ISOLATION AND CHARACTERIZATION OF LYTIC …...iii CERTIFICATE This is to certify that the thesis...

i

ISOLATION AND CHARACTERIZATION OF LYTIC

BACTERIOPHAGES AGAINST Escherichia coli ISOLATED FROM

DAIRY FARM SEWAGE

BY

SANEM SOMA SEKHAR GOUD B.V.Sc & A.H.

RVM/2014-003

THESIS SUBMITTED TO THE

P. V. NARASIMHA RAO TELANGANA VETERINARY

UNIVERSITY

IN PARTIAL FULFILMENT OF THE REQUIREMENTS

FOR THE AWARD OF THE DEGREE OF

MASTER OF VETERINARY SCIENCE

DEPARTMENT OF VETERINARY PUBLIC HEALTH AND EPIDEMIOLOGY

COLLEGE OF VETERINARY SCIENCE

RAJENDRANAGAR, HYDERABAD-500 030.

P.V. NARASIMHA RAO TELANGANA VETERINARY UNIVERSITY,

HYDERABAD-500 030

OCTOBER’ 2016

ii

CERTIFICATE

Dr. SANEM SOMA SEKHAR GOUD (RVM/14-003) has

satisfactorily prosecuted the course of research and that the thesis entitled “ISOLATION

AND CHARACTERIZATION OF LYTIC BACTERIOPHAGES AGAINST

Escherichia coli ISOLATED FROM DAIRY FARM SEWAGE” submitted is the

result of original research work and is of sufficiently high standard to warrant its

presentation to the examination. I also certify that the thesis or part of has not been

previously submitted by him for a degree of any University.

Date : (A. JAGADEESH BABU)

Place : Hyderabad Major Advisor

iii

CERTIFICATE

This is to certify that the thesis entitled “ISOLATION AND

CHARACTERIZATION OF LYTIC BACTERIOPHAGES AGAINST Escherichia

coli ISOLATED FROM DAIRY FARM SEWAGE” submitted in partial fulfilment of

the requirements for the degree of MASTER OF VETERINARY SCIENCE for P. V.

Narasimha Rao Telangana Veterinary University, Hyderabad is a record of the bonafied

research work carried out by Dr. SANEM SOMA SEKHAR GOUD, RVM/14-003

under my guidance and supervision. The subject of the thesis has been approved by

Student’s Advisory Committee.

No part of the thesis has been submitted for any other degree or diploma. All the

assistance and help received during course of investigation have been duly acknowledged

by the author of thesis.

(A.JAGADEESH BABU)

Chairman of the Advisory Committee

Thesis approved by the Student Advisory Committee

Chairman : Dr. A.JAGADEESH BABU

Associate Professor and Head

Department of Veterinary Public Health and

Epidemiology

College of Veterinary Science

Tirupati, Chittoor District, A.P.

Member : Dr. N. KRISHNAIAH

Professor and Head

Department of Veterinary Public Health and

Epidemiology


Rajendranagar, Hyderabad-500 030.

Member : Dr. P. KALYANI

Assistant Professor

Department of Veterinary Biotechnology


Rajendranagar, Hyderabad-500 030.

iv

CONTENTS

Chapter

No.

Title Page No.

I.

INTRODUCTION

1-3

II. REVIEW OF LITERATURE 4-56

III. MATERIALS AND METHODS 57-72

IV. RESULTS 73-110

V. DISCUSSION 111-130

VI. SUMMARY 131-135

LITERATURE CITED 136-175

ANNEXURE 176-190

v

LIST OF TABLES

Table

No.

Title Page

No.

2.1

ICTV classification of phages

48

3.1 List of equipment used in the study 59

3.2 Source and number of samples collected 59

3.3 Antimicrobial discs used to study the antimicrobial susceptibility

of the isolates 63

3.4 Details of oligonucleotide primers used in this study 65

4.1 Results of the biochemical tests for Escherichia coli isolates 74

4.2 Antimicrobial sensitivity/ intermediate/ resistant-patterns of

Escherichia coli from different sources 81

4.3 Antibiotic resistant among Escherichia coli (source wise) 82

4.4 Components of reaction mixture used in PCR assay 84

4.5 PCR conditions used for multiplex PCR assay 85

4.6 Screening and comparison of cultural method for detection of

Escherichia coli and multiplex PCR for detection of Shiga-toxin

producing E. coli

87

4.7 Effect of 400C temperature on the activity of phage 92

4.8 Effect of 600C temperature on the activity of phage 93

4.9 Effect of sunlight on the activity of phage 94

4.10 Effect of U.V light on the activity of phages 95

4.11 Effect of SDS (1%) on the activity of phages 96

4.12 Effect of SDS (0.1%) on the activity of phages 97

4.13 Effect of phenol (1%) on the activity of phages 98

4.14 Effect of phenol (5%) on the activity of phages 99

4.15 Effect of chloroform (5%) on the activity of phages 100

4.16 Effect of chloroform (10%) on the activity of phages 101

4.17 Effect of formalin (40%) on the activity of phages 102

4.18 Activity of bacteriophages against E. coli isolated from sewage

samples 109

vi

LIST OF ILLUSTRATIONS

Figure

No. Particulars

Page

No.

1.

Plate showing pink colonies of E. coli on MacConkey agar

plate

75

2. Plate showing green metallic sheen of E. coli on EMB agar plate 75

3. Picture showing gram negative coccobacillary rods of E. coli 76

4. Indole test showing red colour ring: positive for E. coli 76

5. Methyl red test showing red colour: positive for E. coli 77

6. Voges-Proskauer test showing no red colour formation: positive

for E. coli

77

7. Citrate test showing no blue colour formation: positive for E. coli 78

8. Triple sugar iron test showing acid slant, acid butt and gas

production: positive for E. coli

78

9. Urease test showing no pink colour formation: positive for E. coli 79

10. Motility test showing growth of organisms away from the line of

inoculation: positive for E. coli

79

11. Antibiotic sensitivity and resistance pattern of the E. coli

isolates (Ampicillin, Azithromycin, Chloramphenicol,

Gentamicin, Streptomycin, Penicillin-G and Tetracycline)

83

12. Antibiotic sensitivity and resistnace pattern of the E. coli

isolates (Ciprofloxacin, Meropenem, Tigecycline, Cefadroxil,

Cefotaxime, Cefoperazone and Ofloxacin)

83

13. Detection of stx1, stx2, eaeA and hlyA in sewage samples

collected from organized dairy farms

88

vii


collected from unorganized dairy farms

88


collected from animal sheds

89

16. Picture showing lytic bacteriophages against E. coli: spot test 103

17. Plaques on secondary streaking on the E. coli lawn gave the

clearing zone around the streak lines

103

18. Picture showing lytic bacteriophages against E. coli: Double agar

overlay method (circular plaques with diameter ranging from 0.1

to 3 mm)

104

19. Effect of heat on the activity of bacteriophages (%) 104

20. Effect of sunlight on the activity of bacteriophages (%) 105

21. Effect of U.V light on the activity of the bacteriophages (%) 105

22. Effect of SDS on the activity of bacteriophages (%) 106

23. Effect of phenol on the activity of bacteriophages (%) 106

24. Effect of chloroform on the activity of bacteriophages (%) 107

25. Effect of formalin on the activity of bacteriophages (%) 107

26. Determination of molecular weight of E. coliphage nucleic acid 108

27. Electron micrograph of phage by Scanning Electron Microscopy 110

viii

LIST OF ABBREVIATIONS

µg : micro gram

µl : micro litre

aw : Water activity

Bp : Base pair

Kbp : Kilo base pair

CDC : Centers for Disease Control and Prevention

Cfu : Colony forming units

Dntp : Deoxy ribo nucleoside triphosphate

DNA : Deoxy ribonucleic acid

EaeA : Intimin Gene

E. coli : Escherichia coli

EHEC : Enterohaemorrhagic E. coli

ETEC : Enterotoxigenic E. coli

EPEC : Enteropathogenic E. coli

EIEC : Enteroinvasive E. coli

EAEC : Enteroaggregative E. coli

DEAC : Diffuse-adhering E. coli

STEC : Shiga-toxin producing E. coli

VTEC : Verotoxin producing E. coli

EMB : Eosine Methylene Blue

Fig. : Figure

g, gm : Gram

HC : Haemorrhagic Colitis

HUS : Haemolytic Uremic Syndrome

TTP : Thrombotic thrombocytopenic purpura

ix

A/E : Attaching and Effacing

NM : Non motile

I.U : International Units

MCA : MacConkey agar

mg : milli gram

V : Volts

Ma : milli ampere

Min : Minute

H : Hour

Ml : Millilitre

mM : Millimolar

Pmol : Pico moles

M : Molarity

MR : Methyl red

VP : Voges-Proskauer

IMViC : Indole, Methyl red, Voges-Proskauer, Citrate

PCR : polymerase chain reaction

rpm : Rotations per minute

stx1 : Shiga toxin 1

stx2 : Shiga toxin 2

hlyA : Haemolytic Gene

SMAC : Sorbitol MacConkey agar

TAE : Tris -Acetate with EDTA

TBE : Tris-Borate with EDTA

TE : Tris EDTA buffer

Taq : Thermus aquaticus

x

TSB : Tryptic soya broth

TSI : Triple sugar iron agar

UV : Ultra Violet

V/cm : Volts per centimetre

v/v : Volume/volume

ICTV : International Committee on Taxonomy of

Viruses

SDS : Sodium do Decyl Sulphate

PFU : Plaque Forming Unit

SM buffer : Sodium magnesium

EDTA : Ethylene Diamine Tetra Acetic acid

SEM : Scanning Electron Microscopy

% : Per cent

0C : Centigrade / degree Celsius

NaCl : Sodium chloride

MgSO4 : Magnesium sulphate

HCl : Hydrochloric acid

et al. : And associates or co workers

xi

ACKNOWLEDGEMENT

I am very much fortunate and privileged to receive guidance and help from my major

advisor, DR. A. JAGADEESH BABU, Associate Professor & Head, Department of Veterinary

Public Health and Epidemiology, College of Veterinary Science, Tirupati, for his genuine co-

operation, guidance, encouragement and moral support from the initiation of the work to the ship-

shaping of the manuscript. I express my wholehearted indebtedness to him for his interesting

ideas and discussions that were profoundly fruitful. I consider myself fortunate to have worked

under him. I sincerely thank him for his transcendent suggestions and efforts to embellish this

research. The present work bears at every stage the impression of his work counsel, sustained

interest, careful and seasonal criticism and meticulous attention to details, for without his

guidance and valuable suggestions, this work could not have seen the light of the day. It was

indeed a rare privilege for me to work under his unending inspiration and indomitable spirit.

I deem it my honor to express my sincere thanks to Dr. N. KRISHNAIAH, Professor &

Head, Department of Veterinary Public Health and Epidemiology, College of Veterinary Science,

Rajendranagar, Hyderabad, for his valuable advice, inspiration, constant encouragement and

deliberate counsel during the course of investigation and execution of the thesis and moral

support to complete of research work.

I would like to place on records my heartfelt thanks to Dr. P. KALYANI, Assistant

Professor of Department of Veterinary Biotechnology, College of Veterinary Science,

Rajendranagar, Hyderabad and, member of my advisory committee, for their sumptuous

suggestions, generous help, affectionate guidance, constant encouragement and deliberate

counsel during the course of investigation and execution of the thesis.

I express my profound thanks to Dr. SUJATHA SINGH, Assistant Professor of

Veterinary Public Health and Epidemiology, college of veterinary science, Rajendranagar,

Hyderabad, DR. C. S. SWETHA, DR. A. SUPRIYA, Assistant Professor of Veterinary Public

Health and Epidemiology, College of Veterinary Science, Tirupati and DR. A. VIJAY KUMAR,

Assistant professor of Veterinary Public Health and Epidemiology, college of Veterinary Science.

Korutla, for their help and kind cooperation during my course of work. Their scientific acumen,

critical judgments and trust in my abilities has motivated me throughout the course of this

investigation and compilation of manuscript.

I am also thankful to Dr. D. Sreenivasulu, Professor and Head, Department of Veterinary

Microbiology and Dr. R. Venu, Associate Professor of Veterinary Parasitology, college of

Veterinary Science, Tirupati, for their kind cooperation during my course of work.

I am also thankful to Dr. P. Anusha, CTF, Department of Veterinary Public Health and

Epidemiology, college of Veterinary Science, Rajendranagar, Hyderabad.

xii

Inexplicable sense of reverence to my father, Sri. S. Prathap Goud, who in my life has

urged me on by way of his untiring support and seemingly unlimited belief in me and my mother,

Smt. S. Anasuyamma, who had always dreamt of my success and for her assiduous efforts in

shaping my life. They constantly educated, guided and moulded me into the present position and

whose boundless love, unparalleled affection, encouragement and moral support is a constant

source of motivation for me. I owe much to my beloved sister’s smt. Sujatha and smt. Anuradha

and brother-in-laws Mr. Suresh and Mr. Naresh, whose inspiring words and encouragement

rendered throughout my career.

From the inner core of my heart, I express my deep sense of gratitude to my colleagues,

Dr. Shylaja, Dr. Swapna, and Dr. Prasanthi, for their kind help and cooperation during the

entire research work throughout these two years.

I am very glad to acknowledge the encouragement, support and help offered by my

seniors Dr. Ramya, Dr. Rajesh Sahu, Dr. Subash, Dr. Praveen Kumar, Dr.Deepak,

Dr.Venkateshwar rao and Dr. Reshma. I also thank my junior colleagues Dr. Monika, Dr.

Sireesha and Dr. Gopi Reddy.

I owe my humble and heartfelt thanks to my friends Dr. Mary, Dr. Mahesh, Dr.

Raghavendra, Dr. Vamsi Krishna Yadav, Dr. Saleem Shabaz and my school friends for their

encouragement and support showed on me during my research period and cheering me up in my

bad times. Thank god for introducing these gifted people in my life.

I express my deep sense of gratitude to my TEACHERS, who teached me till date.

I thank the officials of P. V. NARASIMHA RAO TELANGANA VETERINARY

UNIVERSITY, HYDERABAD for providing all the necessities during my course work.

I thank the officials of SRI VENKATESWARA VETERINARY UNIVERSITY,

TIRUPATI for providing financial and all the necessities during my investigation.

I would like to extend my thanks to Non-teaching staff of Department of Veterinary Public

Health and Epidemiology, College of Veterinary Science, Hyderabad, and Tirupati for their help

in meticulous preparation of this manuscript. I apologize to all the wonderful people I have

missed of course I am indebted to all of them who did their best to improve my best.

(SANEM SOMA SEKHAR GOUD)

xiii

DECLARATION

I, Mr. SANEM SOMA SEKHAR GOUD (RVM/14-003) here by declared

that the thesis entitled “ISOLATION AND CHARACTERIZATION OF LYTIC

BACTERIOPHAGES AGAINST ESCHERICHIA COLI ISOLATED FROM

DAIRY FARM SEWAGE” submitted to P. V. Narasimha Rao Telangana Veterinary

University for the degree of MASTER OF VETERINARY SCIENCE is a result of

original research work done by me. It is further declared that the thesis or any part of

thereof has not been published earlier in any manner.

Date: (SANEM SOMA SEKHAR GOUD)

Place: Hyderabad

xiv

NAME OF THE

AUTHOR

: SANEM SOMA SEKHAR GOUD

TITLE OF THE

THESIS

: ISOLATION AND CHARACTERIZATION OF LYTIC

BACTERIOPHAGES AGAINST Escherichia coli

ISOLATED FROM DAIRY FARM SEWAGE

DEGREE TO WHICH

IT IS SUBMITTED

: MASTER OF VETERINARY SCIENCE

FACULTY : VETERINARY SCIENCE

DISCIPLINE : VETERINARY PUBLIC HEALLTH AND

EPIDEMIOLOGY

MAJOR ADVISOR : Dr. A. JAGADEESH BABU

UNIVERSITY : P.V. NARASIMHA RAO TELANGANA VETERINARY

UNIVERSITY

YEAR OF

SUBMISSION

: 2016

ABSTRACT

The present study was undertaken in developing alternatives to the antibiotics and

one such alternative is lytic bacteriophage against Escherichia coli isolated from sewage

and waste water samples. A total of 128 sewage samples were collected from organized,

unorganized dairy farms and also from animal sheds of small farms and isolated E. coli.

All the 128 isolates were confirmed as Escherichia coli by subjecting them to various

biochemical tests. The isolates were streaked on SMAC plates, which revealed that none

of the isolates have shown colourless colonies but 108 isolates have shown pink colonies.

Antibiogram pattern was studied for the isolates using 14 antibiotic discs, which

revealed varying degree of resistance to ampicillin (92.19%), penicillin-G (76.56%),

cefotaxime (71.10%), streptomycin (64.84%), gentamicin (64.06%), chloramphenicol

(57.81%), tetracycline (54.69%), cefoperazone (51.56%), ofloxacin (44.53%), cefadroxil

(39.06%), ciprofloxacin (38.28%), azithromycin (30.40%), meropenem (27.34%) and

tigecycline (20.31%).

xv

PCR assay was standerdized for detection of STEC using primers derived from

stx1, stx2, eaeA and hlyA genes. The PCR assay revealed that out of 28 samples from

organized dairy farms one (3.57%) was positive for stx1 gene, Out of 32 samples from

unorganized dairy farms, two (6.25%) samples were positive for STEC, of which one

(3.13%) carried stx1 gene and another (3.13%) carried stx1, stx2 and eaeA genes. Out of

68 samples from the animal sheds, eight (11.76%) samples were for STEC by PCR

method. Among the eight STEC, three (4.41%) samples carried stx1, four (5.88%)

samples carried stx2 and another one (1.47%) sample carried both stx1 and stx2 genes.

Bacteriophages isolated from dairy sewage and waste water samples against the

Escherichia coli, phages produced clear plaques on the TSA plates, which were discrete,

clear, circular plaques of diameter 0.1 to 3 mm.

Physico-chemical characterization of phages was carried out by subjecting them

to heat, sunlight, U V light, SDS, phenol, chloroform and formalin at different time

intervals. The phages were completely reduced when exposed at 400C for a period of 3 h,

whereas at 600C within 30 min. Complete reduction in the phage titre was noticed when

exposed to direct sunlight and U.V light for a period of 3h and 5 min respectively. The

phage concentration was completely reduced when exposed to 1% SDS, 0.1% SDS, 1%

phenol, 5% phenol, 5% chloroform, 10% chloroform and 40% formalin within a period

of 15 min, 15 min, 30 min, 15 min, 3 min, 5 min and 15 min respectively. The phage

DNA was isolated and subjected to restriction enzyme digestion analysis with EcoRI

enzyme and found that the bands formed by the phages were below 48.5 kb. The SEM

observations of phage revealed that the phage had icosahedral head with short tail. It was

found that based on morphology the phage exhibited non-contractile tail and belong to

the order Caudovirales and family Podoviridae. The invitro experiment showed that there

was a 100% reduction in the E. coli count after 10 h of incubation. All these elements

suggest that phages could be useful as natural antimicrobials against Escherichia coli.

1

CHAPTER I

INTRODUCTION

The world Health Organization (WHO) estimated that 5 million children die each

year as a consequence of acute diarrhoea (Snyder and Merson, 1982). Enteric bacteria

like Escherichia coli, shigella sps, salmonella sps, enterotoxigenic Escherichia coli

(ETEC), etc. (William et al., 2008) infect gastrointestinal tract of humans and animals.

Sewage from animal farms and wastewater streams are the major sources of these enteric

pathogens (Rene et al., 2007). The most common cause of worldwide food and water

borne human diarrhoea is ETEC. Due to ETEC in developing countries 650 million cases

per year of enteric diseases occur which result in 800,000 deaths (Susan et al., 2006).

Escherichia coli is the cause of a third of cases of childhood diarrhoea in developing and

threshold countries (Albert et al., 1995) and is also the most prominent cause of diarrhoea

in travellers to developing countries (Black, 1990). E. coli is also prominently associated

with diarrhoea in pet and farm animals. Due to its malleable genetic character, E. coli has

one of the widest spectra of disease of any bacterial species (Donnenberg, 2002). The

recent emergence of E. coli O157 as a major food pathogen is a lively reminder of its

dynamic character and also the emergence of antibiotic resistance among these

microorganisms.

Antibiotic-resistant pathogens constitute a worsening global health problem

exacerbated by interconnected travel, antibiotic overuse, horizontal gene transfer, and

bacterial evolution. New classes of antimicrobials are needed to treat these pathogens but

the drug development pipeline is dry (Walsh, 2003). As a result, there has been a renewed

interest in alternative antimicrobial treatments, including bacteriophages, antimicrobial

peptides and proteins, and nanoparticles. The discovery of bacteriophage particles that

seemed to ‘eat bacteria’ is generally attributed to Twort (1915) and D’Herelle (1917) in

2

the early 20th century. The therapeutic potential of ‘phages’ – members of the kingdom

of viruses and obligate predators of bacteria – was recognized soon thereafter and applied

for several decades before the discovery and widespread adoption of antibiotics

(Sulakvelidze et al., 2001).

Bacteriophages are viruses which range from 24-200 nm in size; infect bacterial

cells (Al-Mola et al., 2010). These are the obligate intracellular parasites which infect

bacteria, seize their replication machinery, replicate into thousands of new progenies and

lyses the cell for escape (Gu et al., 2012). Phages are the most abundant entities on earth,

(1030 to 1032) and help in regulating microbial balance in environment. In 1971, a

Canadian scientist, Felix d Herelle at Pasteur Institute of Science accidentally came across

phages as Fleming came across penicillin (Lawrence Broxmeyer, 2004). Phages lack their

own metabolic machinery and hence require bacterial host for replication. Phages are

highly host specific and can infect a specific species or strain of bacteria. But there are

some exceptions, like listeria A511, which can infect entire genus (Martin et al., 1993).

Like all viruses, genome of bacteriophages consist of nucleic acid (RNA or DNA)

surrounded by a protein coat, capsid. Capsid is made up of morphological subunits

capsomeres. These capsomeres are comprised of protein subunit protomeres. Some

phages also contain additional structures such as tail and fibres (Grabow, 2000). The

receptors on the host cell are recognized by the phage tail fibers. After adsorption phage

DNA will be incorporated into host cell, whereas capsid remains outside the cell. Host

cell envelope is weakened by lysozyme activity of tail base plate of phages (Hilla Hadas

et al., 1997). Inside host cell, gene expression and morphogenesis occur. New virion

progenies are produced and lyse the bacterial cell. Depending on the life cycle pattern,

bacteriophages are of two types, lytic or lysogenic. Lytic phages typically proceed with

replication immediately after infecting the host cell and new viruses are released in large

numbers by lysis of the host cell. Lysogenic phages integrate their nucleic acid into the

3

host cell where it remains until induced to become autonomous again and start replication

and cell lysis (Raghu et al., 2012).

The clinical use of phage therapy is faced with long product development and

approval timelines in Western regulatory frameworks. As a result, many companies and

researchers have pursued food safety, agricultural, industrial, and clinical diagnostic

applications instead. Several companies have successfully developed phage-based

products with EPA, USDA, and FDA approval. Such products have established a

favourable regulatory precedent in which individual components of phage cocktails can

be tailored towards bacterial targets. Products targeted at Listeria monocytogenes

represent one of the first examples of phage cocktails to obtain Generally Recognized As

Safe (GRAS) status from the FDA. These products are designed to be used as sterilizing

agents for processed foods (ListShieldTM and LISTEXTM P100). Another approved

product treats crop pathogens such as Xanthomonas campestris pv. vesicatoria and

Pseudomonas syringae pv. tomato (Omnilytics’ AgriphageTM). Further products are in

development against other bacterial pathogens, including Escherichia coli strains

(O157:H7) and Salmonella enterica (Abuladze et al., 2008)

Keeping in view of the public health significance of Shiga Toxin producing

Escherichia coli the work has been designed to study the isolation and characterization

of Shiga Toxin producing Escherichia coli and their specific phages present in the same

environment to develop new strategy for generalized control of bacterial populations,

especially pathogens in waste water that come out from animal farms with the following

objectives

1. Isolation, identification and molecular characterization of E. coli from the dairy

farm sewage.

2. Isolation and characterization of strongly lytic bacteriophages against the E. coli

isolated from the dairy farm sewage.

