the agarose
solution to a final concentration of 0.5 µl / ml and mixed carefully. The molten agarose
was poured in to a gel casting tray fitted with acrylic comb and allowed to solidify. Once
67
the gel was solidified a few ml of 1X TBE buffer was added, comb was removed carefully
and the tray containing the gel was then placed in a submarine horizontal electrophoresis
unit filled with 1X TBE buffer upto a level of 1mm above the gel surface.
The wells were loaded with 5 µl of each PCR product was mixed with 1 µl of 6X
loading dye. Electrophoresis was carried out at the rate of 5-6 v/cm and the motility was
monitored by the migration of the dye. After sufficient migration, the gel was observed
under UV transillumination using Syngene Gel Documentation system to visualize the
bands and image was captured. The PCR product size was determined by comparing with
a standard molecular weight marker.
3.11. Bacteriophage isolation
The lytic bacteriophages were isolated by using the disease causing strain
Escherichia coli as a representative strains employing double agar overlay method
described by Adams (1959) with slight modifications using sewage water collected from
different dairy farms.
3.11.1. Sample preparation by enrichment method
As a part of the enrichment process, a portion of sewage sample was mixed with
the host bacteria (in log phage) and allowed for incubation overnight at the temperature
of 370C. The homogenate was centrifuged at 2000 rpm (Remi motor Ltd., R8) and
followed by filtration using sterile syringe filters (Millex®GV) with pore size of 0.22 µm
to make them bacteria-free. After filtration 100 µl of the filtered sample was serially
diluted in Salt of Magnesium (SM) buffer, by 10 fold dilution. This filtrate was screened
for the presence of phage and was stored at 40C for the further use.
68
3.11.2. Spot Assay
100 µl log phage host was spread on sterile TSA plates and 10 µl lysate was
spotted on the plate and incubated at 370C for 24h.
3.11.3. Double agar overlay method
The lysate was then assayed according to the double-agar overlay method of
Adams (1959) with slight modifications. The logarithmic phage cells (100 µl) of the host
bacterial strains in TSB were mixed with 100 µl of the serially diluted lysate and were
incubated at 370C for 20 min. After incubation, 5 ml of 0.75% sterile soft agar was added
to this, mixed well and was immediately overlaid on 20% bottom TSA plates. Phage free
cultures (containing only bacterial host) and host-free cultures (containing only phage)
were used as controls. Then the petri plates were kept in laminar air flow until it gets
solidified, and incubator at 370C for overnight to obtain clear zone of plaques.
3.12. Preparation of bacteriophage stocks
Bacteriophage stocks were prepared by using double agar overlay method with
minor modifications (Sambrook et al., 1989). To the double agar over lay plates that were
showing characteristic plaque morphology three ml of SM buffer was added. The entire
surface of semisolid material was scrapped with the sterile spatula and incubated at 37ºC
for 8 hours. Then the entire scrapped material with SM buffer was collected with wide
bore microtips into 50 ml sterile container. The phage suspension was centrifuged at
10,000 rpm for 15 min at 4ºC and the supernatant was filtered through 0.45µ syringe filter
and stored at 40C for further use.
3.13. Estimation of the titre of the isolated bacteriophage against E. coli
Titration of the phage was done by preparing 10-fold serial dilution of the phage
lysate. For titration, 10-1 to 10-4 dilutions were made in SM buffer (pH 7.0). Equal quantity
69
of each phage dilution and fresh exponential Escherichia coli in SM buffer and subjected
to double agar overlay method described in 3.11.3. Phage titre was determined in terms
of plaque forming units (PFU/ml) with the help of formula given below:
PFU/ml = No. of plaques counted ×1
Dilution factor×
1
volume of phage taken
3.14. Activity of bacteriophages against target bacteria
Survival rate of target bacteria was assessed by inoculating phage in the actively
growing log phase host. Sewage sample was collected and filtered. After filtration sewage
sample was taken in pre-sterilized flask. Then added the specific phage at 106 PFU/ml
and used for treatment. The phage inoculated sample was incubated at 370C. After
periodic time intervals, the phage treated sample was subjected to assess the activity of
target bacteria. Sewage sample was taken as control. The following are the treatment sets
prepared for the study.
T1 - Sewage water with bacterial isolate
T2 – T1 and host specific bacteriophages
3.15. Physical characterisation of isolated bacteriophages
The effect of heat, sunlight and UV light on survivability of phage was determined
at different time intervals.
3.15.1. Effect of heat
To determine the heat stability, purified phage preparation was subjected to the
test temperature (400C and 600C) in water bath. After periodic time intervals, (i.e. 5, 10,
30, 60, 120 and 180 min) the aliquots (100µl) were subjected to the phage titre (PFU/ml)
estimation as per procedure described in 3.11.3 to estimate the survivability of the phage.
70
3.15.2. Effect of sunlight
The phage should be treated under sunlight in order to estimate the survivability
of phages in sunlight. The purified phage preparation was subjected to direct sunlight.
After various time intervals (15, 30, 60, 120 and 180 minutes) the aliquots were subjected
to the phage titre (PFU/ml) estimation as per procedure described previously to estimate
the survivability of the phage.
3.15.3. Effect of UV light
The phage should be treated with UV light in order to estimate the survivability
of phages under UV light. The purified phage preparation was treated with UV light at
room temperature. After various time intervals (1, 3 and 5 minutes) the aliquots were
subjected to the phage titre (PFU/ml) to estimate the survivability of the phage.
3.16. Chemical characterization of isolated bacteriophages
Effect of some commonly available chemicals, viz., Sodium doDecyl Sulphate
(0.1% and 1%), phenol (1% and 5% aqueous), chloroform (5% and 10%) and formalin
(40%) on survivability of bacteriophage was observed.
3.16.1. Effect of SDS (0.1% and 1%)
The purified phage preparation was mixed with an equal amount of SDS and
incubate at 37o C. After 5, 10, 15 and 30 min of incubation, the aliquots were subjected
to the phage titre (PFU/ml) to estimate the survivability of the phage.
3.16.2. Effect of phenol (1% and 5% aqueous)
The purified phage preparation was mixed with an equal amount of phenol
(aqueous) and incubated at 37o C. After 10, 15 min and 30 min of incubation, the aliquots
were subjected to the phage titre (PFU/ml) to estimate the survivability of the phage.
71
3.16.3. Effect of chloroform (5% and 10%)
The purified phage preparation was mixed with an equal amount of chloroform
and incubated at 37o C. After 1, 3, 5 and 15 min of incubation, the aliquots were subjected
to the phage titre (PFU/ml) estimation.
3.16.4. Effect of formalin (40%)
The purified phage preparation was mixed with an equal amount of formalin and
incubated at 37o C. After 5, 10, 15 and 30 min of incubation, the aliquots were subjected
to the phage titre (PFU/ml) to estimate the survivability of the phages.
3.17. Molecular characterisation of the lytic bacteriophage
3.17.1 Phage DNA isolation
The extraction of Phage DNA was carried out by the method of Sambrook and
Russel (2001) with some modifications. Briefly, 400 µl of lysate was transferred to 1.5
ml of micro centrifuge tube and was incubated at 560C for one hour with proteinase K at
a final concentration of 50 µl/ml, 0.5M Ethylene Diamino Tetra Acetic acid (EDTA) at a
final concentration of 20 mM and 10% Sodium do Decyl Sulphate (SDS) at a final
concentration of one percent. After incubation, the digestion mix in the tube was cooled
to room temperature. Afterwards the suspension was extracted with equal volumes of
phenol: chloroform: isoamyl alcohol (25:24:1 v/v). The phases were separated by
centrifugation (Sigma 3K30, Germany) at 13000 rpm for 5 min at room temperature. The
upper aqueous layer was transferred to a clean tube using wide-bore pipette. To this,
double volume of absolute ethanol and 3 M sodium acetate (pH:7) to a final concentration
of 0.3 M were added, followed by incubation at room temperature for 30 min. After
incubation, the precipitated DNA was collected by centrifugation at 13000 rpm for 10
min at 40C. The supernatant was discarded and then added 500 µl of 70% ethanol to wash
72
the nucleic acid pellet. Then centrifuged at 13000 rpm for 10 min at room temperature.
The pellet was dried and dissolved in a minimal volume of Tris-EDTA (TE) buffer.
3.17.2 Restriction endonucleases digestion analysis
The restriction pattern of the Phage DNA was studied using the enzyme, EcoRI
(Chromous biotech, REN 009A). Enzyme digestion was performed as recommended by
the manufacturer. For digestion, each 20 µl digestion solution containing approximately
1 µg of bacteriophage DNA and 1U of the restriction enzyme in reaction buffer, was
incubated for 90 min at 370C. The restriction enzyme digested DNA sample were loaded
onto 1.2% agarose gel in TBE buffer by mixing loading buffer. Electrophoresis of
restriction enzyme digested samples were carried out along with lambda DNA ladder
(Chromous biotech, MAN 05) by applying 50 V current for 2 h. molecular weight of
Phage DNA fragment was calculated by plotting distance of migration against molecular
weights of marker.
3.18. Morphological characterization
Morphological characterization of bacteriophage particles was carried out by
using scanning electron microscopy (SEM). The phage particles were fixed in 2.5%
glutaraldehyde (pH 7.2) in 0.1 M phosphate buffer (pH 7.2) for 24 h at 40C. Remaining
Post fixation done in 2% aqueous osmium tetraoxide for 4 h. Dehydration steps were
carried out in series of graded alcohols (50%, 70%, 80%, 90% and 100%) and dried to
critical point drying with CPD unit. The processed samples were mounted over the stubs
with double sided carbon conductivity tape and a thin layer of gold coat over the samples
were done by using an automated sputter coater (model: JEOL JFC 1600) for 3 min and
scanned under scanning electron microscope (SEM model: JOEL- JSM 5600) at required
magnifications as per standard procedures at RUSKA lab’s, College of Veterinary
Science, PVNR TVU, Rajendranagar, Hyderabad, India.
73
CHAPTER IV
RESULTS
A total of 128 samples from different sources viz: organized dairy farms (n=28),
unorganized dairy farms (n= 32) and animal sheds (n=68) maintained by the farmers with
two to five number of cattle in and around Tirupati, Chittoor District, Andhra Pradesh
were collected between January 2016 and March 2016 and analysed.
4.1. Isolation of Escherichia coli
All the sewage and waste water samples collected from different organized,
unorganized dairy farms and also from the animal sheds were inoculated into tryptic soy
broth and incubated at 370C for 24 hrs. After the incubation period a loop full of inoculum
from tryptic soy broth tubes was streaked on MacConkey agar and Eosine methylene blue
agar plates by following all the aseptic precautions. The plates were incubated at 370C for
48 hrs. The plates were observed for pink colonies on MacConkey agar (Fig. 1) and small
dark colonies with green metallic sheen on Eosine methylene blue agar plates (Fig. 2).
All the 128 samples were positive for E. coli by culture method and were subjected to
Gram’s staining and found Gram negative, coccobacillary rods (Fig. 3).
4.2. Biochemical characterization of Escherichia coli
The biochemical reactions of all the isolates were given in Table 4.1. The isolates
were subjected to the biochemical tests like IMViC tests, urease test and triple sugar iron
agar tests.
All the isolates were positive for indole and methyl red tests, where the isolates
have produced red colour ring in indole test (Fig. 4) and red colour in methyl red test.
(Fig-5) and all isolates were negative for voges-proskauer (Fig. 6) and citrate utilization
tests (Fig-7). Further all the isolates were subjected to triple sugar iron agar test (Fig-8),
and urease test (Fig-9). The results revealed that all the isolates were negative for urease
74
test and positive for triple sugar iron agar test where the isolates have produced acid butt
and acid slant and also gas. All these isolates were also subjected to motility test and they
showed growth away from the line of inoculation (Fig-10). All the biochemical reactions
confirmed the presence of Escherichia coli.
Table 4.1. Results of the biochemical tests for Escherichia coli isolates
S. No Name of the
biochemical test
Total number of
samples screened
No of isolates positive
for the biochemical
tests
1 Gram’s staining 128 128
2 Indole test 128 128
3 Methyl red test 128 128
4 Voges-proskauer test 128 00
5 Citrate utilization test 128 00
6 Urease test 128 00
7 Triple sugar iron agar
test (Y/Y/H2S-) 128 128
8 Motility test 128 128
75
76
77
78
79
80
4.3. Antimicrobial sensitivity testing
To detect the resistant and sensitivity pattern of Escherichia coli from different
sources, in-vitro antibiotic sensitivity was carried out by disc diffusion as per the method
of Bauser et al. (1966) by using 14 commercially available antibiotic discs. Muller Hinton
agar plates showing the sensitivity, intermediate sensitivity and the resistance patterns of
various antibiotic discs were shown in Table 4.2 and Figure. 11 and 12.
A total of 98 isolates were resistant to different antibiotic discs used in this study.
The sensitivity patterns of the isolates for various antibiotic discs are presented in Table
4.3. Among the 128 isolates no isolates, was completely sensitive to any of the antibiotic
test discs used in this study. Maximum resistance was observed for ampicillin (92.19%),
Penicillin-G (76.56%), cefotaxime (71.10%), streptomycin (64.84%), gentamicin
(64.06%), chloramphenicol (57.81%), tetracycline (54.69%), cefoperazone (51.56%),
ofloxacin (44.53%), cefadroxil (39.06%), ciprofloxacin (38.28%), azithromycin
(30.40%), meropenem (27.34%), and tigecycline (20.31%) (Table 4.3).
81
Table. 4.2: Antimicrobial sensitivity/intermediate/resistant-patterns of Escherichia coli from different sources
S. No Antimicrobial agent Pattern of antibiogram
Sensitive (%) Intermediate (%) Resistant (%)
1 Ampicillin 06 (4.68%) 04 (3.13%) 118 (92.19%)
2 Gentamycin 24 (18.75%) 12 (9.37%) 82 (64.06%)
3 Streptomycin 23 (17.96%) 12 (9.37%) 83 (64.84%)
4 Ciprofloxacin 63 (49.22%) 16 (12.50%) 49 (38.28%)
5 Chloramphenicol 31 (24.22%) 23 (17.97%) 74 (57.81%)
6 Penicillin-G 30 (23.44%) 00 (0.00%) 98 (76.56%)
7 Cefoperazone 48 (37.50%) 14 (10.94%) 66 (51.56%)
8 Cefotaxime 20 (15.62%) 17 (13.28%) 91 (71.09%)
9 Tigecycline 91 (71.10%) 11 (8.59%) 26 (20.31%)
10 Meropenem 76 (59.37%) 17 (13.28%) 35 (27.34%)
11 Azithromycin 63 (49.22%) 29 (22.65%) 38 (29.69%)
12 Cefadroxil 44 (34.37%) 34 (26.56%) 50 (39.06%)
13 Ofloxacin 45 (35.15%) 26 (20.31%) 57 (44.53%)
14 Tetracycline 36 (28.12%) 22 (17.19%) 70 (54.69%)
82
Table.4.3. Antibiotic resistant among Escherichia coli (source wise)
S.No Antimicrobial agent % of resistance in
Total Organized Unorganized Animal sheds
1 Ampicillin 24 (85.71%) 31 (96.87%) 63 (92.65%) 118 (92.19%)
2 Gentamycin 12 (42.86%) 12 (37.50%) 58 (85.29%) 82 (64.06%)
3 Streptomycin 16 (57.14%) 11 (34.37%) 56 (82.35%) 83 (64.84%)
4 Ciprofloxacin 09 (32.14%) 12 (37.50%) 28 (41.18%) 49 (38.28%)
5 Chloramphenicol 18 (64.28%) 11 (34.37%) 45 (66.18%) 74 (57.81%)
6 Penicillin-G 19 (67.85%) 28 (87.50%) 51 (75.00%) 98 (76.56%)
7 Cefoperazone 07 (25.00%) 15 (46.87%) 44 (64.71%) 66 (51.56%)
8 Cefotaxime 11 (39.28%) 23 (71.87%) 57 (83.82%) 91 (71.09%)
9 Tigecycline 06 (21.43%) 08 (25.00%) 12 (17.65%) 26 (20.31%)
10 Meropenem 03 (10.71%) 10 (31.25%) 22 (32.35%) 35 (27.34%)
11 Azithromycin 08 (28.57%) 12 (37.50%) 18 (26.47%) 38 (29.69%)
12 Cefadroxil 11 (39.28%) 16 (50.00%) 23 (33.82%) 50 (39.06%)
13 Ofloxacin 12 (42.86%) 14 (43.75%) 31 (45.59%) 57 (44.53%)
14 Tetracycline 18 (64.28%) 18 (56.25%) 54 (79.41%) 70 (54.69%)
83
84
4.4. Sorbitol MacConkey agar plate test (SMAC)
For the phenotypic detection of Shiga toxin producing Escherichia coli, all the
Escherichia coli isolates from different sources were streaked on SMAC plates and the
plates were incubated at 370C for 24 hr. The results revealed that none of the isolates have
shown colourless colonies on SMAC plates but a total of 108 isolates have shown pink
colonies.
4.5. Standardization of multiplex PCR for primers ofstx1, stx2, eaeA and hlyA genes
to detect shiga toxin producing Escherichia coli.
Initial experiments to optimize PCR reaction conditions for Escherichia coli
template involved the empirical variation of annealing temperature (580C – 630C),
concentration of primer (5 – 15 p mol), magnesium chloride (1 mM – 3 mM), template
volume (2µl - 8 µl) and the cycling conditions. Optimal results were obtained using 5 µl
of bacterial lysate or 20 ng of diluted DNA as template in a reaction mixture consisting
of 2.5 µl of 10X assay buffer for Taq polymerase containing 2.0 mM magnesium chloride,
1 µl of dNTP mix, 0.25 µl of each primer and 1 U of Taq DNA polymerase in a final
reaction volume made up to 25 µl with molecular grade water (Table 4.4).
Table 4.4: Components of reaction mixture used in PCR assay
S. No. Name of the reagent Quantity (µl)
1. 10 X PCR buffer 2.5 µl
2. d NTP mix 0.2 µl
3. Primer – F(10 p.mol) 0.25 µl ×4
4. Primer – R(10 p.mol) 0.25 µl ×4
5. Taq DNA polymerase 0.3 µl
6. 25 mM Magnesium Chloride 2.0 µl
7. Template DNA 5.0 µl
8. Nuclease free water 13.0 µl
85
Initial denaturation at 950C for five minutes followed by 35 cycles each of
denaturation at 940C for 45 seconds, annealing at 590C for 45 seconds and extension at
720C for one minutes with a final extension period of six minutes at 720C was found to
be optimum for obtaining the desired PCR amplification of 180 bp for stx1, 255 bp for
stx2, 384 bp for eaeA and 534 bp for hlyA gene of shiga-toxin producing E. coli (Table
4.5).
Table 4.5. PCR conditions used for multiplex PCR assay
S. No. Step Temperature Duration No. of cycles
1 Initial denaturation 950C 5 min 1
2 Final denaturation 940C 45 sec
35 3 Annealing 590C 45 sec
4 Initial extension 720C 1 min
5 Final extension 720C 6 min 1
6 Hold 40C --- ---
4.5.1. Screening of the samples from dairy farm sewage and waste water:
The results of the detection of Shiga toxin producing Escherichia coli by PCR
method are shown in Fig-13 (Organized Dairy farms), Fig-14 (Unorganized dairy farms)
and Fig-15 (Animal sheds) respectively.
Out of 28 samples from the organized dairy farm of Tirupati and surrounding
villages, 28 (100.00%) were positive for Escherichia coli by culture method (Table 4.6).
Out of 28 positives one (3.57%) sample was positive for Shiga toxin producing E.coli by
PCR method and this isolate carried stx1 gene.
Out of 32 samples from the unorganized dairy farms in and around Tirupati, all
the 32 samples (100.00%) were positive for Escherichia coli by culture method (Table
4.6). Out of 32 positives two (6.25%) samples were positive for Shiga toxin producing E.
86
coli by PCR method. Among the two (2) Shiga toxin producing E. coli, one isolate carried
stx1 gene, whereas another isolate carried stx1, stx2 and eaeA genes.
All 68 samples from the animal sheds were positive for Escherichia coli by culture
method (Table 4.6). Out of which eight (11.76%) samples were positive for Shiga toxin
producing E.coli by PCR method. Among the eight Shiga toxin producing E. coli, three
isolates carried stx1, four isolates carried stx2 and one isolate carried both stx1and
stx2genes.
87
Table 4.6: screening and comparison of culture method for detection of Escherichia coli and multiplex PCR for detection of Shiga-toxin
producing E. coli
S.No Source
No. of
samples
screened
No. of
E. coli by
culture
method
Total No. of
samples
positive for
PCR
Multiplex PCR for stx1, stx2, eaeA and hlyA genes
stx1 stx2 eaeA hlyA stx1 and stx2 stx1, stx2
and eaeA
1 Organized
dairy farms 28 28 01 (3.57%) 01 (3.57%) 00 00 00 00 00
2 Unorganized
dairy farms 32 32 02 (6.25%) 01 (3.13%) 00 00 00 00 01 (3.13%)
3 Animal sheds 68 68 08 (11.76%) 03 (4.41%) 04 (5.88%) 00 00 01 (1.47%) 00
Grand total 128 128 11 (8.59%) 05 (3.90%) 04 (3.13%) 00 00 01 (0.78%) 01 (0.78%)
88
89
90
4.6. Isolation of E. coliphage and its characterization:
4.6.1. Collection and processing of samples:
A total of 128 sewage samples were collected from organized, unorganized dairy
farms and animal sheds in and around Tirupati, Chittoor district, Andhra Pradesh and
processed for E. coliphages isolation. E. coli isolated from the sewage samples were used
for isolation of bacteriophages.
4.6.2 Isolation of E. coliphages:
A total of 22 E. coliphages were isolated from a total of 128 sewage samples
processed for isolation (Fig. 16). The source farm wise, sample wise presented in
Annexure-IV. The plaques, on secondary streaking on the E. coli lawn gave the clearing
zone around the streak lines (Fig. 17).
4.6.3. Plaque morphology:
The observed plaques were discrete, clear and circular in shape with a diameter
of 0.1 to 3mm (Fig. 18).
4.7. Physical characterization of E.coliphages
4.7.1. Heat:
The effect of heat on the activity of E. coliphages revealed that at 400C phage titre
was completely reduced within three hours (Table 4.7). At 600C temperature treatment
completely inactivated the phages within 30 min (Table 4.8). The graphical representation
of heat effect on the activity of bacteriophages was shown in Fig. 19.
4.7.2. Sunlight
The effect of sunlight on the activity of phages showed that exposure to direct
sunlight gradually decreased the phage concentration and within three hours E.coliphages
titre was completely reduced (Table 4.9). The graphical representation of sunlight effect
on the activity of bacteriophages was shown in Fig. 20.
91
4.7.3. UV light:
Exposing the phages to the UV light for five minutes causes complete inactivation
of bacteriophages (Table 4.10). The graphical representation of U V light effect on the
activity of bacteriophages was shown in Fig. 21.
4.8. CHEMICAL CHARACTERIZATION
4.8.1. SDS
The effect of SDS treatment on the activity of E.coliphages revealed that both 1%
and 0.1%concentrations of SDS completely inactivated the phage within 15 minutes at
370C (Table 4.11 & 4.12). The graphical representation of SDS effect on the activity of
bacteriophages was shown in Fig. 22.
4.8.2. Phenol
The effect of phenol treatment on the activity of E. coliphages revealed that the
phages were completely inactivated by phenol within 30 min and 15 min at 1% and 5%
concentration respectively. (Table 4.13 & 4.14). The graphical representation of phenol
effect on the activity of bacteriophages was shown in Fig. 23.
4.8.3. Chloroform
The effect of chloroform treatment on the activity of E. coliphages showed that
5% and 10% concentrations of chloroform completely inactivated the E. coliphages
within five and three minutes respectively at 370C (Table 4.15 & 4.16). The graphical
representation of chloroform effect on the activity of bacteriophages was shown in Fig.