4

CHAPTER II

REVIEW OF LITERATURE

2.1 Escherichia coli

Escherichia coli (E. coli) belongs to the family Enterobacteriaceae, which is a

Gram negative, robust, facultatively anaerobic, motile, non-sporulating, rod shaped

bacteria (Vogt and Dippold, 2005). The bacterium was previously discovered by Theodor

Escherich, a German paediatrician in the year 1885 from the faecal sample of healthy

individual and named it as Bacterium coli because of the fact that it was found in the

colon. Early prokaryotic classification placed Bacterium coli in a genera based on their

motility and shape. Afterwards Emst Haeckel’s bacterial classification placed this

bacteria in the Kingdom Monera (Escherich, 1885). In 1895 Migula reclassified this

bacteria in the genus Escherichia which was named so after its discoverer (Castellani and

Chalmers, 1919). This genus belongs to the bacterial group formally called “coliforms”

which are the members of the “the enterics” known as Enterobacteriaceae family (George

and Garrity, 2005).They are the normal component of the microflora in the intestine of

warm-blooded organisms. Most of the E. coli strains inhabiting intestines of humans and

animals are harmless (Hartl and Dykhuizen, 1984). However, some E. coli strains such

as E. coli O157:H7, can make people sick, causing severe stomach cramps, diarrhoea and

vomiting (PHAC, 2015). The types of E. coli that can cause diarrhoea may be transmitted

through contaminated water or food, or through direct contact with animals or persons

(CDC, 2012).

Pathogenic E. coli represents a phenotypically and genotypically diverse group of

pathogens and there is no single method to enrich and to isolate for the various pathotypes

that exist. However, current evidence indicates that pathogenic E. coli strains are more

than one type. E. coli has been subdivided into six groups based on their ability to produce

5

toxins, to adhere and to invade epithelial cells (Kornacki and Marth, 1982; Doyle, 1991;

Donnenberg and Whittam, 2001). They are enterotoxigenic E. coli (ETEC),

enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterohemorrhagic E.

coli (EHEC), enteroaggregative E. coli (EAEC) and diffuse-adhering E. coli (DEAC),

among them EHEC is considered as most important one.

2.2. Enterohemorrhagic E. coli (EHEC)

In 1983, an E. coli strain serotype O157:H7, was identified in association with

outbreaks of bloody diarrhoea called hemorrhagic colitis (HC) leading to the recognition

of EHEC as a new and increasingly important class of enteric pathogens causing intestinal

and renal disease (Nataro and Kaper, 1998). The term enterohemorrhagic E. coli (EHEC)

is applied to those STEC serotypes that have the same clinical, epidemiological and

pathogenic features associated with the prototype strain E. coli O157:H7.

EHEC strains produce verocytotoxin or shiga like toxin, encoded by stx1 and stx2

and are referred as shiga toxin producing E. coli (STEC) or verotoxins producing strains

of E. coli (VTEC). Human infections with STEC can be variable from a simple or watery

diarrhoea to hemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS) (WHO,

1998). These cytotoxins are active on vero cells, known as verocytotoxins and they were

first described by Konowalchuk et al. (1977). Epidemiological evidence shows that

O157:H7 is the important serotype among the variety of EHEC serotypes, which have

been implicated in human foodborne diseases (Martinez-Freijo et al., 1999). The STEC

serogroups associated with human diseases are numerous and include O1, O2, O4,

O5,O6, O22, O23, O26, O38, O45, O48, O50, O55, O73, O75, O91, O100, O103, O104,

O105, O111, O113, O114, O115, O117, O118, O119, O121, O125, O126, O128, O132,

O145, O153, O163, O165, and O166, as well as untypeable isolates (DebRoy et al., 2004;

Heijnen and Medema, 2006; Erickson and Doyle, 2007; Lin et al., 2011). The toxins viz:

6

stx1 and stx2 have shown 55% of homology genetically and these toxins were

immunologically not cross reactive (Karmali, 1989), stx1 is genetically and

immunologically related to the shiga toxins produced by the Shigella dysenteriae type 1

strains (Jackson, et al., 1987). Interestingly, stx2 strains appear to be more commonly

responsible for HUS than those producing only stx1 (Kleanthous et al., 1990).

Among STEC serotypes, O157:H7 is associated with both outbreaks and sporadic

cases of severe disease, but it has been shown that other serotypes may also cause human

infections albeit variably (Coombs et al., 2011). This quantitative and qualitative

difference in disease association among STEC has given rise to various classification

schemes the simplest of which divides STEC into E. coli O157 and non-O157. However,

in view of the fact that the virulence potential of non-O157 might be genetically

determined a seropathotype (SPT) classification has been proposed in which prior

association with human epidemics, HUS and diarrhoea is considered (Coombs et al.,

2011). In this scheme, SPT-A includes O157:H7 and O157:NM, the most commonly

isolated serotypes from outbreaks and HUS. SPT-B strains differ from group A in the

frequency of isolation from outbreaks and HUS cases, SPT-C strains are only associated

with sporadic cases of HUS, SPT-D are isolated from diarrheal cases and have not been

encountered in outbreaks or HUS and SPT-E that have never been associated with human

disease (Karmali et al., 2003). Furthermore, data collected by using different methods of

comparative genomic have suggested that several discreet genotypes differing in

virulence exist within E. coli O157:H7 population and based on these data this serotype

has been subdivided into nine clades (Zhang et al., 2007; Manning et al., 2008).

2.3. GROWTH REQUIREMENTS

The environmental factors such as temperature, water activity (aw), pH and food

composition will influence the survival and growth of E. coli. The optimal temperature

7

for multiplication of E. coli is 37°C or 98.6°F but some of the laboratory strains can grow

up to 49°C (Fotadar et al., 2005), although there have been reports of some ETEC strains

growing at temperatures as low as 4°C. For the growth of E. coli, a near neutral pH is

optimum but the growth is possible even below pH 4.4. For growth of E. coli minimum

aw required is 0.95 (Adams and Moss, 2008). Multiplication can be driven by utilizing a

large number of redox pairs involving reduction of substrates like oxygen, fumerate,

trimethylamine N-oxide and dimethyl sulfoxide plus oxidation of substances like formic

acid, pyruvic acid and hydrogen (Ingledew and Poole, 1984).

Heat resistance of E. coli in foods is depended on the composition, pH and aw of

the food. The heat resistance of E. coli increases as the aw decreases. Also, E. coli is more

resistant to heat when it is in its stationary phase of growth compared to its log phase of

growth (Desmarchelier and Fegan, 2003). Low temperature has little effect on E. coli

survival.

STEC required an optimum temperature of 37°C for growth (ranging from 7°C to

50°C) but destroyed at 70°C by cooking (WHO, 2011). E. coli O157:H7 grows poorly at

temperatures above 44-45°C and these temperatures are often used for the detection of E.

coli in food samples, these conditions probably shows a negative impact on the recovery

of this serotype (Hui et al., 2001). The serotype O157:H7 is highly acid resistant food-

borne pathogen that survives in the acidic environment of stomach and colonise in the

gastrointestinal tract (Price et al., 2004). The doubling time of Escherichia coli O157:H7

increases by three fold in 4.5% NaCl in broth whereas at 6.5% a 36 h lag was noted with

a generation time of 31.7 h and no growth occurred at ≥ 8.5% NaCl (Jay, 2000).

2.4. Significance of E. coli on the health of animals and human beings

2.4.1. Human beings

STEC related disease may involved either sporadic cases or large outbreaks

involving a common contaminated food source. In some cases individuals infected with

8

STEC may be asymptomatic, even though large numbers of organisms and free toxins

were found in the faecal samples of the individuals (Edelman et al., 1988; Brian et al.,

1992). Most of the infected individuals may suffer with watery diarrhoea initially but in

some cases this is progressed to bloody diarrhoea within one to two days and

haemorrhagic colitis (HC) (O’Brien et al., 1983; Riley et al., 1983; Riley, 1987). Also

frequently reported the severe abdominal pain. In a proportion of individuals, infection

progresses to haemolytic-uremic syndrome (HUS) and thrombocytopenia (Karmali et al.,

1983; Karmali et al., 1985).

2.4.1.1 Haemorrhagic colitis (HC)

Haemorrhagic colitis was first seen in 1982 in Oregon and Michigan, as a food

borne disease. It was associated with eating of sandwiches at a fast-food restaurant that

contained undercooked ground beef. All 43 individuals had bloody diarrhoea and severe

abdominal cramps, with 63% experiencing nausea, 49% vomiting, fever only in 7% of

the patients. The mean incubation period was 3.8-3.9 days and symptoms lasted for 3 to

more than 7 days (Riley et al., 1983).

Mead and Griffin, (1998); Tarr et al. (2005) reported that over 70% of the patients

developed bloody diarrhoea (HC) within one to three days and after onset though lower

frequencies have also been reported. The amount of blood in faeces varies from traces to

almost entirely blood.

The right side colonic inflammation in patients with STEC infection was observed

by using barium enema or colonoscopy by Pavia et al. (1990).

The shedding of E. coli O157:H7 in children has a median duration of 13 days

(range 2 to 62 days) in patients with diarrhoea (HC) and 21 days (range from 5 to 124

days) in patients with HUS was reported by Pennington, (2010).

9

2.4.1.2. Haemolytic-uremic syndrome (HUS)

HUS is a life-threatening sequelae, characterized by acute renal failure,

thrombocytopenia and microangiopathic haemolytic anaemia (Karmali et al., 1985).

Some individuals were experienced neurological symptoms including lethargy, severe

headache, convulsions and encephalopathy (Tesh and O’Brien, 1991). Death in acute

phase due to renal failure, severe hypertension, myocarditis, or neurological disease

(Robson et al., 1993).

The incidence of HUS is higher in infants, young children and elder peoples, even

though occurred in all age groups and it is the major cause of acute renal failure in

paediatric population (Karmali, 1989). It is because of immunological naivety in young

children and declining immune system function in the elder peoples. Improved clinical

management and paediatric renal dialysis techniques have reduced the mortality from

about 50% to less than 10% over the last two to three decades (Karmali, 1989).

Richardson et al. (1992) reported that invivo experiments with purified stxs have

reproduced the syndrome HUS, with damage to the intestine, kidney and CNS in rabbits

and mice.

The largest outbreak of E. coli O157 from ground beef was reported in four

western states in January 1993, involving more than 700 persons, mostly children. Among

the infected persons, more than one quarter were hospitalized, 7.5% of patients developed

HUS and four children died (Bell et al., 1994; Tuttle et al., 1999).

In 1995, CDC, Atlanta reported that in 1994, an outbreak of E. coli O157:H7 at

Washington and California, HUS was developed in 13% among the 23 persons involved

and epidemiological investigation revealed that eating of commercially distributed dry-

cured salami product was the reason of an outbreak.

Lopez et al. (1989) reported that in Argentina and Uruguay, E. coli infections are

endemic and shiga toxin HUS is a common cause of acute renal failure in children.

10

Centres for Disease Control and Prevention (CDC) estimations indicted that E. coli

O157:H7 is responsible for approximately 62,500 cases annually in the United States due

to food borne infection, which are largely associated with cases of paediatric HUS and a

leading cause of renal failure in children (Sanchez et al., 2002).

Karpman et al. (1998) conducted the study on the apoptotic cell death associated

with shiga-like toxin (stx) producing E. coli and revealed that renal cortices from children

with postenteropathic HUS and from mice infected with E. coli O157:H7 and paediatric

renal tubular epithelial cells stimulated with stx and E. coli extracts were examined for

apoptotic changes and were detected by terminal dUTP nick end labelling of tubuli and

glomeruli from HUS patients and from mice inoculated with stx2 positive and stx-

negative strains. Apoptosis was more extensive and severe ultramorphological nuclear

and cytoplasmic changes were seen in the stx2 positive group.

Rangel et al. (2005) reported that from 1982 to 2002, a total of 350 outbreaks,

accounting 8,598 cases of E. coli O157 infections were reported from 49 states of United

States. Among them, 354 (4.1%) cases of HUS and 40 (0.5%) deaths were reported.

Rivas (2009) conducted an investigation on HUS in children and reported that

Argentina had the highest incidence rate of HUS in children ≤ 5 years old (15 per 100,000

population).

Kiranmayi et al. (2010) worked on E. coli O157:H7 and reported that Escherichia

coli O157:H7 strains carrying stx2 gene along with enterohaemolysin gene are potentially

dangerous to human health and E. coli strains producing stx2 are appear to be more

commonly responsible for serious complications such as HUS than those producing only

stx1.

2.4.1.3. Thrombotic thrombocytopenic purpura (TTP)

STEC infection can also result in a variant form of HUS, referred as Thrombotic

thrombocytopenic purpura (TTP). The diarrhoea associated TTP is more common in

11

adults than in children but it differ from HUS, in that patients are more often febrile and

have marked neurological involvement (Morrison et al., 1985; Karmali, 1989) with

mortality rate as high as 50% (Griffin, 1995).

2.4.2. Animals

Cattle considered as the main reservoir for E. coli O157:H7 serotype, but sheep

are also considered as a significant source to human infections (La Ragione et al., 2009).

E. coli O157:H7 was also isolated from goats (Pritchard et al., 2000) and water buffaloes

(Conedera et al., 2004). STEC O157:H7 has been isolated from wild ruminants, are act

as a potential reservoir. The serotype O157:H7 has been isolated from wild deer (Renter

et al., 2001). Rarely, this bacteria has isolated from non-ruminant species like horse, dog,

rabbit, seagull, starling, wild boar and rat (jay et al., 2007; Wetzel and Lejeune, 2006)

and are not considered as hosts, but rather as vectors transiently colonized by the

bacterium following contact with ruminant faeces (Caprioli et al., 2005).

Studies have shown that up to 30% of all cattle are asymptomatic carriers for the

serotype E. coli O157:H7 (Callaway et al., 2006)

Boqvist et al. (2009) reported in 1996, in Sweden the survey to found the

prevalence of E. coli O157:H7 in slaughtered cattle was initiated and reported that 3,071

faecal samples collected between April, 1996 and August, 1997 and among them 37

(1.2%) faecal samples were positive for STEC.

Dean-Nystrom et al. (1997) worked on E. coli O157:H7 and reported that

experimentally produced infection with high doses of serotype O157:H7, causing

diarrhoea in neonatal calves with A/E lesions. Hancock et al., 2001 reported that cattle

normally harbour E. coli O157:H7 without showing signs of disease.

Grauke et al. (2002) worked on E. coli O157:H7 and reported that it has been

isolated from the entire gastrointestinal tract of bovines viz., from oral cavity to the

rectum, but lower part of the digestive tract is considered as more prevalent part of STEC.

12

Naylor et al. (2003) reported that the terminal rectum, 5 cm proximal to the rectal anal

junction (RAJ) in cattle is considered as the primary site for colonization of STEC and

this region also referred to as terminal mucosa. Nart et al. (2008) informed that the

bacteria E. coli O157:H7 attaches and forms microcolonies and A/E lesions in the

terminal mucosa. Low et al. (2005) and Cobbold et al. (2007) reported that colonization

of E. coli O157:H7 in the terminal mucosa has been correlated to high shedders.

Barkocy-Gallagher et al. (2003) reported that hides from cattle can also be

contaminated with O157:H7 and these are considered to be more important source of

carcass contamination than faecal matter at slaughter. Further his research has indicated

that the number of hides positive for E. coli O157:H7 is a more accurate predictor for

carcass contamination than is faecal prevalence.

Nart et al. (2008) revealed that the rumen, small intestine, proximal colon and in

particular a region of lymphoid-rich tissue immediately distal to the ileo-caecal valve of

the bovine digestive system, are identified as the minor site of VTEC O157:H7carriage.

Cornick et al. (2000) reported that STEC strains are better adopted for

colonization and persistence than other pathotypes of E. coli and also found that there is

no consistent differences among the pathotypes in the frequency, magnitude and

transmissibility of colonization in sheep and also reported that the STEC strains tend to

persist to two weeks and two months post-inoculation more frequently than other

pathotypes.

Dean-Nystrom et al. (2000) worked on VTEC and reported that neonatal piglets are

infected artificially with high doses of VTEC O157:H7 has induced severe disease and

A/E lesions.

Kolling and Matthews (2001) studied about the virulence of E. coli O157:H7 and

revealed that mice which were orally challenged with starvation-induced non-culturable

cells (FO46) or chlorine-induced non-culturable cells (43895 and FO46) and found that

13

non-culturable cells were not recovered from the faecal samples but mouse kidney were

receiving the cells and assayed for the presence of shiga toxin using the vero cell assay

and suggested a loss of virulence.

Booher et al. (2002) reported that experimental studies shown that pigs have no

innate resistance to colonization and can serve as a reservoir host, under suitable

conditions and further he reported that three month old pigs have been colonized after

receiving an infectious dose of 1010 CFU and shed the bacterium for up to 2 months.

Jordan et al. (2005) worked on colonization of E. coli O157:H7 and informed that

it has been demonstrated that, intimin is not necessary for persistent colonization in pigs.

2.5. EPIDEMIOLOGY

Doyle et al. (2006) worked on the epidemiology of STEC and reported that many

outbreaks of STEC O157 were recorded from the various countries in the past two

decades. In the early 1990s with more than 700 cases, an outbreak was occurred in the

western US and noticed three deaths, which was due to the consumption of undercooked

hamburger meat (ground beef), further he also reported that in 1996, an outbreak of STEC

O157:H7 was identified in Scotland and a total of 512 people were infected and 17 deaths,

were because of contaminated meat products and also another outbreak of O157:H7 was

occurred massively in Sakai city, Japan in the year 1996 and more than 10,000 people

were affected after white radish sprouts had been served at school canteens and resulted

in 12 deaths.

Hauswaldt et al. (2013) reported that a HUS outbreak with 501 cases, 151

hospitalization and 45 cases, in 1993 in US and was due to consumption of undercooked

hamburger at fast food restaurants. Epidemiological studies of CDC, 1996-2012 revealed

that STEC had been put under surveillance in the US, since 1996 and the reported

incidence rate was decreased from 1996 (0.91 to 2.62 per 100,000 people) to 2012 (1.12

per 100,000 people), whereas the incidence rate of STEC non-O157 was continuously

14

increased (ranged from 0.16 to 1.16 per 100,000 people) since it was put under

surveillance in 2000. CDC, 2011 reported that the incidence of STEC was peaked in

summer. Doyle et al. (2006) reported that in 2000 in Wisconsin, US there was an outbreak

of E. coli O157:H7 infection due to contaminated meat products and it results in 788 cases

with one death.

Jiao Yong et al. (2009) revealed that in 1999 to 2000, two waves of large

outbreaks of E. coli O157:H7 were occurred in China in three neighbouring provinces

viz., Jiangsu, Anhui and Henan and this outbreak was resulted in 208 deaths among the

thousands of the cases.

Doyle et al. (2006) reported that the massive outbreaks of STEC O157 had been

reported in 1995, 1999 and 2000 in Scotland, New York and Canada (Walkerton) with

633, more than 1000 and 2300 cases respectively and the source of these outbreaks was

identified to be due to water contamination.

Lim Esther et al. (2012) worked on STEC and reported that in New Zealand, the

incidence of STEC showed a significant increase since 2002 and a small peak was

observed in 2003 and highest incidence rate was found in 2011 (3.5 cases per 100,000

population).

The large outbreak of STEC O111: NM was identified in rural Oklahoma (buffet-

style restaurant), in August 2008. Totally 70 patients were hospitalized out of 341 cases

of gastroenteritis, among them HUS was developed in 25 patients and one died. The

epidemiological study was evidenced that cross-contamination of restaurant food from

food preparation equipment or surfaces, or from an unidentified infected food handler

(Bradley et al., 2012).

European Centre for Disease Prevention and Control, (2012) revealed that during

2002 to 2012, the incidence of STEC O157 infection in Canada was significantly

decreased from 3.80 to 1.39 per 100,000 people over a period from 2002 to 2012 whereas,

15

in case of EU countries the incidence of STEC was increased from 2006 to 2009 and

remained stable in 2010 and the reported rates ranged from 0.77 to 0.96 per 100,000

population. Further they reported that highest rate of incidence, 4.41 per 100,000

population was reported by Ireland in 2010, followed by Sweden (3.58 per 100,000

population) and Denmark (3.22 per 100,000 people) and more cases were reported in

summer similar to US.

Rangel et al. (2005) worked on epidemiology of E. coli O157:H7 in United States

and revealed that twenty four multistate E. coli O157 outbreaks were reported since 1992

and ranged from one to three per year, but in 1999, six were reported. Two to eight states

with a median of three were involved in these outbreaks and these outbreaks were due to

foodborne transmission (16 from ground beef and 6 from produce).

Conedera et al. (2007) reported that pork salami (meat from pigs) is the source of

outbreak in Italy, in 1994 and where two adults contracted bloody diarrhoea.

OzFoodNet Working Group, (2012) reported that the incidence of 0.4 cases per

100,000 population had been reported in Australia in 2010, which is comparable or lower

than other developed countries.

Vally et al. (2012) studied the epidemiology of STEC and reported that the

distribution of STEC infection was seasonal with a larger population of reported cases

occurring in the summer months and lower in winter.

2.6. ISOLATION AND IDENTIFICATION OF ESCHERICHIA COLI

2.6.1. Conventional/ culture methods

For isolation of any bacteria conventional method is still the only absolute method

for establishing the infection status. Isolation from a single animal is sufficient evidence

to establish the infection status of a herd and is considered to be the gold standard test.

But the isolation and identification of the non-STEC E. coli pathotypes are difficult due

to lack of a medium that can be used to enrich or to isolate a specific strain.

16

Zinnah et al. (2007) collected ten different biological (human faeces, and urine,

rectal swab of cattle, sheep and goat, cloacal swab of chicken, duck and pigeons) and

environmental samples (drain sewage and soil) and they were subjected to primary

isolation by propagating in nutrient broth followed by culture on different medias viz.

MacConkey agar, Brilliant green agar and EMB agar and observed the characteristic

colony morphology of bright pink colour, yellowish green colonies surrounded by an

intense yellow green zone and metallic sheen colonies respectively.

Bhat et al. (2008) collected faecal samples from the lambs and were immediately

inoculated on Mac Conkey’s agar and Eosin Methylene Blue agar and observed lactose

fermenting colonies and metallic sheen colonies respectively and for further confirmation

the isolates were subjected to biochemical tests.

Esseili et al. (2008) obtained water samples from Lake Eric Beach in Maumee Bay

State Park and were filtered through sterile nitrocellulose membrane and transferred the

membranes to modified m-TEC agar for isolation of E. coli and the isolates were

transferred to EMB agar.

Singh and Prakash, (2008) used the lactose broth as enrichment medium for E. coli

and the inoculum was streaked on the Levine Eosin Methylene Blue Agar and observed

typical green metallic sheen and for confirmation of the isolates they conducted various

biochemical tests and various sugar fermentation tests like glucose, mannitol, lactose,

salicin and sucrose.

Oliveira et al. (2009) collected specimens viz. liver, spleen and lung of the infected

commercial birds with typical lesions of colibacillosis for the isolation of Escherichia coli

and the specimens were emulsified in sterile solution of 0.85% NaCl and supernatant was

plated in MacConkey agar and observed the pink-red colour colonies and for further

confirmation used the Analytical Profile Index (API) strips.

17

Kumar and Prasad (2010) used the peptone water for the enrichment and after 24

hours of incubation they streaked on MacConkey Lactose Agar (MLA) and observed the

pink coloured colonies and for confirmation of cultural characteristics i.e. green metallic

sheen again streaked on the EMB agar and subjected the isolates to various biochemical

tests.

Kesava Naidu et al. (2011) inoculated the faecal samples from diarrheic farm

animals, sewage, water from ponds and bore wells, ground beef and meat in Sorbitol

MacConkey’s agar plates with cefixime-tellurite supplements (CT-SMAC agar) for the

isolation of STEC. Sorbitol negative colonies were further tested for the β-Glucoronidase

production, cellobiose fermentation and growth in the presence of potassium cyanide by

standard techniques to differentiate STEC strains from other strains of E. coli as they are

unable to ferment sorbitol and MUG.

Dastmalchi saei and Ayremlou, (2012) collected faecal samples from 2-6months

old healthy and diarrheic calves and resuspended one gram of sample in 10 ml 0.85%

NaCl and the same was inoculated in MacConkey lactose agar plates and observed lactose

positive (rose pink) colonies and they were further streaked on to EMB agar and observed

green metallic sheen colonies produced by E. coli.

Karadeniz et.al. (2012) used water samples from public housing for the isolation of

Escherichia coli by making use of Endo-C agar and it was resulted in colonies with

metallic green sheen and confirmed by using MCA, EMB agars.

Inu Rawal et al. (2013) collected water samples from two of the lakes (Pichhola

and Fateh sagar) of Udaipur city and isolated the E. coli by using the MacConkey agar

and EMB agar and they confirmed them after conducting Gram staining and various

biochemical tests viz. Indole production and citrate utilization.

18

Robati and Gholami (2013) inoculated the samples in EBC medium for enrichment

after incubation for differentiation of sorbitol fermenting and non-sorbitol fermenting E.

coli samples and a loopfull of inoculum was streaked on the Sorbitol MacConkey agar

(SMAC) which was supplemented with Cefixime and potassium tellurite and also for

identification of lactose fermenting E. coli they used EMB and VRBA medium.