24.
4.8.4. Formalin
The effect of formalin treatment on the activity of E. coliphages showed that 40%
concentration of formalin completely inactivated the E. coliphages within 15 min at 370C
(Table 4.17). The graphical representation of formalin effect on the activity of
bacteriophages was shown in Fig. 25.
92
Table 4.7: Effect of 400C temperature on the activity of phage
Samp
le no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage with respect to control
00 min 05 min 10 min 15 min 30 min 60 min 120 min 180
min
1. 2.6x104 2.48x104 (95.38%) 2.28x104 (87.69%) 1.6x104 (61.54%) 1.12x104 (43.08%) 5.7x103 (21.92%) 2.4x103 (9.23%) 00
6. 2.52 x104 2.36x104 (93.65%) 2.2x104 (87.30%) 1.52x104 (60.32%) 1.04x104 (41.27%) 5.4x103 (21.43%) 2.0x103 (7.93%) 00
11. 5.6 x103 5.3x103 (94.64%) 4.9x103 (92.45%) 3.5 x103 (62.50%) 2.5x103 (44.64%) 1.2x103 (21.43%) 0.5x103 (8.92%) 00
13. 2.64 x104 2.44x104 (92.42%) 2.32x104 (87.88%) 1.64x104 (62.12%) 1.16x104 (43.94%) 5.4x103 (20.45%) 2.5x103 (9.46%) 00
16. 2.96 x104 2.8x104 (94.59%) 2.56x104 (86.49%) 1.84x104 (62.16%) 1.32x104 (44.59%) 6.3x103 (21.28%) 3.1x103(10.47%) 00
18. 1.08 x104 1.02x104 (94.44%) 9.3x103 (86.11%) 6.7x103 (62.04%) 4.6x103 (42.59%) 2.4x103 (22.22%) 1.2x103(11.11%) 00
23. 2.08 x104 1.92x104 (92.31%) 1.84x104 (88.46%) 1.28x104 (61.54%) 9.1x103 (43.75%) 4.2x103 (20.19%) 2.3x103(11.05%) 00
26. 2.4 x104 2.24x104 (93.33%) 2.12x104 (88.33%) 1.48x104 (61.67%) 1.08x104 (45.00%) 5.3x103 (22.08%) 2.8x103(11.66%) 00
29. 1.92 x104 1.84x104 (95.83%) 1.72x104 (89.58%) 1.16x104 (60.62%) 8.6x103 (44.79%) 3.9x103 (20.31%) 1.8x103 (9.37%) 00
31. 1.52 x104 1.44x104 (94.73%) 1.32x104 (86.84%) 9.5x103 (62.50%) 6.3x103 (41.45%) 3.2x103 (21.05%) 1.5x103 (9.86%) 00
33. 1.68 x104 1.6x104 (95.24%) 1.44x104 (85.71%) 1.04x104 (61.91%) 7.3x103 (43.45%) 3.6x103 (21.42%) 1.6x103 (9.52%) 00
42. 2.72 x104 2.52x104 (92.65%) 2.36x104 (86.76%) 1.68x104 (61.77%) 1.2x104 (44.12%) 6.0x103 (22.05%) 3.1x103(11.39%) 00
51. 1.96 x104 1.84x104 (93.88%) 1.72x104 (87.76%) 1.2x104 (61.22%) 8.5x103 (43.37%) 4.1x103 (20.91%) 2.0x103 (10.2%) 00
53. 2.56 x104 2.4x104 (93.75%) 2.2x104 (85.94%) 1.58x104 (61.72%) 1.12x104 (43.75%) 5.7x103 (22.26%) 3.0x103(11.71%) 00
55. 2.88 x104 2.72x104 (94.44%) 2.52x104 (87.50%) 1.8x104 (62.50%) 1.29x104 (44.79%) 5.8x103 (20.13%) 2.5x103 (8.68%) 00
58. 2.48 x104 2.36x104 (95.16%) 2.16x104 (87.10%) 1.56x104 (62.90%) 1.04x104 (41.94%) 5.4x103 (21.77%) 2.3x103 (9.27%) 00
64. 2.08 x104 1.96x104 (94.23%) 1.84x104 (88.46%) 1.28x104 (61.54%) 9.1x103 (43.75%) 4.7x103 (22.59%) 2.2x103(10.57%) 00
82. 3.44 x104 3.28x104 (95.35%) 2.96x104 (86.05%) 2.12x104 (61.63%) 1.52x104 (44.18%) 7.3x103 (21.22%) 3.5x103(10.17%) 00
95. 1.88 x104 1.76x104 (93.62%) 1.64x104 (87.23%) 1.16x104 (61.70%) 8.2x103 (43.61%) 4.0x103 (21.27%) 1.7x103 (9.04%) 00
107. 9.2 x103 8.7x103 (94.57%) 7.9x103 (85.87%) 5.6x103 (60.87%) 3.8x103 (41.30%) 1.9x103 (20.65%) 1.0x103(10.86%) 00
119. 4.8 x103 4.5x103 (93.75%) 4.3x103 (89.58%) 2.9x103 (60.42%) 2.1x103 (43.75%) 1.0x103 (20.83%) 00 00
127. 2.8 x104 2.64x104 (94.29%) 2.48x104 (88.57%) 1.76x104 (62.86%) 1.24x104 (44.28%) 6.2x103 (22.14%) 2.6x103 (9.28%) 00
Avera
ge % 100% 94.19% 87.62% 61.72% 43.51% 21.34% 9.53% 0%
93
Table 4.8: Effect of 600C temperature on the activity of phage
Sample
no. PFU/ml ( at 10-1 dilution) at various time intervals and Percentage with respect to control
00 min 05 min 10 min 15 min 30 min
1. 2.6x104 1.2 x104 (46.15%) 2.3 x103 (8.84%) 00 00
6. 2.52 x104 1.24 x104 (49.20%) 1.7 x103 (6.74%) 00 00
11. 5.6 x103 2.6 x103 (46.42%) 00 00 00
13. 2.64 x104 1.31 x104 (49.62%) 2.1 x103 (7.95%) 00 00
16. 2.96 x104 1.36 x104 (45.94%) 2.7 x103 (9.12%) 0.7 x103 (2.36%) 00
18. 1.08 x104 5.1 x103 (47.22%) 0.8 x103 (7.40%) 00 00
23. 2.08 x104 1.02 x104 (49.03%) 1.4 x103 (6.73%) 00 00
26. 2.4 x104 1.12 x104 (46.66%) 2.2 x103 (9.16%) 00 00
29. 1.92 x104 8.4 x103 (43.75%) 1.1 x103 (5.72%) 00 00
31. 1.52 x104 7.6 x103 (50.00%) 0.9 x103 (5.92%) 00 00
33. 1.68 x104 7.2 x103 (42.85%) 1.0 x103 (5.95%) 00 00
42. 2.72 x104 1.32 x104 (48.52%) 1.9 x103 (6.98%) 00 00
51. 1.96 x104 8.8 x103 (44.89%) 1.3 x103 (6.63%) 00 00
53. 2.56 x104 1.16 x104 (45.31%) 2.0 x103 (7.81%) 0.6 x103 (2.34%) 00
55. 2.88 x104 1.32 x104 (45.83%) 2.8 x103 (9.72%) 1.3 x103 (4.51%) 00
58. 2.48 x104 1.2 x104 (48.38%) 2.1 x103 (8.46%) 00 00
64. 2.08 x104 9.8 x103 (47.11%) 1.1 x103 (5.28%) 00 00
82. 3.44 x104 1.62 x104 (47.09%) 2.9 x103 (8.43%) 1.5 x103 (4.36%) 00
95. 1.88 x104 8.0 x103 (42.55%) 1.3 x103 (6.91%) 00 00
107. 9.2 x103 3.9 x103 (42.39%) 0.7 x102 (7.60%) 00 00
119. 4.8 x103 1.9 x103 (39.58%) 00 00 00
127. 2.8 x104 1.28 x104 (45.71%) 2.3 x103 (8.21%) 00 00
Averag
e % 100% 46.10% 6.79% 0.61% 0.00%
94
Table 4.9: Effect of sunlight on the activity of phage
Sam
ple
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage with respect to control
00 min 05 min 10 min 15 min 30 min 60 min 120 min 180
min
1. 2.6x104 2.39x104 (91.92%) 2.07x104 (79.61%) 1.48x104 (56.92%) 1.16x104 (44.61%) 7.9x103 (30.38%) 4.7x103 (18.07%) 00
6. 2.52x104 2.35x104 (93.25%) 1.97x104 (78.17%) 1.32x104 (52.38%) 1.13x104 (44.84%) 7.1x103 (28.17%) 5.1x103 (20.23%) 00
11. 5.6x103 5.1x103 (91.07%) 4.5x103 (80.35%) 3.1x103 (55.35%) 2.5x103 (44.64%) 1.7x103 (30.35% ) 1.1x103 (19.64%) 00
13. 2.64x104 2.43x104 (92.04%) 2.13x104 (80.68%) 1.36x104 (51.51%) 1.2x104 (45.45%) 8.3x103 (31.43%) 4.5x103 (17.04%) 00
16. 2.96x104 2.71x104 (91.55%) 2.33x104 (78.71%) 1.59x104 (53.71%) 1.32x104 (44.59%) 8.6x103 (29.05%) 5.7x103 (19.25%) 00
18. 1.08x104 9.8x103 (90.74%) 8.5x103 (78.70%) 5.9x103 (54.62%) 4.7x103 (43.51%) 3.4x103 (31.48%) 2.1x103 (19.44%) 00
23. 2.08x104 1.92x104 (92.30%) 1.64x104 (78.84%) 1.07x104 (51.44%) 9.6x103 (46.15%) 6.5x103 (31.25%) 3.6x103 (17.30%) 00
26. 2.4 104 2.21x104 (92.08%) 1.94x104 (80.83%) 1.24x104 (51.66%) 1.12x104 (46.66%) 7.2x103 (30.00%) 4.5x103 (18.75%) 00
29. 1.92x104 1.76x104 (91.66%) 1.56x104 (81.25%) 1.08x104 (56.25%) 8.4x103 (43.75%) 5.8x103 (30.20%) 3.5x103 (18.22%) 00
31. 1.52x104 1.39x104 (91.44%) 1.21x104 (79.60%) 7.9x103 (51.97%) 6.9x103 (45.39%) 4.7x103 (30.92%) 2.9x103 (19.07%) 00
33. 1.68x104 1.55x104 (92.26%) 1.37x104 (81.54%) 8.7x103 (51.78%) 7.3x103 (43.45%) 5.3x103 (31.54%) 3.2x103 (19.04%) 00
42. 2.72x104 2.43x104 (89.34%) 2.17x104 (79.77%) 1.49x104 (54.77%) 1.21x104 (44.48%) 8.1x103 (29.77%) 4.9x103 (18.01%) 00
51. 1.96x104 1.81x104 (92.34%) 1.59x104 (81.12%) 1.0x104 (51.02%) 8.6x103 (43.87%) 6.0x103 (30.61%) 4.0x103 (20.40%) 00
53. 2.56x104 2.28x104 (89.06%) 2.03x104 (79.29%) 1.4x104 (54.68%) 1.12x104 (43.75%) 7.6x103 (29.68%) 4.5x103 (17.57%) 00
55. 2.88x104 2.67x104 (92.70%) 2.33x104 (80.90%) 1.58x104 (54.86%) 1.27x104 (44.09%) 8.6x103 (29.86%) 5.6x103 (19.44%) 00
58. 2.48x104 2.31x104 (93.14%) 1.97x104 (79.43%) 1.36x104 (54.83%) 1.08x104 (43.54%) 7.9x103 (31.85%) 4.7x103 (18.95%) 00
64. 2.08x104 1.86x104 (89.42%) 1.62x104 (77.89%) 1.12x104 (53.84%) 9.2x103 (44.23%) 6.7x103 (32.21%) 3.8x103 (18.26%) 00
82. 3.44x104 3.12x104 (90.69%) 2.78x104 (80.81%) 1.8x104 (52.32%) 1.52x104 (44.18%) 1.02x104 (29.65%) 6.1x103 (17.73%) 00
95. 1.88x104 1.75x104 (93.08%) 1.48x104 (78.72%) 9.6x103 (51.06%) 8.1x103 (43.08%) 5.9x103 (31.38%) 3.3x103 (17.55%) 00
107. 9.2x103 8.4x103 (91.30%) 7.4x103 (80.43%) 4.9x103 (53.26%) 4.1x103 (44.56%) 2.9x103 (31.52%) 1.6x103 (17.39%) 00
119. 4.8x103 4.3x103 (89.58%) 3.8x103 (79.16%) 2.6x103 (54.16%) 2.1x103 (43.75%) 1.4x103 (29.16%) 0.8x102 (16.66%) 00
127. 2.8x104 2.59x104 (92.50%) 2.26x104 (80.71%) 1.48x104 (52.85%) 1.24x104 (44.28%) 8.2x103 (29.28%) 5.7x103 (20.35%) 00
Aver
age
% 100% 91.52% 79.84% 53.42% 44.40% 30.44% 18.56% 0%
95
Table 4.10: Effect of U.V light on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 01 min 03 min 05 min
1. 2.6x104 7.2 x103 (27.69%) 2.8 x103 (10.76%) 00
6. 2.52 x104 6.8 x103 (26.98%) 2.4 x103 (9.52%) 00
11. 5.6 x103 1.6 x103 (28.57%) 00 00
13. 2.64 x104 7.6 x103 (28.78%) 2.7 x103 (10.22%) 00
16. 2.96 x104 8.0 x103 (27.02%) 3.2 x103 (10.81%) 00
18. 1.08 x104 3.2 x103 (29.62%) 1.1 x103 (10.18%) 00
23. 2.08 x104 5.6 x103 (26.92%) 2.3 x103 (11.05%) 00
26. 2.4 x104 6.4 x103 (26.66%) 2.6 x103 (10.83%) 00
29. 1.92 x104 5.2 x103 (27.08%) 2.1 x103 (10.93%) 00
31. 1.52 x104 4.0 x103 (26.31%) 1.6 x103 (10.52%) 00
33. 1.68 x104 4.8 x103 (28.57%) 1.8 x103 (10.71%) 00
42. 2.72 x104 7.6 x103 (27.94%) 2.9 x103 (10.66%) 00
51. 1.96 x104 5.6 x103 (28.57%) 2.1 x103 (10.71%) 00
53. 2.56 x104 7.2 x103 (28.12%) 2.8 x103 (10.93%) 00
55. 2.88 x104 8.4 x103 (29.16%) 3.1 x103 (10.76%) 00
58. 2.48 x104 6.8 x103 (27.41%) 2.7 x103 (10.88%) 00
64. 2.08 x104 6.0 x103 (28.84%) 2.1 x103 (10.09%) 00
82. 3.44 x104 9.6 x103 (27.90%) 3.8 x103 (11.04%) 00
95. 1.88 x104 5.2 x103 (27.65%) 2.0 x103 (10.63%) 00
107. 9.2 x103 2.4 x103 (26.08%) 1.1 x103 (11.95%) 00
119. 4.8 x103 1.3 x103 (27.08%) 00 00
127. 2.8 x104 7.8 x103 (27.85%) 3.1 x103 (11.07%) 00
Average
% 100% 27.76% 9.73% 0.00%
96
Table 4.11: Effect of SDS (1%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 05 min 10 min 15 min
1. 2.6x104 9.3 x103 (35.76%) 3.3 x103 (12.69%) 00
6. 2.52 x104 8.7 x103 (34.52%) 3.1 x103 (12.30%) 00
11. 5.6 x103 1.9 x103 (33.92%) 0.5 x102 (8.92%) 00
13. 2.64 x104 9.5 x103 (95.98%) 3.0 x103 (11.36%) 00
16. 2.96 x104 1.09 x104 (36.82%) 4.1 x103 (13.85%) 00
18. 1.08 x104 3.7 x103 (34.25%) 00 00
23. 2.08 x104 7.4 x103 (35.57%) 2.5 x103 (12.01%) 00
26. 2.4 x104 8.5 x103 (35.41%) 2.3 x103 (9.58%) 00
29. 1.92 x104 7.3 x103 (38.02%) 1.9 x103 (9.89%) 00
31. 1.52 x104 5.6 x103 (36.84%) 2.2 x103 (14.47%) 00
33. 1.68 x104 5.8 x103 (34.52%) 1.7 x103 (10.11%) 00
42. 2.72 x104 9.7 x103 (35.66%) 3.7 x103 (13.60%) 00
51. 1.96 x104 6.9 x103 (35.20%) 2.3 x103 (11.73%) 00
53. 2.56 x104 9.4 x103 (36.71%) 2.9 x103 (11.32%) 00
55. 2.88 x104 1.07 x104 (37.15%) 3.0 x103 (10.41%) 00
58. 2.48 x104 8.6 x103 (34.67%) 3.3 x103 (13.30%) 00
64. 2.08 x104 7.3 x103 (35.09%) 2.6 x103 (12.50%) 00
82. 3.44 x104 1.19 x104 (34.59%) 3.7 x103 (10.75%) 00
95. 1.88 x104 6.7 x103 (35.63%) 1.8 x103 (9.57%) 00
107. 9.2 x103 3.3 x103 (35.86%) 1.1 x103 (11.95%) 00
119. 4.8 x103 1.5 x103 (31.25%) 00 00
127. 2.8 x104 1.04 x104 (37.14%) 3.8 x103 (13.57%) 00
Average
% 100% 35.48% 10.63% 0.00%
97
Table 4.12: Effect of SDS (0.1%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 05 min 10 min 15 min
1. 2.6x104 1.23 x104 (47.31%) 6.1 x103 (23.46%) 00
6. 2.52 x104 1.18 x104 (46.82%) 5.9 x103 (23.41%) 00
11. 5.6 x103 2.6 x103 (46.43%) 1.2 x103 (21.42%) 00
13. 2.64 x104 1.27 x104 (48.10%) 6.5 x103 (24.62%) 00
16. 2.96 x104 1.46 x104 (49.32%) 7.5 x103 (25.33%) 00
18. 1.08 x104 5.1 x103 (47.22%) 2.6 x103 (24.07%) 00
23. 2.08 x104 1.03 x104 (49.51%) 4.9 x103 (23.56%) 00
26. 2.4 x104 1.22 x104 (50.83%) 6.2 x103 (25.83%) 00
29. 1.92 x104 8.9 x103 (46.35%) 4.5 x103 (23.44%) 00
31. 1.52 x104 7.5 x103 (49.34%) 3.7 x103 (24.34%) 00
33. 1.68 x104 8.0 x103 (47.61%) 4.3 x103 (25.59%) 00
42. 2.72 x104 1.39 x104 (51.10%) 6.4 x103 (23.52%) 00
51. 1.96 x104 9.4 x103 (47.95%) 4.5 x103 (22.95%) 00
53. 2.56 x104 1.24 x104 (48.43%) 6.3 x103 (24.60%) 00
55. 2.88 x104 1.43 x104 (49.65%) 6.8 x103 (23.61%) 00
58. 2.48 x104 1.15 x104 (46.37%) 6.3 x103 (25.40%) 00
64. 2.08 x104 1.01 x104 (48.56%) 4.8 x103 (23.07%) 00
82. 3.44 x104 1.78 x104 (51.74%) 9.0 x103 (26.16%) 00
95. 1.88 x104 8.9 x103 (47.34%) 4.4 x103 (23.40%) 00
107. 9.2 x103 4.5 x103 (48.91%) 2.1 x103 (22.82%) 00
119. 4.8 x103 2.3 x103 (47.91%) 1.1 x103 (22.91%) 00
127. 2.8 x104 1.39 x104 (49.64%) 6.9 x103 (24.64%) 00
Average
% 100% 46.29% 24.01% 0.00%
98
Table 4.13: Effect of phenol (1%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 10 min 15 min 30 min
1. 2.6x104 1.57 x104 (60.38%) 5.9 x103 (22.69%) 00
6. 2.52 x104 1.55 x104 (61.50%) 5.5 x103 (21.52%) 00
11. 5.6 x103 3.5 x103 (62.50%) 1.3 x103 (23.21%) 00
13. 2.64 x104 1.61 x104 (60.98%) 5.8 x103 (21.96%) 00
16. 2.96 x104 1.86 x104 (62.83%) 6.9 x103 (23.31%) 00
18. 1.08 x104 6.5 x103 (60.18%) 2.5 x103 (23.14%) 00
23. 2.08 x104 1.24 x104 (59.61%) 4.7 x103 (22.59%) 00
26. 2.4 x104 1.48 x104 (61.66%) 5.1 x103 (21.25%) 00
29. 1.92 x104 1.21 x104 (63.02%) 4.0 x103 (20.83%) 00
31. 1.52 x104 9.1 x103 (59.86%) 3.5 x103 (23.02%) 00
33. 1.68 x104 1.03 x104 (61.30%) 3.7 x103 (22.02%) 00
42. 2.72 x104 1.63 x104 (59.92%) 5.8 x103 (21.32%) 00
51. 1.96 x104 1.2 x104 (61.22%) 4.6 x103 (23.46%) 00
53. 2.56 x104 1.58 x104 (61.71%) 5.6 x103 (21.87%) 00
55. 2.88 x104 1.72 x104 (59.72%) 6.5 x103 (22.56%) 00
58. 2.48 x104 1.51 x104 (60.88%) 5.5 x103 (22.17%) 00
64. 2.08 x104 1.3 x104 (62.50%) 4.3 x103 (20.67%) 00
82. 3.44 x104 2.13 x104 (61.92%) 7.8 x103 (22.67%) 00
95. 1.88 x104 1.16 x104 (61.70%) 4.1 x103 (21.80%) 00
107. 9.2 x103 5.5 x103 (59.78%) 1.9 x103 (20.65%) 00
119. 4.8 x103 2.9 x103 (60.41%) 1.0 x103 (20.83%) 00
127. 2.8 x104 1.73 x104 (61.78%) 6.1 x103 (21.78%) 00
Average
% 100% 61.15% 21.15% 0.00%
99
Table 4.14: Effect of phenol (5%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 10 min 15 min
1. 2.6x104 8.9 x103 (34.23%) 00
6. 2.52 x104 8.2 x103 (32.53%) 00
11. 5.6 x103 1.8 x103 (32.14%) 00
13. 2.64 x104 8.9 x103 (33.71%) 00
16. 2.96 x104 1.03 x104 (34.79%) 00
18. 1.08 x104 3.5 x103 (32.40%) 00
23. 2.08 x104 6.5 x103 (31.25%) 00
26. 2.4 x104 8.2 x103 (34.16%) 00
29. 1.92 x104 6.3 x103 (32.81%) 00
31. 1.52 x104 4.8 x103 (31.57%) 00
33. 1.68 x104 5.9 x103 (35.11%) 00
42. 2.72 x104 8.8 x103 (32.35%) 00
51. 1.96 x104 6.7 x103 (34.18%) 00
53. 2.56 x104 8.1 x103 (31.64%) 00
55. 2.88 x104 9.4 x103 (32.63%) 00
58. 2.48 x104 8.6 x103 (34.67%) 00
64. 2.08 x104 6.4 x103 (30.76%) 00
82. 3.44 x104 1.16 x104 (33.72%) 00
95. 1.88 x104 5.9 x103 (31.38%) 00
107. 9.2 x103 3.0 x103 (32.60%) 00
119. 4.8 x103 1.5 x103 (31.25%) 00
127. 2.8 x104 9.5 x103 (33.92%) 00
Average
% 100% 32.90% 0.00%
100
Table 4.15: Effect of chloroform (5%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 01 min 03 min 05 min
1. 2.6x104 1.77 x104 (68.07%) 7.3 x103 (28.07%) 00
6. 2.52 x104 1.7 x104 (67.46%) 6.7 x103 (26.58%) 00
11. 5.6 x103 3.8 x103 (67.85%) 1.5 x103 (26.78%) 00
13. 2.64 x104 1.84 x104 (69.70%) 7.8 x103 (29.54%) 00
16. 2.96 x104 1.99 x104 (67.22%) 8.3 x103 (28.04%) 00
18. 1.08 x104 7.5 x103 (69.44%) 2.9 x103 (26.85%) 00
23. 2.08 x104 1.43 x104 (68.75%) 6.0 x103 (28.84%) 00
26. 2.4 x104 1.64 x104 (68.33%) 7.1 x103 (29.58%) 00
29. 1.92 x104 1.29 x104 (67.18%) 5.3 x103 (27.60%) 00
31. 1.52 x104 1.04 x104 (68.42%) 4.5 x103 (29.60%) 00
33. 1.68 x104 1.13 x104 (67.26%) 4.9 x103 (29.16%) 00
42. 2.72 x104 1.83 x104 (67.28%) 8.2 x103 (30.14%) 00
51. 1.96 x104 1.36 x104 (69.38%) 5.6 x103 (28.57%) 00
53. 2.56 x104 1.79 x104 (69.92%) 7.8 x103 (30.46%) 00
55. 2.88 x104 1.96 x104 (68.05%) 7.8 x103 (27.08%) 00
58. 2.48 x104 1.74 x104 (70.16%) 7.1 x103 (28.62%) 00
64. 2.08 x104 1.41 x104 (67.78%) 6.0 x103 (28.84%) 00
82. 3.44 x104 2.38 x104 (69.18%) 1.04 x104 (30.23%) 00
95. 1.88 x104 1.27 x104 (67.55%) 5.5 x103 (29.25%) 00
107. 9.2 x103 6.4 x103 (69.56%) 2.5 x103 (27.17%) 00
119. 4.8 x103 3.3 x103 (68.75%) 1.3 x103 (27.085%) 00
127. 2.8 x104 1.95 x104 (69.64%) 8.3 x103 (29.64%) 00
Average
% 100% 68.49% 28.56% 0.00%
101
Table 4.16: Effect of chloroform (10%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 01 min 03 min
1. 2.6x104 9.4 x103 (36.15%) 00
6. 2.52 x104 9.4 x103 (37.30%) 00
11. 5.6 x103 2.0 x103 (35.71%) 00
13. 2.64 x104 9.8 x103 (37.12%) 00
16. 2.96 x104 1.13 x104 (38.17%) 00
18. 1.08 x104 4.0 x103 (37.03%) 00
23. 2.08 x104 8.0 x103 (38.46%) 00
26. 2.4 x104 8.9 x103 (37.08%) 00
29. 1.92 x104 7.0 x103 (36.45%) 00
31. 1.52 x104 5.6 x103 (36.84%) 00
33. 1.68 x104 6.2 x103 (36.90%) 00
42. 2.72 x104 1.05 x104 (38.60%) 00
51. 1.96 x104 7.3 x103 (37.24%) 00
53. 2.56 x104 9.9 x103 (38.67%) 00
55. 2.88 x104 1.09 x104 (37.84%) 00
58. 2.48 x104 9.4 x103 (37.90%) 00
64. 2.08 x104 7.6 x103 (36.53%) 00
82. 3.44 x104 1.31 x104 (38.08%) 00
95. 1.88 x104 7.1 x103 (37.76%) 00
107. 9.2 x103 3.5 x103 (38.04%) 00
119. 4.8 x103 1.7 x103 (35.41%) 00
127. 2.8 x104 1.06 x104 (37.85%) 00
Average
% 100% 37.32% 0.00%
102
Table 4.17: Effect of formalin (40%) on the activity of phages
Sample
no.
PFU/ml ( at 10-1 dilution) at various time intervals and Percentage
with respect to control
00 min 05 min 10 min 15 min
1. 2.6x104 1.33 x104 (51.15%) 5.3 x103 (20.38%) 00
6. 2.52 x104 1.24 x104 (49.20%) 5.4 x103 (21.42%) 00
11. 5.6 x103 2.9 x103 (51.78%) 1.0 x103 (17.85%) 00
13. 2.64 x104 1.37 x104 (51.89%) 5.2 x103 (19.69%) 00
16. 2.96 x104 1.55 x104 (52.36%) 5.6 x103 (18.91%) 00
18. 1.08 x104 5.2 x103 (48.14%) 2.2 x103 (20.37%) 00
23. 2.08 x104 1.05 x104 (50.48%) 3.9 x103 (18.75%) 00
26. 2.4 x104 1.18 x104 (49.16%) 4.7 x103 (19.58%) 00
29. 1.92 x104 1.01 x104 (52.60%) 3.8 x103 (19.79%) 00
31. 1.52 x104 7.7 x103 (50.65%) 3.1 x103 (20.39%) 00
33. 1.68 x104 8.7 x103 (51.78%) 3.7 x103 (22.02%) 00
42. 2.72 x104 1.41 x104 (51.83%) 5.9 x103 (21.69%) 00
51. 1.96 x104 9.7 x103 (49.48%) 4.0 x103 (20.41%) 00
53. 2.56 x104 1.3 x104 (50.78%) 4.9 x103 (19.14%) 00
55. 2.88 x104 1.49 x104 (51.73%) 5.2 x103 (18.05%) 00
58. 2.48 x104 1.3 x104 (52.41%) 4.5 x103 (18.14%) 00
64. 2.08 x104 1.01 x104 (48.55%) 4.3 x103 (20.67%) 00
82. 3.44 x104 1.78 x104 (51.74%) 7.4 x103 (21.51%) 00
95. 1.88 x104 9.1 x103 (48.40%) 4.1 x103 (21.80%) 00
107. 9.2 x103 4.7 x103 (51.08%) 1.6 x103 (17.39%) 00
119. 4.8 x103 2.3 x103 (47.91%) 1.0 x103 (20.83%) 00
127. 2.8 x104 1.46 x104 (52.14%) 6.1 x103 (21.78%) 00
Average
% 100% 50.69% 20.02% 0.00%
103
104
Fig. 19: Effecct of heat on the activity of bacteriophages (%)
100%
94.19%
87.62%
61.72%
43.51%
21.34%
9.53%
0.00%
100%
46.10%
6.79%
0.61% 0.00% 0.00% 0.00% 0.00%0%
20%
40%
60%
80%
100%
120%
0 5 10 15 30 60 120 180
PE
RC
EN
TA
GE
MINUTES
40C 60C
105
Fig. 20: Effecct of sunlight on the activity of bacteriophages (%)
Fig. 21: Effect of UV light on the activity of bacteriophages (%)
100%
91.52%
79.84%
53.42%
44.40%
30.44%
18.56%
0.00%0%
20%
40%
60%
80%
100%
120%
0 5 10 15 30 60 120 180
PE
RC
EN
TA
GE
MINUTES
100%
27.76%
9.73%
0.00% 0.00% 0.00% 0.00%0%
20%
40%
60%
80%
100%
120%
0 1 3 5 10 15 30
PE
RC
EN
TA
GE
MINUTES
106
Fig. 22: Effect of SDS on the activity of bacteriophages (%)
Fig. 23: Effect of Phenol on the activity of bacteriophages (%)
100%
35.48%
10.63%
0.00% 0.00% 0.00%
100%
46.29%
24.01%
0.00% 0.00% 0.00%0%
20%
40%
60%
80%
100%
120%
0 5 10 15 30 60
PE
RC
EN
TA
GE
MINUTES
1% SDS 0.1% SDS
100%
61.15%
21.15%
0.00% 0.00%
100%
32.90%
0.00% 0.00% 0.00%0%
20%
40%
60%
80%
100%
120%
0 10 15 30 60
PE
RC
EN
TA
GE
MINUTES
1% Phenol 5% Phenol
107
Fig. 24: Effect of Chloroform on the activity of bacteriophages (%)
Fig. 25: Effect of Formalin on the activity of bacteriophages (%)
100%
68.49%
28.56%
0.00% 0.00% 0.00% 0.00%
100%
37.32%
0.00% 0.00% 0.00% 0.00% 0.00%0%
20%
40%
60%
80%
100%
120%
0 1 3 5 10 15 30
PE
RC
EN
TA
GE
MINUTES
5% Chloroform 10% Chloroform
100%
50.69%
20.02%
0.00% 0.00%0%
20%
40%
60%
80%
100%
120%
0 5 10 15 30
PE
RC
EN
TA
GE
MINUTES
108
4.9. Restriction Endonuclease digestion analysis
Phages appear to have similar profiles of the nucleic acid fragments generated
by digestion of their DNA with EcoRI. The patterns for those enzyme cleaved products
are shown in Fig. 26.
109
4.10. Morphological characterization of phages by SEM
The SEM observations of phage revealed that the phage had icosahedral head with
short tail (fig. 27). It was found that based on morphology the phage exhibited non-
contractile tail and belong to the order Caudovirales and family Podoviridae.
4.11. Activity of bacteriophages against target bacteria
The invitro experiment was carried out to know the lytic activity of bacteriophages
on E. coli isolated from different sewage samples. Sewage samples were inoculated with
their specific isolated phages, incubated and analysed at every five hours interval. The
results showed that there was a 100% reduction in the E. coli count after 10 h of incubation
(Table. 4.18).
Table 4.18: Activity of bacteriophages against E. coli isolated from sewage samples
Sample
No.
Escherichia coli count at
0 h 5 h 10 h 15 h
T1 T2 T1 T2 T1 T2 T1 T2
1. 13 21 141 14 211 00 65 00
6. 11 18 138 13 189 00 56 00
11. 7 11 82 8 122 00 29 00
13. 12 19 143 17 204 00 65 00
16. 15 24 169 19 275 00 73 00
18. 11 20 116 12 201 00 62 00
23. 13 19 137 13 228 00 67 00
26. 12 21 134 14 212 00 65 00
29. 8 12 94 11 145 00 38 00
31. 11 21 131 13 195 00 53 00
33. 9 17 102 11 156 00 49 00
42. 14 23 159 21 247 00 68 00
51. 15 27 163 27 286 00 79 00
53. 9 14 98 13 165 00 48 00
55. 12 23 139 17 217 00 71 00
58. 8 15 91 12 142 00 41 00
64. 7 13 75 9 121 00 37 00
82. 7 16 71 10 128 00 29 00
95. 13 26 146 16 236 00 59 00
107. 11 16 118 13 193 00 51 00
119. 15 29 171 31 267 00 81 00
127. 10 14 109 11 183 00 52 00
110
111
CHAPTER V
DISCUSSION
Escherichia coli is one of the common microbial flora of gastrointestinal tract of
animals and human beings but may become pathogenic to both. Although most isolates
of E. coli are non-pathogenic but they are considered as indicator of faecal contamination
in food and about 10 to 15% of intestinal coliforms are opportunistic and pathogenic
serotypes (Barnes and Gross 1997) and cause a variety of lesions in immunocompromised
hosts as well as in animals and other healthy human beings. Among the diseases some are
often severe and sometimes lethal infections such as meningitis, endocarditis, urinary
tract infection, septicaemia, epidemic diarrhoea of adults and children (Daini et al. 2005).
The World Health Organization estimates that 5 million children die each year as
a consequence of acute diarrhoea (Snyder and Merson, 1982). Escherichia coli is the
cause of a third of cases of childhood diarrhoea in developing and threshold countries
(Albert et al. 1995) and is also the most prominent cause of diarrhoea in travellers to
developing countries (Black, 1990). E. coli is also prominently associated with diarrhoea
in pet and farm animals. Due to its malleable genetic character, E. coli has one of the
widest spectra of disease of any bacterial species (Donnenberg, 2002). The recent
emergence of E. coli O157 as a major food pathogen is a lively reminder of its dynamic
character. Furthermore, Shigella species, the cause of dysentery, taxonomically constitute
a subspecies of E. coli. In addition, effective treatment and prevention measures are
lacking for E. coli diarrhoea. The mainstay of treatment is oral rehydration (Bhan et al.
1994). This simple and inexpensive measure has saved countless lives, but it does not
influence the natural course of disease and has no intrinsic antibacterial activity.
Antibiotic use is of doubtful value since resistance is widespread in E. coli, and vaccines
are still in the early development phase (Savarino et al. 2002). Water and sanitation
112
programmes could improve the quality of drinking water, but are prohibitively expensive
for many developing countries.
Furthermore, there are good historical reasons to single out E. coli diarrhoea for
phage therapy. As early as 1919, Felix d’Herelle, the co-discoverer of phages, advocated
their use for the treatment of bacterial diarrhoea (Summers, 1999, 2001). American
pharmaceutical companies sold phage-based therapy in the 1930s (Duckworth, 1999).
During World War II the German and Soviet armies used phages against dysentery and
the US army conducted classified research on it (Hausler, 2003). After the war the Eliava
Phage Institute in Tbilisi, Georgia, conducted a well-designed field study in the 1960s
that came close to the standards of a placebo-controlled clinical trial (Babalova et al.
1968). More recently, British scientists reported on the successful veterinary application
of E. coli phages in the 1980s (Smith and Huggins, 1982) and phage therapy is now back
in the headlines (Merril et al. 2003).
5.1. Polymerase chain reaction (PCR)
Several workers have used PCR with varied success for detection of STEC from
food and faecal samples using specific gene primers for targeting. Of the specific gene
sequences stx1, stx2, eaeA and hlyA genes have been most frequently targeted for PCR
based detection of STEC. In present study the stx1 and stx2 genes have been designated
as specific genes for shiga toxins, eaeA for intimin and hlyA for enterohaemolysins for
detection of STEC.
STEC strains have been found to produce a family of related cytotoxins known as
Shiga toxins (stxs), classified into two major classes, shiga toxin 1 and shiga toxin 2 coded
by stx1 and stx2 genes respectively. Members of the stx family are compound toxins
comprising a single catalytic 32 kDa A-subunit and a multimeric B-subunit that is
113
involved in the binding of the toxin to the specific glycolipid receptors on the surface of
the target cell (Fratamico and Bagi, 2012).
The ability to adhere to intestinal epithelial cells and to colonize the human
gut is undoubtedly one of the key determinants of virulence. It has been known for a
decade that certain strains of STEC are capable of causing attaching and effacing (AE)
lesion on enterocytes. Production of AE lesion is a multistep event initiated by adherence
of bacteria to the microvilli, transduction of a signal into enterocytes, which is followed
by aggregation of the cytoskeletal actin with effacement of microvilli leading to intimate
attachment of the bacteria to the cell surface. The formation of this AE lesion is mediated
by secreted and surface-arrayed bacterial proteins encoded by a pathogenicity island
called the locus for enterocyte effacement (LEE). LEE, which is inserted at 82 min in the
E. coli chromosome, includes the eaeA gene that encodes intimin, a 939-amino acid (outer
membrane) protein which mediates intimate attachment of the bacterium to the
enterocyte. (Momtaz et al. 2012).
Escherichia coli isolates of serogroups O157, O26 and O111 commonly produce
Ehx and it is therefore a useful epidemiological marker for potential stx-producing strains.
Scotland et al. (1990) showed that there was good correlation between Ehx production
and hybridization with the CVD419 probe and suggested that Ehx may be encoded on the
large plasmid (pO157) carried by many E. coli O157. A plasmid location for the toxin
was confirmed by Schmidt et al. (1994), and later studies have shown that the CVD419
probe hybridizes with part of the Ehx structural gene hlyA (Schmidt et al.1995). The
manner in which E-hly may contribute to the pathogenesis of EHEC disease is possibly
that haemoglobin released by the action of the haemolysin provides a source of iron.
For the detection of STEC, techniques have been developed to identify the stx1 and
stx2 which encodes shiga toxins, eaeA encodes intimin and hlyA genetic determinant that
encodes for enterohaemolysin. These assays utilize PCR techniques. PCR is generally
114
considered to be the most sensitive means of determining whether a faecal specimen or a
food sample contains STEC. Although direct extracts of faeces or foods can be used as
templates for PCR but the best results are usually obtained by testing extracts of primary
broth cultures (Cerqueira et al., 1999; Elder et al., 2000). Broth enrichment serves two
purposes: inhibitors in the sample are diluted and bacterial growth increase the number
of copies of the target sequence. Sensitivity is important when testing faecal samples,
because although STEC numbers may be very high in the early stages of infection, they
may drop dramatically as disease progresses. Sensitivity is also particularly important
when testing in suspected foods, at least for certain O111 and O157 STEC strains. Some
of the PCR assays for detection of STEC described to date use single pairs of primers
based on consensus sequences, which are capable of amplifying all stx-related gens. PCR
has also been used for the detection of genes encoding accessory STEC virulence factors
such as stx1, stx2, eae by Kobori et al. (2004). Similarly Kumar et al. (2004), Paton and
Paton (2005), Cho et al. (2006), Bhat et al. (2008), Dhanashree and Mallya (2008), El-
El-Jakee et al. (2009), Bonyadian et al. (2010), Sahilah et al. (2010), Bosilevac and
Koohmaraie (2011), Dutta et al. (2011), Botkin et al. (2012), Dastmalchi saei and
Ayremlon (2012), Virpari et al. (2013), Bakshi et al. (2014), Rasheed et al. (2014), Son
et al. (2014), Sudershan et al. (2014), Neher et al. (2016) and Panahee and Pourtaghi
(2016) utilized the PCR technique for the detection of STEC from water, food and faecal
samples and to detect stx1, stx2, eaeA and hlyA genes which encodes for shiga toxin,
intimin and enterohaemolysin production by STEC.
5.1.1. Standardization of PCR assay
The PCR procedure using stx1, stx2, eaeA and hlyA derived primers were
standardized by optimizing the annealing temperature, primer concentration, MgCl2
concentration, template volume and cyclic conditions. The specific PCR product of 180
bp for stx1, 255 bp for stx2, 384 bp for eaeA and 534 bp for hlyA were stored at -200C, as
115
it was observed that storage at a temperature of 40C for a longer period resulted in the
degradation of the product.
5.1.2. Detection of Shiga toxin Producing Escherichia coli by PCR:
Nucleic acid amplification by PCR has applications in many fields of biology and
medicine including the detection of viruses, bacteria and other infectious agents (Thiele
et al. 1990). In the present study, a oligonucleotide primer set was used which encodes
the Shiga toxins, intimin and enterohaemolysins produced by E.coli. Primers were
selected on the basis of published nucleotide sequence of the 180 bp for stx1, 255 bp for
stx2, 384 bp for eaeA and 534 bp for hlyA genes (Paton and Paton., 1998).
In the present investigation, only one E. coli isolated from the sewage water from
organized dairy farms in and around Tirupati (Table.4.7) exhibited stx1 (3.57%) gene
whereas all the remaining 27 isolates were negative for any of the genes that determines
STEC. E. coli isolated from the sewage water of unorganized dairy farms in and around
Tirupati revealed that out of 32 isolates only one isolate exhibited stx1 (3.13%) gene ,
where as another isolate was positive for a combination of stx1, stx2 and eaeA genes
(3.13%). The E. coli isolated from the sewage water of various animal sheds in and around
Tirupati exhibited stx1 and stx2 individually and also in combination. Among the 68 E.
coli isolates from various animal sheds three isolates have carries stx1 gene, four isolates
exhibited stx2 gene and one isolate has shown a combination of stx1 and stx2.
In the present investigation, it is clear that pathogenesis of STEC is multifactorial
and involves several virulence attributes of the organism. Rapid and sensitive methods
for detection of STEC are now in force; especially there has been advance in PCR
technology, which has increased the speed and has made it possible to quantitate the
number of STEC organisms present in a suspected sample. These results substantiate
those obtained by other methodological approaches followed by Ram et al. (2007), who
reported that 30% of the E. coli isolates from river Ganga water sources contained either
116
stx1 or stx2. Halabi et al. (2008) reported that only one E. coli isolate was found to contain
stx in the rural area of Austin. Ram et al. (2007), reported that stx genes were present in
22.7% of E. coli isolates obtained from the river Ganga. Duris et al. (2009) reported that
greater than 50% of faecal coliform isolates tested positive for stx2 DNA in river water
in Maryland. Waste water has been attributed to pollution of recreation and drinking water
in specific cases (Lienemann, et al. 2011), the general efflux of these to a water supply
remains unknown, especially in cases where water treatment facilities are in effect. Given
the ability of stx2-encoding phages to persist under thermal stress and chlorination, the
chronic release of these types of microbes to aquatic environments from wastewater
remains a possibility (Muniesa et al., 1999). However, attempts to relate stx gene or stx-
producing organism presence to indicators of wastewater or faecal pollution have failed
to show a correlation in many cases (Smith et al., 2009, Walters et al., 2011 and Haack
et al., 2009). This suggests that other factors besides general wastewater efflux explain
the presence of microbes harbouring or expressing stx in aquatic environments. These
limited studies set a wide range for which to compare stx distribution and abundance in
other waste water systems, will give information, which is important to know the
prevalence of stx-dependent illness arising from contamination of drinking water both in
animals and human beings.
In India, various studies conducted have found very little occurrence of STEC in
waste water, animals and humans. It is not clear that why the incidence of STEC is low
in India and other developing countries, despite having all the reservoirs and STEC in the
food chain. Some researchers have argued that under reporting of the incidence is the
cause, whereas other showed that due to the presence of pre-existing stx1, IgG antibodies
in asymptomatic cases offers positive protection against STEC infection (Karmali, 1989).
But the frequent isolation of STEC strains from non-human sources like animals, food
and other products along with the identification of multidrug resistance and virulence
117
genes across the Indian subcontinent poses a serious threat of the outbreaks that can occur
in the future.
5.2. Antibiotic resistant pattern of Escherichia coli by disc diffusion method:
Antibiotics are extensively used as growth promoters in livestock production or
to control infectious diseases. Anti-microbial abuse is considered to be the most vital
selecting force to antimicrobial resistance of bacteria. Moreover, antibiotic treatment is
considered the most important issue that promotes the emergence, selection and spreading
of antibiotic-resistant microorganisms in both veterinary and human medicine. It was
stated by well-established evidence that antibiotics can lead to the emergence and
dissemination of antibiotic resistant E. coli which can then be passed into people via food
or direct contact with infected animals. These resistant microbes may function as a
potential source in the transportation of antimicrobial resistance to human pathogens
E.coli isolated in this study was highly resistant to ampicillin (92.19%). The
results are comparable with Atere et al. (2015), who observed 89.6% of resistance to
ampicillin by the E. coli isolates, Niranjan and Malini (2014) observed 88.4% of
resistance to ampicillin by the E.coli isolates and Habrun et al. (2010) also observed the
antimicrobial sensitivity of E. coli isolated from the different organs of pigs in breeding
farm and they reported that 85% isolates were resistant to ampicillin, Vinita et al.(2010)
reported 94.29% of E.coli isolates were resistant to ampicillin, Anago et al. (2015)
observed 97.6% of resistance to ampicillin whereas Arabi and Banazadehi (2013)
observed the antibiotic resistance pattern of E. coli isolated from the urinary tract infected
patients and their results showed that 100% of isolates were resistance to ampicillin,
El-Rahman et al. (2015) also reported 100% resistance of E.coli isolates to ampicillin. A
little lesser resistance to ampicillin than in the present investigation was observed by
Nitika et al. (2014) and Mustika et al. (2015) who reported 81.4 % and 80.0%
respectively, and in contrast to the results obtained in this study Adenaike et al. (2016),
118
Zinnah et al. (2008), Eryılmaz et al. (2010), Bonnedahl et al. (2015),Melo et al. (2015)
and Aasmae et al. ( 2015), reported 69%, 59%, 56%, 30.1%,20.2% and 4.4% of resistance
among the E.coli isolates to ampicillin respectively.
In the present study 76.56% resistance was observed for penicillin-G and higher
resistance of 100% than the present study was reported by Sabir et al. (2014), Nontongana
et al. (2014), Maloo et al. (2014) and Mustika et al. (2015). Jeyasanta et al. (2012), who
also reported a little higher resistance of 82.41% to penicillin-G whereas low resistance
(63%) was reported by Chandrasekaran et al. (2014).