Virpari, et al., (2013) used MacConkey broth for the enrichment and the streaking

was carried on MacConkey agar and Eosin Methylene Blue agar, after confirming the

colonies of E. coli they conducted various biochemical tests such as IMViC tests and

urease test.

Bakhshi et al. (2014) isolated the Escherichia coli from stool samples of calves with

diarrhoea by streaking on MacConkey agar and suspected colonies were subjected to

biochemical tests viz. gram staining, oxidase, indole, simmons citrate, urease and

hydrogen sulphide.

Neher et al. (2016) streaked the different samples (faecal, intestinal content, rectal

swab and heart blood of apparently healthy and clinically ill/ dead animals and birds) on

MacConkey’s lactose agar plates and EMB agar plates and observed the lactose

fermenting colonies and metallic sheen respectively.

Panahee and Pourtaghi (2016) collected different samples like minced beef, mutton,

chicken meat, chicken feet and mechanically separated chicken meat aseptically and were

transferred on to MacConkey agar and the suspected colonies were subjected to

biochemical tests for further confirmation.

2.6.2. Biochemical characterization of Escherichia coli

Kobori et al. (2004) determined the E. coli at species level using cytochrome

oxidase, triple sugar iron agar, urea and indole tests.

19

Zinnah et al. (2007) reported biochemical characterization of Escherichia coli as

acid and gas production by fermenting sugars (dextrose, maltose, lactose, sucrose and

mannitol) and gave positive reaction to catalase, methyl red and indole tests whereas

negative reaction to voges-proskauer test and H2S production.

Barati, et al. (2012) performed biochemical tests to confirm the Escherichia coli

and revealed Gram negative, oxidase negative, indole positive, Simon’s citrate negative

and urease negative.

Inu Rawal et al. (2013) conducted the various biochemical tests viz. Gram

staining, indole production and citrate utilization for the confirmation of Escherichia coli.

Jakaria et.al. (2012) reported biochemical characterization of Escherichia coli as

production of acid and gas by fermenting sugars (dextrose, sucrose, lactose, maltose and

mannitol) and gave positive reaction to indole, methyl red (MR) and catalase tests, but

were negative to Voges-Proskauer (VP) test.

Karadeniz et.al. (2012) performed biochemical characterization of Escherichia

coli and revealed that the isolates were motile, catalase, indole and methyl red positive,

urea, Voges-Proskauer, citrate, H2S negative and on TSI agar it produced acid on butt and

slant.

Momtaz et al. (2012) confirmed the Escherichia coli by performing various

biochemical tests viz. TSI, Lysine iron agar (LIA), oxidative/ fermentative degradation

of glucose, citrate utilization, urease production, indole fermentation, tryptophan

degradation, glucose degradation (methyl red test) and motility.

Zakeri and Kashefi, (2012) confirmed the Escherichia coli using TSI, sulphide

indole motility (SIM), methyl red and Voges-Proskauer (MR-VP), and indole and citrate

(IMVIC) tests.

Dutta et al. (2013) conducted various biochemical tests and reported that indole

production and acid slant, butt and no H2S production on the TSI agar.

20

Momtaz and Jamshidi (2013) tested E. coli isolates biochemically for growth on

triple sugar iron agar and Lysine iron agar, oxidative / fermentative degradation of

glucose, citrate utilization, urease production, indole fermentation, tryptophan

degradation, glucose degradation (methyl red test) and motility.

Zende et al. (2013) biochemically tested the isolates of E. coli obtained from

chicken muscles for indole production, glucose degradation, tryptophan degradation,

citrate utilization, urease production and for motility and growth on triple sugar iron agar.

Rasheed et al. (2014) confirmed E. coli by using gram staining, motility and

standard biochemical tests Viz., catalase, oxidase, fermentation of lactose and glucose

and IMViC tests.

Panahee and Pourtaghi (2016) biochemically tested the isolates obtained from

different meat samples and identified as indole and methyl red tests positive, Voges-

Proskauer and citrate utilization test were negative.

2.6.3. Molecular methods (PCR)

Kobori et al., (2004) conducted the studies on the virulence properties of shiga

toxin producing E. coli in milk samples obtained from dairy cows with mastitis and they

reported that 31 samples were positive for E. coli out of 528 milk samples and further

these isolates were subjected to PCR for the detection of different virulence factors of E.

coli and the results revealed that 20 (64.5%) isolates have shiga toxin producing genes,

among them 13 isolates were positive for stx1 and 3 for stx2 and 4 isolates were carried

both stx1and stx2 and 3 (9.6%) isolates of non shiga toxin producing E. coli were also

positive for eaeA gene.

Kumar et al. (2004) used the PCR technique for the detection of stx1 and stx2

genes for the isolates obtained from seafood, beef and a patient with bloody diarrhoea and

the results revealed that the sea food isolates have produced either stx2 or both stx1 and

stx2, beef isolates produced stx1 alone.

21

Paton and Paton (2005) developed a trivalent PCR assay for the detection of the

novel toxin A subunit gene subA, as well as stx1 and stx2 and the three primer pairs used

in the assay do not interfere with each other and generate amplification products of 556,

180, and 255 bp respectively. Further he reported that the assay can be used for

determining the toxin genotype of STEC isolates, as well as for direct detection of toxin

genes in primary faecal culture extracts.

Cho et al. (2006) performed a PCR using Robocycler thermal system for each

agglutination positive isolates to detect virulence marker genes using by specific primers:

stx1, stx2, eae and hlyA and the results revealed that 17 (43%) isolates have both stx1 and

stx2 genes and 21 (53%) strains havestx2 gene only.

Bhat et al., (2008) detected the virulence genes viz., stx1, stx2, eae and ehxA by

multiplex PCR assay and reported that 16 (45.71%) of 35 STEC isolates carried both stx1

and stx2, 15 (42.85%) isolates havestx1 alone and 4 (11.42%) havestx2 alone and they

also reported that one (2.85%) and 28 (80%) of STEC isolates possessed eae and ehxA

genes respectively.

Dhanashree and Mallya (2008) screened the diarrheagenic stool samples and meat

samples for STEC using PCR method and reported that out of 142 biochemically positive

E. coli from stool samples, 110 isolates were positive for only eae gene and two of the

eae positive E. coli stool isolates were carried hlyA genes and none of the eae positive

isolates were positive for stx1 and stx2, whereas among 80 biochemically positive E. coli

from meat samples, 40 were positive foreaeA gene and one of the eae positive isolate

carried all the four genes viz., stx1, stx2, rfb O157, eae and hlyA.

El-Jakee et al. (2009) characterized the isolated E. coli strains from water sources

using virulence genes (hly, fliCh7, stx1, stx2 and eae ) by PCR assay and results revealed

22

that 8 isolates were carried stx1, 4 possessed stx2 genes and also reported that 21.4%,

21.4% and 28.6% of eae, fiCh7 and hly genes respectively.

Bonyadian et al., (2010) detected the shiga toxin-producing E. coli by using the

virulence genes stx1, stx2, hly and eae and the results showed that, out of 58 E. coli

isolates 16 (27.6%) isolates were positive for stx1, 4 (6.9%) isolates carried stx2 and 8

(13.8%) isolates harboured both stx1 and stx2and 12 (20.7%) isolates were positive for

hly and none of the isolate carried eae gene.

Sahilah et al. (2010) examined Escherichia coli O157:H7 from 20 beef samples for

the detection of stx1 and stx2 genes by mPCR and characterized using RAPD-PCR

fingerprinting and revealed that 14 isolates were positive for both stx1 and stx2, 5 isolates

were carried stx1 alone and one isolate was negative for stx1 or stx2 genes.

Bosilevac and Koohmaraie (2011) observed the prevalence and characterization

of non-O157 STEC in commercial ground beef samples, and reported that 7.8% of

samples were positive for only stx1, 53% isolates carried stx2 alone, 41.5% samples were

positive for eaeA gene and hlyA gene was present in 55.5% isolates.

Dutta et al. (2011) screened the phenotypically characterized samples for the

detection of virulence genes stx1, stx2, eaeA and hlyA by multiplex PCR assay and the

results revealed that 24 isolates out of 42, belongs to three serogroups (O64, O89 and

O91) and remaining 18 were recorded as untypable (UT) and further they reported that

altogether, 14 (33.33%) isolates carried at least one virulence gene, of which 10 (23.81%)

and four (9.52%) were recorded as STEC and EPEC, respectively and among the 10

STEC isolates, one carried only stx2, one carried both stx2 and hlyA, four carried stx1,

stx2 and hlyA, two carried stx1, eaeA and hlyA genes and two carried stx1 and eaeA,

among the four EPEC isolates, two carried eaeA and hlyA, one carried only eaeA gene

and one carried only hlyA gene.

23

Botkin et al. (2012) performed multiplex PCR assay for the differentiation of

enterohemorrhagic E. coli (EHEC), shiga toxin-producing E. coli (STEC) and

enteropathogenic E. coli (EPEC) using selected biomarkers associated with each strain’s

respective virulence genotype. They demonstrated consistent amplification of genes

specific to the prototype EHEC O157:H7 EDL933 and EPEC O127:H6 E2348/69 strains

using the optimized multiplex PCR protocol with purified genomic DNA. A screen of

gDNA from isolates in a diarrheagenic E. coli collection revealed that the multiplex PCR

assay was successful in predicting the correct pathotype of EPEC and EHEC clones

grouped in the distinctive phylogenetic disease clusters EPEC1 and EHEC1 and was able

to differentiate EHEC1 and EHEC2 clusters.

Dastmalchi saei and Ayremlon (2012) screened the E. coli isolates by PCR assay

for the presence of virulence genes and reported that among 26 STEC isolates, six

(23.1%) isolates carried stx1 gene, seven (26.92%) isolates possessed stx2 gene and 13

(50%) isolates gave positive amplicon both for stx1 and stx2 and also reported that out of

26 stx positive isolates, seven were positive for eaeA gene and 15 were positive for the

hlyA gene.

Virpari et al., (2013) used PCR technique and analysed the presence of virulence

associated genes and reported that out of 80 E. coli isolates, 25 (31.25%) were positive

for stx genes, of which seven (8.75%) isolates were positive for stx1, 12 (15%) isolates

have stx2 gene alone and five (6.25%) isolates carried both stx1 and stx2 genes and seven

(8.75%) isolates were positive for eaeA gene.

Bakhshi et al., (2014) observed the presence of shiga toxin genes (stx1 and stx2)

and intimin (eaeA) genes in the stool samples of calves with diarrhoea, and 21 (4.3%)

isolates were identified as EHEC with stx1, stx2 and eaeA genes and amplification bands

of 422 bp, 894 bp and 478 bp were obtained for eae, stx1 and stx2 genes respectively.

24

Rasheed et al. (2014) determined the distribution of virulent genes viz., stx1, stx2

and hlyA among STEC isolated from food samples like raw egg surface, raw chicken,

unpasteurized milk of buffalo, fresh raw meat of sheep, cooked chicken fried rice from

street vendors, cooked chicken noodles from street vendors, snacks such as chaat/ pav

bhaji-street vendors, drinking water from street vendors and hand washing water from

street venders and results revealed that, of the 31 STEC positive strains, 25.8% of isolates

were positive to only stx1 gene, 54.8% carried both stx1 and stx2, 9.6% of isolates were

possessed both stx1 and hlyA genes, 3.2% of isolates were carried both stx2 and hlyA

genes and 7.1% of isolates were positive for all the three genes viz., stx1, stx2 and hlyA.

Son et al. (2014) developed a 75-min conventional multiplex PCR assay, IS-5P,

targeting the four virulence factors stx1, stx2, eae and ehxA plus the O157:H7 specific

+93 uidA single nucleotide polymorphism to assess the potential pathogenicity of STEC

isolates and observed the amplicon size of 306 bp for stx1, 482 bp for stx2, 245 bp for

eae, 136 bp for ehxA and 382 bp for +93 uidA.

Sudershan, et al. (2014) performed PCR assay for identification of different strains

of E. coli in stool samples of children’s (6 months to 5 years of age) suffering from acute

diarrhoea.

Neher et al. (2016) screened all the E. coli strains obtained from the samples viz.,

faeces, intestinal content, rectal swab and heart blood of different clinically affected

healthy animals and birds for the detection of virulence genes viz., stx1, stx2 and eae and

reported that among the 36 (26.08%) STEC isolates, 15 (41.67%), 14 (38.89%) and one

(2.78%) were exhibited eae, stx2 and stx1 alone respectively, whereas four (11.11%) and

two (5.56%) isolates were carried both stx1 and stx2, stx2 and eae respectively.

Panahee and Pourtaghi (2016) detected the shiga toxin genes (stx1 and stx2) and

intimin (eaeA) gene in different kinds of meat and products by using PCR assay and the

25

results indicated that 21 (72.4%) and 4 (13.7%) isolates carried stx2 and eaeA genes

respectively.

Suganya et al. (2016) screened the stool samples by PCR assay for the genetic

characterization of enteroaggregative E. coli (EAEC), enteropathogenic E. coli (EPEC),

enterotoxigenic E. coli (ETEC), enterohemorrhagic E. coli (EHEC) and enteroinvasive E.

coli (EIEC) and among them only one ETEC gene was detected

2.7. Antibiotic resistance

2.7.1. Ampicillin

Zinnah et al. (2008) conducted the studies on the antimicrobial resistance pattern

of Escherichia coli isolated from different biological and environmental sources and

showed that 59% of the isolates were resistant to ampicillin.

Eryulmaz et al., (2010) observed the antibiotic resistance pattern of ampicillin for

the urinary Escherichia coli isolates and reported that 56% of isolates were shown

resistance to ampicillin.

Habrun et al., (2010) observed the antimicrobial sensitivity of E. coli isolated from

the different organs of pigs in breeding farm and reported that 85% isolates were resistant

to ampicillin.

Vinita et al., (2010) analysed the antimicrobial resistance of E. coli isolated from

the urinary tract infected patients and reported that 94.29% of isolates were resistant to

ampicillin.

Cergole-Novella et al. (2011) conducted the studies on the antimicrobial resistance

pattern of STEC isolated from human infections and cattle faeces and revealed that 34.4%

of the isolates were resistant to ampicillin.

Arabi and Banazadehi (2013) observed the antibiotic resistance pattern of E. coli

isolated from the urinary tract infected patients and their results showed that 100% of the

isolates were resistance to ampicillin.

26

Niranjan and Malini (2014) analysed the antimicrobial resistance pattern of E. coli

causing urinary tract infection from in-patients and revealed that 88.4% of the isolates

were resistant to ampicillin.

Nitika et al. (2014) observed the antimicrobial resistance pattern of E. coli isolated

from urine samples of outpatients and reported that 18.3% of the isolates were sensitive

to ampicillin.

Aasmae et al. (2015) conducted the studies on the antimicrobial resistance pattern

of intestinal E. coli in clinically healthy dogs and reported that out of 68 isolates three

(4.4%) were resistant to ampicillin

Anago et al. (2015) observed the antibiotic resistance pattern of E. coli isolated

from various biological samples and showed that 97.6% of the isolates were resistance to

ampicillin whereas 2.4% were susceptible.

Atere et al. (2015) determined the antimicrobial resistance pattern of pathogenic

Escherichia coli isolated from liver and trachea and revealed that 89.6% of the isolates

were resistance to ampicillin.

Bonnedahl et al. (2015) analysed the antimicrobial resistance pattern of E. coli

isolated from gull samples and reported that 30.1% of the isolates were shown resistance

to ampicillin.

El-Rahman et al. (2015) conducted the studies on the antibiotic resistance pattern

of the E. coli isolated from environmental sources polluted with waste water and reported

that 100% of the isolates were resistance to ampicillin.

Melo et al. (2015) observed the antimicrobial resistance pattern of E. coli isolates

obtained from human and food samples and revealed that 20.2% of E. coli isolates were

resistant to ampicillin

27

Mustika et al. (2015) conducted the studies on the antimicrobial resistance pattern

of E. coli isolated from faecal samples and showed that 80% of the isolates were resistant

to ampicillin.

Adenaike et al. (2016) observed the antibiotic resistance pattern of E. coli isolated

from zoborodo drink and showed that 69% of E. coli isolates were resistant to ampicillin.

Mahmud et al. (2016) determined the antimicrobial resistance pattern of bacteria

isolated from nasal and lung swab from healthy and sick cattle and reported that high

resistance of E. coli isolates against ampicillin.

2.7.2. Penicillin-G

Jeyasanta et al. (2012) analysed the antibiotic resistance pattern of E. coli

isolated from sea foods and their results revealed that 82.41% of isolates were

resistant to penicillin-G.

Chandrasekaran et al. (2014) analysed the antibiotic resistance pattern of E. coli

isolated from mastitis milk in dairy cows and they reported that 63% of isolates were


Maloo et al. (2014) observed the antimicrobial sensitivity of E. coli isolated from

water samples of Veraval coast and their results revealed that 100% of isolates were


Nontongana et al., (2014) observed the antibiotic resistance pattern E. coli isolated

from water samples of Kat river and the Fort Beaufort abstraction water and they reported

that 100% isolates were resistant to penicillin-G.

Sabir et al. (2014) observed the antibiotic resistance pattern of E. coli isolated

from urinary tract infected patients and they reported that 100% of isolates were resistant

to penicillin.

28


of E. coli isolated from faecal samples and revealed that 100% of the E. coli isolates were

shown resistance to penicillin-G

2.7.3. Cefadroxil

Kumar et al. (2013) analysed the antibiotic resistance pattern for clinically

isolated E. coli and their results showed that 88.52% of isolates were resistant to

cefadroxil.

Mishra et al. (2013) observed the antibiotic resistance pattern of E. coli isolated

from water samples of river Mahanandi and their results revealed that 58.33% of isolates

were shown resistance to cefadroxil.

Khan et al. (2014) observed the antimicrobial resistance pattern of clinically

isolated E. coli and reported that 97.62% of isolates were shown resistance against

cefadroxil.

Rahim et al. (2014) observed the antibiotic resistance pattern of clinically isolated

E. coli and reported that 85.71% of isolates were resistant to cefadroxil.

Sundvall et al. (2014) analysed the antibiotic resistance pattern of urinary

pathogenic E. coli and reported that 2.6% of isolates were resistant to cefadroxil.

Bonnedahi et al. (2015) analysed the antimicrobial resistance pattern of E. coli

isolated from gull samples and reported that 15.1% of the isolates were shown resistance

to cefadroxil.

2.7.4. Cefotaxime

Vinita et al. (2010) conducted studies on antimicrobial resistance pattern of E. coli

isolated from the urinary tract infected patients and reported that 78.51% of isolates were

resistant to cefotaxime.

29


isolated from the urinary tract infected patients and their results showed that 81.9% of the

isolates were resistance to cefotaxime.

Kumar et al. (2013) analysed the antibiotic resistance pattern for clinically isolated

E. coli and their results showed that 90.16% of isolates were resistant to cefotaxime.

Ali et al. (2014) analysed the antibiotic resistance pattern of uropathogenic E. coli

isolated from the non-hospitalized patients and reported that 58.5% of isolates were


Manikandan and Amsath (2014) observed the antimicrobial resistance of E. coli

isolated from urine samples and they reported that 58% of isolates were resistant to

cefotaxime.

Raihan et al. (2014) studied the antibiogram pattern of the E. coli strains isolated

from the diarrheic samples of calves and their results showed that 60% of the isolates

were resistant to cefotaxime.

Aasmae et al. (2015) observed the antimicrobial pattern of E. coli and their results

showed that 100% of E. coli isolates were susceptible to cefotaxime

Anago et al. (2015) studied the antibiotic resistance pattern of E. coli isolated from

various biological samples and their results revealed that 56.5% of the isolates were

resistance to cefotaxime.


of the E. coli isolated from environmental sources polluted with waste water and revealed

that 40 % of the isolates were shown resistance to cefotaxime.

Ferdosi et al. (2015) observed the antimicrobial resistance pattern of E. coli

isolated from urine samples and reported that 45.6% of the isolates were shown resistance

to cefotaxime.

30

Hussain et al. (2015) observed the antimicrobial resistance of clinically isolated

E. coli and reported that 67% of the isolates were resistant to cefotaxime.


obtained from human and food samples and revealed that 1.2% of E. coli isolates were


Munsi et al. (2015) analysed the antimicrobial resistance pattern of E. coli isolated

from milk samples collected from local vendors and reported that the isolates were highly

sensitive to cefotaxime.

Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic E.

coli and their results showed that out of 244 E. coli isolates 72 (29.50%) isolates were


Akter et al. (2016) observed the antimicrobial resistance pattern of E. coli isolated

from urine samples and reported that 75% of the isolates were sensitive to cefotaxime.

Preethishree et al. (2016) conducted the studies on antimicrobial susceptibility

pattern of uropathogenic E. coli and their results revealed that 35.56% of the isolates were

shown sensitivity to cefotaxime.

Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary tract

infections from outpatients and revealed that 71.42% of E. coli isolates were shown


2.7.5. Cefoperazone

Saeed et al. (2009) observed the antibiotic resistance pattern of E. coli isolated from

the surgical wound infections and they reported that 65.5% of isolates were shown

resistance to cefoperazone.

31

Tanvir et al. (2012) analysed the antibiotic resistance pattern of E. coli isolated from

urinary tract infected patients and they reported that 86.8% isolates were sensitive to

cefoperazone.

Asati (2013) analysed the antibiotic resistance pattern of E. coli isolated from urine

samples of urinary tract infected patients and reported 79% of isolates were shown

sensitivity to cefoperazone.

Mishra et al. (2013) conducted the studies on the antibiotic resistance pattern of

E. coli isolated from water samples of river Mahanandi and showed that 66.66% of

isolates were resistant to cefoperazone.

Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic

Escherichia coli and their results showed that out of 244 E. coli isolates 72 (29.50%)

isolates were resistance to cefoperazone.

Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary tract

infections from outpatients and revealed that 75.97% of E. coli isolates were shown

resistance to cefoperazone.

2.7.6. Meropenem

Toroglu et al. (2005) observed the antibiotic resistance pattern of E. coli isolated

from water samples of Aksu river and they reported that 25% isolates were resistant to

meropenem.

Tanvir et al. (2012) analysed the antibiotic resistance pattern of uropathogenic E.

coli and they reported that 77.2% isolates were sensitive to meropenem.

Mishra et al. (2013) analysed the antibiotic resistance pattern of E. coli isolated


were shown resistance to meropenem.

32

Biswas et al. (2014) conducted the antibiogram studies on the urinary isolates and

reported that 100% of the E. coli isolates were resistance to meropenem.


from urine samples of outpatients and their results showed that 74.6% of the isolates were

sensitive to meropenem.

Vij et al. (2014) observed the antibiotic resistance pattern of E. coli isolated from

urinary tract infected patients and their results showed that 62.7% of isolates were

resistant to meropenem.


coli and their results showed that out of 244 E. coli isolates three (1.22%) isolates were

resistance to meropenem.


from urine samples and their results revealed that 100% of the isolates were shown

sensitivity to meropenem.

2.7.7. Gentamicin



showed that 32% of the isolates were resistant to gentamicin.

Alshara (2010) observed the antimicrobial resistance pattern of E. coli isolated

from paediatric patients and reported that 17.3% of isolates were shown resistance to

gentamycin

Eryulmaz et al. (2010) analysed the antibiotic resistance pattern of gentamycin for

the urinary E. coli isolates and their results showed that 9% of isolates were resistant to

gentamycin.

33

Vinita et al. (2010) conducted studies on antimicrobial resistance pattern of E. coli

isolated from the urinary tract infected patients and reported that 70.86% of isolates were

resistant to gentamycin.


isolated from the urinary tract infected patients and their results showed that 82.5% of

isolates were resistant to gentamycin.


isolated from the non-hospitalized patients and reported that 5% of isolates were resistant

to gentamycin.

Biswas et al. (2014) analysed the antimicrobial resistance pattern among the

urinary isolates and their results revealed that 94.11% of the E. coli isolates were

resistance to gentamicin.


isolated from urine samples and reported that 62.5% of isolates were resistant to

gentamycin.


from the diarrhoeic samples of calves and their results showed that 80% of the isolates

were sensitive to gentamicin.

Anago et al. (2015) conducted the studies on the antibiotic resistance pattern of

E. coli isolated from various biological samples and revealed that 45.2% of the isolates

were resistance to gentamicin.


Escherichia coli isolated from liver and trachea and their results showed that 68.8% of

the E. coli isolates were resistance to gentamicin.

34


of the E. coli isolated from environmental sources polluted with waste water and showed

that 10% of E. coli strains were resistant to gentamicin.

Ferdosi et al. (2015) observed the antimicrobial resistance pattern of E .coli

isolated from urine samples and reported that 36.8% of the isolates were resistance to

gentamicin.


obtained from human and food samples and showed that 2.3% of the isolates were

resistant to gentamicin.