The E. coli isolates in this study exhibited 39.06% resistance to cefadroxil. Higher
resistance by E. coli isolates for this antibiotic was observed by Khan et al. (2014) who
observed 97.62% of resistance, Kumar et al. (2013) reported 88.52% of resistance, Rahim
et al. (2014) observed 85.71% of resistance and Mishra et al. (2013) observed 58.33% of
resistance to cefadroxil, whereas Bonnedahl et al. (2015)and Sundvall et al. (2014)
analysed the antibiotic resistance pattern of pathogenic E. coli and reported that only
15.1 % and 2.6% of isolates were resistant to cefadroxil respectively.
The resistance to cefotaxime by E. coli isolates was 71.10% in the present study.
Similar to the present investigation Ranjini et al. (2016) reported 71.42% of resistance to
cefotaxime. Very high resistance to cefotaxime was observed by Kumar et al. (2013) who
reported 90.16% of resistance, Arabi and Banazadehi (2013) who found 81.9% of
resistance and Vinita et al.(2010) reported 78.51% of resistance, when compared to the
results obtained in the present investigation. Hussain et al. (2015) observed 67% of
resistance, Raihan et al. (2014) observed 60% of resistance, Ali et al. (2014) reported
58.5% , Manikandan and Amsath (2014) found 58% of resistance, Anago et al. (2015)
reported 56.5% of resistance, Ferdosi et al. (2015) found 45.6% of resistance, El-Rahman
et al. (2015) who observed 40% of resistance, Sohail et al. (2015)found 29.50% of
119
resistance, which are less than the present study. Melo et al. (2015) reported very low
resistance (1.2%) to cefotaxime by E.coli isolates.
E.coli isolates in the present study have shown 51.56 % of resistance to
cefoperazone. Saeed et al. (2009) observed 65.5% of resistance, Mishra et al. (2013)
observed 66.66% of resistance and Ranjini et al. (2016) revealed 75.97% of resistance to
cefoperazone among the E.coli isolates, which are higher than the present study, on the
contrary Sohail et al. (2015) reported only 29.50% resistance, Asati (2013) observed 21%
of resistance and Tanvir et al. (2012) reported 13.2% of resistance by the E. coli isolates
towards cefoperazone.
In the present investigation the E.coli isolates have shown 27.43% of resistance to
the antibiotic meropenem. Similar to these studies a lower resistance to meropenem than
in the present study was observed by Nitika et al. (2014) who reported 25.4% of
resistance, Toroglu et al. (2005) observed 25% of resistance, Tanvir et al. (2012) reported
22.8% resistance and Sohail et al. (2015) reported 1.22% of resistance to meropenem
whereas Mishra et al. (2013) found 41.66% of resistance, Vij et al. (2014) observed
62.7% of resistance and Biswas et al. (2014) who observed 100% resistance to
meropenem by the E.coli isolates, which was considerably higher than the resistance
observed in the present investigation. On contrary Akter et al. (2016) reported zero (0%)
per cent resistance to meropenem by the E.coli isolates.
In the present study 64.06% of resistance was observed for gentamicin by the
isolates. Higher resistance to gentamycin than in the present investigation was observed
by Biswas et al. (2014) who observed 94.11% of resistance, Arabi and Banazadehi (2013)
found 82.5% of resistance, Vinita et al.(2010) reported 70.86% of resistance and Atere
et al. (2015) found a little higher resistance (68.8%) among the E. coli isolates, whereas
Manikandan and Amsath (2014) found 62.5% of resistance which is almost similar to the
present study. Comparatively lower resistance to gentamicin than in the present study was
120
observed by Ranjini et al. (2016) who reported 56.98% of resistance, Anago et al. (2015)
found 45.2% of resistance, Ferdosi et al. (2015) observed 36.8% of resistance, Zinnah et
al. (2008) reported that 32% of resistance, Sohail et al. (2015) revealed that 19.26% of
resistance, Alshara (2010) found 17.3% of resistance, El-Rahman et al. (2015)reported
10% of resistance, Eryulmaz et al. (2010) observed 9% of resistance and Ali et al. (2014)
who reported 5% of resistance among the E.coli isolates to gentamycin whereas 0%
resistance to gentamycin was observed by Akter et al. (2016).
Habrun et al. (2010) observed the antimicrobial sensitivity of E. coli isolated
from the different organs of pigs in breeding farm and reported that 91% of the isolates
were resistance to streptomycin and Stephan and Schumacher (2000) found only 17.07%
of susceptibility to streptomycin, whereas in the present study resistance to streptomycin
was observed only in 64.84% of the isolates. Higher resistance than the isolates of present
investigation was observed by Cergole-Novella et al. (2014) who reported 78.1% of
resistance and Saeed et al. (2009) observed 72.4% of resistance to streptomycin by the
E.coli isolates. Vladimir Pyatov et al. (2014) reported 48.6% resistance, Daniel et
al.(2012) observed 59.0%, whereas very low resistance levels viz. 30.0%, 20%, 11.0%
and 4.4% were reported by Sabir et al. (2014), Mustika et al. (2015), El-Shatoury et al.
(2015) and Aasmae et al. (2015) respectively.
The resistance of ciprofloxacin in the present study was 38.28%. The resistance to
ciprofloxacin in the present investigation was lower than the resistance reported by Anago
et al. (2015), Biswas et al. (2014), Ranjini et al. (2016), Arabi and Banazadehi (2013),
Ohieku and Magaji (2013), Kumar et al. (2013) and Atere et al. (2015) who reported
91.7%, 88.23%, 84.91%, 78%, 58%, 54.10% and 47.9% respectively, whereas lower
resistance of 33.60%, 24.6%, 15%, 14.5%, 10.6%, 10%, 8%, 4.7% and 2.9% was reported
by Sohail et al. (2015), Ferdosi et al. (2015), Eryulmaz et al. (2010), Alshara (2010),
Aminu and David (2015), El-Rahman et al. (2015), Zinnah et al. (2008), Melo et al.
121
(2015) and Aasmae et al. (2015) respectively. On the contrary Raihan et al. (2014),
El-Shatoury et al. (2015) and Adenaike et al. (2016) have showed 0% resistance to
ciprofloxacin by the E. coli isolates.
In the present investigation the E.coli isolates have shown 44.53% of resistance to
ofloxacin. Higher than the resistance that was observed in this study was reported by
Mary and Usha (2013) who observed 97% of resistance, Mishra, et al. (2013) found
83.33% of resistance, Ohieku and Magaji (2013) observed 71% of resistance,
Manikandan and Amsath (2014) observed 64.5% of resistance, Ibrahim et al. (2012)
reported that 55.1% of resistance and Atere et al. (2015) reported 52.1%resistance to
ofloxacin among the E.coli isolates. Whereas very little resistance than in the present
study was observed by Ferdosi et al. (2015) and Oluyege et al. (2015) who reported 8.8%
and 3.9% of resistance respectively.
The antibiotic azithromycin has shown 30.40% of resistance among the E.coli
isolates in the present investigation. Higher resistance to azithromycin by E.coli was
reported by Raihan et al. (2014) who found 100% of resistance, Aminu and David (2015)
observed 76.6% of resistance, Pant et al. (2015) observed 71.0% resistance, Chayani et
al. (2009) have shown 60.37% of resistance, Zinnah et al. (2008) observed 33% of
resistance. Aly et al. (2012) revealed 31% of resistance, which was similar to the present
findings for various clinical samples, whereas Akter et al. (2016) reported only 11.0%
resistance in their E.coli isolates.
In the present investigation chloramphenicol has shown 57.81% of resistance
among the E.coli isolates whereas higher resistance to chloramphenicol by E.coli isolates
was reported by Pant et al. (2015) who reported 70% of resistance and Vinita et al. (2010)
found 61.14% of resistance. Saeed et al. (2009) observed 58.6% of resistance, which was
almost similar to the present findings, whereas Ibrahim, et al.(2012), Melo et al.
122
(2015)and Joshi et al. (2012) reported 22.4%, 4.7% and 0% of resistance respectively,
which are lower than the present study in E.coli isolates of various sources.
The resistance to tetracycline was 54.69% in this study. Adenaike et al. (2016)
reported 54.0% resistance, which is similar to the present findings, whereas lower
resistance of 40.4% and 26% were reported by Aminu and David (2015) and Melo et al.
(2015) respectively. Very low resistance of 7.0% and 2.9% were reported by El-Shatoury
et al. (2015) and Aasmae et al. (2015) respectively. Higher resistance of 100% (Pant et
al., 2015 and Nsofor et al., 2016), 88.2% (Oluyege et al., 2015) 77.1% (Ibrahim et al.,
2012), 69.4% (Sabir et al., 2014) and 60% (Zinnah et al., 2008) than the present study for
the E. coli isolates obtained from different sources.
E.coli isolates in the present study have shown 20.31% of resistance to the antibiotic
tigecycline. Higher resistance than in the present study was observed by Mantzourani et
al. (2015) who found 100% resistance by the E.coli isolates, whereas Ali et al. (2014)
reported only 2.5% of resistance to tigecycline, on the contrary Nandi et al. (2014),
Behera et al. (2009) and Rossi et al. (2008) have reported 100% sensitivity to tigecycline
by the E.coli isolates.
Although it is extremely difficult to explain these conflicting data with regards to
both time and place of study, the variation is probably due to differential clonal expression
and drug pressure in community.
5.3. Isolation of E.coliphage and its characterization:
A total of 128 sewage samples from different organized, unorganized and various
animal sheds located in and around Tirupati were collected and processed for
E.coliphages isolation. A total of twenty two (22) E.coliphages were isolated from 128
sewage samples. E.coliphages were isolated by using tryptic soy agar. The plaques on
secondary streaking on E. coli mat culture gave the clearing zone around the streak lines.
The presence of E.coliphages were further confirmed by spot test where E. coli was grown
123
on nutrient agar and 10µl of isolated bacteriophages against E. coli was spotted on
different areas of nutrient agar plates and the clear zone around the spot was observed.
Shukla and Hirpurkar (2011) studied the presence of bacteriophages in sewage material
of cattle, pig, goat and poultry and isolated the bacteriophages against two most common
environmental bacteria viz.: B.subtilis and E. coli by double agar layer method. Mulani
et al. (2015) worked on host specific phages from environmental samples and found
potential activity of bacteriophages against E. coli using spot test, Mahadevan et al.
(2009) isolated host specific bacteriophages against E. coli from sewage water by using
spot test and Beheshti Maal et al. (2015) isolated two novel bacteriophages against E. coli
SBSWF-27 and E. coli PTCC-1399 by using spot test. Olieveira et al. (2009) isolated five
bacteriophages against E. coli from poultry sewage by using spot test method and
confirmed their presence by double layer technique.
Manjunath et al. (2013) used the sewage sample originated from hospital,
domestic, municipal waste and from the waste water treatment plant and isolated phage
DMEC-1 against the multidrug resistant E. coli by using double agar over layer method
and same method was used to isolate phages specific to E. coli O157 from waste water
treatment plant by Gunathilaka (2014). Sheng et al. (2006) isolated phage SH1 and
reported that phage was highly lytic and formed large clear plaques in all E. coli O157:H7
strains tested.
Jann et al. (1971) isolated bacteriophages against E. coli O8 strains and
Jamalludeen et al. (2009) worked on avian E. coli strains and isolated seven phages
against E. coli serogroups O1, O2 and O78 from wastewater. Calci et al. (1998) found
lytic bacteriophages to E. coli in the faecal samples of cattle, sheep, goat and reported that
sheep and goats have lowest mean density of bacteriophages based on the number of
PFU/gm of faeces.
124
Jensen et al. (1998) used agar overlay technique for the isolation of E. coliphages,
which were lytic against ATCC E. coli AB1157, BHR3, BHR4 and BHR5 and Duraisamy
et al. (2015) found 46 bacteriophages against E. coli by processing 10 hospital effluent
samples by using double agar layer method.
The findings of various scientists mentioned above revealed that spot test and
double agar layer method are the two most commonly used methods for the isolation of
bacteriophages.
5.3.1. Morphological characterization
5.3.1.1. Plaque morphology:
The observed plaques were circular with a diameter of 0.1 to 3mm (Fig. 19).
Similar to the present findings Bach et al. (2003) reported that the phages isolated against
E. coli from faeces were of same size. Various workers have observed varied plaque
diameter varying from (0.1-3.5mm). Pandey et al. (2013) and Calderone and Pickett
(1965) observed clear plaques of brucellaphage of variable size (0.5-3.5 mm) and Morris
and Corbel (1973) observed that the plaques of A422 were clear and varied in diameter
from 0.1 to 2.0 mm whereas the plaques of S708 and M51 were of two types i.e. small,
turbid plaques, 0.1 to 0.5 mm in diameter and large, clear plaques of 0.5 to 2.5 mm in
diameter.
5.3.2. Physical characterization
5.3.2.1. Heat:
The effect of heat on the activity of phage revealed that at 400C phage titre was
gradually decreased within three hours, whereas at 600C temperature treatment
completely inactivated the phage within 30 minutes (Table. 4.10). The results obtained in
this study were similar to the findings of Al-Mola and Al-Yassari (2010), who reported
that the effect of temperature on phage titre was significantly increased at a temperature
of 370C than at 500C and 650C. Allue-Guardia et al. (2012) conducted heat stability test
125
of phages and reported that at 600C there was complete inactivation of phages, Chachra
et al. (2012) subjected the brucellaphages to different temperatures and reported that there
was no growth at 700C and 1000C with in 20 min, Zaman and Arip (2012) characterized
the ability of bacteriophages at temperatures ranging between 100C-800C and reported
that phages were stable in a temperature range of 100C- 300C and became less stable
following exposure to 400C and 500C, Manjunath et al. (2013) examined the stability of
phages at room temperature and 600C and reported that there was 100 fold decrease in
titre at 600C temperature within 15 min and Pandey et al. (2013) reported that the effect
of heat on the activity of phages, were gradually deceased at 400C within three hours and
at 600C temperature, phages were completely inactivated within 10 min. Taj et al. (2014)
worked on the effect of various ranges of temperatures on T4 bacteriophage lytic activity
against E. coli and reported that at a temperature regimes of 400C, 550C and 700C the T4
bacteriophages were completely inactivated.
Temperature is one of the most important environmental factor that strongly
affects many aspects of the biological systems. One of the important characteristic of the
temperature, as environmental factor, is its fluctuation over a wide range of spatial and
temporal scales that makes possible as well as limits existence of life in different niches.
Influence of temperature upon the biological system is very vivid and it has been observed
that evolution of phenotypic traits, species distributions, and extinctions in many cases
can be traced to changes in temperature regimes (Vale et al.2008). Present study results
are in confirmation with the above findings as during the experiment it was observed that
yield of bacteriophage was highly temperature dependent
5.3.2.2. Sunlight:
The effect of sunlight on activity of phage showed that exposure to direct sunlight
gradually decreased the phage concentration and within three hours E.coliphage titre got
reduced. There are two ways that virus inactivation mechanisms occurs in sunlight, one
126
is through absorption of photons by the virus itself (direct and indirect endogenous
inactivation) and the second one is by reaction with reactive species formed by
photosensitizers in the water column (exogenous inactivation). The presence of
photosensitizing molecules decreased the rate of sunlight mediated inactivation of PV3
signaling that inactivation was dominated by endogenous mechanisms (Silverman et al.,
2013). The results obtained in this study were in accordance with Chachra et al. (2012),
who worked on brucellaphages and reported that the survivability of phages was
gradually decreased from 95.8% to 73% over a 90 min. period and Pandey et al. (2013)
described the effect of sunlight on activity of phages and reported that there was a gradual
decrease in phage concentration within 3 h exposure to direct sunlight.
5.3.2.3. UV light:
Exposing the phage to the UV light for five minutes caused complete inactivation
of bacteriophage. Inactivation of faecal coliforms and coliphages was mainly by shorter
wavelengths (UV-B) a result consistent with photobiological damage (Sinton et al.,
2002). The findings of this study were similar to the findings of Allue-Guardia et al.
(2012), who worked on Cdt phages and reported that the phages were very sensitive to
U.V treatment and Chachra et al. (2012) estimated the stability of the phage lysates
towards the UV light and reported that the U.V light killed the phages within the first 15
min of exposure. Pandey et al. (2013) determined the effect of UV light on the activity of
phage and reported that UV light had drastic effect on the phage survivability and also
reported that phages were completely inactivated within three minutes.
5.3.3. CHEMICAL CHARACTERIZATION
5.3.3.1. SDS
The effect of SDS treatment on activity of phage revealed that both 1% and0.1%
concentrations of SDS completely inactivated the phage within 15 minutes at 370C. SDS
is a strong anionic detergent, that can solubilize the proteins and lipids that form the
127
membranes. This will help the cell membranes and nuclear envelops to breakdown and
expose the chromosomes that contain the DNA. The results obtained in this study are
almost similar to the findings obtained by Chachra et al. (2012), who worked on
bacteriophages and reported that complete destruction of the phages was observed within
15 min of exposure to 10% SDS and Pandey et al. (2013) determined the stability of the
brucellaphages by subjecting them to SDS and reported that complete inactivation of
phage was observed within 15 min when exposed to 0.1% SDS
5.3.3.2. Phenol:
The effect of phenol treatment on activity of phage revealed that the phage gets
completely inactivated by 5% phenol within 15 minutes. It suggested that low
concentration exponent is associated with inactivation of the phage by an effect on the
protein coat of the particle and a high concentration exponent with an effect on its internal
structure (Cook and Brown, 1964). Pandey et al. (2013) worked on the activity of
brucellaphages against phenol (5% aqueous) and reported that complete inactivation of
the phages within 15 min, which is almost similar to the present study.
5.3.3.3. Chloroform
The effect of chloroform treatment on activity of phage showed that
10%chloroform completely inactivated the E.coliphages within 5 minutes at 370C. Phage
contain lipids as a structure components of their virions and so detection identity to only
a few families (Bertani and Bertani, 1986). Sands and lowlicht (1976) showed these lipids
are essential for maintaining the virus ability to infect new host. Any disruption of the
lipid components will lead to a loss of viability of the virus, lipids are soluble in non-
polar solvents such as ether and chloroform, which are capable of extracting and
disrupting the lipid components of the phages by interfering with the hydrophobic
interactions between lipid molecules. Non-polar solvents are capable of denaturing
proteins by disrupting the hydrophobic interaction between proteins, which can also lead
128
to a loss of viability (Camerini-Otera and Franklin, 1972).Similar to the findings obtained
in this study Al-Mola and Al-Yassari (2010) determined the sensitivity of phages to
chloroform and reported that chloroform completely inactivated the phage within five
minutes, Pandey et al. (2013) determined the effect of chloroform on the stability of
phages and reported that complete inactivation of phages within five minutes, whereas
Manjunath et al. (2013) reported that there was no decrease in the phage titre in
chloroform treated phages after 4 and 24 h incubated at room temperature.
5.3.3.4. Formalin
Exposure of phage to 40% formalin up to 15 minutes causes complete inactivation
of phages. The destructive action of formalin may be attributed by its alkylation of protein
and nucleic acids (De Benedictis et al., 2007). The results obtained in this study were in
accordance with Pandey et al. (2013), who reported that complete inactivation of phages
within 15 min. when exposed to 40% formalin.
5.3.4. Restriction Endonuclease digestion analysis:
Restriction enzymes such as EcoRI recognizes specific sequences of DNA and
cleaves the phosphodiester bond on each strand at that sequence. After digestion with a
restriction enzyme, the resulted fragments can be separated by agarose gel electrophoresis
and their corresponding sizes can be estimated (Vlab.amrita.edu., 2011). In the present
investigation phages appear to have similar profiles of the nucleic acid fragments
generated by digestion of their DNA with EcoRI.
The findings obtained in this study were in accordance with Goodridge et.al.
(2003), who performed restriction enzyme analysis with four enzymes and confirmed the
phages isolated against Escherichia coli, Jamalludeen et al. (2009) determined the
genome size of isolated phages EC-Nid1 and EC-Nid2 by using Restriction enzymes, Bao
et al. (2011) performed restriction enzyme analysis with EcoRI and Hind III to digest
genomes of the bacteriophages and Jamalludeen (2012) isolated Phages EC-NJ4 and EC-
129
NJ7 against Escherichia coli and also reported that the two phages appears to have similar
profiles of the nucleic acid fragments generated by restriction enzyme digestion.
5.4. In vitro studies to detect the activity of phages against target bacteria:
To detect the activity of phages against target bacteria in vitro studies were
conducted by taking the sewage sample and isolated phages were inoculated in to the
same and the samples were analysed at every five hour interval. The results of this study
revealed that there was complete inhibition of E.coli after 10 hours of incubation. The
results obtained in this study were almost similar to the results obtained by Beheshti Maal
et al. (2015) reported for the first time on invitro isolation and identification of two novel
bacteriophages that have lytic effect on E. coli PTCC1399 and E. coli SBSWF27 strains
as well as coliform population of Isfahan municipal wastewater and further he reported
that there was a 22-fold reduction in coliform load in wastewater with coliphages
incubation for two hours and Mulani et al. (2015) worked on potential activity of
bacteriophages against target bacteria by inoculating bacteriophages in actively growing
host and reported that there was 100% reduction in E. coli and Salmonella count within
nine hours.
The in vitro studies carried out to know the activity of bacteriophages against
E.coli determined that these phages readily killed the target bacteria. So use of
bacteriophages for reducing pathogenic bacteria in sewage along with other standard
methods like primary and secondary treatment could be considered as an effective and
simple alternative for replacement of costly instruments and establishment of the old
wastewater treatment plants (Beheshti Maal et al., 2014). Phage mediated bacterial
mortality has the capacity to influence treatment performance by controlling the
abundance of pathogenic bacteria (Periasamy and Sundaram, 2013). Many wastewater
treatment plants aim for the complete pathogen removal during treatment by using
disinfectants like chlorine which can harm the environment. Hence development of cheap
130
and eco-friendly approaches is necessary. Pathogen specific phages isolated from sewage
have the potential to eliminate the dreadful pathogens (Periasamy and Sundaram, 2013).
131
CHAPTER VI
SUMMARY
Escherichia coli strains are naturally inhabiting in the intestines of a variety of
animals and humans are harmless but some can cause debilitating conditions and
sometimes fatal conditions in humans, mammals and birds. Pathogenic strains are divided
into intestinal pathogens causing diarrhoea and extra-intestinal E. coli causing variety
infections like urinary tract infections (UTI), meningitis and septicaemia. In several
recent outbreaks of gastrointestinal tract diseases, the morbidity and mortality was
associated with shiga toxin producing E. coli (STEC). Human infections associated with
STEC can be variable from a simple or watery diarrhoea to haemorrhagic colitis (HC)
and haemolytic uremic syndrome (HUS). HUS is a life threatening sequelae,
characterized by acute renal failure, thrombocytopenia and microangiopathic haemolytic
anaemia. However, some individuals are experiences neurological symptoms like
convulsions and encephalopathy.
STEC strains produce verocytotoxins or shiga like toxins, encoded by stx1 and
stx2 and are responsible for severe infections in human beings. Several virulence factors
are responsible for pathogenicity of STEC, among them enterohaemolysin and intimin
are important, which are encoded by hlyA and eaeA respectively. Bovines are thought to
be primary reservoir of this pathogen and these pathogens are recovered from faecal
matter of healthy animals also. Animal based foods, which are contaminated with bovine
faecal matter are responsible for food borne infections. The food industry, restaurants and
private homes occasionally fail to meet adequate cooling, storage, preparation and other
hygiene standards and food may be contaminated with faecal flora due to improper
practices of those who prepare the food. The usage of antibiotics in the livestock industry
has been increased from many years that resulted the emergence of antibiotic resistant
132
pathogens. Thus the present study has triggered the efforts in developing alternatives to
the antibiotics and one such alternative is strongly lytic bacteriophages against E.coli.
Bacteriophages have been used in many applications including phage therapy, and
in control of food borne pathogens. The use of bacteriophages for bio-control has many
advantages when compared with other antimicrobial agents including high specificity,
self-replication and stability under different conditions. However, to obtain the more
efficacy phages, must be characterized and applied to different conditions.