Oluyege et al. (2015) analysed the antimicrobial resistance pattern of E. coli

isolated from faecal swabs collected from healthy infants below five months of age and

revealed that 5.9% of the isolates were shown resistance to gentamicin.

Pant et al. (2015) conducted the studies on the antimicrobial resistance pattern of

E. coli from children suspecting urinary tract infections and revealed that 25% of the

isolates were shown sensitivity to gentamicin.

Sohail et al. (2015) analysed the antibiotic resistance pattern of uropathogenic

E. coli and their results showed that out of 244 E. coli isolates 47 (19.26%) isolates were




sensitivity to gentamicin.


isolated from nasal and lung swab from healthy and sick cattle and reported that E. coli

isolates were shown highly resistance to gentamicin.

35



shown sensitivity to gentamicin.

Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary

tract infections from outpatients and revealed that 56.98% of E. coli isolates were shown


2.7.8. Streptomycin

Stephan and Schumacher (2000) observed the antibiotic sensitivity pattern of E.

coli isolated from animals, food and asymptomatic human carriers and they reported that

17.07% of isolates were susceptible to streptomycin.



resistance to streptomycin.

Habrun et.al. (2010) observed the antimicrobial sensitivity of E. coli isolated from

the different organs of pigs in breeding farm and reported that 91% isolates were resistant

to streptomycin.

Cergole-Novella et al. (2011) conducted the studies on the antimicrobial

resistance pattern of STEC isolated from human infections and cattle faeces and revealed

that 78.1% of the isolates were shown resistance to streptomycin.

Nontongana et al. (2014) analysed the antibiotic resistance pattern of E. coli

isolated from water samples of Kat river and the Fort Beaufort abstraction water and they

reported that 77% of isolates were susceptible to streptomycin.

Sabir et al. (2014) studied the antibiotic resistance pattern of E. coli isolated from

urinary tract infected patients and they reported that 30% of isolates were resistant to

streptomycin.

36

Aasmae et al. (2015) studied the antimicrobial resistance pattern of intestinal E.

coli in clinically healthy dogs and revealed that out of 68 isolates three (4.4%) were

resistant to streptomycin.

El-Shatoury et al. (2015) observed the antimicrobial resistance pattern of STEC

isolated from different water sources and reported that 11% of the isolates were resistance

to streptomycin.


of E. coli isolated from faecal samples and showed that 20%of the isolates were resistant

to streptomycin.

2.7.9. Ciprofloxacin



showed that 8% of the isolates were resistant to ciprofloxacin.

Alshara (2010) observed the antimicrobial resistance pattern of E. coli isolated from

paediatric patients and reported that 14.5% of isolates were shown resistance to

ciprofloxacin.

Eryulmaz et al. (2010) conducted the studies about the antibiotic resistance pattern

of urinary Escherichia coli isolates and reported that 15% of isolates were resistant to

ciprofloxacin.

Arabi and Banazadehi (2013) observed the antibiotic resistance patterns of E. coli

isolated from the urinary tract infected patients and their results showed that 78% of

isolates were resistant to ciprofloxacin.

Kumar et al. (2013) analysed the antibiotic resistance pattern for clinically isolated

E. coli and their results showed that 54.10% of isolates were resistant to ciprofloxacin.

37

Ohieku and Magaji (2013) observed the antimicrobial resistance of E. coli isolated

from urinary tract infected patients and reported that 58% of isolates were shown

resistance against ciprofloxacin.

Biswas et al. (2014) conducted the antibiogram studies on the urinary isolates,

among them 88.23% of the E. coli isolates were resistance to ciprofloxacin.


from urine samples of outpatients and reported that 32.3% of the isolates were sensitive

to ciprofloxacin.


from the diarrhoeic samples of calves and their results showed that 100% of the isolates

were sensitive to ciprofloxacin.

Aasmae et al. (2015) analysed the antibiotic resistance pattern of intestinal E. coli

isolated from clinically healthy dogs and reported that two isolates (2.9%) were shown

resistance to ciprofloxacin.

Aminu and David (2015) analysed the antibiotic resistance pattern of E. coli

isolated from the faeces of apparently healthy white Fulani cattle and reported that 10.6%

of isolates were resistant to ciprofloxacin.

Anago et al. (2015) observed the antibiotic resistance pattern of E. coli isolated

from various biological samples and their results reported that 91.7% of the isolates were



Escherichia coli isolated from liver and trachea and showed that 47.9% of the isolates

were resistance to ciprofloxacin.

38


of the E. coli isolated from environmental sources polluted with waste water and showed

that 10% of E. coli strains were resistant to ciprofloxacin.


isolated from different water sources and reported that none of the isolate was resistance

to ciprofloxacin.


isolated from urine samples and their results showed that 24.6% of the isolates were



obtained from human and food samples and revealed that 4.7% of the isolates were shown


Munsi et al. (2015) isolated the E. coli from milk samples collected from local

vendors, observed the antimicrobial resistance pattern and reported that the isolates were

highly sensitive to ciprofloxacin.


E. coli from children suspecting urinary tract infections and reported that 28% of the

isolates were shown sensitivity to ciprofloxacin.





from zoborodo drink and reported that 100% of the isolates were susceptible to

ciprofloxacin.

39



sensitivity to ciprofloxacin.


isolated from nasal and lung swab from healthy and sick cattle and reported that E. coli

isolates were shown mild resistance to ciprofloxacin.



shown sensitivity to ciprofloxacin.

Ranjini et al. (2016) studied the antibiogram pattern of E. coli causing urinary

tract infections from outpatients and revealed that 84.91% of E. coli isolates were shown


2.7.10. Ofloxacin

Ibrahim et al. (2010) observed the antimicrobial resistance of uropathogenic E. coli

and their results revealed that 93.1% of isolates were sensitive to ofloxacin.

Ibrahim et al. (2012) analysed the antimicrobial resistance of E. coli isolated from

clinical samples and they reported that 55.1% of isolates were resistant to ofloxacin.

Mary and Usha (2013) observed the antimicrobial resistance of E. coli isolated from

panipuri and their results revealed that 97% of isolates were resistance to ofloxacin.

Mishra et al. (2013) analysed the antibiotic resistance pattern of E. coli isolated


were shown resistance to ofloxacin.

Ohieku and Magaji (2013) observed the antimicrobial resistance of clinically

isolated E. coli and they reported that 71% of isolates were shown resistance against

ofloxacin.

40


isolated from urine samples and they reported that 64.5% of isolates were resistant to

ofloxacin.


Escherichia coli isolated from liver and trachea and their results revealed that 52.1% of

the E. coli isolates were resistance to ofloxacin.


isolated from urine samples and their results showed that 8.8% of the isolates were

resistance to ofloxacin.


isolated from faecal swabs collected from healthy infants below five months of age and

revealed that 3.9% of the isolates were shown resistance to ofloxacin.



resistance to ofloxacin.

2.7.11. Azithromycin



showed that 33% of the isolates were resistant to azithromycin.

Chayani et al. (2009) conducted the studies on the antibiotic resistance pattern to

the clinically isolated E. coli and their results showed that 60.37% of E. coli isolates were

resistant to azithromycin.

Aly et al. (2012) analysed the antibiotic resistance pattern of E. coli isolated from

clinical samples and food samples and their results revealed that 31% isolates of clinical

samples and 37% isolates of food samples were resistant to azithromycin

41


from the diarrhoeic samples of calves and reported that 100% of the isolates were

sensitive to azithromycin.

Aminu and David (2015) observed the resistance pattern of E. coli isolated from

the faeces of apparently healthy white Fulani cattle and their results showed that 76.6%

of isolates were resistant to azithromycin.

Munsi et al. (2015) analysed the antimicrobial resistance pattern of E. coli isolated

from milk samples collected from local vendors and their results revealed that the isolates

were moderately sensitive to azithromycin.



isolates were shown sensitivity to azithromycin.



sensitivity to azithromycin.

2.7.12. Chloramphenicol



resistance to chloramphenicol.

Vinita et al. (2010) analysed the antimicrobial resistance of E. coli isolated from

the urinary tract infected patients and they reported that 61.14% of isolates were resistant

to chloramphenicol.


clinical samples and they reported that 22.4% of isolates were resistant to

chloramphenicol.

42

Joshi et al. (2012) conducted studies on the antibiotic resistance pattern of E. coli

isolated from the colibacillosis in layers and they reported that 100% of the isolates were

sensitive to chloramphenicol.

Rehman et al. (2013) observed the antibiotic sensitivity pattern of isolates of Shiga

toxin producing E. coli isolated from faecal samples of bovines and stool samples of

bovine handlers and they reported that 86.6% of isolates were shown sensitivity to

chloramphenicol.


isolated from water samples of Kat river and the Fort Beaufort abstraction water and they

reported that 73% of isolates were susceptible to chloramphenicol.


obtained from human and food samples and revealed that 4.7% of the isolates were

resistant to chloramphenicol.



isolates were shown sensitivity to chloramphenicol.

2.7.13. Tetracycline

Stephan and Schumacher (2000) observed the antibiotic sensitivity pattern of E.

coli isolated from animals, food and asymptomatic human carriers and reported that

17.07% of isolates were susceptible to tetracycline.



showed that 60% of the isolates were resistant to tetracycline.

Cergole-Novella et al. (2011) conducted the studies on the antimicrobial resistance

pattern of STEC isolated from human infections and cattle faeces and revealed that 100%

of the isolates were resistant to tetracycline.

43


clinical samples and reported that 77.1% of isolates were resistant to tetracycline.


isolated from water samples of Kat river and the Fort Beaufort abstraction water and

reported that 75% of isolates were susceptible to tetracycline.

Sabir et al. (2014) worked on the antibiotic resistance pattern of E. coli isolated

from urinary tract infected patients and reported that 69.4% of isolates were resistant to

tetracycline.

Aasmae et al. (2015) analysed the antibiotic resistance pattern of intestinal E. coli

isolated from clinically healthy dogs and their results revealed that two isolates (2.9%)

were resistance to tetracycline.

Aminu and David (2015) observed the resistance pattern of E.coli isolated from

the faeces of apparently healthy white Fulani cattle and reported that 40.4% of isolates

were resistant to the tetracycline.


isolated from different water sources and reported that 7% of the isolates were resistance

to tetracycline.


isolated from faecal swabs collected from healthy infants below 5 months of age and

revealed that 88.2% of the isolates were shown resistance to tetracycline.



isolates were shown resistance to tetracycline.

44


obtained from human and food samples and their results revealed that 26.0% of E. coli

isolates were resistant to tetracycline.


from zoborodo drink and showed that 54% of E. coli isolates were resistant to

tetracycline.

Nsofor et al. (2016) studied the antimicrobial susceptibility pattern of Escherichia

coli isolated from faecal samples obtained from humans, poultry and cattle and the results

revealed that 100% of the isolates were resistant to tetracycline.

2.7.14. Tigecycline

Rossi et al. (2008) conducted studies on the antibiotic resistance pattern of E. coli

isolated from the various clinical samples and their results revealed that 100% of the

isolates were sensitive to tigecycline.

Behera et al. (2009) conducted studies on the antibiotic resistance pattern of

clinically isolated E. coli and they reported that 100% isolates were sensitive to

tigecycline.


isolated from the non-hospitalized patients and they reported that 2.5% of isolates were

resistant to tigecycline.

Nandi et al. (2014) observed the antibiotic sensitivity of E. coli isolated from

various samples of patients and they reported that 100% of isolates were sensitive to

tigecycline.

Mantzourani et al. (2015) analysed the antibiotic resistance pattern of E. coli isolated

from clinical and environmental samples and they reported that 100% of the isolates were

resistant to tigecycline.

45

2.8. Bacteriophages

2.8.1. History of Bacteriophage

Bacteriophages or phages are viruses that infect bacteria. They are now believed

to represent the most abundant biological entities with an estimated range of 1030 to 1032

total phage particles on the earth and assuming that they out number the bacteria about

10-folds (Emond and Moineau, 2007). The antimicrobial activity of the some components

against Vibrio cholera from Indian river water was observed by Hankin in the year 1896,

Gamaleya confirmed the Hankin’s observation with Bacillus subtilis in 1898. These

bacteriophages were first discovered against Staphylococcus aureus by Frederick Twort,

a bacteriologist, in 1915 and characterized the viral nature of the phage independently in

1917 by the microbiologist Felix d’Herelle (Sulakvelidze et al., 2001) and called his

discovery “bacteriophage”; a term he derived from the Greek word “phagein” (eater)

(Kutter and Sulakvelidze, 2004; Brovko et al., 2012). D’Herelle subsequently published

extensively on phages and helped to establish the International Bacteriophage Institute in

Tbilisi, Georgia in 1923 (Summers, 1999 and Sulakvelidze, 2001).

2.8.2. Classification of bacteriophages

About 150-1,000 new phage particles are produced after infecting a single

bacterial cell, which contributes the most abundant form of life on earth (Ackermann,

2003). Phages are highly diverse structurally and genetically including shape, nucleic acid

composition, presence/absence and properties of their tails, genera and families.

Therefore, phages have been classified in many different ways.

D‟Herelle (1918) stated and classified bacteriophages as a single species, the

“Bacteriophagum intestinale”, with many races. The forerunners of phage classification

were the great Australian microbiologist, Sir Macfarlane Burnet, who proved in 1937 that

phages were differed in size and resistance against physicochemical agents (Burnet,

46

1933). Ruska (1943), who proved that phages were morphologically diverse and proposed

a classification of viruses in 1943 by using electron microscopy.

In 1948, Holmes classified the viruses into three families based on host range and

symptoms of disease, Phages constituted the family Phagineae. Lwoff et al. (1962)

classified the viruses based on the properties of the virion and its nucleic acid and

proposed a system with a latinised nomenclature that included several phages. In 1965 a

Provisional Committee on Nomenclature of Viruses (PCNV) was founded, later became

the International Committee on Taxonomy of Viruses (ICTV) and issued its first report

in 1971, which included six phage “genera” and the “ribophage group” and groups were

listed with type species and properties (Wildy, 1971). The ICTV has biolt on the

Bradley’s basic classification scheme to structure what is known as the modern phage

classification systems or the ICTV classification. Bradley recognized six basic types:

tailed phages, filamentous phages and cubic phages with ssDNA, dsDNA, ssRNA or

dsRNA (Ackermann, 2003; Weinbauer, 2004). New phage groups have been introduced

over time, with the most recent development being the establishment of the order

Caudovirales for tailed phages containing 15 genera (Ackermann, 2003).

The ICTV is the only international body concerned with virus taxonomy and

presently classifies viruses into group into 7 orders and 96 families. Bacteriophages form

one order, 13 families and 30 genera (Ackermann, 2003; Ackermann, 2011). Originally

viruses were classified based on morphological properties and host type. At present,

ICTV may considered the every available property for classification. The current trend

utilizes sequence information, which can provide fine mapping of related viruses. Still

used the genome type (RNA or DNA, single or double standed) to provide fundamental

classification criteria. A viral species is defined by a set of properties, some of which may

be absent in a particular member (Ackermann, 2003).This is also called the “polythetic

species concept”, which defines viral species as a polythetic class of viruses constituting

47

a replicating lineage and occupying specific ecological niches (Weinbauer, 2004). Greek

or Latin roots ending in –virales, -viridae, and virus are labels used to construct taxonomic

names of orders, families, and genera, respectively (Ackermann, 2003).

Shapes of the bacteriophages are diverse, include cubic, lemon-shaped, spindle,

filamentous or pleomorphic viruses (Ackermann, 2003). A diversity of other structures

such as head appendages, collar and tail fibres or spikes are also found in some

bacteriophages. It is not uncommon for the capsid diameter and the genome size to vary

by a factor of ten between viruses (Weinbauer, 2004). The majority of described phages

have a head diameter usually ranging from 30 to 60 nm (Mathias et al., 1995). However,

giant viruses with head sizes ranging from 200 to over 700nm have been reported

(Gowing, 1993).

Ackermann, (2007) has studied 5,500 phages by electron microscopy and revealed

that 96.2% tailed phages and only 3.7% were polyhedral, filamentous or pleomorphic.

Species belonging to the order: Caudovirales have a double-stranded DNA as genetic

material and are divided into three families: Siphoviridae (long, non-contractile tail and

isometric head), Myoviridae (contractile tail with isometric head) and Podoviridae (short,

non-contractile tail and isometric head) (Ackermann, 2007)

Based on the ICTV classification, the phages are placed according to their

respective order, families, genome type and genome size as shown in Table 2.1.

2.9. Isolation of bacteriophages against Escherichia coli

Jann et al. (1971) isolated a bacteriophage against Escherichia coli O8 strains

from Freiburg sewage, while adding the same at high multiplicity, he reported that the

phages could not multiply in E. coli O93 but able to kill them.

48

Table 2.1. ICTV classification of phages (Harper, 2011)

Virus family Genome

type

Genome

size (kb) Structure Example

Caudovirales

Myoviridae ds DNA 33.6-170 Non-enveloped, icosahedral head (50-110 nm, may be

elongated) with long contractile tail Enterobacteria phage T4

Podoviridae ds DNA 40-42+ Non-enveloped, icosahedral head (60 nm) with short,

non-contractile tail Enterobacteria phage T7

Siphoviridae ds DNA 48.5 Non-enveloped, icosahedral head (60 nm) with long,

non-contractile tail Enterobacteria phage

Other families

Tectiviridae ds DNA 147-157 Icosahedral, contains lipid, 63 nm with 20 nm spikes Enterobacteria phage

PRD1

Corticoviridae ds DNA 9-10 Icosahedral, contains lipid 60 nm+ Pseudoalteromonas phage

PM2

Plasmaviridae ds DNA 12 Enveloped, spherical/ pleomorphic, 80 nm Acholeplasma phage L2

Inoviridae ss DNA 4.4-8.5 Non-enveloped, filamentous, 6-8 nm x 760-1950 nm Enterobacteria phage

M13

Microviridae ss DNA 4.4-5.4 Non-enveloped, icosahedral, 26 nm Enterobacteria phage ϕX

174

Leviviridae ss DNA 3.4-4.2 Non-enveloped, icosahedral, 26 nm Enterobacteria phage

MS2

Cystoviridae ds RNA

(segmented)

13.4

(3 segments) Enveloped, spherical, 86 nm with 86 nm spikes Pseudomonas phages ϕ6

49

Calci et al. (1998) compared the prevalence of lytic bacteriophages to E. coli in

faecal samples from different animal species and the study reported positive phage

isolation in beef cattle, sheep and goats, although it was noted that sheep and goats have

the lowest mean density of bacteriophage, based on the number of plaque-forming units

per gram of faeces.

Jensen et al. (1998) isolated bacteriophages by following soft agar overlay method

and reported that among them two bacteriophages, BHR1 and BHR2 were capable of

lysing both P. aeruginosa PAO303 and E. coli AB1157 and three bacteriophages were

lytic for both S. natans ATCC 13338 and E. coli AB1157, BHR3, BHR4 and BHR5.

Sheng et al. (2006) isolated phage SH1 by a standard enrichment procedure from

raw sewage taken from a municipal sewage treatment system and that phage was highly

lytic and formed large clear plaques in all 12 E. coli O157:H7 strains tested.

Jamalludeen et al. (2009) worked on avian E. coli strains and isolated seven

phages against Escherichia coli serogroups O1, O2 and O78 from waste water and faecal

samples, collected from poultry processing plants by using double agar overlay method.

Mahadevan et al. (2009) isolated the host specific bacteriophages by using five

bacterial pathogen isolates obtained from sewage water and observed that bacteriophages

against Escherichia coli and Salmonella typhi were able to infect its original host

bacterium, whereas the phages of Pseudomonas aeruginosa was able to infect both

Pseudomonas and Escherichia coli.

Olieveira et al. (2009) isolated five bacteriophages (CphiF78E, PhiF258E,

PhiF2589E, PhiF61E and PhiF5318E) against Escherichia coli from samples of poultry

sewage. They used the spot test method as an initial test for the presence of phage and

later performed double layer plaque technique and phages were purified by successive

single plaque isolation from the higher dilutions plates where plaques were still distinct.

50

Shukla and Hirpurkar (2011) studied the presence of bacteriophage in sewage

material at different depths of the tanks located in livestock farms of different species i.e.,

cattle, pig, goat and poultry and subjected to rapid detection by streak plate method and

isolated the bacteriophages against two most common environmental bacteria namely

B.subtilis and E. coli by double agar layer method. Further they reported that 67, 63, 50

and 13 percentages of phages were isolated from pig faeces, dairy cattle farm waste,

buffalo farm waste and goat farm waste respectively.

Manjunath et al. (2013) used the sewage sample originated from hospital,

domestic, municipal waste and the water from water treatment plant as source to isolate

the phage ϕDMEC-1 against the multidrug resistant E. coli (DMEC-1) by double agar

layer method.

Gunathilaka (2014) isolated and purified phages specific to E. coli O157 and

Salmonella from two out of 35 water samples and she reported that none of the river water

samples were positive for E. coli O157 and Salmonella specific phage and all phages were

isolated from wastewater treatment plants.

Beheshti Maal et al. (2015) isolated two novel bacteriophages from Zayandehrood

river water against Escherichia coli SBSWF27 and E. coli PTCC1399 by spot test and on

BHA showed big phage plaques after overnight incubation at 37°C.

Duraisamy et al. (2015) isolated 46 bacteriophages by processing 10 hospital

effluent samples against 20 different MDR and ESBL strains by double layer agar

method.

Mulani et al. (2015) conducted research on isolation and characterization of

bacterial species and their specific phages present in the same environment to develop

new strategy for generalized control of bacterial populations, especially regarding the

pathogens in waste water and reported that potential activity of bacteriophages against

51

target bacteria has shown 100% reduction in CFU/ml for both E. coli and Salmonella

species at 9thhour.

2.10. Physico-chemical characterization of isolated bacteriophages

2.10.1. Physical characterization

2.10.1.1. Effect of temperature on the activity of bacteriophages

Although tests indicate that phages are capable of tolerating broad temperature

ranges whereas in natural systems phages appear only to occur within constrained

temperature ranges. Temperature sensitivity can therefore be a characteristic of a phage

population found in a particular environment. For example, marine bacteriophages have

been shown to be more sensitive to heat than phages from other environments (Spencer,

1955).

Al-Mola and Al-Yassari (2010) determined the sensitivity of phages at different

temperatures (37°C, 50°C and 65°C) by exposing to different time intervals (10, 20, 30,

40, 50 and 60 min.) and revealed that the effect of temperature on phage titre, was

significantly increased (P<0.05) at the temperature of 37°C comparing with phage titre at

50°C and 65°C.

Allue-Guardia et al. (2012) conducted heat stability tests of phages and reported

that the resistance of the two Cdt phages and SOM23 phages to high temperatures (60

and 70°C) and the results revealed that when treated at 60°C, inactivation of infectious

particles was of 1.3log10 units at 60min, whereas treatment at 70°C showed inactivation

greater than 2.4log10 units at 30 min and greater than 4.5 log10 units at 60 min was

observed with SOM23 phages whereas Cdt phage particles were still detectable by qPCR

and there was no remarkable reduction at any time interval or temperature, which

confirms that the phage DNA was remained intact.

52

Chachra et al. (2012) subjected the brucellaphage to the different temperatures of

-20°C, 4°C, 37°C, 50°C, 70°C and 100°C for a period of 20 min. and observed that there

was no growth when exposed to 70°C and 100°C for a similar time period of 20 min.

Zaman and Arip (2012) characterized the ability of bacteriophage when exposed

to overnight incubation at temperature ranging from 10°C to 80°C and reported that

isolated phages were stable in a temperature range of 10°C to 37°C and became less stable

following exposure to 40°C and 50°C and the region of optimum stability was at close to

body temperature 37°C and further they reported that the isolated phages do not have the

ability to survive at temperature above 50°C.

Manjunath et al. (2013) examined the stability of the phage lysates at room

temperature, - 400C, -200C, 40C, and 200C and also in presence of 20% (v/v) glycerol at

-400C and -200C and Phage titres maintained at various conditions were examined after

3, 6, 9 and 12 months of storage by double agar layer technique and the results revealed

that there was no significant decrease in the level of phage titre after 3 months storage at

all the tested temperatures, except at room temperature, where the titre was reduced by

30%, whereas ΦDMEC-1 was highly sensitive to higher temperature (600C) for 15

minutes, with a 100-fold decrease in titre.

Pandey et al. (2013) reported that the effect of heat on the activity of phage

revealed that at 40°C phage titre gradually decreased from 1340 to 110 PFU/ml (8.2%)

within three hours and at 60°C temperature treatment phages were completely inactivated

within 10 min.