A total of 128 samples collected from different sources viz: organized dairy farms
(n=28), unorganized dairy farms (n= 32) and animal sheds (n=68) were used for
Escherichia coli isolation. All the 128 isolates were found Gram negative cocobacillary
rods and confirmed by subjecting them to different biochemical tests. All the 128 isolates
were positive for Indole and Methyl red test whereas negative for Voges-Proskauer and
Citrate utilization tests. Further all the isolates were subjected to TSI test and urease test
and the results revealed that all the isolates produced acid butt, acid slant and also gas in
TSI agar test and no pink colour formation in the urease test. All the biochemical reactions
confirmed the presence of Escherichia coli. For the phenotypic detection of Shiga toxin
producing Escherichia coli all the isolates from different sources were streaked on SMAC
and the results revealed that none of the isolates have shown colourless colonies which is
a characteristic feature of E.coli O157:H7, but a total of 108 isolates have shown pink
colonies.
Antibiogram for E. coli was carried out to know the multidrug resistance of these
pathogens by using 14 antibiotic discs following the standard disc diffusion method.
Among the 128 isolates no isolates, was completely sensitive to any of the antibiotic test
discs used in this study. Maximum resistance was observed for ampicillin (92.19%),
followed by penicillin-G (76.56%), cefotaxime (71.10%), streptomycin (64.84%),
gentamicin (64.06%), chloramphenicol (57.81%),tetracycline (54.69%), cefoperazone
133
(51.56%), ofloxacin (44.53%), cefadroxil (39.06%),ciprofloxacin (38.28%),
azithromycin (30.40%), meropenem (27.34%), and tigecycline (20.31%).
For molecular characterization of E.coli isolated from dairy farm sewage, four
sets of primers derived from stx1, stx2. eaeA and hlyA genes were used for STEC
detection by multiplex PCR assay. The PCR assay was initially standardized by
optimizing the concentration of the components of the reaction mixture, annealing
temperature and cycling conditions. Optimal results were obtained using 5 µl of bacterial
lysate or 20 ng of diluted DNA as template in a reaction mixture consisting of 2.5 µl of
10X assay buffer for Taq polymerase containing 2.0 mM Magnesium chloride, one µl of
dNTP mix, 0.25 µM of each primer and one unit of Taq DNA polymerase in a final
reaction volume made up to 25 µl with molecular grade water.
Initial denaturation at 950C for five minutes followed by 35 cycles each of
denaturation at 940C for 45 seconds, annealing at 590C for 45 seconds and extension at
720C for one minute with a final extension period of 6 minutes at 720C was found to be
optimum for obtaining the desired PCR amplification of 180 bp for stx1, 255 bp for stx2,
384 bp for eaeA and 534 bp for hlyA genes of STEC.
Out of 28 samples from the organized dairy farm of Tirupati and surrounding
villages, 28 (100.00%) were positive for Escherichia coli by culture method. Out of 28
positives, 1 (3.57%) isolate was positive for Shiga toxin producing E.coli by PCR method
and carried stx1 gene.
Out of 32 samples from the unorganized dairy farms in and around Tirupati, 32
samples (100.00%) were positive for Escherichia coli by culture method. Out of 32
positives, two (6.25%) isolates were positive for Shiga toxin producing E. coli by PCR
method. Among the two Shiga toxin producing E. coli, one isolate carried stx1, whereas
another isolate carried a combination of stx1, stx2 and eaeA genes.
134
Out of 68 sewage samples from the animal sheds around Tirupati, 68 samples
(100.00%) were positive for Escherichia coli by culture method. Out of 68 positives, eight
(11.76%) isolates were positive for Shiga toxin producing E.coli by PCR method. Among
the eight Shiga toxin producing E.coli, three isolates carried stx1, four isolates carried
stx2 and one isolate carried both stx1and stx2genes
The isolates were used in screening of lytic bacteriophages recovered from
sewage and wastewater samples by double agar overlay method against E. coli. The
isolated phages produced discrete, clear and circular plaques on TSA plates with a
diameter of 0.1 to 3.0 mm.
Physical and chemical stability of phages was carried out by subjecting them to
temperature, sunlight, UV light, SDS, phenol, chloroform and formalin and exposed at
different time intervals. The phages were completely reduced when exposed at 400C for
a period of three hours whereas at 600C inactivation was observed within 30 min.
Complete reduction in the phage titre was noticed when exposed to direct sunlight and
UV light for a period of 3 h and 5 min respectively. The phage concentration was
completely reduced when exposed to 1% SDS, 0.1% SDS, 1% phenol, 5% phenol, 5%
chloroform, 10% chloroform and 40% formalin for a period of 15 min, 15 min, 30 min,
15 min, 5 min, 3 min and 15 min respectively.
The phage DNA was isolated and subjected to restriction enzyme digestion
analysis with EcoRI enzyme and found that the bands formed by the phages were below
48.5 kb.
The SEM observations of phage revealed that the phage had icosahedral head with
short tail. It was found that based on morphology the phage exhibited non-contractile tail
and belong to the order Caudovirales and family Podoviridae.
135
The invitro experiment was carried out to know the lytic activity of bacteriophages
on E. coli isolated from different sewage samples and showed that there was a 100%
reduction in the E. coli count after 10 h of incubation.
The analysis revealed that phages produce plaques on respective organisms and
tolerated different temperature ranges, sunlight, UV light, SDS, phenol, chloroform and
formalin. The isolated organisms were resistant to more of the drugs and so there is need
for alternative other than antibiotics. All these elements suggest that phages could be
useful as natural antimicrobials against Escherichia coli.
136
LITERATURE CITED
Aasmae, B., Volkova, J., Häkkinen, L., Orro, T., Tenson, T. and Kalmus, P. (2015).
Invitro antimicrobial resistance of intestinal Escherichia coli and Enterococci in
clinically healthy dogs in Estonia. Vet. Med. Zoot., 72 (94): 3-8.
Abuladze, T., Li, M., Menetrez, M. Y., Dean, T., Senecal, A. and Sulakvelidze, A. (2008).
Bacteriophages reduce experimental contamination of hard surfaces, tomato,
spinach, broccoli, and ground beef by Escherichia coli O157:H7. Appl. Environ.
Microbiol., 74:6230-6238
Ackermann, H. W. (2003). Bacteriophage observations and evolution. Research in
Microbiology, 154: 245-251.
Ackermann, H. W. (2007). 5500 phages examined in the electron microscope. Archives
of Virology, 152, 227–243.
Ackermann, H. W. (2011). Bacteriophage taxonomy. Microbiology Australia, 32(2), 90-
94.
Adams, M. H. (1959). Methods of study of bacterial viruses. In Bacteriophages.
Interscience Publishers, London, United Kingdom: 447-448.
Adams, M. R. and Moss, M. O. (2008). Food Microbiology. 3rd Edition. Royal Society
of Chemistry, Cambridge: 216-224.
Adenaike, O., Olonitola, O. S., Ameh, J. B. and Whong, C. M. Z. (2016). Incidence of
broad spectrum resistance in E. coli isolated from Zoborodo sold in Samaru, Zaria,
Nigeria. Int. J. Curr. Microbiol. App. Sci., 5(1): 796-801.
Akter, T., Hossain, M. J., Khan, Md. S., Sultana, H., Fatema, K., Al-Sanjee, S. and Datta,
137
S. (2016). Isolation and antimicrobial susceptibility pattern analysis of
Escherichia coli isolated from clinical samples of Bangladesh. Asian Journal of
Biomedical and Pharmaceutical Sciences, 6(54): 13-16.
Albert, J. M., Faruque, S.M., Faruque, A.S.G., Neogi, P.K.B., Ansaruzzaman, M.,
Bhuiyan, N.A., Alam, K. and Akbar, M.S. (1995). Controlled study of
Escherichia coli diarrheal infections in Bangladeshi children. J. Clin. Microbiol.,
33: 973 977.
Ali, I., Kumar, N., Ahmed, S., and Dasti, J. I., (2014). Antibiotic resistance in
uropathogenic E. coli strains isolated from non-hospitalized patients in Pakistan.
DOI: 10.7860/JCDR.
Allue-Guardia, A., Jofre, J. and Muniesa, M. (2012). Stability and Infectivity of
Cytolethal Distending Toxin Type V Gene-Carrying Bacteriophages in a Water
Mesocosm and under Different Inactivation Conditions. Appl. Environ.
Microbiol., 78 (16): 5818–5823.
Al-Mola, G. A. and Al-Yassari, I. H. (2010). Characterization of E. coli phage isolated
from sewage. J. Vet. Med. Sci., 9(2): 40-54.
Alshara, M. (2010). Antimicrobial Resistant Pattern of Escherichia coli Strains Isolated
from Paediatric Patients in Jordan. Acta Medica Iranica., 49: (5).
Aly, M.E.A., Tamer, M. E., and Magdy, A. A., (2012). Antibiotic resistance profile of E.
coli strains isolated from clinical specimens and food samples in Egypt. Intl. J.
Microbiol. Res., 3 (3): 176-182.
Aminu, R.F and David, I. (2015). Antimicrobial susceptibility of commensal
138
Escherichia coli from faeces of apparently healthy white Fulani cattle (Bos
indicus). Journal of Microbiology and Infections.,1:1.
Anago, E., Ayi-Fanou, L., Akpovi, C. D., Hounkpe, W. B., Tchibozo, M. A. D., Bankole,
H. S. and Sanni, A. (2015). Antibiotic resistance and genotype of beta-lactamase
producing Escherichia coli in nosocomial infections in Cotonou, Benin. Annals
of Clinical Microbiology and Antinicrobials, 14(5): 2-6.
Arabi, F.M.Z and Banazadehi, A (2013). Prevalence and antimicrobial susceptibility
patterns of uropathogens among patients referring to valieasr laboratory in
Najafabad, Isfahan, Iran. Middle-East J. Sci. Res., 13 (1): 85-90.
Asati, R.K (2013). Antimicrobial sensitivity pattern of Escherichia coli isolated from
urine samples of UTI patients and issues related to the rational selection of
antimicrobials. International Journal of Pharmacology and Therapeutics.,3(3).
at http://www.cdc.gov/ncidod/dbmd/diseaseinfo/diarrecoli_t.htm
Atere, V. A., Bamikole, A. M., Ajurojo, O. A. and Alo, O. S. (2015). Antimicrobial
resistance pattern of pathogenic Escherichia coli isolated from chicken liver and
trachea. J. Advancement in Medical and Life Sciences, 3(3): 1-4.
Babalova, E. G., Katsitadze, K. T., Sakvaredidze, L. A. and 10 other authors (1968).
Preventive value of dried dysentery bacteriophage. Zh. Mikrobiol. Epidemiol.
Immunobiol., 2: 143–145.
Bach, S. J., McAllister, T. A., Veira, D. M., Gannon, V. P. J. and Holley, R. A. (2003).
Effect of bacteriophage DC22 on Escherichia coli O157:H7 in an artificial rumen
system (Rusitec) and inoculated sheep. Anim. Res., 52: 89-101.
Bakhshi, B., Najibi, S. and Sepehri-Seresht, S. (2014). Molecular characterization of
139
enterohemorrhagic Escherichia coli isolates from cattle. J. Vet. Med. Sci., 76(9):
1195-1199.
Bao, H., Zhang, H. and Wang, R. (2011). Isolation and characterization of bacteriophages
of Salmonella enterica serovar Pullorum. Poultry Science, 90(10): 2370-2377.
Barati, S., Bonisdian, M., Habibian, R. and Jostejou, T. (2012). Antibiotic resistance of
enterotoxigenic and enteroaggrigative Escherichia coli isolated from
gastroenteritis cases. Asian Journal of Biomedical and Pharmaceutical sciences,
2(14): 54-58.
Barkocy-Gallagher, G. A., Arthur, T. M., Rivera-Betancourt, M., Nou, X., Shackelford,
S. D., Wheeler, T. L. and Koohmaraie, M. (2003). Seasonal prevalence of Shiga
toxin-producing Escherichia coli, including O157:H7 and non-O157 serotypes,
and Salmonella in commercial beef processing plants. J. Food Prot., 66(11),
1978-86.
Barnes, H. J. and Gross, W. B. (1997). Colibacillosis. Pages 131-139 in Diseases of
Poultry. 10th ed. B. W. Calnek, ed. Mosby-Wolf Publication Ltd., London, UK.
Bauer, A. W., Kirby, W. M. M., Sherris, J. C. and Tuck, M. (1966). Antibiotics
susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol.,
45: 493-496.
Behera, B., Das, A., Mathur, P., Kapil, A., Ravisekhar, G and Dhawan, B (2009).
Tigecycline susceptibility report from an Indian tertiary care hospital. Indian J
Med Res., 129: 446-450.
Beheshti Maal, K., Delfan, A. S. and Salmanizadeh, S. (2014). Isolation of Klebsiella
pneumoniae and Klebsiella oxytoca and their bacteriophages and their application
in waste treatment and coliforms phage therapy. Res. J. Environ. Sci., 8: 123-133.
140
Beheshti Maal, K., Delfan, A. S. and Salmanizadeh, S. (2015). Isolation and Identification
of two novel Escherichia coli Bacteriophages and their Application in wastewater
treatment and coliform’s phage therapy. Jundishapur. J. Microbiol., 8(3): 14945.
Bell, B. P., Goldoft, M., Griffin, P. M., Davis, M. A., Gordon, D. C., and Tarr, P. I.,
(1994). A multistate outbreak of Escherichia coli O157:H7-associated bloody
diarrhoea and hemolytic uremic syndrome from hamburgers. The Washington
experience. JAMA.272:1349–53.
Bertani, L. and Bertani, G. (1986). Preparation and characterization of temperate non-
inducible bacteriophage P2. J. Gen. Virol. 2: 357.
Bhan, M. K., Mahalanabis, D., Fontaine, O. and Pierce, N. F. (1994). Clinical trials of
improved oral rehydration salt formulations: a review. Bull World Health Organ,
72: 945-955.
Bhat, M. A., Nishikawa, Y. and Wani, S. A. (2008). Prevalence and virulence gene
profiles of Shiga toxin- producing Escherichia coli and enteropathogenic
Escherichia coli from diarrhoeic and healthy lambs in India. Small Ruminant
Reearch, 75: 65-70.
Biswas, R., Rabbani, R., Ahmed, H. S., Sarker, M. A. S., Zafrin, N. and Rahman, Md. M.
(2014). Antibiotic sensitivity pattern of urinary tract infection at a tertiary care
hospital. Bangladesh Crit. Care J., 2(1): 21-24.
Black, R. E. (1990). Epidemiology of traveler’s diarrhea and relative importance of
various pathogens. Rev. Infect. Dis., 12: 373-379.
Bonnedahl, J., Stedt J, Waldenström J, Svensson L, Drobni M, Olsen B (2015)
141
Comparison of Extended- Spectrum ß-Lactamase (ESBL) CTX-M Genotypes in
Franklin Gulls from Canada and Chile. PLoS ONE 10(10): 0141315.
Bonyadian, M., Momtaz, H., Rahimi, E., Habibian, R., Yazdani, A. and Zamani, M.
(2010). Identification and characterization of shiga toxin-producing Escherichia
coli isolates from patients with diarrhoea in Iran. Indian J. Med. Res., 132: 328-
331.
Booher, S. L., Cornick, N. A. and Moon, H. W. (2002). Persistence of Escherichia coli
O157:H7 in experimentally infected swine. Vet. Microbiol., 89(1), 69-81.
Boqvist, S., Aspan, A. & Eriksson, E. (2009). Prevalence of verotoxigenic Escherichia
coli O157:H7 in fecal and ear samples from slaughtered cattle in Sweden. J. Food
Prot., 72(8), 1709-12.
Bosilevac, J. M. and Koohmaraie, M. (2011). Prevalence and Characterization of Non
O157 Shiga Toxin-Producing Escherichia coli Isolates from Commercial Ground
Beef in the United States. Appl. Environ. Microbiol., 77(6): 2103-2112.
Botkin, D. J., Galli, L., Sankrapani, V., Soler, M., Rivas, M. and Torres, A. G. (2012).
Development of a multiplex PCR assay for detection of shiga toxin-producing
Escherichia coli, enterohemorrhagic E. coli and enteropathogenic E.coli strains.
Frontiers in Cellular and Infection Microbiology, 2(8):1-9.
Bradley, K. K., Williams, J. M., Burnsed, L. J., et al. (2012). Epidemiology of a large
restaurant-associated outbreak of Shiga toxin-producing Escherichia coli
O111:NM. Epidemiol. Infect.,140(9):1644-1654.
Brian, M. J., Frosolono, M., Murray, B. E., Miranda, A., Lopez,E. L., Gomez, H. F. and
142
Cleary, T. G. (1992). Polymerase chain reaction for diagnosis of
enterohemorrhagic Escherichia coli infection and hemolytic-uremic syndrome. J.
Clin. Microbiol., 30:1801–1806.
Brovko, L. Y., Anany, H. and Griffiths, M. W. (2012). “6 Bacteriophages for detection
and control of Bacterial Pathogens in Food and Food-Processing Environment.”
Advances in food and nutrition research, 67: 241.
Burnet, F. M. (1933). The classification of dysentery-coli bacteriophages. III. A
correlation of the serological classification with certain biochemical tests. J.
Pathol. Bacteriol., 37: 179–184.
Calci, K. R., Burkhardt, W., Watkins, W. D., and Rippey, S. R. (1998). Occurrence of
male-specific bacteriophage in feral and domestic animal wastes, human feces,
and human-associated wastewaters. Applied and Environmental
Microbiology, 64(12), 5027-5029.
Calderone J. G and Pickett, M. J. (1965). Characterization of brucellaphages. J. Gen.
Microbiol. 39:1-10.
Callaway, T. R., Edrington, T. S., Brabban, A. D., Keen, J. E., Anderson, R. C., Rossman,
M. L., Engler, M. J., Genovese, K. J., Gwartney, B. L., Reagan, J. O., Poole, T.
L., Harvey, R. B., Kutter, E. M. and Nisbet, D. J. (2006). Fecal prevalence of
Escherichia coli O157, Salmonella, Listeria, and bacteriophage infecting E. coli
O157:H7 in feedlot cattle in the southern plains region of the United States.
Foodborne Pathog. Dis., 3(3), 234-44.
Camerini- Otera, R. D. and Franklin, R. M. (1972). Structure and synthesis of a lipid-
containing bacteriophage. XII. The fatty acids and lipid content of bacteriophage
PM2. Virology, 49: 385.
143
Caprioli, A., Morabito, S., Brugere, H. and Oswald, E. (2005). Enterohaemorrhagic
Escherichia coli: emerging issues on virulence and modes of transmission. Vet.
Res., 36(3): 289311.
Castellani, A. and Chalmers, A. J. (1919). “Manual of Tropical Medicine”. 3rd ed.,
Williams wood and co., New York.
Centers for Disease Control and Prevention. (1995). Escherichia coli O157:H7 outbreak
linked to commercially distributed dry-cured salami— Washington and
California, 1994. Morbid. Mortal. Weekly Rep. 44:157– 160.
Centres for Disease Control and Prevention. E. coli. (2012).
Centres for Disease Control and Prevention. (1996-2012). Incidence of laboratory-
confirmed bacterial and parasitic infections, and postdiarrheal hemolytic uremic
syndrome (HUS), by year and pathogen, Foodborne Diseases Active Surveillance
Network (FoodNet), United States, 1996–2012.
Centres for Disease Control and Prevention. (2011). FoodNet 2011 Surveillance Report.
In: US Department of Health & Human Services, ed.
Cergole-Novella, M. C., Pignatari, A. C. C., Castanheira, M. and Guth, B. E. C. (2011).
Molecular typing of antimicrobial-resistant Shiga-toxin-producing Escherichia
coli strains (STEC) in Brazil. Research in Microbiology, 162: 117-123.
Cerqueira, A. M. F., Guth, B. E. C., Joaquim, R. M. and Andrade, J. R. C. (1999). High
occurrence of shiga toxin producing Escherichia coli (STEC) in healthy cattle in
Rio de Janeiro state, Brazil. Veterinary Microbiology, 70: 111-121.
Chachra, D., Kaur, H., Chandra, M. and Saxena, H. (2012). Isolation, Electron
144
Microscopy And Physicochemical Characterization Of A Brucellaphage Against
Brucella abortus Vaccine Strain S19. The Internet Journal of Microbiology,
10(2): 1-7.
Chandrasekaran, D., Venkatesan, P., Tirumurugaan, K. G., Nambi, A.
P.,Thirunavukkarasu, P.S., Kumanan , K., Vairamuthu, S and Ramesh, S
(2014). Veterinary World., 2231-0916.
Chayani, N., Tiwari, S., Sarangi, G., Mallick, B., Mohapatra, A., Paty, BP and Das, P
(2009). Role of azithromycin against clinical isolates of family enterobacteriaceae
a comparison of its minimum inhibitory concentration by three different methods.
Indian Journal of Medical Microbiology., 27(2): 107-10.
Cho, S., Bender, J. B., Diez-Gonzalez, F., Fossler, C. P., Hedberg, C. W., Kaneene, J. B.,
Ruegg, P. L., Warnick, L. D. and Wells, S. J. (2006). Prevalence and
characterization of Escherichia coli O157 isolates from Minnesota dairy farms
and country fairs. J. Food Prot., 69(2): 252-259.
Cobbold, R. N., Hancock, D. D., Rice, D. H., Berg, J., Stilborn, R., Hovde, C. J. and
Besser, T. E. (2007). Rectoanal junction colonization of feedlot cattle by
Escherichia coli O157:H7 and its association with supershedders and excretion
dynamics. Appl. Environ. Microbiol., 73(5): 1563-8.
Conedera, G., Dalvit, P., Martini, M., Galiero, G., Gramaglia, M., Goffredo, E., Loffredo,
G., Morabito, S., Ottaviani, D., Paterlini, F., Pezzotti, G., Pisanu, M., Semprini,
P. and Caprioli, A. (2004). Verocytotoxin-producing Escherichia coli O157 in
minced beef and dairy products in Italy. Int. J. Food Microbiol., 96(1): 67-73.
Conedera, G., Mattiazzi, E., Russo, F., Chiesa, E., Scorzato, I., Grandesso, S., Bessegato,
145
A., Fioravanti, A. and Caprioli, A. (2007). A family outbreak of Escherichia coli
O157 haemorrhagic colitis caused by pork meat salami. Epidemiol. Infect.,
135(2): 311-314.
Cook, A. M. and Brown, W. R. L. (1964). Inactivation of a bacteriophage by chemical
antibacterial agents. Journal of Pharmacy and Pharmacology, 16(8): 611-617.
Coombs, B. K., Gilmour, M. W. and Goodman, C.D. (2011). The evolution of virulence
in non-O157 Shiga toxin-producing Escherichia coli. Front. Microbiol.,
doi:10.3389/ fmicb.2011.000 90.
Cornick, N. A., Booher, S. L., Casey, T. A. and Moon, H. W. (2000). Persistent
Colonization of Sheep by Escherichia coli O157:H7 and Other E. coli Pathotypes.
Appl. Environ. Microbiol., 66(11): 4926-4934.
D’Herelle F. (1917). An invisible antagonist microbe of dysentery bacillus. Comptes
Rendus Hebdomadaires des Seances de L’academie des Sciences : 373-375.
D’Herelle, F. (1918). Technique de la recherche du microbe filtrant bacteriophage
(Bacteriophagum intestinale). C. R. Seances Soc. Biol. Filiales 81: 1160–1162.
Daini, O. A., Ogbulo, O. D. and Ogunledun, A. (2005). Quinolones Resistance and R-
plasmids of some gram negative enteric bacilli. Afr. J. Clin. And Exp. Micro. 6:
14-19.
Daniel, J.L, Payne, T.A and Feng, P (2012). Simultaneous identification of strains of
Escherichia coli serotype O157:H7 and their Shiga like toxin type by mismatch
amplification mutation assay- multiplex PCR. J. Clin. Microbiol. 33: 248–250.