Taj et al. (2014) worked on the effect of various ranges of dilution, temperature

and pH on T4 bacteriophage lytic activity against Escherichia coli and reported that T4

bacteriophage did lysis from 10-1 to 10-7 dilutions, while at 15°C, 25°C and 30°C there

was lysis but with little delay. Similarly at 41°C T4 bacteriophage were developed and

53

performed lysis on its host but at temperature regimes of 45°C, 55°C and 70°C, the T4

bacteriophage was completely inactive.

2.10.1.2. Effect of UV light on the activity of bacteriophages

Allue-Guardia et al.(2012) worked on Cdt Phages and reported that the Cdt

phages were very sensitive to the UV treatment used and showed reductions of infectious

phages of 3.5 (125), 3.1(62) and4.0(SOM23)log10 units after30min,but they were still

more resistant than the Cdt-STEC strain, which showed a reduction of 5 log10 units after

only 5 min.

Chachra et al. (2012) examined the stability of the phage lysates towards the UV

light by exposing them for a period of 15 min. to 90 min. and revealed that UV light killed

the brucellaphage within the first 15 min. of exposure.

Pandey et al. (2013) determined the effect of UV light on the activity of phage

and revealed that UV light had drastic effect on the phage survivability and the phage gets

completely inactivated within 3 min.

2.10.1.3. Effect of sun light on the activity of bacteriophages

Chachra et al. (2012) worked on brucellaphages and reported that brucellaphage

which were subjected to sunlight for a period of 15 min. to 90 min., revealed that the

survivability was gradually decreased from 95.8% (on exposure for 15 min) to 73% over

a 90 min. period.

Pandey et al. (2013) described the effect of sunlight on activity of phage and

revealed that exposure to direct sunlight gradually decreased the phage concentration and

within 3 h, the brucellaphage titre was reduced by 93.99%.

54

2.10.2. Chemical characterization

2.10.2.1. Effect of SDS on the activity of bacteriophages

The effect of 10% SDS on the phage activity was shown by Chachra et al. (2012)

by subjecting the phage for a period of 15 min. to 3h and revealed that complete

destruction of the phage was observed within 15 min.

Pandey et al. (2013) determined the stability of the brucellaphage by subjecting

them to SDS (0.1%) and revealed that complete inactivation of phage within 15 min.

when exposed to 0.1% SDS.

2.10.2.2. Effect of phenol (aqueous) on the activity of bacteriophages

Pandey et al. (2013) determined the stability of brucellaphages and reported that

complete inactivation of the phage was observed within 15 min after exposure to

5%phenol at 37°C.

2.10.2.3. Effect of chloroform on the activity of bacteriophages

Al-Mola and Al-Yassari (2010) determined the sensitivity of phages to

chloroform by exposing them at different time intervals (5, 10, 15, 20, 25, 30, 35 and 40

min.) and reported that chloroform completely inactivated the phage within 5min.

Manjunath et al. (2013) reported that there was no decrease in the phage titre in

chloroform treated sample after 4 and 24 h of incubation at room temperature.

Pandey et al. (2013) determined the effect of 10% chloroform on the activity of

brucellaphage and revealed that complete inactivation was observed within 5 min.

55

2.10.2.4. Effect of formalin on the activity of bacteriophages

Pandey et al. (2013) determined the stability of the brucellaphage by subjecting

them to 40% formalin and revealed that complete inactivation of phage within 15 min.

when exposed to 40% formalin.

2.11. Molecular characterization of phage by Restriction endonucleases digestion

analysis

Goodridge et al. (2003) performed restriction enzyme analysis with four enzymes

(EcoRV, SspI, NdeI and TaqI) and confirmed the phages LG1 and AR1 isolated against

Escherichia coli were distinct. The results revealed that the restriction enzymes SspI,

NdeI, and TaqI completely digested AR1 DNA and these results were coincided with

those observed when the same enzymes were used to digest T4 DNA. Further they

reported that phageLG1 DNA was partially degraded by NdeI, and completely digested

by EcoRV, SspI and TaqI and both AR1 and LG1 DNA were readily digested by several

restriction enzymes indicates that both phages possess double-stranded DNA.

Lappe et al. (2009) observed that the Podoviridae and Siphoviridae (PFGE-A)

were approximately 42 kb while there was size variation among the Myoviridae and the

Podoviridae subdivided into three groups, Pa (SETP1, 8 and 10), Pb (SETP15 and 16)

and Pc (SETP14). Likewise the Siphoviridae subdivided into Sa (SETP3, 5 and12), Sb

(SETP7 and 11) and Sc (SETP13), and the Myoviridae also divided into three groups, Ma

(SETP4and 9), Mb (SETP2) and Mc (SETP6). Their further studies revealed that

Salmonella enteritidis Typing Phage (SETP) 2, 4 and 9 were about 36.5 kb and SETP6

was approximately 27 kb. They also reported that Hind III digestion of phage DNA

produced 9 distinct patterns of 8 to 11 bands that showed correlation with morphotype.

Jamalludeen et al. (2009) determined the genome size of isolated phages EC-Nid1

and EC-Nid2 by using restriction enzymes, EcoRI and AccI and this restriction analysis

56

demonstrated the genome size of phages EC-Nid1 and EC-Nid2 were 67.06 kb and 68.04

kb respectively.

Bao et al. (2011) performed restriction enzyme analysis with EcoRI and HindIII

to digest genomes of the bacteriophages and their results indicated that the restriction

patterns of bacteriophage PSPu-95 obtained with enzymes EcoRI or HindIII were

absolutely different from PSPu-4-116 and bacteriophage genome was estimated to be

58.3 kbp in length for PSPu-95 and 45.2 kbp in length for PSPu-4-116.

Jamalludeen (2012) isolated Phages EC-NJ4 and EC-NJ7 against Escherichia coli

appears to have similar profiles of the nucleic acid fragments generated by digestion of

their DNAs with AccI and EcoRI.

2.12. Scanning Electron Microscopy (SEM)

Mulani et al. (2015) examined bacteriophage particles by scanning electron

microscopy and observed the hexagonal symmetry of head with a size of 100-150 nm.

57

CHAPTER III

MATERIALS AND METHODS

The research work was carried out in the department of Veterinary Public Health

and Epidemiology, College of Veterinary Science, Tirupati. During the course of this

study glassware of Borosil make and plastic ware of Torsons make were used.

Microbiological culture media was prepared with double glass distilled water. All the

media used in the present study were sterilized by autoclaving at 1210C at 15psi pressure

for 15 minutes unless otherwise specified. Sterility of the media was checked by

incubating at 370C for 24 hours. The buffers and all other chemical reagents were

prepared with triple distilled water. Chemicals used during this study were obtained from

M/s Merck, Qualigens, SD Fine Chemicals and Hi-Media. Readymade microbiological

media, sugars and antibiotic discs were procured from Hi-Media Laboratories Limited,

Mumbai. All the molecular grade chemicals used for PCR work were obtained from

Thermo Scientifics, Bangalore. The oligonucleotide primers used in the molecular

characterization of the isolates were supplied by Eurofins Genomics India Private

Limited, Bangalore.

3.1 Media, chemicals, glassware, plasticware and equipments

Tryptone soya broth (TSB), Nutrient agar (NA), Tryptic soya agar (TSA),

MacConkey agar (MLA), Eosine Methylene Blue (EMB) agar and other selective and

differential dehydrated media were obtained from HiMedia laboratories, Mumbai. All the

molecular grade chemicals used for PCR work were obtained from Thermo Scientifics,

Bangalore. Glassware’s (conical flasks 500 ml, 250 ml, 100 ml, Graduated reagents

bottles wide mouth screw cap, test tubes etc) were procured from Borosil, India while

plasticware (5 ml tubes, 1.5m ependorff tubes, 2-200 µl and 200-1000 µl microtips) from

Tarsons, India.

58

3.1.1 Preparation and sterilization of glassware and plastic ware

3.1.1.1 Glassware

Glassware was soaked overnight in Labolene. The next day they were thoroughly

cleaned, washed and rinsed three times in running tap water. After overnight soaking in

double glass distilled water, the glassware was dried and then sterilized in hot air oven at

1600C for one hour.

3.1.1.2 Plastic ware and rubber items

Plastic ware and rubber items were sterilized by autoclaving at 1210C at 15 psi

pressure for 15 minutes.

3.2. Equipment

Equipment from National and International firms were used in this study especially

during the molecular characterization of the isolates are given in the Table. 3.1.

3.3. Bacterial strains

The reference strain for Shiga Toxin producing Escherichia coli (MTCC 1699) was

obtained from the department of Veterinary Public Health and Epidemiology, College of

Veterinary Science, Tirupati, Andhra Pradesh.

3.4. Collection of samples

The specimens selected for this study were dairy farm sewage and wastewater. The

sewage and wastewater samples were collected from different organized and unorganized

dairy farms and animal sheds in and around Tirupati, aseptically in sterilized plastic

containers. A total of 128 samples from different sources viz: Organized dairy farms

59

(n=28), unorganized dairy farms (n=32) and animal sheds (n=68) were collected

aseptically in sterilized plastic containers. The collected specimens were processed within

2 to 24 hours of collection. The source and number of samples collected in this study is

given in Table. 3.2.

Table 3.1. List of equipment used in the study

S.No Name of the Equipment Company/ firm

1. Ultra centrifuge Beckman, Optima TLX 120

2. Thermocycler Eppendorf, MC gradient

3. U.V transilluminator B.Genei, MD-20,312 nm

4. Gel documentation unit Syngene, GBOX HR

5. Gel electrophoresis B.Genei

6. Micro centrifuge Minispin, Genei, India

7. Water bath Inlab equipment (Madras) pvt. ;td

8. Deep freezer Sanyo, MDF-U333

9. Weighing balance Essae Teraoka ltd., DS-852G

10. Hot air oven York Scientific Industries Pvt.Ltd.,

India, Yorco Hot Air Sterilizer (Oven)

11. Bacteriological incubator Micro Teknik, India

12. Microscope Olympus India Pvt. Ltd., Binocular

Microscope, Model CH20BIMF

Table. 3.2. Source and number of samples collected

S. No Source of the sample Number collected

1. Organized dairy farms 28

2. Unorganized dairy farms 32

3. Animal sheds 68

TOTAL 128

60

3.5. Isolation and Identification of Escherichia coli

3.5.1. Isolation

Tryptone soy broth (TSB) was used for enrichment of inoculum and incubated at

370C for 24h. After overnight incubation, the cultures were streaked on MacConkey agar

and Eosine Methylene Blue (EMB) agar plates and the plates were incubated at 370C for

24h. After incubation the plates were observed for lactose fermenting colonies and

greenish metallic sheen colonies respectively. The colonies thus obtained were

transferred to nutrient agar slants in duplicate and incubated at 370C for 24 h and stored

at 40C for further identification. The composition of media and any specific procedure

followed in its preparation are presented in Annexure I.

3.5.2. Identification

A bacterial smear was prepared on a clean microscope slide and heat fixed. The

smear was entirely covered with Crystal Violet solution and allowed to stand for one

minute. The slide was rinsed with water and flooded with gram’s iodine. After one

minute, the slide was rinsed with water and destained with 95% ethyl alcohol for

15seconds. Counter staining was done with Carbol fuschin for one minute. The slide was

gently blotted dry and viewed under oil immersion objective of the light microscope.

Purple coloured cells are interpreted as gram positive and red or pink coloured cells are

interpreted as gram negative bacteria according to the method described by Merchant and

Packer, (1967).

3.6. Biochemical characterization

For confirmation of Escherichia coli, the biochemical tests conducted were triple

sugar iron agar test, urease test, motility test and IMViC tests. The procedures used for

the conduction of biochemical tests are given in Annexure II.

61

3.7. Preservation of isolates

A loop full of the isolated organism was added to the sterile Luria-Bertani glycerol

broth vials and mixed well in vortex mixer. The vials were then labelled and stored until

further use.

3.8. Antimicrobial susceptibility test

The modified disc diffusion method of Bauer et al. (1966) was employed and the

interpretation was made as per the interpretation chart provided by the manufacturer using

panel of 14 antibiotics.

3.8.1. Preparation of inoculum

Transferred 4-5 colonies from primary isolated medium i.e. MacConkey agar and

EMB agar plates to 5 ml of Tryptic soya broth by touching the top of the colonies with a

flame sterilized and cooled platinum loop and incubated the bacterial suspension at 370C

for 8 h. After incubation, the resulted culture was compared with the turbidity standard

prepared separately for adjustment of bacterial suspension.

3.8.2. Preparation of turbidity standard

The turbidity standard was prepared by adding 0.5 ml of (1.17% w/v) of barium

chloride dehydrate (BaCl2 2H2O) solution to 1% sulphuric acid. The turbidity standard

was placed in the tube identical to the one used for the broth sample and was stored in the

dark at room temperature. The turbidity was equivalent to 108 CFU/ml which is half the

density of a Mac Farland 0.5 standard. The standard was agitated on a vortex mixer

immediately before use. If the culture was found less turbidity than the turbidity standard,

it was further incubated for 2-8 h at 370C until turbidity was equivalent to the standard. If

the turbidity exceeds that of the standard the culture solution was diluted with tryptic soya

broth to equitate with the standard.

62

3.8.3. Antimicrobial discs

Commercially available standard antimicrobial discs (Hi-Media) were procured

and stored at 2-80C in the refrigerator. Unopened disc containers were removed from the

refrigerator 1-2 h before use, to bring them to room temperature. The antimicrobial discs

with known concentrations as noted in micrograms (µg) or International Units (I.U) per

disc were used to study the antimicrobial susceptibility of the isolates. The antimicrobial

discs used in this study are given in Table 3.3.

3.8.4. Medium for antimicrobial susceptibility test

Muller-Hinton (MH) agar, the recommended medium for disc diffusion test was

used in the present study. Medium was prepared according to protocol provided by

manufacturer and autoclaved at 1210C, 15 lbs for 15 min. When the temperature of the

medium was reached between 45-500C it was mixed well and approximately 15-20 ml of

medium was added to the sterilized petriplates and incubated overnight at 370C for

sterility testing and the uncontaminated plates were wrapped with aluminium foil and

they were stored at 40C till use.

3.8.5 Preparation of inoculum

The sterile cotton swab was dipped in the standardized bacterial suspension and rotated

several times. Then the cotton swab was gently pressed on the upper inside wall of the

test tube to remove excess inoculum. The swab was then streaked over the entire surface

of the MH agar plate for three times. The plate was turned at 600 angle between each

streak to ensure even distribution of the inoculum. A final sweep of the swab was made

around the agar rim.

Allowed the inoculated plates to dry for 5 to 15 min and placed the selected

antimicrobial discs with a distance of 24 mm apart by using a disc dispenser and gently

63

Table.3.3. Antimicrobial discs used to study the antimicrobial susceptibility of the isolates

S.No Name of the

antimicrobial disc

Quantity of

antimicrobial substance

per disc

Diameter of zone of inhibition

in mm (as per the manufacturer guidelines)

Sensitive Intermediate resistant

1 Ampicillin 10 mcg > 17 14-16 < 13

2 Gentamycin 10 mcg > 17 13-14 < 12

3 Streptomycin 10 mcg > 15 12-14 < 11

4 Ciprofloxacin 05 mcg > 21 16-20 < 15

5 Chloramphenicol 30 mcg > 18 13-17 < 12

6 Penicillin-G 10 units > 29 --- < 28

7 Cefoperazone 75 mcg > 21 16-20 < 15

8 Cefotaxime 30 mcg > 23 15-22 < 14

9 Tigecycline 15 mcg > 16 13-15 < 12

10 Meropenem 10 mcg > 23 20-22 < 19

11 Azithromycin 15 mcg > 18 14-17 < 13

12 Cefadroxil 15 mcg > 18 15-17 < 14

13 Ofloxacin 05 mcg > 16 13-15 < 12

14 Tetracycline 30 mcg > 19 15-18 < 14

64

pressed down on to the agar surface to provide uniform contact. The inoculated plates

were inverted and incubated at 370C for 24 to 48 h. Each plate was examined after

incubation for the diameter of zones of complete inhibition including the diameter of the

discs were measured up to the nearest whole millimetre with ruler in non-reflecting

background. The zone margin was the area where no obvious growth was visible and the

readings were compared with that specified readings in the interpretive chart supplied by

the manufacturer of the antibiotic discs and the results were documented as sensitive (S),

intermediate resistant (I) and resistant (R).

3.9. Confirmation of Shiga toxin producing Escherichia coli by using Sorbitol

MacConkey agar (SMAC)

40.00gms of Sorbitol MacConkey agar part I and 10 gms of part II were added to

1000 ml of distilled water and gently heated to dissolve the medium completely and

sterilized by autoclaving at 1210C for 15 minutes and then cooled to room temperature.

The contents were mixed well and 15 -20 ml of media was added to the sterile petridish

and incubated over night at 370C for sterility testing.

The isolates were streaked on SMAC agar plates and incubated the plates at 370C

for 24 hours. After incubation the plates were observed for the colonies. Colourless

colonies were the characteristic growth of E. coli O157:H7 whereas pink colour colonies

were the E. coli Non O157:H7 organisms.

3.10. Multiplex Polymerase Chain Reaction for detection of virulence genes of STEC

(stx1, stx2, eaeA and hlyA)

3.10.1 Oligonucleotide primers

The primers used for the detection of shiga toxin producing Escherichia coli were

custom synthesized by M/s Eurofins Genomics, Bangalore, India. The details of the

primers are given in Table 3.4.

65

Table 3.4: Details of oligonucleotide primers used in this study

Primer Target

gene Primer sequence (51-31)

Expected

amplicon

size(bp)

Refere

nce

stx 1: F stx1

5’-ATA AAT CGC CAT TCG TTG ACT AC-3’ 180

Paton

and

Paton

(1998)

stx 1: R AGAACGCCCACTGAGATCATC

stx 2: F stx2

GGCACTGTCTGAAACTGCTCC 255

stx 2: R TCGCCAGTTATCTTGACATTCTG

eaeA: F eaeA

GACCCGGCACAAGCATAAGC 384

eaeA: R CCACCTGCAGCAACAAGAGG

hlyA: F hlyA

GCATCATCAAGCGTACGTTCC 534

hlyA: R AATGAGCCAAGCTTGTTAAGCT

3.10.2. Reference strains

The reference strain for Shiga Toxin producing Escherichia coli (MTCC 1699)

was obtained from the department of Veterinary Public Health and Epidemiology,

College of Veterinary Science, Tirupati, Andhra Pradesh.

3.10.3. Template DNA preparation by boiling and snap chilling method

Preparation of template DNA from Escherichia coli strains was carried out as per

Lee et al. (2003) with slight modifications. About 2 ml of overnight grown culture was

taken in micro centrifuge tube and centrifuged at 12,000 rpm for 10 minutes. The pellet

was suspended in 200 µl of nuclease free water and boiled for 15 min in a boiling water

bath. The micro centrifuge tubes were transferred immediately on to ice. After 20 min,

the tubes were centrifuged at 12,000 rpm for 10 min at 40C and the supernatant was used

as template for multiplex PCR assay.

66

3.10.4. Standardization of Multiplex PCR assay for detection of virulence genes

(stx1, stx2, eaeA and hlyA genes)

The multiplex PCR protocol was followed as per the method described by Paton

and Paton (1998) with some modifications. In brief, the multiplex PCR protocol was

standardized in a volume of 25.0 µl of reaction mixture containing 1X PCR buffer, 0.25

µM each of the 8 primers (4 primer pairs), 0.2mM each deoxynucleoside triphosphate

(dATP, dUTP, dGTP, and dCTP) (Thermo, USA), 1.0 U of Taq DNA polymerase

(Thermo, USA), template DNA and magnesium chloride (MgCl2). Sterile nuclease free

water was added accordingly to make up the 25 µl reaction mixture. The template DNA

volume was evaluated from 2 µl to 8 µl. The MgCl2 concentration was evaluated for

1.0mM, 1.5 mM, 2.0 mM, 2.5 mM and 3.0 mM.

PCR tube containing the reaction mixture was flash spun in a micro centrifuge

tube to settle the reactants at the bottom. Thermal cycling was performed in a 96-well

Eppendorf gradient Thermal cycler with a heated lid. It consisted of an initial denaturation

at 950C for 5 min, followed by 35 cycles of denaturation at 940C for 45 sec, 45 sec of

annealing temperature (temperature standardized) and initial extension at 720C for one

min and a final extension at 720C for 6 min followed by maintenance at 40C. The

annealing temperature was evaluated between 58 to 630C by performing gradient

multiplex PCR.

3.10.5. Analytical Agar Gel Electrophoresis:

DNA amplified by PCR was subjected to 1% agarose gel electrophoresis as

described by Sambrook and Russel (2001). Agarose gel (1%) was prepared by boiling

agarose in an appropriate volume of 1 X TBE buffer and allowed to cool to 500C. After

cooling for about 3 minutes, ethidium bromide (10 mg/ml) stock was added to the agarose

solution to a final concentration of 0.5 µl / ml and mixed carefully. The molten agarose

was poured in to a gel casting tray fitted with acrylic comb and allowed to solidify. Once

67

the gel was solidified a few ml of 1X TBE buffer was added, comb was removed carefully

and the tray containing the gel was then placed in a submarine horizontal electrophoresis

unit filled with 1X TBE buffer upto a level of 1mm above the gel surface.

The wells were loaded with 5 µl of each PCR product was mixed with 1 µl of 6X

loading dye. Electrophoresis was carried out at the rate of 5-6 v/cm and the motility was

monitored by the migration of the dye. After sufficient migration, the gel was observed

under UV transillumination using Syngene Gel Documentation system to visualize the

bands and image was captured. The PCR product size was determined by comparing with

a standard molecular weight marker.

3.11. Bacteriophage isolation

The lytic bacteriophages were isolated by using the disease causing strain

Escherichia coli as a representative strains employing double agar overlay method

described by Adams (1959) with slight modifications using sewage water collected from

different dairy farms.

3.11.1. Sample preparation by enrichment method

As a part of the enrichment process, a portion of sewage sample was mixed with

the host bacteria (in log phage) and allowed for incubation overnight at the temperature

of 370C. The homogenate was centrifuged at 2000 rpm (Remi motor Ltd., R8) and

followed by filtration using sterile syringe filters (Millex®GV) with pore size of 0.22 µm

to make them bacteria-free. After filtration 100 µl of the filtered sample was serially

diluted in Salt of Magnesium (SM) buffer, by 10 fold dilution. This filtrate was screened

for the presence of phage and was stored at 40C for the further use.

68

3.11.2. Spot Assay

100 µl log phage host was spread on sterile TSA plates and 10 µl lysate was

spotted on the plate and incubated at 370C for 24h.

3.11.3. Double agar overlay method

The lysate was then assayed according to the double-agar overlay method of

Adams (1959) with slight modifications. The logarithmic phage cells (100 µl) of the host

bacterial strains in TSB were mixed with 100 µl of the serially diluted lysate and were

incubated at 370C for 20 min. After incubation, 5 ml of 0.75% sterile soft agar was added

to this, mixed well and was immediately overlaid on 20% bottom TSA plates. Phage free

cultures (containing only bacterial host) and host-free cultures (containing only phage)

were used as controls. Then the petri plates were kept in laminar air flow until it gets

solidified, and incubator at 370C for overnight to obtain clear zone of plaques.

3.12. Preparation of bacteriophage stocks

Bacteriophage stocks were prepared by using double agar overlay method with

minor modifications (Sambrook et al., 1989). To the double agar over lay plates that were

showing characteristic plaque morphology three ml of SM buffer was added. The entire

surface of semisolid material was scrapped with the sterile spatula and incubated at 37ºC

for 8 hours. Then the entire scrapped material with SM buffer was collected with wide

bore microtips into 50 ml sterile container. The phage suspension was centrifuged at

10,000 rpm for 15 min at 4ºC and the supernatant was filtered through 0.45µ syringe filter

and stored at 40C for further use.

3.13. Estimation of the titre of the isolated bacteriophage against E. coli

Titration of the phage was done by preparing 10-fold serial dilution of the phage

lysate. For titration, 10-1 to 10-4 dilutions were made in SM buffer (pH 7.0). Equal quantity

69

of each phage dilution and fresh exponential Escherichia coli in SM buffer and subjected

to double agar overlay method described in 3.11.3. Phage titre was determined in terms

of plaque forming units (PFU/ml) with the help of formula given below:

PFU/ml = No. of plaques counted ×1

Dilution factor×

1

volume of phage taken

3.14. Activity of bacteriophages against target bacteria

Survival rate of target bacteria was assessed by inoculating phage in the actively

growing log phase host. Sewage sample was collected and filtered. After filtration sewage

sample was taken in pre-sterilized flask. Then added the specific phage at 106 PFU/ml

and used for treatment. The phage inoculated sample was incubated at 370C. After

periodic time intervals, the phage treated sample was subjected to assess the activity of

target bacteria. Sewage sample was taken as control. The following are the treatment sets

prepared for the study.

T1 - Sewage water with bacterial isolate

T2 – T1 and host specific bacteriophages

3.15. Physical characterisation of isolated bacteriophages

The effect of heat, sunlight and UV light on survivability of phage was determined

at different time intervals.

3.15.1. Effect of heat

To determine the heat stability, purified phage preparation was subjected to the

test temperature (400C and 600C) in water bath. After periodic time intervals, (i.e. 5, 10,

30, 60, 120 and 180 min) the aliquots (100µl) were subjected to the phage titre (PFU/ml)

estimation as per procedure described in 3.11.3 to estimate the survivability of the phage.

70

3.15.2. Effect of sunlight

The phage should be treated under sunlight in order to estimate the survivability

of phages in sunlight. The purified phage preparation was subjected to direct sunlight.

After various time intervals (15, 30, 60, 120 and 180 minutes) the aliquots were subjected

to the phage titre (PFU/ml) estimation as per procedure described previously to estimate

the survivability of the phage.

3.15.3. Effect of UV light

The phage should be treated with UV light in order to estimate the survivability

of phages under UV light. The purified phage preparation was treated with UV light at

room temperature. After various time intervals (1, 3 and 5 minutes) the aliquots were

subjected to the phage titre (PFU/ml) to estimate the survivability of the phage.

3.16. Chemical characterization of isolated bacteriophages

Effect of some commonly available chemicals, viz., Sodium doDecyl Sulphate

(0.1% and 1%), phenol (1% and 5% aqueous), chloroform (5% and 10%) and formalin

(40%) on survivability of bacteriophage was observed.

3.16.1. Effect of SDS (0.1% and 1%)

The purified phage preparation was mixed with an equal amount of SDS and

incubate at 37o C. After 5, 10, 15 and 30 min of incubation, the aliquots were subjected

to the phage titre (PFU/ml) to estimate the survivability of the phage.

3.16.2. Effect of phenol (1% and 5% aqueous)

The purified phage preparation was mixed with an equal amount of phenol

(aqueous) and incubated at 37o C. After 10, 15 min and 30 min of incubation, the aliquots

were subjected to the phage titre (PFU/ml) to estimate the survivability of the phage.

71

3.16.3. Effect of chloroform (5% and 10%)

The purified phage preparation was mixed with an equal amount of chloroform

and incubated at 37o C. After 1, 3, 5 and 15 min of incubation, the aliquots were subjected

to the phage titre (PFU/ml) estimation.

3.16.4. Effect of formalin (40%)

The purified phage preparation was mixed with an equal amount of formalin and

incubated at 37o C. After 5, 10, 15 and 30 min of incubation, the aliquots were subjected

to the phage titre (PFU/ml) to estimate the survivability of the phages.

3.17. Molecular characterisation of the lytic bacteriophage

3.17.1 Phage DNA isolation

The extraction of Phage DNA was carried out by the method of Sambrook and

Russel (2001) with some modifications. Briefly, 400 µl of lysate was transferred to 1.5

ml of micro centrifuge tube and was incubated at 560C for one hour with proteinase K at

a final concentration of 50 µl/ml, 0.5M Ethylene Diamino Tetra Acetic acid (EDTA) at a

final concentration of 20 mM and 10% Sodium do Decyl Sulphate (SDS) at a final

concentration of one percent. After incubation, the digestion mix in the tube was cooled

to room temperature. Afterwards the suspension was extracted with equal volumes of

phenol: chloroform: isoamyl alcohol (25:24:1 v/v). The phases were separated by

centrifugation (Sigma 3K30, Germany) at 13000 rpm for 5 min at room temperature. The

upper aqueous layer was transferred to a clean tube using wide-bore pipette. To this,

double volume of absolute ethanol and 3 M sodium acetate (pH:7) to a final concentration

of 0.3 M were added, followed by incubation at room temperature for 30 min. After

incubation, the precipitated DNA was collected by centrifugation at 13000 rpm for 10

min at 40C. The supernatant was discarded and then added 500 µl of 70% ethanol to wash

72

the nucleic acid pellet. Then centrifuged at 13000 rpm for 10 min at room temperature.

The pellet was dried and dissolved in a minimal volume of Tris-EDTA (TE) buffer.

3.17.2 Restriction endonucleases digestion analysis

The restriction pattern of the Phage DNA was studied using the enzyme, EcoRI

(Chromous biotech, REN 009A). Enzyme digestion was performed as recommended by

the manufacturer. For digestion, each 20 µl digestion solution containing approximately

1 µg of bacteriophage DNA and 1U of the restriction enzyme in reaction buffer, was

incubated for 90 min at 370C. The restriction enzyme digested DNA sample were loaded

onto 1.2% agarose gel in TBE buffer by mixing loading buffer. Electrophoresis of

restriction enzyme digested samples were carried out along with lambda DNA ladder

(Chromous biotech, MAN 05) by applying 50 V current for 2 h. molecular weight of

Phage DNA fragment was calculated by plotting distance of migration against molecular

weights of marker.

3.18. Morphological characterization

Morphological characterization of bacteriophage particles was carried out by

using scanning electron microscopy (SEM). The phage particles were fixed in 2.5%

glutaraldehyde (pH 7.2) in 0.1 M phosphate buffer (pH 7.2) for 24 h at 40C. Remaining

Post fixation done in 2% aqueous osmium tetraoxide for 4 h. Dehydration steps were

carried out in series of graded alcohols (50%, 70%, 80%, 90% and 100%) and dried to

critical point drying with CPD unit. The processed samples were mounted over the stubs

with double sided carbon conductivity tape and a thin layer of gold coat over the samples

were done by using an automated sputter coater (model: JEOL JFC 1600) for 3 min and

scanned under scanning electron microscope (SEM model: JOEL- JSM 5600) at required

magnifications as per standard procedures at RUSKA lab’s, College of Veterinary

Science, PVNR TVU, Rajendranagar, Hyderabad, India.

73

CHAPTER IV

RESULTS

A total of 128 samples from different sources viz: organized dairy farms (n=28),

unorganized dairy farms (n= 32) and animal sheds (n=68) maintained by the farmers with

two to five number of cattle in and around Tirupati, Chittoor District, Andhra Pradesh

were collected between January 2016 and March 2016 and analysed.

4.1. Isolation of Escherichia coli

All the sewage and waste water samples collected from different organized,

unorganized dairy farms and also from the animal sheds were inoculated into tryptic soy

broth and incubated at 370C for 24 hrs. After the incubation period a loop full of inoculum

from tryptic soy broth tubes was streaked on MacConkey agar and Eosine methylene blue

agar plates by following all the aseptic precautions. The plates were incubated at 370C for

48 hrs. The plates were observed for pink colonies on MacConkey agar (Fig. 1) and small

dark colonies with green metallic sheen on Eosine methylene blue agar plates (Fig. 2).

All the 128 samples were positive for E. coli by culture method and were subjected to

Gram’s staining and found Gram negative, coccobacillary rods (Fig. 3).

4.2. Biochemical characterization of Escherichia coli

The biochemical reactions of all the isolates were given in Table 4.1. The isolates

were subjected to the biochemical tests like IMViC tests, urease test and triple sugar iron

agar tests.

All the isolates were positive for indole and methyl red tests, where the isolates

have produced red colour ring in indole test (Fig. 4) and red colour in methyl red test.

(Fig-5) and all isolates were negative for voges-proskauer (Fig. 6) and citrate utilization

tests (Fig-7). Further all the isolates were subjected to triple sugar iron agar test (Fig-8),

and urease test (Fig-9). The results revealed that all the isolates were negative for urease

74

test and positive for triple sugar iron agar test where the isolates have produced acid butt

and acid slant and also gas. All these isolates were also subjected to motility test and they

showed growth away from the line of inoculation (Fig-10). All the biochemical reactions

confirmed the presence of Escherichia coli.

Table 4.1. Results of the biochemical tests for Escherichia coli isolates

S. No Name of the

biochemical test

Total number of

samples screened

No of isolates positive

for the biochemical

tests

1 Gram’s staining 128 128

2 Indole test 128 128

3 Methyl red test 128 128

4 Voges-proskauer test 128 00

5 Citrate utilization test 128 00

6 Urease test 128 00

7 Triple sugar iron agar

test (Y/Y/H2S-) 128 128

8 Motility test 128 128

80

4.3. Antimicrobial sensitivity testing

To detect the resistant and sensitivity pattern of Escherichia coli from different

sources, in-vitro antibiotic sensitivity was carried out by disc diffusion as per the method

of Bauser et al. (1966) by using 14 commercially available antibiotic discs. Muller Hinton

agar plates showing the sensitivity, intermediate sensitivity and the resistance patterns of

various antibiotic discs were shown in Table 4.2 and Figure. 11 and 12.

A total of 98 isolates were resistant to different antibiotic discs used in this study.

The sensitivity patterns of the isolates for various antibiotic discs are presented in Table

4.3. Among the 128 isolates no isolates, was completely sensitive to any of the antibiotic

test discs used in this study. Maximum resistance was observed for ampicillin (92.19%),

Penicillin-G (76.56%), cefotaxime (71.10%), streptomycin (64.84%), gentamicin

(64.06%), chloramphenicol (57.81%), tetracycline (54.69%), cefoperazone (51.56%),

ofloxacin (44.53%), cefadroxil (39.06%), ciprofloxacin (38.28%), azithromycin

(30.40%), meropenem (27.34%), and tigecycline (20.31%) (Table 4.3).

81

Table. 4.2: Antimicrobial sensitivity/intermediate/resistant-patterns of Escherichia coli from different sources

S. No Antimicrobial agent Pattern of antibiogram

Sensitive (%) Intermediate (%) Resistant (%)

1 Ampicillin 06 (4.68%) 04 (3.13%) 118 (92.19%)

2 Gentamycin 24 (18.75%) 12 (9.37%) 82 (64.06%)

3 Streptomycin 23 (17.96%) 12 (9.37%) 83 (64.84%)

4 Ciprofloxacin 63 (49.22%) 16 (12.50%) 49 (38.28%)

5 Chloramphenicol 31 (24.22%) 23 (17.97%) 74 (57.81%)

6 Penicillin-G 30 (23.44%) 00 (0.00%) 98 (76.56%)

7 Cefoperazone 48 (37.50%) 14 (10.94%) 66 (51.56%)

8 Cefotaxime 20 (15.62%) 17 (13.28%) 91 (71.09%)

9 Tigecycline 91 (71.10%) 11 (8.59%) 26 (20.31%)

10 Meropenem 76 (59.37%) 17 (13.28%) 35 (27.34%)

11 Azithromycin 63 (49.22%) 29 (22.65%) 38 (29.69%)

12 Cefadroxil 44 (34.37%) 34 (26.56%) 50 (39.06%)

13 Ofloxacin 45 (35.15%) 26 (20.31%) 57 (44.53%)

14 Tetracycline 36 (28.12%) 22 (17.19%) 70 (54.69%)

82

Table.4.3. Antibiotic resistant among Escherichia coli (source wise)

S.No Antimicrobial agent % of resistance in

Total Organized Unorganized Animal sheds

1 Ampicillin 24 (85.71%) 31 (96.87%) 63 (92.65%) 118 (92.19%)

2 Gentamycin 12 (42.86%) 12 (37.50%) 58 (85.29%) 82 (64.06%)

3 Streptomycin 16 (57.14%) 11 (34.37%) 56 (82.35%) 83 (64.84%)

4 Ciprofloxacin 09 (32.14%) 12 (37.50%) 28 (41.18%) 49 (38.28%)

5 Chloramphenicol 18 (64.28%) 11 (34.37%) 45 (66.18%) 74 (57.81%)

6 Penicillin-G 19 (67.85%) 28 (87.50%) 51 (75.00%) 98 (76.56%)

7 Cefoperazone 07 (25.00%) 15 (46.87%) 44 (64.71%) 66 (51.56%)

8 Cefotaxime 11 (39.28%) 23 (71.87%) 57 (83.82%) 91 (71.09%)

9 Tigecycline 06 (21.43%) 08 (25.00%) 12 (17.65%) 26 (20.31%)

10 Meropenem 03 (10.71%) 10 (31.25%) 22 (32.35%) 35 (27.34%)

11 Azithromycin 08 (28.57%) 12 (37.50%) 18 (26.47%) 38 (29.69%)

12 Cefadroxil 11 (39.28%) 16 (50.00%) 23 (33.82%) 50 (39.06%)

13 Ofloxacin 12 (42.86%) 14 (43.75%) 31 (45.59%) 57 (44.53%)

14 Tetracycline 18 (64.28%) 18 (56.25%) 54 (79.41%) 70 (54.69%)

84

4.4. Sorbitol MacConkey agar plate test (SMAC)

For the phenotypic detection of Shiga toxin producing Escherichia coli, all the

Escherichia coli isolates from different sources were streaked on SMAC plates and the

plates were incubated at 370C for 24 hr. The results revealed that none of the isolates have

shown colourless colonies on SMAC plates but a total of 108 isolates have shown pink

colonies.

4.5. Standardization of multiplex PCR for primers ofstx1, stx2, eaeA and hlyA genes

to detect shiga toxin producing Escherichia coli.

Initial experiments to optimize PCR reaction conditions for Escherichia coli

template involved the empirical variation of annealing temperature (580C – 630C),

concentration of primer (5 – 15 p mol), magnesium chloride (1 mM – 3 mM), template

volume (2µl - 8 µl) and the cycling conditions. Optimal results were obtained using 5 µl

of bacterial lysate or 20 ng of diluted DNA as template in a reaction mixture consisting

of 2.5 µl of 10X assay buffer for Taq polymerase containing 2.0 mM magnesium chloride,

1 µl of dNTP mix, 0.25 µl of each primer and 1 U of Taq DNA polymerase in a final

reaction volume made up to 25 µl with molecular grade water (Table 4.4).

Table 4.4: Components of reaction mixture used in PCR assay

S. No. Name of the reagent Quantity (µl)

1. 10 X PCR buffer 2.5 µl

2. d NTP mix 0.2 µl

3. Primer – F(10 p.mol) 0.25 µl ×4

4. Primer – R(10 p.mol) 0.25 µl ×4

5. Taq DNA polymerase 0.3 µl

6. 25 mM Magnesium Chloride 2.0 µl

7. Template DNA 5.0 µl

8. Nuclease free water 13.0 µl

85

Initial denaturation at 950C for five minutes followed by 35 cycles each of

denaturation at 940C for 45 seconds, annealing at 590C for 45 seconds and extension at

720C for one minutes with a final extension period of six minutes at 720C was found to

be optimum for obtaining the desired PCR amplification of 180 bp for stx1, 255 bp for

stx2, 384 bp for eaeA and 534 bp for hlyA gene of shiga-toxin producing E. coli (Table

4.5).

Table 4.5. PCR conditions used for multiplex PCR assay

S. No. Step Temperature Duration No. of cycles

1 Initial denaturation 950C 5 min 1

2 Final denaturation 940C 45 sec

35 3 Annealing 590C 45 sec

4 Initial extension 720C 1 min

5 Final extension 720C 6 min 1

6 Hold 40C --- ---

4.5.1. Screening of the samples from dairy farm sewage and waste water:

The results of the detection of Shiga toxin producing Escherichia coli by PCR

method are shown in Fig-13 (Organized Dairy farms), Fig-14 (Unorganized dairy farms)

and Fig-15 (Animal sheds) respectively.

Out of 28 samples from the organized dairy farm of Tirupati and surrounding

villages, 28 (100.00%) were positive for Escherichia coli by culture method (Table 4.6).

Out of 28 positives one (3.57%) sample was positive for Shiga toxin producing E.coli by

PCR method and this isolate carried stx1 gene.

Out of 32 samples from the unorganized dairy farms in and around Tirupati, all

the 32 samples (100.00%) were positive for Escherichia coli by culture method (Table

4.6). Out of 32 positives two (6.25%) samples were positive for Shiga toxin producing E.

86

coli by PCR method. Among the two (2) Shiga toxin producing E. coli, one isolate carried

stx1 gene, whereas another isolate carried stx1, stx2 and eaeA genes.

All 68 samples from the animal sheds were positive for Escherichia coli by culture

method (Table 4.6). Out of which eight (11.76%) samples were positive for Shiga toxin

producing E.coli by PCR method. Among the eight Shiga toxin producing E. coli, three

isolates carried stx1, four isolates carried stx2 and one isolate carried both stx1and

stx2genes.

87

Table 4.6: screening and comparison of culture method for detection of Escherichia coli and multiplex PCR for detection of Shiga-toxin

producing E. coli

S.No Source

No. of

samples

screened

No. of

E. coli by

culture

method

Total No. of

samples

positive for

PCR

Multiplex PCR for stx1, stx2, eaeA and hlyA genes

stx1 stx2 eaeA hlyA stx1 and stx2 stx1, stx2

and eaeA

1 Organized

dairy farms 28 28 01 (3.57%) 01 (3.57%) 00 00 00 00 00

2 Unorganized

dairy farms 32 32 02 (6.25%) 01 (3.13%) 00 00 00 00 01 (3.13%)

3 Animal sheds 68 68 08 (11.76%) 03 (4.41%) 04 (5.88%) 00 00 01 (1.47%) 00

Grand total 128 128 11 (8.59%) 05 (3.90%) 04 (3.13%) 00 00 01 (0.78%) 01 (0.78%)

90

4.6. Isolation of E. coliphage and its characterization:

4.6.1. Collection and processing of samples:

A total of 128 sewage samples were collected from organized, unorganized dairy

farms and animal sheds in and around Tirupati, Chittoor district, Andhra Pradesh and

processed for E. coliphages isolation. E. coli isolated from the sewage samples were used

for isolation of bacteriophages.

4.6.2 Isolation of E. coliphages:

A total of 22 E. coliphages were isolated from a total of 128 sewage samples

processed for isolation (Fig. 16). The source farm wise, sample wise presented in

Annexure-IV. The plaques, on secondary streaking on the E. coli lawn gave the clearing

zone around the streak lines (Fig. 17).

4.6.3. Plaque morphology:

The observed plaques were discrete, clear and circular in shape with a diameter

of 0.1 to 3mm (Fig. 18).

4.7. Physical characterization of E.coliphages

4.7.1. Heat:

The effect of heat on the activity of E. coliphages revealed that at 400C phage titre

was completely reduced within three hours (Table 4.7). At 600C temperature treatment

completely inactivated the phages within 30 min (Table 4.8). The graphical representation

of heat effect on the activity of bacteriophages was shown in Fig. 19.

4.7.2. Sunlight

The effect of sunlight on the activity of phages showed that exposure to direct

sunlight gradually decreased the phage concentration and within three hours E.coliphages

titre was completely reduced (Table 4.9). The graphical representation of sunlight effect

on the activity of bacteriophages was shown in Fig. 20.

91

4.7.3. UV light:

Exposing the phages to the UV light for five minutes causes complete inactivation

of bacteriophages (Table 4.10). The graphical representation of U V light effect on the

activity of bacteriophages was shown in Fig. 21.

4.8. CHEMICAL CHARACTERIZATION

4.8.1. SDS

The effect of SDS treatment on the activity of E.coliphages revealed that both 1%

and 0.1%concentrations of SDS completely inactivated the phage within 15 minutes at

370C (Table 4.11 & 4.12). The graphical representation of SDS effect on the activity of

bacteriophages was shown in Fig. 22.

4.8.2. Phenol

The effect of phenol treatment on the activity of E. coliphages revealed that the

phages were completely inactivated by phenol within 30 min and 15 min at 1% and 5%

concentration respectively. (Table 4.13 & 4.14). The graphical representation of phenol

effect on the activity of bacteriophages was shown in Fig. 23.

4.8.3. Chloroform

The effect of chloroform treatment on the activity of E. coliphages showed that

5% and 10% concentrations of chloroform completely inactivated the E. coliphages

within five and three minutes respectively at 370C (Table 4.15 & 4.16). The graphical

representation of chloroform effect on the activity of bacteriophages was shown in Fig.

24.

4.8.4. Formalin

The effect of formalin treatment on the activity of E. coliphages showed that 40%

concentration of formalin completely inactivated the E. coliphages within 15 min at 370C

(Table 4.17). The graphical representation of formalin effect on the activity of

bacteriophages was shown in Fig. 25.

92

Table 4.7: Effect of 400C temperature on the activity of phage

Samp

le no.

PFU/ml ( at 10-1 dilution) at various time intervals and Percentage with respect to control

00 min 05 min 10 min 15 min 30 min 60 min 120 min 180

min

1. 2.6x104 2.48x104 (95.38%) 2.28x104 (87.69%) 1.6x104 (61.54%) 1.12x104 (43.08%) 5.7x103 (21.92%) 2.4x103 (9.23%) 00

6. 2.52 x104 2.36x104 (93.65%) 2.2x104 (87.30%) 1.52x104 (60.32%) 1.04x104 (41.27%) 5.4x103 (21.43%) 2.0x103 (7.93%) 00

11. 5.6 x103 5.3x103 (94.64%) 4.9x103 (92.45%) 3.5 x103 (62.50%) 2.5x103 (44.64%) 1.2x103 (21.43%) 0.5x103 (8.92%) 00

13. 2.64 x104 2.44x104 (92.42%) 2.32x104 (87.88%) 1.64x104 (62.12%) 1.16x104 (43.94%) 5.4x103 (20.45%) 2.5x103 (9.46%) 00

16. 2.96 x104 2.8x104 (94.59%) 2.56x104 (86.49%) 1.84x104 (62.16%) 1.32x104 (44.59%) 6.3x103 (21.28%) 3.1x103(10.47%) 00

18. 1.08 x104 1.02x104 (94.44%) 9.3x103 (86.11%) 6.7x103 (62.04%) 4.6x103 (42.59%) 2.4x103 (22.22%) 1.2x103(11.11%) 00

23. 2.08 x104 1.92x104 (92.31%) 1.84x104 (88.46%) 1.28x104 (61.54%) 9.1x103 (43.75%) 4.2x103 (20.19%) 2.3x103(11.05%) 00

26. 2.4 x104 2.24x104 (93.33%) 2.12x104 (88.33%) 1.48x104 (61.67%) 1.08x104 (45.00%) 5.3x103 (22.08%) 2.8x103(11.66%) 00

29. 1.92 x104 1.84x104 (95.83%) 1.72x104 (89.58%) 1.16x104 (60.62%) 8.6x103 (44.79%) 3.9x103 (20.31%) 1.8x103 (9.37%) 00

31. 1.52 x104 1.44x104 (94.73%) 1.32x104 (86.84%) 9.5x103 (62.50%) 6.3x103 (41.45%) 3.2x103 (21.05%) 1.5x103 (9.86%) 00

33. 1.68 x104 1.6x104 (95.24%) 1.44x104 (85.71%) 1.04x104 (61.91%) 7.3x103 (43.45%) 3.6x103 (21.42%) 1.6x103 (9.52%) 00

42. 2.72 x104 2.52x104 (92.65%) 2.36x104 (86.76%) 1.68x104 (61.77%) 1.2x104 (44.12%) 6.0x103 (22.05%) 3.1x103(11.39%) 00

51. 1.96 x104 1.84x104 (93.88%) 1.72x104 (87.76%) 1.2x104 (61.22%) 8.5x103 (43.37%) 4.1x103 (20.91%) 2.0x103 (10.2%) 00

53. 2.56 x104 2.4x104 (93.75%) 2.2x104 (85.94%) 1.58x104 (61.72%) 1.12x104 (43.75%) 5.7x103 (22.26%) 3.0x103(11.71%) 00

55. 2.88 x104 2.72x104 (94.44%) 2.52x104 (87.50%) 1.8x104 (62.50%) 1.29x104 (44.79%) 5.8x103 (20.13%) 2.5x103 (8.68%) 00

58. 2.48 x104 2.36x104 (95.16%) 2.16x104 (87.10%) 1.56x104 (62.90%) 1.04x104 (41.94%) 5.4x103 (21.77%) 2.3x103 (9.27%) 00

64. 2.08 x104 1.96x104 (94.23%) 1.84x104 (88.46%) 1.28x104 (61.54%) 9.1x103 (43.75%) 4.7x103 (22.59%) 2.2x103(10.57%) 00

82. 3.44 x104 3.28x104 (95.35%) 2.96x104 (86.05%) 2.12x104 (61.63%) 1.52x104 (44.18%) 7.3x103 (21.22%) 3.5x103(10.17%) 00

95. 1.88 x104 1.76x104 (93.62%) 1.64x104 (87.23%) 1.16x104 (61.70%) 8.2x103 (43.61%) 4.0x103 (21.27%) 1.7x103 (9.04%) 00

107. 9.2 x103 8.7x103 (94.57%) 7.9x103 (85.87%) 5.6x103 (60.87%) 3.8x103 (41.30%) 1.9x103 (20.65%) 1.0x103(10.86%) 00

119. 4.8 x103 4.5x103 (93.75%) 4.3x103 (89.58%) 2.9x103 (60.42%) 2.1x103 (43.75%) 1.0x103 (20.83%) 00 00

127. 2.8 x104 2.64x104 (94.29%) 2.48x104 (88.57%) 1.76x104 (62.86%) 1.24x104 (44.28%) 6.2x103 (22.14%) 2.6x103 (9.28%) 00

Avera

ge % 100% 94.19% 87.62% 61.72% 43.51% 21.34% 9.53% 0%

93

Table 4.8: Effect of 600C temperature on the activity of phage

Sample

no. PFU/ml ( at 10-1 dilution) at various time intervals and Percentage with respect to control

00 min 05 min 10 min 15 min 30 min

1. 2.6x104 1.2 x104 (46.15%) 2.3 x103 (8.84%) 00 00

6. 2.52 x104 1.24 x104 (49.20%) 1.7 x103 (6.74%) 00 00

11. 5.6 x103 2.6 x103 (46.42%) 00 00 00

13. 2.64 x104 1.31 x104 (49.62%) 2.1 x103 (7.95%) 00 00

16. 2.96 x104 1.36 x104 (45.94%) 2.7 x103 (9.12%) 0.7 x103 (2.36%) 00

18. 1.08 x104 5.1 x103 (47.22%) 0.8 x103 (7.40%) 00 00

23. 2.08 x104 1.02 x104 (49.03%) 1.4 x103 (6.73%) 00 00

26. 2.4 x104 1.12 x104 (46.66%) 2.2 x103 (9.16%) 00 00

29. 1.92 x104 8.4 x103 (43.75%) 1.1 x103 (5.72%) 00 00

31. 1.52 x104 7.6 x103 (50.00%) 0.9 x103 (5.92%) 00 00

33. 1.68 x104 7.2 x103 (42.85%) 1.0 x103 (5.95%) 00 00

42. 2.72 x104 1.32 x104 (48.52%) 1.9 x103 (6.98%) 00 00

51. 1.96 x104 8.8 x103 (44.89%) 1.3 x103 (6.63%) 00 00

53. 2.56 x104 1.16 x104 (45.31%) 2.0 x103 (7.81%) 0.6 x103 (2.34%) 00

55. 2.88 x104 1.32 x104 (45.83%) 2.8 x103 (9.72%) 1.3 x103 (4.51%) 00

58. 2.48 x104 1.2 x104 (48.38%) 2.1 x103 (8.46%) 00 00

64. 2.08 x104 9.8 x103 (47.11%) 1.1 x103 (5.28%) 00 00

82. 3.44 x104 1.62 x104 (47.09%) 2.9 x103 (8.43%) 1.5 x103 (4.36%) 00

95. 1.88 x104 8.0 x103 (42.55%) 1.3 x103 (6.91%) 00 00

107. 9.2 x103 3.9 x103 (42.39%) 0.7 x102 (7.60%) 00 00

119. 4.8 x103 1.9 x103 (39.58%) 00 00 00

127. 2.8 x104 1.28 x104 (45.71%) 2.3 x103 (8.21%) 00 00

Averag

e % 100% 46.10% 6.79% 0.61% 0.00%

94

Table 4.9: Effect of sunlight on the activity of phage

Sam

ple

no.