Dastmalchi saei, H. and Ayremlon, N. (2012). Characterization of Shiga toxin-producing
146
Escherichia coli (STEC) in feces of healthy and diarrheic calves in Urmia region,
Iran. Iran J. Miccrobiol., 4(2): 63-69.
De Benedictis, P., Beato, M.S. and Capua, I. (2007). Inactivation of avian influenza
viruses by chemical agents and physical conditions: a review. Zoonoses Public
Health 54(2), 51-68.
Dean-Nystrom, E. A., Bosworth, B. T. and Moon, H. W. (1997). Pathogenesis of
Escherichia coli O157:H7 infection in neonatal calves. Adv. Exp. Med. Biol., 412:
47-51.
Dean-Nystrom, E. A., Pohlenz, J. F., Moon, H. W. and O'Brien, A. D. (2000). Escherichia
coli O157:H7 causes more-severe systemic disease in suckling piglets than in
colostrum-deprived neonatal piglets. Infect. Immun., 68(4): 2356-8.
DebRoy, C., Roberts, E., Kundrat, J., Davis, M. A., Briggs, C. E. and Fratamico, P. M.
(2004). Detection of Escherichia coli serogroups O26 and O113 by PCR
amplification of the wzx and wzy genes. Appl. Environ. Microbiol. 70:1830–
1832.
Desmarchelier, P. M. and Fegan , N. (2003). Enteropathogenic Escherichia coli. Hocking
A. D (ed) Food borne microorganisms of public health significance. Australian
Institute of Food Science and Technology (NSW Branch), Sydney, 6(2): 267–310.
Dhanashree, B. and Mallya, P. S. (2008). Detection of shiga-toxigenic Escherichia coli
(STEC) in diarrheagenic stool and meat samples in Mangalore, India. Indian J.
Med. Res., 128: 271-277.
Donnenberg, M. S. (2002). Escherichia coli: Virulence Mechanisms of a Versatile
147
Pathogen. Amsterdam: Academic Press.
Donnenberg, M. S. and Whittam, T. S. (2001). Pathogenesis and evolution of virulence
in enteropathogenic and enterohemorrhagic Escherichia coli. J. Clin. Inv., 107(5):
539.
Doyle, M. P. (1991). Escherichia coli O157:H7 and its significance in foods. Int. J. Food
Microbiol., 12:289.
Doyle, M. E., Kaspar, C. W. and Weiss, R. (2006). Human Illness Caused by E. coli
O157:H7 from Food and Non-food Sources. 2006.
http://fri.wisc.edu/docs/pdf/FRIBrief_EcoliO157H7humanillness.pdf.
Duckworth, D. H. (1999). History of virology: bacteriophages. In Encyclopedia of
virology, pp. 725-730. Edited by A. Granoff and R. G. Webster. Memphis, TN:
Academic Press.
Duraisamy, N., Ramesh, N., Krishnakumar, V., Rajesh, P., Solomon, E. K. and Kannan,
V. R. (2015). Distribution, Isolation and Characterization of lytic bacteriophages
against multi-drug resistant and extended-spectrum of β-lactamase producing
pathogens from hospital effluents. Asian J. Pharm. Clin. Res., 8(2): 384-389.
Duris, J.W., Haack, S.K and Fogarty, L.R (2009). Gene and antigen markers of Shiga-
toxin Producing E. coli from Michigan and Indiana river water: Occurrence and
relation to recreational water quality criteria. J. Environ. Qual., 38:1878–1886.
Dutta, S., Guin, S., Ghosh, S., Pazhani, G. P., Rajendran, K., Bhattacharya, M. K.,
Takeda, Y., Balakrish Nair, G. and Ramamurthy, T. (2013). Trends in the
Prevalence of Diarrheagenic Escherichia coli among Hospitalized Diarrheal
Patients in Kolkata, India. PLos ONE, 8(2): 56068.
148
Dutta, T. K., Roychoudhury, P., Bandyopadhyay, S., Wani, S. A. and Hussain, I. (2011).
Detection and characterization of shiga toxin producing Escherichia coli (STEC)
and enteropathogenic Escherichia coli (EPEC) in poultry birds with diarrhoea.
Indian J. Med. Res., 133: 541-545.
Edelman, R., Karmali, M. A. and Fleming, P. A. (1988). Summary of the International
Symposium and Workshop on Infections due to Verocytotoxin (Shiga-like toxin)-
producing Escherichia coli. J. Infect. Dis., 157:1102– 1104.
Elder, R. O., Keen, K. J., Siragusa, G. R., Barkocy-Gallagher, G. A., Koohmarate, M. and
Laegreid, W. W. (2000). Correlation of enterohemorrhagic Escherichia coli O157
prevalence in feces, hides and carcassesof beef cattle during processing.
Proceedings National of Academic Sciences, U.S.A, 28: 2999-3003.
EL-Jakee, J., Moussa, E. I., Mohamed, Kh. F. and Mohamed, G. (2009). Using
Molecular Techniques for Characterization of Escherichia coli Isolated from
Water Sources in Egypt. Global Veterinaria., 3(5): 354-362.
El-Rahman, A. A., El-Wafa, W. M. A. and Ibrahim, A. N. (2015). Prevalence of antibiotic
resistant E. coli in some environmental sources polluted with wastewater. J.
Microbiol. Biotech. Res., 5 (5):17-24
El-Shatoury, E. H., El-Leithy, M. A., Abou-Zeid, M. A., El-Taweel, G. E. and El-
Senousy, W. M. (2015). Antibiotic susceptibility of shiga toxin producing E. coli
O157:H7 isollated from different water sources. The Open Conference
Proceedings Journal, 6: 30-34.
Emond, E. and Moineau, S. (2007). Bacteriophages and food fermentations. In: McGrath,
149
S., Van Sinderen, D. eds. Bacteriophage: Genetics and Molecular Biology.
Horizon Scientific Press/ Caister Academic Press: 93-124.
Erickson, M. C., and Doyle, M. P. (2007). Food as a vehicle for transmission of Shiga
toxin-producing Escherichia coli. J. Food Prot. 70:2426–2449.
Eryulmaz, M., Merve, E.B., Muharrem, M., Yildiz and Ahmet Akin (2010).
Antimicrobial Resistance of Urinary Escherichia coli Isolates. Trop J Pharm Res.,
9(2): 205-209.
Escherich, T. (1885). “Die Darmbakterien des Neugeborenen and Sauglinge”. Fortschr.
Med., 3: 515-522
Esseili, M. A., Issmat I. Kassem and Von Sigler. (2008). Optimization of DGGE
community fingerprinting for characterizing Escherichia coli communities
associated with fecal pollution. Water Research, 42: 4467-4476.
European Centre for Disease Prevention and Control. (2012). Annual epidemiological
report Reporting on 2010 surveillance data and 2011 epidemic intelligence data.
Ferdosi-Sh. E., Javanian, M., Moradian-K, M., et al. Resistance patterns of Escherichia
coli causing urinary tract infection. Caspian J Intern Med 2015; 6(3):148-151.
Fotadar, U., Zaveloff, P. and Terracio, L. (2005), “Growth of Escherichia coli at elevated
temperatures”. J. Basic Microbiol., 45(5): 403-404.
Fratamico. P.M and Bagi, K.L (2012). Detection of Shigatoxin producing Escherichia
coli in ground beef using the Gene Discreal-timePCRsystem Frontiers in
Cellular and Infection Microbiology., 2(152).
150
George, M. and Garrity. (2005). “The Gamma proteobacteria”. Bergey’s Manual of
Systematic Bacteriology. 2nd ed., New York, Springer: 1108.
Goodridge, L., Gallaccio, A. and Griffiths, M. W. (2003). Morphological, host range and
genetic characterization of two coliphages. Appl. Environ. Microbiol., 69(9):
5364-5371.
Gowing, M. M. (1993). Large virus-like particles from vacuoles of Phaeodarian
radiolarians and from other marine samples. Marine Ecology Progress Series,
101, 33-43.
Grabow, W. O. K. (2000). Bacteriophages update on application as models for viruses in
water. Water SA, 27: 251 268.
Grauke, L. J., Kudva, I. T., Yoon, J. W., Hunt, C. W., Williams, C. J. and Hovde, C. J.
(2002). Gastrointestinal tract location of Escherichia coli O157:H7 in ruminants.
Appl. Environ. Microbiol., 68(5), 2269-77.
Griffin, P. M. (1995). Escherichia coli O157:H7 and other enterohaemorrhagic
Escherichia coli. In: Blaser, M.J., Smith, J.I., Ravdin, H.B., Greenberg, H. B.
and Guerrant, R. L. Infections of the gastrointestinal tract. Raven Press,
NewYork: 121-145.
Gu, J., Liu, X., Li, Y., Han, W., Lei, L., et al. (2012). A method for generation phage
cocktail with great therapeutic potential. PLoS ONE, 7(3).
Gunathilaka, G. U. (2014). Characterization of bacteriophages from environmental water
samples and the potential of bacteriophages tailspike proteins (tsp) in bacteria
detection. Thesis submitted to the graduate School of Wayne State University,
Detroit, Michigan in partial fulfilment of the requirements for the degree of Master
of Science.
151
Haack, S.K., Duris, J.W., Fogarty, L.R., Kolpin, D.W., Focazio, M.J., Furlong, E.T and
Meyer, M.T (2009). Comparing waste water chemicals, indicator bacteria
concentrations, and bacterial pathogen genes as faecal pollution indicators.
J. Environ. Qual. 38: 248–258.
Habrun, B., Komp, G.,e Zeljko., C., Spicic, I., Miroslav, B., and Mario, M (2010).
Antimicrobial sensitivity of Esherichia coli, samonella spp., Pasteurella
multocida, Streptococcus suis and Actinobacillus pleuropneumoniae isolated
from diagnostic samples from large pig breeding farms in Croatia. Vet. Arhiv.,
80 (5): 571-583.
Halabi, M., Orth, D., Grif, K., Wiesholzer-Pittl, M., Kainz, M., Schoberl, J., Dierich,
M.P., Allerberger, F and Wurzner, R (2008). Prevalence of Shiga toxin-,
intimin- and Haemolysin genes in Escherichia coli isolates from drinking water
supplies in a rural area of Austria. Int. J. Hyg. Environ. Health., 211: 454–457.
Hancock, D., Besser, T., Lejeune, J., Davis, M. and Rice, D. (2001). The control of VTEC
in the animal reservoir. Int. J. Food Microbiol., 66(1-2), 71-8.
Harper, D. R. and Enright, M. C. (2011). Bacteriophages for the treatment of
Pseudomonas aeruginosa infections. Journal of applied microbiology, 111(1), 1-
7.
Hartl, D. L. and Dykhuizen, D. E. (1984). The population genetics of Escherichia coli.
Ann. Rev. Genet., 18:31-68
Hausler, T. (2003). Gesund durch Viren. Munchen: Piper Verlag (in Germany).
Hauswaldt, S., Nitschke, M., Sayk, F., Solbach, W. and Knobloch, J. K. (2013). Lessons
152
Learned From Outbreaks of Shiga Toxin Producing Escherichia coli. Curr. Infect.
Dis. Rep., 15(1):4-9.
Heijnen, L. and Medema, G. (2006). Quantitative detection of E. coli, E. coli O157 and
other Shiga toxin producing E. coli in water samples using a culture method
combined with real-time PCR. J. Water Health 4: 487–498.
HillaHadas, Monica Einav, Itzhak Fishov and Arieh Zaritsky. (1997). Bacteriophage T4
development depends on the physiology of ts host Escherichia coli. Microbiology,
143: 179 185.
Holmes, F. O. (1948). Order Virales. In Bergey’s Manual of Determinative Bacteriology
(6th edn) (Breed, R.S. et al., eds). Williams & Wilkins, Baltimore, MD: 1126–
1286.
Hui, Y. H., Pierson, M. D. and Gorham, J. R. (2001). Bacterial pathogens. In: Foodborne
Disease Handbook. New York: Marcel Dek. 2nd ed. : 170-196.
Hussain, A., Razvi, N., Anjum, F. and Humayoun, R. (2015). Resistance pattern of 3rd
generation cephalosporins. World Journal of Pharmacy and Pharmaceutical
Sciences, 4(4): 34-44.
Ibrahim, M.E., Bilal, N.E and Hamid, M.E (2012). Increased multi-drug resistant
Escherichia coli from hospitals in Khartoum state, Sudan. African Health
Sciences., 12(3): 368 - 375
Ibrahim, M., Humodi, A., Saeed, Elhassan , M.M. and Hamid, E.M (2010). Increase in
resistance among uropathogens E. coli to empirical therapy.
Ingledew, W. J. and Poole, R. K. (1984). “The respiratory chains of Escherichia coli”.
153
Microbiol. Rev., 48(3): 222-271.
Inu Rawal, Harshada Joshi and Chaudhary, B. L. (2013). Molecular identification of
Escherichia coli isolated from lakes of Udaipur (Raj), India. Asian Jr. of
Microbiol. Biotech. Env. Sc., 15(1): 129-131.
Jackson, M. P., Newland, J.W., Holmes, R. K. and O’Brien, A. D. (1987). Nucleotide
sequence analysis of the structural genes for Shiga-like toxin I encoded by
bacteriophage 933J from Escherichia coli. Microbial Pathogenesis 2, 147–153.
Jakaria, A. T. M., Islam, M. A. and Khatum, M. M. (2012). Prevalence, characteristics
and antibiogram profiles of Escherichia coli isolated from apparently healthy
chickens in Mymensingh, Bangladesh. Microbes and Health, 1(1): 27-29.
Jamalludeen, N. (2012). Isolation and characterization of virulent bacteriophages against
Escherichia coli serogroups O1, O2, and O78. Proceeding of the Eleventh
Veterinary Scientific Conference: 56-63.
Jamalludeen, N., She, Y. M., Lingohr, E. J. and Griffiths, M. (2009). Isolation and
characterization of virulent bacteriophages against Escherichia coli serogroups
O1, O2, and O78. Poultry Science Association Inc., 88 :1694–1702.
Jann, K., Schmidt, G. and Barbara Wallenfels. (1971). Isolation and Characterization of
Escherichia coli bacteriophage ϕ 8 specific for E. coli strains belonging to sero-
group 08. Journal of General Microbiology, 67: 289-297.
Jay, J. M. (2000). Modern Food Microbiology. Maryland: Aspen Publishers. 6th ed.:536.
Jay, M. T., Cooley, M., Carychao, D., Wiscomb, G.W., Sweitzer, R.A., Crawford-
Miksza, L., Farrar, J.A., Lau, D. K., O'Connell, J., Millington, A., Asmundson, R.
154
V., Atwill, E. R. and Mandrell, R. E. (2007). Escherichia coli O157:H7 in feral
swine near spinach fields and cattle, central California coast. Emerg. Infect. Dis.,
13(12), 1908-11.
Jensen, E. C., Schrader, H. S., Rieland, B., Thompson, T. L., Lee, K. W., Nickerson, K.
W. and Kokjohn, T. A. (1998). Prevalence of Broad-Host-Range lytic
Bacteriophages of Sphaerotilus natans, Escherichia coli and Pseudomonas
aeruginosa. Appl. Environ. Microbiol., 64(2): 575-580.
Jeyasanta, K. I., Aiyamperumal, V., and Patterson, J. (2012). Prevalence of Antibiotic
Resistant Escherichia coli in Sea Foods of Tuticorin Coast, Southeastern India.
Advan. Biol. Res., 6 (2): 70-77.
Jiao Yong-Jun ZX-y, Guo Xi-Ling, Shi Zhi-Yang, Feng Zhen-Qing and Wang Hua.
(2009). Monoclonal Antibody S2C4 Neutralizes The Toxicity of Shiga Toxin 2
and Its Variants. Progress as Biochemistry and Biophysics, 36(6):736-742.
Jordan, D. M., Booher, S. L. and Moon, H. W. (2005). Escherichia coli O157:H7 does
not require intimin to persist in pigs. Infect. Immun., 73(3), 1865-7.
Joshi, S., Rashmi, S and Singh, P (2012). Antibiotic resistance profile of
Escherichia coli isolates from Colibacillosis in and around Pantnagar, India.
Vet. World., 5(7): 405-408.
Karadeniz, E., Sarigullu, F. E., Untac, I. and Colak, O. (2012). Plasmid profile analysis
of phage sensitive E. coli strains from Human sewage system. Journal of animal
Science Advances, 2(10): 873-878.
Karmali, M. A. (1989). Infection by verocytotoxin-producing Escherichia coli. Clin.
155
Microbiol. Rev., 2:15–38.
Karmali, M. A., Mascarenhas, M., Shen, S., Ziebell, K., Johnson, S., Reid-Smith, R., et
al. (2003). Association of genomic O island 122 of Escherichia coli EDL 933 with
Verocytotoxin producing Escherichia coli seropathotypes that are linked to
epidemic and/or serious disease. J. Clin. Microbiol., 41: 4930-4940.
Karmali, M. A., Petric, M., Lim, C., Fleming, P. C., Arbus, G. S. and Lior, H. (1985).The
association between haemolytic uremic syndrome and infection by Verotoxin-
producing Escherichia coli. J. Infect. Dis. 151:775–782.
Karmali, M. A., Steele, B. T., Petric, M. and Lim, C. (1983). Sporadiccasesof hemolytic
uremic syndrome associated with fecal cytotoxin and cytotoxinproducing
Escherichia coli. Lancet :619–620
Karpman, D., Hakansson, A., Maria-Thereza R. Perez, Isaksson, C., Eric Carlemalm,
Caprioli, A. and Svanborg, C. (1998). Apoptosis of Renal Cortical Cells in the
Hemolytic-Uremic Syndrome: In Vivo and In Vitro Studies. American Society for
Microbiology (INFECTION AND IMMUNITY), 66(2): 636–644.
Kesava Naidu, G., Rajendra Goud, N., Gaddad, S. M. and Shivannavar, C. T. (2011).
Detection of Shiga toxin genes (stx1 and stx2) and molecular characterization of
shiga-toxigenic Escherichia coli isolated from diverse sources in Gulbarga region,
India. Pharmacophore, 2(5): 253-265.
Khan, M.A., Naqvi, B.S., Rizvi, M., Zeb-un-Nisa and Atta Abbas (2014). Resistance
pattern of cephadroxil monohydrate and ceftrioaxone sodium against different
clinical isolates. IJAMSCR., 2(1): 45-50.
156
Kiranmayi, C. B., Krishnaiah, N. and Mallika, E. N. (2010). Escherichia coli O157:H7 –
An emerging pathogen in foods of animal origin. Vety. World, 3: 382-389.
Kleanthous, H., Smith, H. R., Scotland, S. M., Gross, R. J., Rowe, B., Taylor, C. M. and
Milford, D. V. (1990). Haemolytic uremic syndromes in the British Isles, 1985-8:
association with verocytotoxin producing Escherichia coli. Part 2:
Microbiological aspects. Arch. Dis. Child. 65(7): 722-727.
Kobori, D., Rigobelo, E. C., Macedo, C., Marin, J. M. and Avila, F. A. (2004). Virulence
properties of Shiga toxin-producing Escherichia coli isolated from cases of
Bovine Mastitis in Brazil. Revue Elev. Med. Vet. Pays trop., 57(1-2): 15-20.
Kolling, G. L. and Matthews, K. R. (2001). Examination of Recovery In Vitro and In
Vivo of Nonculturable Escherichia coli O157:H7. Appl. Environ. Microbiol.,
67(9): 3928–3933.
Konowalchuk, J., Speirs, J. I. and Stavric, S. (1977). Vero response to a cytotoxin of
Escherichia coli. Infect. Immun. 18: 775-779.
Kornacki, J. L. and Marth, E. L. (1982). Foodborne illness caused by Escherichia coli: a
review. J. Food Prot., 45:1051.
Kumar, H. S., Indrani Karunasagar, Karunasagar, I., Tsukamoto Teizou, Kensuke Shima
and Shinji Yamasaki. (2004). Characterization of Shiga toxin-producing
Escherichia coli (STEC) isolated from seafood and beef. FEMS microbial.
Letters, 233: 173-178.
Kumar, R. and Prasad, A. (2010). Detection of E.coli and Staphylococcus in Milk and
Milk Products in and around Pantnagar. Vety. World., 3(11):495-496.
157
Kumar, R., Umashanker Keshri and Manoj Kumar (2013). Antimicrobials Sensitivity
and Resistance Pattern of Bacterial Isolates at a Tertiary Care Hospital in
Jharkhand, India. RIBPS., 4(1): 1248-1255.
Kutter, E. and Sulakvelidze, A. (2004). Bacteriophages: biology and applications, CRC
Press.
La Ragione, R. M., Best, A., Woodward, M. J. and Wales, A. D. (2009). Escherichia coli
O157:H7 colonization in small domestic ruminants. FEMS Microbiol. Rev., 33(2),
394-410.
Lappe, N., Doran, G., O’Connor, J., O’Hare, C. and Cormican, M. (2009).
Characterization of bacteriophages used in the Salmonella enterica serovar
enteritidis phage-typing scheme. Journal of Medical Microbiology, 58(1): 86-93.
Lawrence Broxmeyer. (2004). Bacteriophages antibacterials with a future? Medical
Hypotheses, Elsevier, 62: 889-893.
Lee, J. H., Vinal, A. C. and Dallas, W. S. (2003). Nucleotide sequence comparison
between heat-labile toxin B-subunit cistrons from Escherichia coli of human and
porcine origin. Infect Immun 48: 73–77.
Lienemann, T., Pitkanen, T., Antikainen, J., Molsa, E., Miettinen, I., Haukka, K., Vaara,
M and Siitonen, A (2011). Shiga toxin-producing Escherichia coli O100:H: stx
(2e) in drinking water contaminated by waste water in Finland. Curr. Microbiol.
62: 1239–1244.
Lim Esther, L. L., Alison, B., Peter, C. and Ruth, P. (2012). Foodborne disease in New
Zealand 2011, In: Institute of Environmental Science and Research Limited.
Lin, A., Nguyen, L., Lee, T., Clotilde, L. M., Kase, J. A., Son, I., Carter, J. M. and Lauzon.
158
C. R. (2011). Rapid O serogroup identification of the ten most clinically relevant
STECs by Luminex microbeadbased suspension array. J. Microbiol. Methods
87:105–110.
Lopez, E. L., Diaz, M., Grinstein, S., Devoto, S., Mendilaharzu, F., Murray, B. E.,
Ashkenazi, S., Rubeglio, E., Woloj, M. and Vasquez, M. (1989). Hemolytic
uremic syndrome and diarrhoea in Argentine children: The role of Shiga-like
toxins. J. Infect. Dis., 160: 469–475.
Low, J. C., McKendrick, I. J., McKechnie, C., Fenlon, D., Naylor, S. W., Currie, C.,
Smith, D. G., Allison, L. and Gally, D. L. (2005). Rectal carriage of
enterohemorrhagic Escherichia coli O157 in slaughtered cattle. Appl. Environ.
Microbiol., 71(1), 93-7.
Lwoff, A., Home, R. and Tournier, P. (1962) A system of viruses. In Basic Mechanisms
in Animal Virology. Cold Spring Harb. Symp. Quant. Biol. 27: 51–62.
Mahadevan, M. S., Nagananda, G. S., Das, A., Bhattacharya, S. and Suryan, S.. (2009).
Isolation of Host- Specific Bacteriophages from Sewage against Human
Pathogens. Asian J. Biotechnol., 1(4): 163-170.
Mahmud MAA, Islam MN, Khan MFR, Hussain MM and Rahman MM (2016).
Prevalence and antibiotic sensitivity of bacteria isolated from respiratory system
of cattle. International Journal of Natural and Social Sciences, 3(2): 21-29.
Maloo, A., Sunil, B., Rutuja, D., Gajbhiye, S.N., Syed and Dastager, G (2014).
Occurrence and distribution of multiple antibiotic-resistant bacteria
of Enterobacteriaceae family in waters of Veraval coast, India. Environmental
and Experimental Biology., 12: 43–50.
159
Manikandan, C and Amsath, A (2014). Antibiotic susceptibility pattern of Escherichia
coli isolated from urine samples in Pattukkottai, Tamilnadu. Int.J.Curr.