PFU/ml ( at 10-1 dilution) at various time intervals and Percentage with respect to control

00 min 05 min 10 min 15 min 30 min 60 min 120 min 180

min

1. 2.6x104 2.39x104 (91.92%) 2.07x104 (79.61%) 1.48x104 (56.92%) 1.16x104 (44.61%) 7.9x103 (30.38%) 4.7x103 (18.07%) 00

6. 2.52x104 2.35x104 (93.25%) 1.97x104 (78.17%) 1.32x104 (52.38%) 1.13x104 (44.84%) 7.1x103 (28.17%) 5.1x103 (20.23%) 00

11. 5.6x103 5.1x103 (91.07%) 4.5x103 (80.35%) 3.1x103 (55.35%) 2.5x103 (44.64%) 1.7x103 (30.35% ) 1.1x103 (19.64%) 00

13. 2.64x104 2.43x104 (92.04%) 2.13x104 (80.68%) 1.36x104 (51.51%) 1.2x104 (45.45%) 8.3x103 (31.43%) 4.5x103 (17.04%) 00

16. 2.96x104 2.71x104 (91.55%) 2.33x104 (78.71%) 1.59x104 (53.71%) 1.32x104 (44.59%) 8.6x103 (29.05%) 5.7x103 (19.25%) 00

18. 1.08x104 9.8x103 (90.74%) 8.5x103 (78.70%) 5.9x103 (54.62%) 4.7x103 (43.51%) 3.4x103 (31.48%) 2.1x103 (19.44%) 00

23. 2.08x104 1.92x104 (92.30%) 1.64x104 (78.84%) 1.07x104 (51.44%) 9.6x103 (46.15%) 6.5x103 (31.25%) 3.6x103 (17.30%) 00

26. 2.4 104 2.21x104 (92.08%) 1.94x104 (80.83%) 1.24x104 (51.66%) 1.12x104 (46.66%) 7.2x103 (30.00%) 4.5x103 (18.75%) 00

29. 1.92x104 1.76x104 (91.66%) 1.56x104 (81.25%) 1.08x104 (56.25%) 8.4x103 (43.75%) 5.8x103 (30.20%) 3.5x103 (18.22%) 00

31. 1.52x104 1.39x104 (91.44%) 1.21x104 (79.60%) 7.9x103 (51.97%) 6.9x103 (45.39%) 4.7x103 (30.92%) 2.9x103 (19.07%) 00

33. 1.68x104 1.55x104 (92.26%) 1.37x104 (81.54%) 8.7x103 (51.78%) 7.3x103 (43.45%) 5.3x103 (31.54%) 3.2x103 (19.04%) 00

42. 2.72x104 2.43x104 (89.34%) 2.17x104 (79.77%) 1.49x104 (54.77%) 1.21x104 (44.48%) 8.1x103 (29.77%) 4.9x103 (18.01%) 00

51. 1.96x104 1.81x104 (92.34%) 1.59x104 (81.12%) 1.0x104 (51.02%) 8.6x103 (43.87%) 6.0x103 (30.61%) 4.0x103 (20.40%) 00

53. 2.56x104 2.28x104 (89.06%) 2.03x104 (79.29%) 1.4x104 (54.68%) 1.12x104 (43.75%) 7.6x103 (29.68%) 4.5x103 (17.57%) 00

55. 2.88x104 2.67x104 (92.70%) 2.33x104 (80.90%) 1.58x104 (54.86%) 1.27x104 (44.09%) 8.6x103 (29.86%) 5.6x103 (19.44%) 00

58. 2.48x104 2.31x104 (93.14%) 1.97x104 (79.43%) 1.36x104 (54.83%) 1.08x104 (43.54%) 7.9x103 (31.85%) 4.7x103 (18.95%) 00

64. 2.08x104 1.86x104 (89.42%) 1.62x104 (77.89%) 1.12x104 (53.84%) 9.2x103 (44.23%) 6.7x103 (32.21%) 3.8x103 (18.26%) 00

82. 3.44x104 3.12x104 (90.69%) 2.78x104 (80.81%) 1.8x104 (52.32%) 1.52x104 (44.18%) 1.02x104 (29.65%) 6.1x103 (17.73%) 00

95. 1.88x104 1.75x104 (93.08%) 1.48x104 (78.72%) 9.6x103 (51.06%) 8.1x103 (43.08%) 5.9x103 (31.38%) 3.3x103 (17.55%) 00

107. 9.2x103 8.4x103 (91.30%) 7.4x103 (80.43%) 4.9x103 (53.26%) 4.1x103 (44.56%) 2.9x103 (31.52%) 1.6x103 (17.39%) 00

119. 4.8x103 4.3x103 (89.58%) 3.8x103 (79.16%) 2.6x103 (54.16%) 2.1x103 (43.75%) 1.4x103 (29.16%) 0.8x102 (16.66%) 00

127. 2.8x104 2.59x104 (92.50%) 2.26x104 (80.71%) 1.48x104 (52.85%) 1.24x104 (44.28%) 8.2x103 (29.28%) 5.7x103 (20.35%) 00

Aver

age

% 100% 91.52% 79.84% 53.42% 44.40% 30.44% 18.56% 0%

95

Table 4.10: Effect of U.V light on the activity of phages

Sample

no.

PFU/ml ( at 10-1 dilution) at various time intervals and Percentage

with respect to control

00 min 01 min 03 min 05 min

1. 2.6x104 7.2 x103 (27.69%) 2.8 x103 (10.76%) 00

6. 2.52 x104 6.8 x103 (26.98%) 2.4 x103 (9.52%) 00

11. 5.6 x103 1.6 x103 (28.57%) 00 00

13. 2.64 x104 7.6 x103 (28.78%) 2.7 x103 (10.22%) 00

16. 2.96 x104 8.0 x103 (27.02%) 3.2 x103 (10.81%) 00

18. 1.08 x104 3.2 x103 (29.62%) 1.1 x103 (10.18%) 00

23. 2.08 x104 5.6 x103 (26.92%) 2.3 x103 (11.05%) 00

26. 2.4 x104 6.4 x103 (26.66%) 2.6 x103 (10.83%) 00

29. 1.92 x104 5.2 x103 (27.08%) 2.1 x103 (10.93%) 00

31. 1.52 x104 4.0 x103 (26.31%) 1.6 x103 (10.52%) 00

33. 1.68 x104 4.8 x103 (28.57%) 1.8 x103 (10.71%) 00

42. 2.72 x104 7.6 x103 (27.94%) 2.9 x103 (10.66%) 00

51. 1.96 x104 5.6 x103 (28.57%) 2.1 x103 (10.71%) 00

53. 2.56 x104 7.2 x103 (28.12%) 2.8 x103 (10.93%) 00

55. 2.88 x104 8.4 x103 (29.16%) 3.1 x103 (10.76%) 00

58. 2.48 x104 6.8 x103 (27.41%) 2.7 x103 (10.88%) 00

64. 2.08 x104 6.0 x103 (28.84%) 2.1 x103 (10.09%) 00

82. 3.44 x104 9.6 x103 (27.90%) 3.8 x103 (11.04%) 00

95. 1.88 x104 5.2 x103 (27.65%) 2.0 x103 (10.63%) 00

107. 9.2 x103 2.4 x103 (26.08%) 1.1 x103 (11.95%) 00

119. 4.8 x103 1.3 x103 (27.08%) 00 00

127. 2.8 x104 7.8 x103 (27.85%) 3.1 x103 (11.07%) 00

Average

% 100% 27.76% 9.73% 0.00%

96

Table 4.11: Effect of SDS (1%) on the activity of phages

Sample

no.




1. 2.6x104 9.3 x103 (35.76%) 3.3 x103 (12.69%) 00

6. 2.52 x104 8.7 x103 (34.52%) 3.1 x103 (12.30%) 00

11. 5.6 x103 1.9 x103 (33.92%) 0.5 x102 (8.92%) 00

13. 2.64 x104 9.5 x103 (95.98%) 3.0 x103 (11.36%) 00

16. 2.96 x104 1.09 x104 (36.82%) 4.1 x103 (13.85%) 00

18. 1.08 x104 3.7 x103 (34.25%) 00 00

23. 2.08 x104 7.4 x103 (35.57%) 2.5 x103 (12.01%) 00

26. 2.4 x104 8.5 x103 (35.41%) 2.3 x103 (9.58%) 00

29. 1.92 x104 7.3 x103 (38.02%) 1.9 x103 (9.89%) 00

31. 1.52 x104 5.6 x103 (36.84%) 2.2 x103 (14.47%) 00

33. 1.68 x104 5.8 x103 (34.52%) 1.7 x103 (10.11%) 00

42. 2.72 x104 9.7 x103 (35.66%) 3.7 x103 (13.60%) 00

51. 1.96 x104 6.9 x103 (35.20%) 2.3 x103 (11.73%) 00

53. 2.56 x104 9.4 x103 (36.71%) 2.9 x103 (11.32%) 00

55. 2.88 x104 1.07 x104 (37.15%) 3.0 x103 (10.41%) 00

58. 2.48 x104 8.6 x103 (34.67%) 3.3 x103 (13.30%) 00

64. 2.08 x104 7.3 x103 (35.09%) 2.6 x103 (12.50%) 00

82. 3.44 x104 1.19 x104 (34.59%) 3.7 x103 (10.75%) 00

95. 1.88 x104 6.7 x103 (35.63%) 1.8 x103 (9.57%) 00

107. 9.2 x103 3.3 x103 (35.86%) 1.1 x103 (11.95%) 00

119. 4.8 x103 1.5 x103 (31.25%) 00 00

127. 2.8 x104 1.04 x104 (37.14%) 3.8 x103 (13.57%) 00

Average

% 100% 35.48% 10.63% 0.00%

97

Table 4.12: Effect of SDS (0.1%) on the activity of phages

Sample

no.




1. 2.6x104 1.23 x104 (47.31%) 6.1 x103 (23.46%) 00

6. 2.52 x104 1.18 x104 (46.82%) 5.9 x103 (23.41%) 00

11. 5.6 x103 2.6 x103 (46.43%) 1.2 x103 (21.42%) 00

13. 2.64 x104 1.27 x104 (48.10%) 6.5 x103 (24.62%) 00

16. 2.96 x104 1.46 x104 (49.32%) 7.5 x103 (25.33%) 00

18. 1.08 x104 5.1 x103 (47.22%) 2.6 x103 (24.07%) 00

23. 2.08 x104 1.03 x104 (49.51%) 4.9 x103 (23.56%) 00

26. 2.4 x104 1.22 x104 (50.83%) 6.2 x103 (25.83%) 00

29. 1.92 x104 8.9 x103 (46.35%) 4.5 x103 (23.44%) 00

31. 1.52 x104 7.5 x103 (49.34%) 3.7 x103 (24.34%) 00

33. 1.68 x104 8.0 x103 (47.61%) 4.3 x103 (25.59%) 00

42. 2.72 x104 1.39 x104 (51.10%) 6.4 x103 (23.52%) 00

51. 1.96 x104 9.4 x103 (47.95%) 4.5 x103 (22.95%) 00

53. 2.56 x104 1.24 x104 (48.43%) 6.3 x103 (24.60%) 00

55. 2.88 x104 1.43 x104 (49.65%) 6.8 x103 (23.61%) 00

58. 2.48 x104 1.15 x104 (46.37%) 6.3 x103 (25.40%) 00

64. 2.08 x104 1.01 x104 (48.56%) 4.8 x103 (23.07%) 00

82. 3.44 x104 1.78 x104 (51.74%) 9.0 x103 (26.16%) 00

95. 1.88 x104 8.9 x103 (47.34%) 4.4 x103 (23.40%) 00

107. 9.2 x103 4.5 x103 (48.91%) 2.1 x103 (22.82%) 00

119. 4.8 x103 2.3 x103 (47.91%) 1.1 x103 (22.91%) 00

127. 2.8 x104 1.39 x104 (49.64%) 6.9 x103 (24.64%) 00

Average

% 100% 46.29% 24.01% 0.00%

98

Table 4.13: Effect of phenol (1%) on the activity of phages

Sample

no.




1. 2.6x104 1.57 x104 (60.38%) 5.9 x103 (22.69%) 00

6. 2.52 x104 1.55 x104 (61.50%) 5.5 x103 (21.52%) 00

11. 5.6 x103 3.5 x103 (62.50%) 1.3 x103 (23.21%) 00

13. 2.64 x104 1.61 x104 (60.98%) 5.8 x103 (21.96%) 00

16. 2.96 x104 1.86 x104 (62.83%) 6.9 x103 (23.31%) 00

18. 1.08 x104 6.5 x103 (60.18%) 2.5 x103 (23.14%) 00

23. 2.08 x104 1.24 x104 (59.61%) 4.7 x103 (22.59%) 00

26. 2.4 x104 1.48 x104 (61.66%) 5.1 x103 (21.25%) 00

29. 1.92 x104 1.21 x104 (63.02%) 4.0 x103 (20.83%) 00

31. 1.52 x104 9.1 x103 (59.86%) 3.5 x103 (23.02%) 00

33. 1.68 x104 1.03 x104 (61.30%) 3.7 x103 (22.02%) 00

42. 2.72 x104 1.63 x104 (59.92%) 5.8 x103 (21.32%) 00

51. 1.96 x104 1.2 x104 (61.22%) 4.6 x103 (23.46%) 00

53. 2.56 x104 1.58 x104 (61.71%) 5.6 x103 (21.87%) 00

55. 2.88 x104 1.72 x104 (59.72%) 6.5 x103 (22.56%) 00

58. 2.48 x104 1.51 x104 (60.88%) 5.5 x103 (22.17%) 00

64. 2.08 x104 1.3 x104 (62.50%) 4.3 x103 (20.67%) 00

82. 3.44 x104 2.13 x104 (61.92%) 7.8 x103 (22.67%) 00

95. 1.88 x104 1.16 x104 (61.70%) 4.1 x103 (21.80%) 00

107. 9.2 x103 5.5 x103 (59.78%) 1.9 x103 (20.65%) 00

119. 4.8 x103 2.9 x103 (60.41%) 1.0 x103 (20.83%) 00

127. 2.8 x104 1.73 x104 (61.78%) 6.1 x103 (21.78%) 00

Average

% 100% 61.15% 21.15% 0.00%

99

Table 4.14: Effect of phenol (5%) on the activity of phages

Sample

no.



00 min 10 min 15 min

1. 2.6x104 8.9 x103 (34.23%) 00

6. 2.52 x104 8.2 x103 (32.53%) 00

11. 5.6 x103 1.8 x103 (32.14%) 00

13. 2.64 x104 8.9 x103 (33.71%) 00

16. 2.96 x104 1.03 x104 (34.79%) 00

18. 1.08 x104 3.5 x103 (32.40%) 00

23. 2.08 x104 6.5 x103 (31.25%) 00

26. 2.4 x104 8.2 x103 (34.16%) 00

29. 1.92 x104 6.3 x103 (32.81%) 00

31. 1.52 x104 4.8 x103 (31.57%) 00

33. 1.68 x104 5.9 x103 (35.11%) 00

42. 2.72 x104 8.8 x103 (32.35%) 00

51. 1.96 x104 6.7 x103 (34.18%) 00

53. 2.56 x104 8.1 x103 (31.64%) 00

55. 2.88 x104 9.4 x103 (32.63%) 00

58. 2.48 x104 8.6 x103 (34.67%) 00

64. 2.08 x104 6.4 x103 (30.76%) 00

82. 3.44 x104 1.16 x104 (33.72%) 00

95. 1.88 x104 5.9 x103 (31.38%) 00

107. 9.2 x103 3.0 x103 (32.60%) 00

119. 4.8 x103 1.5 x103 (31.25%) 00

127. 2.8 x104 9.5 x103 (33.92%) 00

Average

% 100% 32.90% 0.00%

100

Table 4.15: Effect of chloroform (5%) on the activity of phages

Sample

no.




1. 2.6x104 1.77 x104 (68.07%) 7.3 x103 (28.07%) 00

6. 2.52 x104 1.7 x104 (67.46%) 6.7 x103 (26.58%) 00

11. 5.6 x103 3.8 x103 (67.85%) 1.5 x103 (26.78%) 00

13. 2.64 x104 1.84 x104 (69.70%) 7.8 x103 (29.54%) 00

16. 2.96 x104 1.99 x104 (67.22%) 8.3 x103 (28.04%) 00

18. 1.08 x104 7.5 x103 (69.44%) 2.9 x103 (26.85%) 00

23. 2.08 x104 1.43 x104 (68.75%) 6.0 x103 (28.84%) 00

26. 2.4 x104 1.64 x104 (68.33%) 7.1 x103 (29.58%) 00

29. 1.92 x104 1.29 x104 (67.18%) 5.3 x103 (27.60%) 00

31. 1.52 x104 1.04 x104 (68.42%) 4.5 x103 (29.60%) 00

33. 1.68 x104 1.13 x104 (67.26%) 4.9 x103 (29.16%) 00

42. 2.72 x104 1.83 x104 (67.28%) 8.2 x103 (30.14%) 00

51. 1.96 x104 1.36 x104 (69.38%) 5.6 x103 (28.57%) 00

53. 2.56 x104 1.79 x104 (69.92%) 7.8 x103 (30.46%) 00

55. 2.88 x104 1.96 x104 (68.05%) 7.8 x103 (27.08%) 00

58. 2.48 x104 1.74 x104 (70.16%) 7.1 x103 (28.62%) 00

64. 2.08 x104 1.41 x104 (67.78%) 6.0 x103 (28.84%) 00

82. 3.44 x104 2.38 x104 (69.18%) 1.04 x104 (30.23%) 00

95. 1.88 x104 1.27 x104 (67.55%) 5.5 x103 (29.25%) 00

107. 9.2 x103 6.4 x103 (69.56%) 2.5 x103 (27.17%) 00

119. 4.8 x103 3.3 x103 (68.75%) 1.3 x103 (27.085%) 00

127. 2.8 x104 1.95 x104 (69.64%) 8.3 x103 (29.64%) 00

Average

% 100% 68.49% 28.56% 0.00%

101

Table 4.16: Effect of chloroform (10%) on the activity of phages

Sample

no.



00 min 01 min 03 min

1. 2.6x104 9.4 x103 (36.15%) 00

6. 2.52 x104 9.4 x103 (37.30%) 00

11. 5.6 x103 2.0 x103 (35.71%) 00

13. 2.64 x104 9.8 x103 (37.12%) 00

16. 2.96 x104 1.13 x104 (38.17%) 00

18. 1.08 x104 4.0 x103 (37.03%) 00

23. 2.08 x104 8.0 x103 (38.46%) 00

26. 2.4 x104 8.9 x103 (37.08%) 00

29. 1.92 x104 7.0 x103 (36.45%) 00

31. 1.52 x104 5.6 x103 (36.84%) 00

33. 1.68 x104 6.2 x103 (36.90%) 00

42. 2.72 x104 1.05 x104 (38.60%) 00

51. 1.96 x104 7.3 x103 (37.24%) 00

53. 2.56 x104 9.9 x103 (38.67%) 00

55. 2.88 x104 1.09 x104 (37.84%) 00

58. 2.48 x104 9.4 x103 (37.90%) 00

64. 2.08 x104 7.6 x103 (36.53%) 00

82. 3.44 x104 1.31 x104 (38.08%) 00

95. 1.88 x104 7.1 x103 (37.76%) 00

107. 9.2 x103 3.5 x103 (38.04%) 00

119. 4.8 x103 1.7 x103 (35.41%) 00

127. 2.8 x104 1.06 x104 (37.85%) 00

Average

% 100% 37.32% 0.00%

102

Table 4.17: Effect of formalin (40%) on the activity of phages

Sample

no.