Microbiol. App.Sci., 3(10): 449-457.
Manjunath, N. S., Agsar, D., Jagannath, K. V., Rangaswamy, B. E., Surya Chandra Rao,
Anand, S. and Yogisha, S. (2013). Characterization and in vitro efficacy studies
of wide host range lytic bacteriophage ΦDMEC-1 infecting Escherichia coli
isolated from pyogenic skin infections.
Manning, S. D., Motiwala, A. S., Springman, A. C., Qi, W., Lacher, D. W., Ouellette, L.
M., et al. (2008). Variation in virulence among clades of Escherichia coli
O157:H7 associated with disease outbreaks. PNAS, 105: 4868-4873.
Mantzourani, I., Panopoulou, M., Theodoridou, I., Tsirogiannis, I.,V.Papaemmanouil,
B., Johnson, B., Biedenbach, D., Bouchillon, S., Stavropoulou, E., and
Bezirtzoglou, E (2015). Comparative Antimicrobial Susceptibility Profiling
of Tigecycline and Other Antibiotics against Clinical and Environmental
Isolates. Int.J.Curr.Microbiol.App.Sci ., 4(4): 384-396.
Martin, J. L., Ithn Eugirgr, D., ALfz Ink and SiegfriesdcHerer. (1993). Isolation,
classification and molecular characterization of bacteriophages for Enterobacter
species. J. Gen. Microbiol., 139: 2627 2633.
Martinez-Freijo, P., Fluit, A. C., Schmitz, F. J., Grek, V. S., Verhoef, J. and Jones, M. E.
(1999). Many class I integrons comprise distinct stable structures occurring in
different species of Enterobacteriaceae isolated from widespread geographic
regions in Europe. Antimicrob. Agents Chemother., 43:686-689.
Mary, C and Usha, M. S (2013). Incidences of multi-drug resistance Escherichia coli
160
isolates in Panipuri sold in Bangalore. IFRJ., 20(2): 1007-1009.
Mathias, C. B. Kirshner, A. T. K. and Velimirov, B. (1995). Seasonal variations of virus
abundance and viral control of bacterial production in a backwater system of
Danube river. Appl. Environ. Microbiol., 61: 3734-3740.
Mead, P. S. and Griffin, P. M. (1998). Escherichia coli O157:H7. Lancet, 352(9135),
1207-12.
Melo, D. B., Menezes, A. P. de. O., Reis, J. N. and Guimaraes, A. G. (2015).
Antimicrobial resistance and genetic diversity of Escherichia coli isolated from
humans and foods. Brazilian Journal of Microbiology, 46 (4): 1165-1170.
Merchant, I. A. and Packer, R. A. (1967). Veterinary bacteriology and virology. The lowa
State University Press, Ames, lowa, USA. 7th edition: 211-305.
Merril, C. R., Scholl, D. and Adhya, S. L. (2003). The prospect for bacteriophage therapy
in Western medicine. Nat. Rev. Drug Discov., 2: 489–497.
Mishra, M., Patel, A.K and Behera, N (2013). Prevalence of Multidrug Resistant
E. coli in the river Mahanadi of Sambalpur. Curr Res Microbiol Biotechnol., 1(5):
239-244
Momtaz, H., Farzan, R., Rahimi, E., Safarpoor, F., Dehkordi, and Souod, N.,(2012)
Molecular Characterization of Shiga Toxin-Producing Escherichia coli
Isolated From Ruminant and Donkey Raw Milk Samples and Traditional Dairy
Products in Iran. The ScientificWorld Journal doi:10.231342.
Momtaz, H. and Jamshidi, A. (2013). Shiga toxin-producing Escherichia coli isolated
from chicken meat in Iran: serogroups, virulence factors and antimicrobial
resistance properties. Poultry Science, 92: 1305-1313.
161
Momtaz, H., Rahimi, E. and Moshkelani, S. (2012a). Molecular detection of
antimicrobial resistance genes in E. coli isolated from slaughtered commercial
chickens in Iran. Veterinarni Medicina, 57(4): 193-197.
Morris, J. A. and Corbel, M. J. (1973). Properties of a new phage lytic for Brucella suis.
J. Gen. Virol., 21:539-554.
Morrison, D. M., Tyrell, D. L. J. and Jewell, L. D. (1985). Colonic biopsy in Verotoxin-
induced hemorrhagic colitis and thrombotic thrombocyopenic purpura (TTP). Am.
J. Clin. Pathol., 86:108–112.
Mulani, M. S., Azhar, S., Azharuddin, S. and Tambe. S. (2015). Harnessing the Power of
Bacteriophage for Pathogen Reduction in Wastewater. Int. J. Curr. Microbiol.
App. Sci., Special Issue-2 152-161.
Muniesa, M., Jofre, J., García-Aljaro, C and Blanch, A.R (1999). Occurrence of
Escherichia coli O157:H7 and other enterohemorrhagic Escherichia coli in the
environment. Environ. Sci. Technol., 40: 7141–7149.
Munsi, Md. N., Sarker, N. R., Khatun, R. and Alam, M. K. (2015). Identification and
antibiogram study of bacterial species isolated from samples of different locations
in Bangladesh. Asian J. Med. Biol. Res., 1(3): 457-462.
Mustika, O. C., Pinatih, K. J. P. and Suardana, I. W. (2015). Antibiotic resistance profiles
of Escherichia coli O157:H7 in cattle at South-Kuta, Badung Regency, Bali,
Indonesia. Global Veterinaria, 15(5): 480-484.
Nandi, P., Kumar, S., Biswas, T., Mitra, G., Chejara, SK and Roy, S (2014). In vitro
162
susceptibility pattern of Tigecycline against MRSA, ESBL producing Escherichia
coli, Klebsiella species and Acinetobacter isolates in a rural tertiary care hospital.
IJMDS., 4(1).
Nart, P., Naylor, S. W., Huntley, J. F., McKendrick, I. J., Gally, D. L. and Low, J. C.
(2008). Responses of cattle to gastrointestinal colonization by Escherichia coli
O157:H7. Infect. Immun., 76(11), 5366-72.
Nataro, J. P. and Kaper, J. B. (1998). Diarrheagenic Escherichia coli. J. Clin. Microbiol.,
11:142-201
Naylor, S. W., Low, J. C., Besser, T. E., Mahajan, A., Gunn, G. J., Pearce, M. C.,
McKendrick, I. J., Smith, D. G. and Gally, D. L. (2003). Lymphoid follicle-dense
mucosa at the terminal rectum is the principal site of colonization of
enterohemorrhagic Escherichia coli O157:H7 in the bovine host. Infect. Immun.,
71(3), 1505-12.
Neher, S., Hazarika, A. K., Barkalita, L. M., Borah, P., Bora, D. P. and Sharma, R. K.
(2016). Isolation and characterization of Shiga toxigenic Escherichia coli of
animal and bird origin by multiplex polymerase chain reaction. Vety. World, 9(2):
123-127.
Niranjan, V and Malini, A (2014). Antimicrobial resistance pattern in Escherichia coli
causing urinary tract infection among inpatients. Indian J Med Res.,139: 945-948.
Nitika, A., Asthana Ashish, K., Madan Molly and Dixit, V. A. (2014). Antibiotic
resistance pattern in E. coli causing community-acquired urinary tract infections.
Journal of Advance Researches in Biological Sciences, 6(3&4): 209-212
Nitikshan, R. V., Naveen Kumar, R., bharathi Kulkani, Kashinath, L., Bhaskar, V. and
163
Polasa, K. (2014). E. coli pathotypes and their antibiotic resistance in young
children with diarrhea in Hyderabad, India. Int. J. Curr. Microbiol. App. Sci., 3(9):
647-654.
Nontongana, N., Sibanda, T., Ngwenya, E and Anthony, I.O (2014). Prevalence and
Antibiogram Profiling of Escherichia coli Pathotypes Isolated from the Kat River
and the Fort Beaufort Abstraction Water. Int. J. Environ. Res. Public
Health.,11: 8213-8227.
Nsofor, C. A., Onichukwu, O. and Ohiaeri, G. (2016). Antibiotic susceptibility pattern of
Escherichia coli isolates from human and animal specimens in Owerri, Nigeria.
Bull. Env. Pharmacol. Life Sci., 5(4): 33-36.
O’Brien, A. D., Lively, T. A., Chen, M. E., Rothman, S. W. and Formal, S. B. (1983).
Escherichia coli O157:H7 strains associated with haemorrhagic colitis in the
United States produce a Shigella dysenteriae 1 (Shiga) like cytotoxin. Lancet: 702.
Ohieku, J.D and Magaji, R.A (2013). Urinary Tract Infections Associated with
Escherichia Coli: A 2005 to 2009 Clinical Assessment of Trends in
Fluoroquinolones Activities in Maiduguri-City, Nigeria. Journal of Applied
Pharmaceutical Science., 3 (8): 084-091.
Oliveira, A., Sillankorva, S., Quinta, R., Henriques, A., Sereno, R. and Azeredo, J. (2009).
Isolation and characterization of bacteriophages for avian pathogenic E. coli
strains. J. Appl. Microbiol., 106(6): 1919-1927.
Oluyege, A. O., Ojo-Bola, O. and Oludada, O. E. (2015). Carriage of antibiotic resistant
commensal E. coli in Infants below 5 months in Ado-Ekiti. Int. J. Curr. Microbiol.
App. Sci., 4(5): 1096-1102.
OzFoodNet Working Group. (2012). Monitoring the Incidence and Causes of Diseases
164
Potentially Transmitted by Food in Australia: Annual Report of the OzFoodNet
Network, 2010: Communicable Diseases Intelligence.
Panahee, M. and Pourtaghi, H. (2016). Virulence gene profiles of shiga-toxin producing
Escherichia coli isolates from retail raw meat in Iran. Bulg. J. Vet. Med. (online
first).
Pandey, S., Chachra, D., Chandra, M. and Saxena, H. M. (2013). Protein profiling and
physico-chemical characterization of an isolated phage against Brucella abortus
strain 19. Afr. J. Microbiol. Res., 7(14): 1233-1238.
Pant, D. R., Chaudhary, N. and Upadhyaya, S. (2015). Isolation and identification of
Escherichia coli (E. coli) from children suspecting urinary tract infection (UTI).
International Journal Of Health Sciences And Research, 5(2): 163-168.
Paton, A. W. and Paton, J. C. (2005). Multiplex PCR for Direct Detection of Shiga
Toxigenic Escherichia coli strains producing the novel subtilase cytotoxin. J.
Clin. Microbiol., 43(6): 2944-2947.
Paton, J. C. and Paton, A. W. (1998). Pathogenesis and diagnosis of Shigatoxin producing
Escherichia coli infections. Clin. Microbiol. Rev., 11: 450–479.
Pavia, A. T., Nichols, C. R., Green, D. P., Tauxe, R. V., Mottice, S. and Greene, K. D.
(1990). Hemolytic uremic syndrome during an outbreak of Escherichia coli
O157:H7 infections in institutions for mentally retarded persons: clinical and
epidemiologic observations, J. persons: clinical and epidemiologic observations.
Pennington, H. (2010). Escherichia coli O157. Lancet 376: 1428-1435.
Periasamy, D. and Sundaram, A. (2013). A novel approach for pathogen reduction in
wastewater treatment. J. Environ. Health Sci. Eng., 1112: 1-9.
Preethishree, P., Rekha Rai, Vimal kumar, K., Asha Pai, K. B. and Pratibha Bhat, U.
165
(2016). Uropathogens and their antibiotic susceptibility pattern at a tertiary care
teaching hospital in Coastal Karnataka, India. Int. J. Curr. Microbiol. App. Sci.,
5(1): 23-31.
Price, S. B., Wright, J. C., DeGraves, F. J., Castanie-Cornet, M. P. and Foster, J. W.
(2004). Acid resistance systems required for survival of Escherichia coli O157 :
H7 in the bovine gastrointestinal tract and in apple cider are different. Appl.
Environ. Microbiol., 70:4792-4799
Pritchard, G. C., Willshaw, G. A., Bailey, J. R., Carson, T. and Cheasty, T. (2000).
Verocytotoxin-producing Escherichia coli O157 on a farm open to the public:
outbreak investigation and longitudinal bacteriological study. Vet. Rec., 147(10),
25964.
Public Health Agency of Canada (PHAC). E. coli. (2015).
Raghu, H. V., Manju, G., Manjunath, B. M., Santhosh Mishra and Praveen Sawale.
(2012). Beneficial face of bacteriophages application in food processing. Int. J.
Quality Res., UDK, 6: 101-108.
Rahim, N., Dr. Syed Baqir Shyum Naqvi., Bashir, S., Rafiq, K and Shagufta Nesar
(2014). Assessment of Different Brands of Cefadroxil for Their In Vitro
Antibacterial Activity against Staphylococcus aureus and Escherichia coli.
IJPSI., 3(2): 2319 – 6718.
Raihan, Md., Ismail Hossain, A., Mostafizer, M., Rahman, Md., Zohorul Islam., Das,
B.C., Habib, A., Belal, S.H., Islam, K (2014). Prevalence and Antimicrobial
Resistance Profile of Escherichia coli and Salmonella Isolated from Diarrheic
Calves. Journal of Animal Health and Production., 2 (1): 12 – 15.
Ram, S., Vajpayee, P and Shanker, R (2007). Prevalence of multi-antimicrobial-
166
agent resistant, Shiga toxin and enterotoxin producing Escherichia coli in surface
waters of river Ganga. Environ. Sci. Technol. 41: 7383–7388.
Rangel, J. M., Sparling, P. H., Crowe, C., Griffin, P. M. and Swerdlow, D. L. (2005).
Epidemiology of Escherichia coli O157:H7 Outbreaks, United States, 1982–
2002. Emerg. Infect. Dis., 11(4) (serial on the internet)
Ranjini, C. Y., Kasukurthi, L. R., Madhumati, B. and Rajendran, R. (2016). Prevalence
of multidrug resistance and extended spectrum beta-lactamases among
uropathogenic Escherichia coli isolates in a tertiary care hospital in South India:
An alarming trend. Community Acquired Infection, 2(1): 19-24..
Rasheed, M. U., Jamil, K., Thajuddin, N., Pasupuleti, M., Ahamed, P. and
Muthukumaresan, K. P. (2014). Distribution of the stx1, stx2 and hlyA genes:
Antibiotic profiling in Shiga-toxigenic E. coli strains isolated from food sources.
Int. J. Curr. Microbiol. App. Sci., 3(5): 348-361.
Rehman, M.U., Rashid, M., Javeed Ahmad, SK., Wani, S.A and Farooq, S (2013).
Multi-drug resistance among Shiga toxin producing Escherichia coli isolated
from bovines and their handlers in Jammu region, India. Vet. World., 6(14):
2231-0916.
Rene, N. B., Danielle, R. D., Debrah, L. D. and Susan, E. B. (2007). Isolation of a
bacteriophage from sewage sludge and characterization of its bacterial host cell.
Rivier Acad. J., 3.
Renter, D. G., Sargeant, J. M., Hygnstorm, S. E., Hoffman, J. D. and Gillespie, J. R.
(2001). Escherichia coli O157:H7 in free-ranging deer in Nebraska. J. Wildl. Dis.,
37(4): 75560.
Richardson, S. E., Rotman, T. A., Jay, V., Smith, C. R., Becker, L. E., Petric, M., Olivieri,
167
N. F. and Karmali, M. A. (1992). Experimental verocytotoxemia in rabbits. Infect.
Immun., 60:4154–4167.
Riley, L. W. (1987). The epidemiologic, clinical, and microbiological features of
hemorrhagic colitis. Annu. Rev. Microbiol., 41:383–407.
Riley, L. W., Remis, R. S., Helgerson, S. D., McGee, H. B., Wells, J. G., Davis, B. R.,
Hebert, R. J., Olcott, E. S., Johnson, L. M., Hargrett, N. T., Blake, P. A. and
Cohen, M. L. (1983). Hemorrhagic colitis associated with a rare Escherichia coli
serotype. N. Engl. J. Med., 308:681–685.
Rivas, M. (2009). Epidemiology of STEC/ VTEC in South America In: Proceedings of
VTEC, 2009, 7th International symposium on shiga toxin (verocytotoxin) –
producing Escherichia coli Infections. Buenos Aires- Argentina, May, 10-13 : 13.
Robati, R. and Gholami, S. (2013). Estimation of virulence genes of Shiga toxin
producing Escherchia coli from juice purchase and vegetables in Tehran/Iran.
Euro. J. Exp. Bio., 3(2): 457-462.
Robson, W. L. M., Leung, A. K. C. and Kaplan, B. S. (1993). Hemolytic-uremic
syndrome. Curr. Prob. Pediatr., 23:16-33.
Rossi, F., Patricia, G., Bernardo, R., Daniel, C and Michael, J D (2008). Rates of
Antimicrobial Resistance in Latin America (2004-2007) and in vitro Activity
of the Glycylcycline Tigecycline and of Other Antibiotics. BJID., 12(5):405-415.
Ruska, H. (1943). Versuch zu einer Ordnung der Virusarten. Arch. Ges. Virusforsch, 2,
480–498.
Sabir, S., Aftab Ahmad, A., Tayyaba, I., Muhammad Asad, A., Rehman Khan, M and
168
Muhammad, N (2014). Isolation and antibiotic susceptibility of E. coli
from urinary tract infections in a tertiary care hospital Pak. J Med Sci., 30 (2).
Saeed, M.A., Abdul, H., Aamir, A., Mashkoor, M, Saira, B., Ayesha, T., Amna, A.,
Tayyaba, I and Yasra, S (2009). A profile of drug resistance genes and integrons
in E. coli causing surgical wound infections in the Faisalabad region of
Pakistan. The Journal of Antibiotics ., 62: 319–323.
Sahilah, A. M., Nor’ Aishah, H., Noraida, I. and Ahmad Azuhairi, A. (2010). Detection
of shiga toxin 1 and 2 (stx1 and stx2) genes in Escherichia coli O157:H7 isolated
from retail beef in Malaysia by Multiplex Polymerase Chain Reaction (PCR).
Sains Malaysiana, 39(1): 57-63.
Sambrook, J. and Russel, D. W. (2001). Molecular cloning: A Laboratory Manual, 3rd
edn. Vol. 2. Cold Spring Harbor Lab Press, New Yark, 2: 8.1-8.125.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular cloning: A Laboratory
Manual. 2nd ed. Cold Spring Harbor Lab Press, Cold Spring Harbor, New Yark.
Sanchez, S., Lee, M. D, Harmon, B. G., Maurer, J. J. and Doyle, M. P. (2002). Zoonosis
Update: Animal issues associated with Escherichia coli O157:H7. Veterinary
Medicine Today, 221: 1122-1126.
Sands, J.A. and Lowlieht, R.A. (1976). Temporal origin of viral phospholipids of
enveloped bacteriophage. Can. S. Microbiol. 22: 154
Savarino, S. J., Hall, E. R., Bassily, S. and 14 other authors. (2002). Introductory
evaluation of an oral, killed whole cell enterotoxigenic Escherichia coli plus
cholera toxin B submit vaccine in Egyptian infants. Pediatr. Infect. Dis. J., 21:
322-330.
169
Schmidt, H., L. Beutin, and H. Karch. (1995). Molecular analysis of the plasmid-encoded
hemolysin of Escherichia coliO157:H7 strai EDL 933.Infect. Immun. 63:1055–
1061
Schmidt, H., Geitz, C., Tarr, P.I., Frosch, M and Karch, H (1994). Non-O157:H7
pathogenic Shiga toxin-producing Escherichia coli: and genetic profiling of
virulence traits and clonality. Journal of Infectious Diseases 179, 115–123.
Scotland, S. M., Rowe, B., Smith, H.R., Willshaw, G.A and Gross. R.J (1990). Vero
cytotoxin producing strains of Escherichia coli from children with haemolytic
uremic syndrome and their detection by specific DNA probes. J. Med. Microbiol.
25:237–243
Sheng, H., Knecht, H. J., Kudva, I. T. and Hovde, C. J. (2006). Application of
Bacteriophages To Control Intestinal Escherichia coli O157:H7 Levels in
Ruminants. Appl. Environ. Microbiol., 72(8): 5359–5366.
Shukla, S. and Hirpurkar, S. D. (2011). Recovery status of bacteriophages of different
livestock farms of Veterinary College, Adhartal, Jabalpur, India. Veterinary
World, 4(3):117-119.
Silverman, A. I., Peterson, B. M., Boehm, A. B., McNeill, K. and Nelson, K. L. (2013).
Sunlight inactivation of human viruses and bacteriophages in coastal waters
containing natural photosensitizers. Environ. Sci. Technol., 47(4):1870-8.
Singh, P. and Prakash, A. (2008). Isolation of Escherechia coli, staphylococcus aureus
and listeria monocyogenes from milk products sold under market conditions at
agra region. Acta agricultural slovenica., 92(1): 83-88.
170
Sinton, L. W., Hall, C. H., Lynch, P. A. and Davies-Colley, R. J. (2002). Sunlight
inactivation of fecal indicator bacteria and bacteriophages from waste
stabilization pond effluent in fresh and saline waters. Applied and Environmental
Microbiology, 68(3): 1122-1131.
Smith, H. W. and Huggins, M. B. (1982). Successful treatment of experimental
Escherichia coli infections in mice using phage: its general superiority over
antibiotics. J. Gen. Microbiol., 128: 307–318.
Smith, C.J., Olszewski, A.M and Mauro, S.A (2009). Correlation of Shiga toxin
gene frequency with commonly used microbial indicators of recreational
water quality. Appl. Environ. Microbiol. 75: 316–21.
Snyder, J. D. and Merson, M. H. (1982). The magnitude of the global problem of acute
diarrhoeal disease: a review of active surveillance data. Bull World Health Organ,
60: 605–613.
Sohail , M., Mohsin, K., Hafiz. G.M.S., Hasnain, J and Abdul, A. K (2015). Character-
istics and Antibiotic Resistance of Urinary Tract Pathogens Isolated From Punjab,
Pakistan. Jundishapur J Microbiol., 8(7).
Son, I., Binet, R., Maounounen-Laasri, A., Lin, A., Hammack, T. S. and Kase, J. A.
(2014). Detection of five shiga toxin-producing Escherichia coli genes with
multiplex PCR. Food Microbiol., 40: 31-40.
Spencer, R. (1955). A marine bacteriophage. Nature, 175: 690.
Stephan, R and Schumacher, S (2000). Resistance patterns of non-O157 Shiga toxin-
producing Escherichia coli (STEC) strains isolated from animals, food and
asymptomatic human carriers in Switzerland. Letters in Applied Microbiology.,
32:11-117.
171
Sudershan, R.V., Kumar, R.N., Kulkarni, B., Kashinath, L., Bhaskar, V., and Polasa, K.
(2014). E. coli pathotypes and their antibiotic resistance in young children
with diarrhoea in Hyderabad, India. Int.J.Curr.Microbiol.App.Sci 3(9): 647-654.
Suganya, D., Kanimozhi, K. K., Panneerselvam, A. and Dhanapaul, K. (2016). Molecular
characterization of Diarrheagenic Escherichia coli from Tiruchirappalli District,
Tamilnadu, India. India. Int. J. Curr. Microbiol. App. Sci., 5(3): 478-484.
Sulakvelidze, A. (2001) Bacteriophages as therapeutic agents. Ann. Med., 33: 507–509.
Sulakvelidze, A., Alavidze, Z. and Morris, J. G. (2001). Jr: Bacteriophage therapy.
Antimicrob Agents Chemother, 45:649-659.
Summers, W. C. (1999). Felix d’Herelle and the Origins of Molecular Biology. Yale
University Press New Haven, CT.
Summers, W. C. (2001). Bacteriophage therapy. Annu. Rev. Microbiol., 55: 437-451.
Sundvall, P., Marie, E., Ronny, G., Sigvard, M., Nils, R., Lars, J and Peter, U (2014).
Antimicrobial resistance in urinary pathogens among Swedish nursing home
residents remains low: a cross-sectional study comparing antimicrobial
resistance from 2003 to 2012. BMC Geriatrics., 14(30): 1471-2318.
Susan, M. T., Scott-Tucker, A., Cooper, L. M. and Henderson, I. R. (2006). Weapons of
mass destruction virulence factors of the global killer Enterotoxigenic Escherichia
coli. FEMS Microbiol. Lett., 263: 10 20.
Taj, M. K., Ling, J. X., Bing, L. L., Qi, Z., Taj, I., Hassani, T. M., Samreen, Z. and
Yunlin, W. (2014). Effect of dilution, temperature and pH on the lysis activity of
T4 phage against E. coli BL21. J. Anim. Plant Sci., 24(4):1252-1255.
Tanvir, R., Rubeena, H and Shahida, H (2012). Prevalence of Multiple Drug Resistant
172
Escherichia coli in Patients of Urinary Tract Infection Registering at
Diagnostic Laboratory in Lahore, Pakistan. Pakistan J. Zool., 44(3): 707-712.
Tarr, P. I., Gordon, C. A. and Chandler, W. L. (2005). Shiga-toxin-producing Escherichia
coli and haemolytic uraemic syndrome. Lancet, 365(9464): 1073-86.
Tesh, V. L., and A. D. O’Brien. 1991. The pathogenic mechanisms of Shiga toxin and the
Shiga-like toxins. Mol. Microbiol., 5:1817–1822
Thiele, D., Coia, J.E., Hanson, M.F and Thomson, F.M (1990). A comparison of
Immunomagnetic separation, direct culture and polymerase chain reaction for
the detection of verotoxin-producing Escherichia coli O157 in human feces.
J. Med. Microbiol., 44: 219–222.
Toroglu, S., Dincer, S and Hatice, K (2005). Antibiotic resistnace in gram negative
Bacteria isolated from Aksu river in Tuirkey. Annals of Microbiology, 55(3):
229-233.
Tuttle, J., Gomez, T., Doyle, M. P., Wells, J. G., Zhao, T., Tauxe, R. V., et al. (1999).
Lessons from a large outbreak of Escherichia coli O157:H7 infections: insights
into the infectious dose and method of widespread contamination of hamburger
patties. Epidemiol. Infect., 122:185–92.
Twort, F. W. (1915). An investigation on the nature of ultra-microscopic viruses.
Lancet:1241-1243.
Vale, P. F., Sternman, M. and Little, T. J. (2008). Temperature dependent costs of
parasitism and maintenance of polymorphism under genotype by environment
interactions. J. Evol. Biol., 21: 1418-1427.
Vally, H., Hall, G., Dyda, A., et al. (2012). Epidemiology of Shiga toxin producing
173
Escherichia coli in Australia, 2000-2010. BMC Public Health, 12:63.
Vij, A.S., Shashi, C and Jigyasa, S (2014). Two years retrospective study of antibiotic
Resistance pattern of uropathogens especially Escherichia coli in north India.
CIBTech Journal of Microbiology., 3(2): 29-36.
Vinita, R., Umesh and Priyanka, P (2010). Antibiotic Resistance Pattern of Urinary
Tract Isolates of Escherichia coli from Kumaun Region. J. Commun. Dis. 42
(1): 63-66.
Virpari, P. K., Nayak, J. B., Brahmbhatt, M. N. and Thaker. C. H. (2013). Study on
isolation, molecular detection of virulence gene and antibiotic sensitivity pattern
of Escherichia coli isolated from milk and milk products. Vet. World, 6(8): 541-
545.
Vlab.amrita.edu. (2011). Restriction digestion. Retrieved 28 june 2016, from
vlab.amrita.edu/?sub=3&brch=77&sim=694&cnt=1.
Vladimir Pyatov., Irena Vrtkova., and Ales Knoll (2014). Detection of Aminoglycoside,
Sulfonamide and Tetracycline resistance genes in Escherichia coli isolated from
bovine milk samples. MENDELNET.
Vogt, R. L. and Dippold, L. (2005). “Escherichia coli O157:H7 outbreak associated with
consumption of ground beef”. Public Health Rep., 120(2):174-178.
Walsh, C. (2003). Where will new antibiotics come from? Nat. Rev. Microbiol., 1:65-70.
Walters, S.P., Thebo, A. L. and Boehm, A. B. (2011). Impact of urbanization and
agriculture on the occurrence of bacterial pathogens and stx genes in coastal
waterbodies of central California. Water Res. 45: 1752–1762.
Weinbauer, M. G. (2004). Ecology of prokaryotic viruses. FEMS Microbiol. Rev., 28:
174
127–181.
Wetzel, A. N. and LeJeune, J. T. (2006). Clonal dissemination of Escherichia coli
O157:H7 subtypes among dairy farms in northeast Ohio. Appl. Environ.
Microbiol., 72(4), 26216.
Wildy, P. (1971). Classification and nomenclature of viruses. First Report of the
International Committee on Nomenclature of Viruses. S. Karger, Basel.
William A. Petri Jr., Mark Miller, Henry J.Binder, Myron M. Levine, Rebecca
Dillingham and Richard L. Guerrant. (2008). Enteric infections, diarrhea, and
their impact on function and development. J. Clin. Invest., 118: 1277 1290
World Health Organization. (1998). Zoonotic non-O157 shiga toxin producing
Escherichia coli (STEC). Report of a WHO scientific Working Group Meeting.
WHO/CSR/APH/98.8. Geneva, Switzerland.
World Health Organization. (2011). Enterohaemorrhagic Escherichia coli.
Zakeri, A. and Kashefi, P. (2012). Antimicrobial susceptibilities of avian Escherichia coli
isolates in Tabriz, Iran. Afr. J. Biotechnol., 11(9): 4467-4470.
Zaman, S. F. J. and Arip, Y. M. (2012). Isolation and characterization of phage specific
to E. coli O157:H7. Proceedings of The 2nd Annual International Conference
Syiah Kuala University 2012 and The 8th IMT-GT Uninet Biosciences
Conference, Banda Aceh, 22-24 November 2012.
Zende, R. J., Chavhan, D. M., Suryawanshi, P. R., Rai, A. K. and Vaidya, V. M. (2013).
PCR detection and serotyping of enterotoxigenic and shigatoxigenic Escherichia
coli isolates obtained from chicken meat in Mumbai, India. Vety. World., 6(10):
770-773.
175
Zhang Y, Laing C, Steele M, Ziebell K, Johnson R, Benson AK, et al. (2007). Genome
evolution in major Escherichia coli O157:H7 lineages. BMC Genomics, 8: 121.
Zinnah, M. A., Bari, M. R., Islam, M. T., Hossain, M. T., Rahman, M. T., Haque, M. H.,
Ruma, S. R. P. and Islam, M. A. (2007). Characterization of Escherichia coli
isolated from samples of different biological and environmental sources. Bangl.
J. Vet. Med., 5(1 and 2): 25-32.
Zinnah, M.A., Haque, M.H., Islam, M.T., Hossain, M.T., Bari, M.R., Babu, S.A.M.,
Rahman, M.T and Islam, M.A (2008). Drug sensitivity pattern of Escherichia
coli isolated from samples of different biological and environmental sources.
Bangl. J. Vet. Med., 6 (1): 13–18.
176
ANNEXURE- I
Medium gm / L
Tryptic soya broth
Casein enzymic hydrolysate 17.00 g
Peptic digest of soyabean meal 3.00 g
Sodium chloride 5.00 g
Dipotassium phosphate 2.50 g
Dextrose 2.50 g
pH 7.3±0.2
Tryptic soya agar
EMB agar
Peptic digest of animal tissue 10.00 g
Dipotassium phosphate 2.00 g
Lactose 5.00 g
Sucrose 5.00 g
Eosin-Y 0.40 g
Methylene blue 0.065 g
Agar 13.50 g
Luria Bertani broth
Casein enzymatic hydrolate 1.50 g
Yeast extract 5.00g
Sodium chloride 10.00 g
pH 7.5±0.2
Casein enzymatic hydrolysate 15.0 g
Agar 15.0 g
Soyatone (soya peptone) 5.0 g
Sodium chloride 5.0 g
pH 7.3±0.2
177
Muller-Hinton agar
Beef, infusion from 300.0 g
Casein acid hydrolysate 17.50 g
Agar 17.00 g
Starch 1.50 g
pH 7.3±0.2
MacConkey agar
Peptic digest of animal tissue 10.00 g
Casein enzymatic hydrolate 1.50 g
Pancreatic digest of gelatine 17.00 g
Lactose 10.00 g
Bile salts 1.50 g
Sodium chloride 5.00 g
Crystal violet 0.001 g
Neutral red 0.03g
Agar 15.00 g
Sorbitol MacConkey agar
Peptic digest of animal tissue 17.00 g
Spdium chloride 5.00 g
Potassium peptone 3.00 g
Biles salt 1.50 g
Neutral red 0.03 g
Crystal violet 0.001
178
ANNEXURE – II
1. Indole test
This test demonstrates the ability of certain bacteria to decompose the amino acid
tryptophane to indole which accumulates in the medium.
Medium
Peptone (containing sufficient tryptophane) 20.0 g
Sodium chloride (NaCl) 5.0 g
Distilled water 1000 ml
Adjust the pH to 7.4 dispense and sterilize by autoclaving at 1210C for 15 minutes.
Kovac’s reagent composition
Amyl or isoamyl alcohol 150.0 ml
P-Dimethyl-amino benzaldehyde 10.0 g
Concentrated Hydrochloric acid 50.0 ml
Dissolve the aldehyde in the alcohol and slowly add the acid. Prepare in small
quantities and store in the refrigerator. Shake gently before use.
Method
Inoculate the medium and incubate for 48 hours at 370C. Sometimes a period of 96
hours at 370C may be required for optimum accumulation of indole. Add 0.5 ml Kovac’s
reagent and shake gently. A red colour ring in the alcohol layer indicates a positive
reaction.
2. Methyl red test
The methyl red test media is employed to detect the production of sufficient acid
during the fermentation of glucose.
179
Medium
Peptone (Glucose phosphate peptone water) 5.0 g
Dipotassium hydrogen phosphate 5.0 g
Distilled water 1000 ml
Glucose 10% solution 50.0 ml
Dissolve the peptone and phosphate, adjust the pH to 7.6, filter dispense in 5ml amounts
and sterilize at 1210C. for 15 min. sterilize the glucose solution by filtration and add 0.25
ml to each tube (final concentration 0.5%).
Methyl red indicator solution
Methyl red 0.1 g
Ethanol 300 ml
Distilled water 200 ml
Method
Inoculate the liquid medium lightly from a young agar slope culture and incubate
at 370C for 48 hours. Add about five drops of the methyl red reagent. Mix and read
immediately. Positive tests are bright red and negative tests are yellow. If the results after
48 hours are equivocal, the test should be repeated with cultures that have been incubated
for 5 days. For some organisms, incubation at 300C for 5 days is preferable to incubation
at 370C for 2 or 5 days.
3. Voges – Proskauer test
This is test usually done in conjunction with methyl red test. Since the production
of acetyl methyl carbinol or butylenes glycol usually results in insufficient acid
accumulating during fermentation to give a methyl red positive reaction.
Medium
Glucose phosphate peptone water as for methyl red test.
180
Method
Incubate at 370C or 300C for 48 hours. Add 1ml of 40% potassium hydroxide and 3
ml of 5% solution of α –naphthalene absolute ethanol. A positive reaction is indicated by
the development of a pink colour in 2 – 5 minutes, becoming in crimson in 30 min. the
tube can be shaken at intervals to ensure maximum aeration.
4. Citrate utilization test
This is a test for the ability of an organism to utilize citrate as the sole carbon and
energy source for growth and an ammonium salt as the sole source of nitrogen.
Simmons medium
Simmons citrate medium is modification of the Koser’s medium with agar and
indicator added.
Koser’s medium 1000 ml
Agar 20.0 g
Bromothymol blue (0.2%) 40.0 ml
Dispense, autoclave at 1210C for 15 min and allow to set slopes.
Method
Inoculate from a saline suspension of the organism to be tested. Incubate for 96
hours at 370C. Positive reaction indicates the blue colour and streak of growth and
negative reaction indicates the original colour and no growth.
5. Triple sugar iron agar test
Triple Sugar Iron Agar (TSI Agar) is used for the differentiation of gram-negative
enteric bacilli based on carbohydrate fermentation and the production of hydrogen
sulphide.
181
TSI Agar contains three sugars (dextrose, lactose and sucrose), phenol red for
detecting carbohydrate fermentation and ferrous ammonium sulphate for detection of
hydrogen sulphide production (indicated by blackening in the butt of the tube).
Medium
Peptic digest of animal tissue 10.0 g
Casein enzymatic hydrolysate 10.0 g
Yeast extract 3.0 g
Beef extract 3.0 g
Lactose 10.0 g
Sucrose 10.0 g
Dextrose 1.0 g
Ferrous sulphate 0.2 g
Sodium chloride 5.0 g
Sodium thiosulphate 0.3 g
Phenol red 0.024 g
Agar 12.0 g
Distilled water 1000 ml
pH 7.4±0.2
Method
To inoculate, carefully touch only the center of an isolated colony on an enteric
plated medium with a cool, sterile needle, stab into the medium in the butt of the tube,
and then streak back and forth along the surface of the slant. Several colonies from each
primary plate should be studied separately, since mixed infections may occur.
Incubate with caps loosened at 35°C and examine after 18-24 hours for
carbohydrate fermentation, gas production and hydrogen sulphide production. Any
combination of these reactions may be observed. Do not incubate longer than 24 hours
182
because the acid reaction in the slant of lactose and sucrose fermenters may revert to an
alkaline reaction.
Results
Compare reactions produced by the unknown isolate with those produced by the
known control organisms.
A yellow (acidic) colour in the slant and butt indicates that the organism being
tested ferments dextrose, lactose and/or sucrose.
A red (alkaline) colour in the slant and butt indicates that the organism being
tested is a non-fermenter.
Hydrogen sulphide production results in a black precipitate in the butt of the
tube.
Gas production is indicated by splitting and cracking of the medium.
6. Rapid Urease test broth
Rapid Urease test broth is recommended for rapid detection of urease production.
Medium
Yeast extract 0.10 g
Urea 20.0 g
Monopotassium phosphate 0.091 g
Disodium phosphate 0.095 g
Phenol red 0.010 g
pH 6.8±0.2
Suspended 20.30 g in 1000 ml distilled water, mixed well and sterilized by filtration. Do
not autoclaved or heat the medium. Dispensed in sterile tubes.
Method
Inoculate from a saline suspension of the organism to be tested. Incubate at 370C
overnight. Positive reaction indicates the cerise colour and negative reaction indicates the
original colour.
183
7. Motility test
Motility test medium is recommended for detection of bacterial motility.
Medium
Tryptose 10.0 g
Sodium chloride 5.0 g
Agar 5.0 g
Distilled water 1000 ml
Final pH (at 250C) 7.2±0.2
Dissolve the contents in distilled water, adjust the pH to 7.2±0.2 and make up the
volume to 1000 ml with distilled water. Dispense in tubes and sterilize at 1210C for 15
min. Allow tubed medium to cool in an upright position.
Method
Inoculation is done by stabbing through centre of the medium. Incubate at 370C
for 24 h. Non-motile organisms grow only along the line of inoculation whereas motile
organisms grow away from the line of inoculation or may show growth even throughout
the medium. If the results after incubation are weak or equivocal, then the motility should
be confirmed by flagellum strain or by direct wet microscopy (hanging drop method).
7. Gram’s stain
A. Ammonium oxalate crystal violet
Solution 1:
Crystal violet 2.0 g
Ethyl alcohol (95 per cent) 20.0 ml
Solution 2:
Ammonium oxalate 0.8 g
184
Distilled water 80.0 ml
Solution 1 and 2 was mixed well and then filtered.
B. Gram’s iodine solution
Iodine 1.0 g
Potassium iodine 2.0 g
The ingredients were dissolved in distilled water to make total
volume of 300 ml and filtered.
C. Acetone or Ethyl alcohol (decolourizer)
D. Safranin (counter stain)
Safranin-O (2.5 per cent solution) in
95 per cent alcohol
10.0 ml
Distilled water 100.0 ml
185
ANNEXURE-III
1. Ethydium bromide (1%)
Ethydium bromide 1 g
Distilled water 100 ml
2. Phenol: Chloroform: Isoamyl alcohol
Phenol 25 ml
Chloroform 24 ml
Isoamyl alcohol 1 ml
3. TBE (1X)
Tris base 10.8 g
Boric acid 5.5 g
EDTA Disodium salt 0.76 g
The ingredients were dissolved in distilled water to make up total volume of 1000 ml
4. Agarose gel loading buffer (6X)
Bromophenol blue 0.25% (w/v)
Xylene cyanol FF 0.25% (w/v)
Ficoll 15% (w/v), (Type 400; Pharmacia)
Dissolved in appropriate volume of deionized water
5. TE buffer (pH 8.0)
Tris base 0.06 g
EDTA 0.0075 g
Deionized water up to 50 ml
186
6. SM buffer
Reagent Amount Final concentration
Sodium chloride (NaCl) 5.8 g 100 mM
Magnesium sulphate (MgSO4.7H2O) 2 g 8 mM
Tris-Cl (1 M, pH 7.5) 50 ml 50 mM
Distilled water 1000 ml
Dissolved the NaCl and MgSO4.7H2O in 800 ml of distilled water, added the Tris-Cl and
adjusted the volume to 1000 ml with distilled water. Sterilized the buffer by autoclaving
for 20 min at 15 psi on liquid cycle and allowed to cool. The SM buffer was stored
indefinitely at room temperature.
187
ANNEXURE-IV
Table. 1: Isolation of E. coliphage from sewage samples
S.no Location of the organized, unorganized dairy
farm and animal sheds
Isolation of
bacteriophages against
E. coli
1. Organized farm, C.V.Sc, Tirupati +
2. Animal shed-1, Vidyanagar ---
3. Animal shed-2, Vidyanagar ---
4. Animal shed, Thummalagunta ---
5. Organized farm-1, S.V. Goshala, Tirupati ---
6. Organized farm-2, S. V. Goshala, Tirupati +
7. Organized farm-3, S. V. Goshala, Tirupati ---
8. Organized farm-4, S. V. Goshala, Tirupati ---
9. Organized farm-5, S. V. Goshala, Tirupati ---
10. Organized farm-6, S. V. Goshala, Tirupati ---
11. Animal shed-1 Peruru +
12. Animal shed-2, Peruru ---
13. Unorganized farm, Peruru +
14. Animal shed-1, Perumalla palli ---
15. Unorganized farm, Perumalla palli ---
16. Unorganized farm-1, Pudhipatla +
17. Animal shed-1, Pudhipatla ---
18. Animal shed-2, Pudhipatla +
19. Animal shed-3, Pudhipatla ---
20. Unorganized farm-2, Pudhipatla ---
21. Animal shed-2, Perumalla palli ---
22. Unorganized farm-1, Srinivasamangapuram (S.M
puram) ---
23. Animal shed-1, S.M puram +
24. Animal shed-2, S.M puram ---
25. Unorganized farm-2, S.M puram ---
26. Unorganized farm-3, S.M puram +
27. Organized farm-1, S.M puram ---
28. Animal shed-1, Thondawada ---
29. Animal shed-2, Thondawada +
30. Unorganized farm- Thondawada ---
31. Organized farm-2 S.M puram +
32. Animal shed-1, Kaluru ---
33. Animal shed-2, Kaluru ---
188
34. Unorganized farm- Nerabaily ---
35. Animal shed-Nerabaily ---
36. Animal shed- Lakshmipuram ---
37. Organized farm, Varadhayapalem ---
38. Animal shed, Mallavaram ---
39. Organized farm-1, Iskan temple, Tirupati ---
40. Organized farm-2, Iskan temple, Tirupati ---
41. Animal shed-1, Anuru ---
42. Animal shed-2, Anuru +
43. Animal shed-1, Ksheerasaagaram ---
44. Unorganized farm, Ksheerasaagaram ---
45. Animal shed-2, Ksheerasaagaram ---
46. Animal shed, Chokkamadugu ---
47. Animal shed-1, Pulluru ---
48. Animal shed-2, Pulluru ---
49. Unorganized farm, Pulluru ---
50. Organized farm-1, L R S, Palamaneru ---
51. Animal shed-1, Katikepalli +
52. Animal shed-2, Kaikepalli ---
53. Organized farm-2, L R S, Palamaneru +
54. Animal shed-1, Medawada ---
55. Unorganized farm-1, Medawada +
56. Animal shed-2, Medawada ---
57. Unorganized farm-1, Dwarakanagar ---
58. Animal shed, Dwarakanagar +
59. Unorganized farm-2, Dwarakanagar ---
60. Organized farm-3, L R S, Palamaneru ---
61. Animal shed-1, Chinnatayyar ---
62. Animal shed-2, Chinnatayyar ---
63. Organized farm, Near Bhakarapeta ---
64. Animal shed, Mangunta +
65. Animal shed-1, Kollagunta ---
66. Animal shed-2, Kollagunta ---
67. Animal shed, V.V.puram ---
68. Unorganized farm-2, Medawada ---
69. Animal shed, Padhmapuram ---
70. Animal shed-1, Srirangarajapuram ---
71. Animal shed-2, Srirangarajapuram ---
72. Unorganized farm, Srirangarajapuram ---
73. Animal shed, Pathapalem ---
74. Organized farm, Bangarupalem ---
75. Organized farm, Putturu ---
189
76. Unorganized farm-1, Kaapukandreega ---
77. Unorganized farm-2, Kaapukandreega ---
78. Animal shed, Kaapukandreega ---
79. Organized farm-1, Srikalahasthi ---
80. Animal shed, DK maripalli ---
81. Unorganized farm, DK maripalli ---
82. Animal shed-1, Venugopalapuram +
83. Animal shed-2, Venugopalapuram ---
84. Organized farm-2, Srikalahasthi ---
85. Unorganized farm, Repalli ---
86. Animal shed, Repalli ---
87. Organized farm, Kollagunta ---
88. Animal shed-1, GMR puram ---
89. Animal shed-2, GMR puram ---
90. Organized farm, Yeguva kamma kangreega ---
91. Unorganized farm, Maddikuppam ---
92. Animal shed, Maddikuppam ---
93. Animal shed, Dasarigunta ---
94. Unorganized farm, Dasarigunta ---
95. Animal shed-1, Venkatapuram +
96. Animal shed-2, Venkatapuram ---
97. Animal shed, Kothapalli mitta ---
98. Unorganized farm, Kothapalli mitta ---
99. Animal shed, CK puram ---
100. Unorganized farm, CK puram ---
101. Organized farm, R.K.V.B peta ---
102. Animal shed-1, Settivanattem ---
103. Animal shed-2, Settivanattem ---
104. Organized farm, Aarimakula palli ---
105. Animal shed, Aarimakula palli ---
106. Animal shed, Vadamalapeta ---
107. Unorganized farm, Vadamalapeta +
108. Animal shed, Thaduku ---
109. Organized farm, Krishna ramapuram ---
110. Organized farm, Jeevakona ---
111. Animal shed, Parameswara mangalam ---
112. Animal shed, Vepagunta ---
113. Unorganized farm, Vepagunta ---
114. Organized farm, Rajula kangreega ---
115. Unorganized farm-1, M. kothuru ---
116. Unorganized farm-2, M. kothhuru ---
117. Animal shed, Chinthamandi ---
118. Unorganized farm, Chinthamandi ---
190
119. Animal shed-1, VKR puram +
120. Animal shed-2, VKR puram ---
121. Unorganized farm, Gundrajukuppam ---
122. Animal shed, Gundrajukuppam ---
123. Organized farm, S.S konda ---
124. Animal shed, Adavikothuru ---
125. Unorganized farm, Mudipalli ---
126. Animal shed, SS konda ---
127. Animal shed, Therani +
128. Unorganized farm, Inam bakham ---
Top Related