1. 2.6x104 1.33 x104 (51.15%) 5.3 x103 (20.38%) 00

6. 2.52 x104 1.24 x104 (49.20%) 5.4 x103 (21.42%) 00

11. 5.6 x103 2.9 x103 (51.78%) 1.0 x103 (17.85%) 00

13. 2.64 x104 1.37 x104 (51.89%) 5.2 x103 (19.69%) 00

16. 2.96 x104 1.55 x104 (52.36%) 5.6 x103 (18.91%) 00

18. 1.08 x104 5.2 x103 (48.14%) 2.2 x103 (20.37%) 00

23. 2.08 x104 1.05 x104 (50.48%) 3.9 x103 (18.75%) 00

26. 2.4 x104 1.18 x104 (49.16%) 4.7 x103 (19.58%) 00

29. 1.92 x104 1.01 x104 (52.60%) 3.8 x103 (19.79%) 00

31. 1.52 x104 7.7 x103 (50.65%) 3.1 x103 (20.39%) 00

33. 1.68 x104 8.7 x103 (51.78%) 3.7 x103 (22.02%) 00

42. 2.72 x104 1.41 x104 (51.83%) 5.9 x103 (21.69%) 00

51. 1.96 x104 9.7 x103 (49.48%) 4.0 x103 (20.41%) 00

53. 2.56 x104 1.3 x104 (50.78%) 4.9 x103 (19.14%) 00

55. 2.88 x104 1.49 x104 (51.73%) 5.2 x103 (18.05%) 00

58. 2.48 x104 1.3 x104 (52.41%) 4.5 x103 (18.14%) 00

64. 2.08 x104 1.01 x104 (48.55%) 4.3 x103 (20.67%) 00

82. 3.44 x104 1.78 x104 (51.74%) 7.4 x103 (21.51%) 00

95. 1.88 x104 9.1 x103 (48.40%) 4.1 x103 (21.80%) 00

107. 9.2 x103 4.7 x103 (51.08%) 1.6 x103 (17.39%) 00

119. 4.8 x103 2.3 x103 (47.91%) 1.0 x103 (20.83%) 00

127. 2.8 x104 1.46 x104 (52.14%) 6.1 x103 (21.78%) 00

Average

% 100% 50.69% 20.02% 0.00%

104

Fig. 19: Effecct of heat on the activity of bacteriophages (%)

100%

94.19%

87.62%

61.72%

43.51%

21.34%

9.53%

0.00%

100%

46.10%

6.79%

0.61% 0.00% 0.00% 0.00% 0.00%0%

20%

40%

60%

80%

100%

120%

0 5 10 15 30 60 120 180

PE

RC

EN

TA

GE

MINUTES

40C 60C

105

Fig. 20: Effecct of sunlight on the activity of bacteriophages (%)

Fig. 21: Effect of UV light on the activity of bacteriophages (%)

100%

91.52%

79.84%

53.42%

44.40%

30.44%

18.56%

0.00%0%

20%

40%

60%

80%

100%

120%

0 5 10 15 30 60 120 180

PE

RC

EN

TA

GE

MINUTES

100%

27.76%

9.73%

0.00% 0.00% 0.00% 0.00%0%

20%

40%

60%

80%

100%

120%

0 1 3 5 10 15 30

PE

RC

EN

TA

GE

MINUTES

106

Fig. 22: Effect of SDS on the activity of bacteriophages (%)

Fig. 23: Effect of Phenol on the activity of bacteriophages (%)

100%

35.48%

10.63%

0.00% 0.00% 0.00%

100%

46.29%

24.01%

0.00% 0.00% 0.00%0%

20%

40%

60%

80%

100%

120%

0 5 10 15 30 60

PE

RC

EN

TA

GE

MINUTES

1% SDS 0.1% SDS

100%

61.15%

21.15%

0.00% 0.00%

100%

32.90%

0.00% 0.00% 0.00%0%

20%

40%

60%

80%

100%

120%

0 10 15 30 60

PE

RC

EN

TA

GE

MINUTES

1% Phenol 5% Phenol

107

Fig. 24: Effect of Chloroform on the activity of bacteriophages (%)

Fig. 25: Effect of Formalin on the activity of bacteriophages (%)

100%

68.49%

28.56%

0.00% 0.00% 0.00% 0.00%

100%

37.32%

0.00% 0.00% 0.00% 0.00% 0.00%0%

20%

40%

60%

80%

100%

120%

0 1 3 5 10 15 30

PE

RC

EN

TA

GE

MINUTES

5% Chloroform 10% Chloroform

100%

50.69%

20.02%

0.00% 0.00%0%

20%

40%

60%

80%

100%

120%

0 5 10 15 30

PE

RC

EN

TA

GE

MINUTES

108

4.9. Restriction Endonuclease digestion analysis

Phages appear to have similar profiles of the nucleic acid fragments generated

by digestion of their DNA with EcoRI. The patterns for those enzyme cleaved products

are shown in Fig. 26.

109

4.10. Morphological characterization of phages by SEM

The SEM observations of phage revealed that the phage had icosahedral head with

short tail (fig. 27). It was found that based on morphology the phage exhibited non-

contractile tail and belong to the order Caudovirales and family Podoviridae.

4.11. Activity of bacteriophages against target bacteria

The invitro experiment was carried out to know the lytic activity of bacteriophages

on E. coli isolated from different sewage samples. Sewage samples were inoculated with

their specific isolated phages, incubated and analysed at every five hours interval. The

results showed that there was a 100% reduction in the E. coli count after 10 h of incubation

(Table. 4.18).

Table 4.18: Activity of bacteriophages against E. coli isolated from sewage samples

Sample

No.

Escherichia coli count at

0 h 5 h 10 h 15 h

T1 T2 T1 T2 T1 T2 T1 T2

1. 13 21 141 14 211 00 65 00

6. 11 18 138 13 189 00 56 00

11. 7 11 82 8 122 00 29 00

13. 12 19 143 17 204 00 65 00

16. 15 24 169 19 275 00 73 00

18. 11 20 116 12 201 00 62 00

23. 13 19 137 13 228 00 67 00

26. 12 21 134 14 212 00 65 00

29. 8 12 94 11 145 00 38 00

31. 11 21 131 13 195 00 53 00

33. 9 17 102 11 156 00 49 00

42. 14 23 159 21 247 00 68 00

51. 15 27 163 27 286 00 79 00

53. 9 14 98 13 165 00 48 00

55. 12 23 139 17 217 00 71 00

58. 8 15 91 12 142 00 41 00

64. 7 13 75 9 121 00 37 00

82. 7 16 71 10 128 00 29 00

95. 13 26 146 16 236 00 59 00

107. 11 16 118 13 193 00 51 00

119. 15 29 171 31 267 00 81 00

127. 10 14 109 11 183 00 52 00

111

CHAPTER V

DISCUSSION

Escherichia coli is one of the common microbial flora of gastrointestinal tract of

animals and human beings but may become pathogenic to both. Although most isolates

of E. coli are non-pathogenic but they are considered as indicator of faecal contamination

in food and about 10 to 15% of intestinal coliforms are opportunistic and pathogenic

serotypes (Barnes and Gross 1997) and cause a variety of lesions in immunocompromised

hosts as well as in animals and other healthy human beings. Among the diseases some are

often severe and sometimes lethal infections such as meningitis, endocarditis, urinary

tract infection, septicaemia, epidemic diarrhoea of adults and children (Daini et al. 2005).

The World Health Organization estimates that 5 million children die each year as

a consequence of acute diarrhoea (Snyder and Merson, 1982). Escherichia coli is the

cause of a third of cases of childhood diarrhoea in developing and threshold countries

(Albert et al. 1995) and is also the most prominent cause of diarrhoea in travellers to

developing countries (Black, 1990). E. coli is also prominently associated with diarrhoea

in pet and farm animals. Due to its malleable genetic character, E. coli has one of the

widest spectra of disease of any bacterial species (Donnenberg, 2002). The recent

emergence of E. coli O157 as a major food pathogen is a lively reminder of its dynamic

character. Furthermore, Shigella species, the cause of dysentery, taxonomically constitute

a subspecies of E. coli. In addition, effective treatment and prevention measures are

lacking for E. coli diarrhoea. The mainstay of treatment is oral rehydration (Bhan et al.

1994). This simple and inexpensive measure has saved countless lives, but it does not

influence the natural course of disease and has no intrinsic antibacterial activity.

Antibiotic use is of doubtful value since resistance is widespread in E. coli, and vaccines

are still in the early development phase (Savarino et al. 2002). Water and sanitation

112

programmes could improve the quality of drinking water, but are prohibitively expensive

for many developing countries.

Furthermore, there are good historical reasons to single out E. coli diarrhoea for

phage therapy. As early as 1919, Felix d’Herelle, the co-discoverer of phages, advocated

their use for the treatment of bacterial diarrhoea (Summers, 1999, 2001). American

pharmaceutical companies sold phage-based therapy in the 1930s (Duckworth, 1999).

During World War II the German and Soviet armies used phages against dysentery and

the US army conducted classified research on it (Hausler, 2003). After the war the Eliava

Phage Institute in Tbilisi, Georgia, conducted a well-designed field study in the 1960s

that came close to the standards of a placebo-controlled clinical trial (Babalova et al.

1968). More recently, British scientists reported on the successful veterinary application

of E. coli phages in the 1980s (Smith and Huggins, 1982) and phage therapy is now back

in the headlines (Merril et al. 2003).

5.1. Polymerase chain reaction (PCR)

Several workers have used PCR with varied success for detection of STEC from

food and faecal samples using specific gene primers for targeting. Of the specific gene

sequences stx1, stx2, eaeA and hlyA genes have been most frequently targeted for PCR

based detection of STEC. In present study the stx1 and stx2 genes have been designated

as specific genes for shiga toxins, eaeA for intimin and hlyA for enterohaemolysins for

detection of STEC.

STEC strains have been found to produce a family of related cytotoxins known as

Shiga toxins (stxs), classified into two major classes, shiga toxin 1 and shiga toxin 2 coded

by stx1 and stx2 genes respectively. Members of the stx family are compound toxins

comprising a single catalytic 32 kDa A-subunit and a multimeric B-subunit that is

113

involved in the binding of the toxin to the specific glycolipid receptors on the surface of

the target cell (Fratamico and Bagi, 2012).

The ability to adhere to intestinal epithelial cells and to colonize the human

gut is undoubtedly one of the key determinants of virulence. It has been known for a

decade that certain strains of STEC are capable of causing attaching and effacing (AE)

lesion on enterocytes. Production of AE lesion is a multistep event initiated by adherence

of bacteria to the microvilli, transduction of a signal into enterocytes, which is followed

by aggregation of the cytoskeletal actin with effacement of microvilli leading to intimate

attachment of the bacteria to the cell surface. The formation of this AE lesion is mediated

by secreted and surface-arrayed bacterial proteins encoded by a pathogenicity island

called the locus for enterocyte effacement (LEE). LEE, which is inserted at 82 min in the

E. coli chromosome, includes the eaeA gene that encodes intimin, a 939-amino acid (outer

membrane) protein which mediates intimate attachment of the bacterium to the

enterocyte. (Momtaz et al. 2012).

Escherichia coli isolates of serogroups O157, O26 and O111 commonly produce

Ehx and it is therefore a useful epidemiological marker for potential stx-producing strains.

Scotland et al. (1990) showed that there was good correlation between Ehx production

and hybridization with the CVD419 probe and suggested that Ehx may be encoded on the

large plasmid (pO157) carried by many E. coli O157. A plasmid location for the toxin

was confirmed by Schmidt et al. (1994), and later studies have shown that the CVD419

probe hybridizes with part of the Ehx structural gene hlyA (Schmidt et al.1995). The

manner in which E-hly may contribute to the pathogenesis of EHEC disease is possibly

that haemoglobin released by the action of the haemolysin provides a source of iron.

For the detection of STEC, techniques have been developed to identify the stx1 and

stx2 which encodes shiga toxins, eaeA encodes intimin and hlyA genetic determinant that

encodes for enterohaemolysin. These assays utilize PCR techniques. PCR is generally

114

considered to be the most sensitive means of determining whether a faecal specimen or a

food sample contains STEC. Although direct extracts of faeces or foods can be used as

templates for PCR but the best results are usually obtained by testing extracts of primary

broth cultures (Cerqueira et al., 1999; Elder et al., 2000). Broth enrichment serves two

purposes: inhibitors in the sample are diluted and bacterial growth increase the number

of copies of the target sequence. Sensitivity is important when testing faecal samples,

because although STEC numbers may be very high in the early stages of infection, they

may drop dramatically as disease progresses. Sensitivity is also particularly important

when testing in suspected foods, at least for certain O111 and O157 STEC strains. Some

of the PCR assays for detection of STEC described to date use single pairs of primers

based on consensus sequences, which are capable of amplifying all stx-related gens. PCR

has also been used for the detection of genes encoding accessory STEC virulence factors

such as stx1, stx2, eae by Kobori et al. (2004). Similarly Kumar et al. (2004), Paton and

Paton (2005), Cho et al. (2006), Bhat et al. (2008), Dhanashree and Mallya (2008), El-

El-Jakee et al. (2009), Bonyadian et al. (2010), Sahilah et al. (2010), Bosilevac and

Koohmaraie (2011), Dutta et al. (2011), Botkin et al. (2012), Dastmalchi saei and

Ayremlon (2012), Virpari et al. (2013), Bakshi et al. (2014), Rasheed et al. (2014), Son

et al. (2014), Sudershan et al. (2014), Neher et al. (2016) and Panahee and Pourtaghi

(2016) utilized the PCR technique for the detection of STEC from water, food and faecal

samples and to detect stx1, stx2, eaeA and hlyA genes which encodes for shiga toxin,

intimin and enterohaemolysin production by STEC.

5.1.1. Standardization of PCR assay

The PCR procedure using stx1, stx2, eaeA and hlyA derived primers were

standardized by optimizing the annealing temperature, primer concentration, MgCl2

concentration, template volume and cyclic conditions. The specific PCR product of 180

bp for stx1, 255 bp for stx2, 384 bp for eaeA and 534 bp for hlyA were stored at -200C, as

115

it was observed that storage at a temperature of 40C for a longer period resulted in the

degradation of the product.

5.1.2. Detection of Shiga toxin Producing Escherichia coli by PCR:

Nucleic acid amplification by PCR has applications in many fields of biology and

medicine including the detection of viruses, bacteria and other infectious agents (Thiele

et al. 1990). In the present study, a oligonucleotide primer set was used which encodes

the Shiga toxins, intimin and enterohaemolysins produced by E.coli. Primers were

selected on the basis of published nucleotide sequence of the 180 bp for stx1, 255 bp for

stx2, 384 bp for eaeA and 534 bp for hlyA genes (Paton and Paton., 1998).

In the present investigation, only one E. coli isolated from the sewage water from

organized dairy farms in and around Tirupati (Table.4.7) exhibited stx1 (3.57%) gene

whereas all the remaining 27 isolates were negative for any of the genes that determines

STEC. E. coli isolated from the sewage water of unorganized dairy farms in and around

Tirupati revealed that out of 32 isolates only one isolate exhibited stx1 (3.13%) gene ,

where as another isolate was positive for a combination of stx1, stx2 and eaeA genes

(3.13%). The E. coli isolated from the sewage water of various animal sheds in and around

Tirupati exhibited stx1 and stx2 individually and also in combination. Among the 68 E.

coli isolates from various animal sheds three isolates have carries stx1 gene, four isolates

exhibited stx2 gene and one isolate has shown a combination of stx1 and stx2.

In the present investigation, it is clear that pathogenesis of STEC is multifactorial

and involves several virulence attributes of the organism. Rapid and sensitive methods

for detection of STEC are now in force; especially there has been advance in PCR

technology, which has increased the speed and has made it possible to quantitate the

number of STEC organisms present in a suspected sample. These results substantiate

those obtained by other methodological approaches followed by Ram et al. (2007), who

reported that 30% of the E. coli isolates from river Ganga water sources contained either

116

stx1 or stx2. Halabi et al. (2008) reported that only one E. coli isolate was found to contain

stx in the rural area of Austin. Ram et al. (2007), reported that stx genes were present in

22.7% of E. coli isolates obtained from the river Ganga. Duris et al. (2009) reported that

greater than 50% of faecal coliform isolates tested positive for stx2 DNA in river water

in Maryland. Waste water has been attributed to pollution of recreation and drinking water

in specific cases (Lienemann, et al. 2011), the general efflux of these to a water supply

remains unknown, especially in cases where water treatment facilities are in effect. Given

the ability of stx2-encoding phages to persist under thermal stress and chlorination, the

chronic release of these types of microbes to aquatic environments from wastewater

remains a possibility (Muniesa et al., 1999). However, attempts to relate stx gene or stx-

producing organism presence to indicators of wastewater or faecal pollution have failed

to show a correlation in many cases (Smith et al., 2009, Walters et al., 2011 and Haack

et al., 2009). This suggests that other factors besides general wastewater efflux explain

the presence of microbes harbouring or expressing stx in aquatic environments. These

limited studies set a wide range for which to compare stx distribution and abundance in

other waste water systems, will give information, which is important to know the

prevalence of stx-dependent illness arising from contamination of drinking water both in

animals and human beings.

In India, various studies conducted have found very little occurrence of STEC in

waste water, animals and humans. It is not clear that why the incidence of STEC is low

in India and other developing countries, despite having all the reservoirs and STEC in the

food chain. Some researchers have argued that under reporting of the incidence is the

cause, whereas other showed that due to the presence of pre-existing stx1, IgG antibodies

in asymptomatic cases offers positive protection against STEC infection (Karmali, 1989).

But the frequent isolation of STEC strains from non-human sources like animals, food

and other products along with the identification of multidrug resistance and virulence

117

genes across the Indian subcontinent poses a serious threat of the outbreaks that can occur

in the future.

5.2. Antibiotic resistant pattern of Escherichia coli by disc diffusion method:

Antibiotics are extensively used as growth promoters in livestock production or

to control infectious diseases. Anti-microbial abuse is considered to be the most vital

selecting force to antimicrobial resistance of bacteria. Moreover, antibiotic treatment is

considered the most important issue that promotes the emergence, selection and spreading

of antibiotic-resistant microorganisms in both veterinary and human medicine. It was

stated by well-established evidence that antibiotics can lead to the emergence and

dissemination of antibiotic resistant E. coli which can then be passed into people via food

or direct contact with infected animals. These resistant microbes may function as a

potential source in the transportation of antimicrobial resistance to human pathogens

E.coli isolated in this study was highly resistant to ampicillin (92.19%). The

results are comparable with Atere et al. (2015), who observed 89.6% of resistance to

ampicillin by the E. coli isolates, Niranjan and Malini (2014) observed 88.4% of

resistance to ampicillin by the E.coli isolates and Habrun et al. (2010) also observed the

antimicrobial sensitivity of E. coli isolated from the different organs of pigs in breeding

farm and they reported that 85% isolates were resistant to ampicillin, Vinita et al.(2010)

reported 94.29% of E.coli isolates were resistant to ampicillin, Anago et al. (2015)

observed 97.6% of resistance to ampicillin whereas Arabi and Banazadehi (2013)

observed the antibiotic resistance pattern of E. coli isolated from the urinary tract infected

patients and their results showed that 100% of isolates were resistance to ampicillin,

El-Rahman et al. (2015) also reported 100% resistance of E.coli isolates to ampicillin. A

little lesser resistance to ampicillin than in the present investigation was observed by

Nitika et al. (2014) and Mustika et al. (2015) who reported 81.4 % and 80.0%

respectively, and in contrast to the results obtained in this study Adenaike et al. (2016),

118

Zinnah et al. (2008), Eryılmaz et al. (2010), Bonnedahl et al. (2015),Melo et al. (2015)

and Aasmae et al. ( 2015), reported 69%, 59%, 56%, 30.1%,20.2% and 4.4% of resistance

among the E.coli isolates to ampicillin respectively.

In the present study 76.56% resistance was observed for penicillin-G and higher

resistance of 100% than the present study was reported by Sabir et al. (2014), Nontongana

et al. (2014), Maloo et al. (2014) and Mustika et al. (2015). Jeyasanta et al. (2012), who

also reported a little higher resistance of 82.41% to penicillin-G whereas low resistance

(63%) was reported by Chandrasekaran et al. (2014).

The E. coli isolates in this study exhibited 39.06% resistance to cefadroxil. Higher

resistance by E. coli isolates for this antibiotic was observed by Khan et al. (2014) who

observed 97.62% of resistance, Kumar et al. (2013) reported 88.52% of resistance, Rahim

et al. (2014) observed 85.71% of resistance and Mishra et al. (2013) observed 58.33% of

resistance to cefadroxil, whereas Bonnedahl et al. (2015)and Sundvall et al. (2014)

analysed the antibiotic resistance pattern of pathogenic E. coli and reported that only

15.1 % and 2.6% of isolates were resistant to cefadroxil respectively.

The resistance to cefotaxime by E. coli isolates was 71.10% in the present study.

Similar to the present investigation Ranjini et al. (2016) reported 71.42% of resistance to

cefotaxime. Very high resistance to cefotaxime was observed by Kumar et al. (2013) who

reported 90.16% of resistance, Arabi and Banazadehi (2013) who found 81.9% of

resistance and Vinita et al.(2010) reported 78.51% of resistance, when compared to the

results obtained in the present investigation. Hussain et al. (2015) observed 67% of

resistance, Raihan et al. (2014) observed 60% of resistance, Ali et al. (2014) reported

58.5% , Manikandan and Amsath (2014) found 58% of resistance, Anago et al. (2015)

reported 56.5% of resistance, Ferdosi et al. (2015) found 45.6% of resistance, El-Rahman

et al. (2015) who observed 40% of resistance, Sohail et al. (2015)found 29.50% of

119

resistance, which are less than the present study. Melo et al. (2015) reported very low

resistance (1.2%) to cefotaxime by E.coli isolates.

E.coli isolates in the present study have shown 51.56 % of resistance to

cefoperazone. Saeed et al. (2009) observed 65.5% of resistance, Mishra et al. (2013)

observed 66.66% of resistance and Ranjini et al. (2016) revealed 75.97% of resistance to

cefoperazone among the E.coli isolates, which are higher than the present study, on the

contrary Sohail et al. (2015) reported only 29.50% resistance, Asati (2013) observed 21%

of resistance and Tanvir et al. (2012) reported 13.2% of resistance by the E. coli isolates

towards cefoperazone.

In the present investigation the E.coli isolates have shown 27.43% of resistance to

the antibiotic meropenem. Similar to these studies a lower resistance to meropenem than

in the present study was observed by Nitika et al. (2014) who reported 25.4% of

resistance, Toroglu et al. (2005) observed 25% of resistance, Tanvir et al. (2012) reported

22.8% resistance and Sohail et al. (2015) reported 1.22% of resistance to meropenem

whereas Mishra et al. (2013) found 41.66% of resistance, Vij et al. (2014) observed

62.7% of resistance and Biswas et al. (2014) who observed 100% resistance to

meropenem by the E.coli isolates, which was considerably higher than the resistance

observed in the present investigation. On contrary Akter et al. (2016) reported zero (0%)

per cent resistance to meropenem by the E.coli isolates.

In the present study 64.06% of resistance was observed for gentamicin by the

isolates. Higher resistance to gentamycin than in the present investigation was observed

by Biswas et al. (2014) who observed 94.11% of resistance, Arabi and Banazadehi (2013)

found 82.5% of resistance, Vinita et al.(2010) reported 70.86% of resistance and Atere

et al. (2015) found a little higher resistance (68.8%) among the E. coli isolates, whereas

Manikandan and Amsath (2014) found 62.5% of resistance which is almost similar to the

present study. Comparatively lower resistance to gentamicin than in the present study was

120

observed by Ranjini et al. (2016) who reported 56.98% of resistance, Anago et al. (2015)

found 45.2% of resistance, Ferdosi et al. (2015) observed 36.8% of resistance, Zinnah et

al. (2008) reported that 32% of resistance, Sohail et al. (2015) revealed that 19.26% of

resistance, Alshara (2010) found 17.3% of resistance, El-Rahman et al. (2015)reported

10% of resistance, Eryulmaz et al. (2010) observed 9% of resistance and Ali et al. (2014)

who reported 5% of resistance among the E.coli isolates to gentamycin whereas 0%

resistance to gentamycin was observed by Akter et al. (2016).

Habrun et al. (2010) observed the antimicrobial sensitivity of E. coli isolated

from the different organs of pigs in breeding farm and reported that 91% of the isolates

were resistance to streptomycin and Stephan and Schumacher (2000) found only 17.07%

of susceptibility to streptomycin, whereas in the present study resistance to streptomycin

was observed only in 64.84% of the isolates. Higher resistance than the isolates of present

investigation was observed by Cergole-Novella et al. (2014) who reported 78.1% of

resistance and Saeed et al. (2009) observed 72.4% of resistance to streptomycin by the

E.coli isolates. Vladimir Pyatov et al. (2014) reported 48.6% resistance, Daniel et

al.(2012) observed 59.0%, whereas very low resistance levels viz. 30.0%, 20%, 11.0%

and 4.4% were reported by Sabir et al. (2014), Mustika et al. (2015), El-Shatoury et al.

(2015) and Aasmae et al. (2015) respectively.

The resistance of ciprofloxacin in the present study was 38.28%. The resistance to

ciprofloxacin in the present investigation was lower than the resistance reported by Anago

et al. (2015), Biswas et al. (2014), Ranjini et al. (2016), Arabi and Banazadehi (2013),

Ohieku and Magaji (2013), Kumar et al. (2013) and Atere et al. (2015) who reported

91.7%, 88.23%, 84.91%, 78%, 58%, 54.10% and 47.9% respectively, whereas lower

resistance of 33.60%, 24.6%, 15%, 14.5%, 10.6%, 10%, 8%, 4.7% and 2.9% was reported

by Sohail et al. (2015), Ferdosi et al. (2015), Eryulmaz et al. (2010), Alshara (2010),

Aminu and David (2015), El-Rahman et al. (2015), Zinnah et al. (2008), Melo et al.

121

(2015) and Aasmae et al. (2015) respectively. On the contrary Raihan et al. (2014),

El-Shatoury et al. (2015) and Adenaike et al. (2016) have showed 0% resistance to

ciprofloxacin by the E. coli isolates.

In the present investigation the E.coli isolates have shown 44.53% of resistance to

ofloxacin. Higher than the resistance that was observed in this study was reported by

Mary and Usha (2013) who observed 97% of resistance, Mishra, et al. (2013) found

83.33% of resistance, Ohieku and Magaji (2013) observed 71% of resistance,

Manikandan and Amsath (2014) observed 64.5% of resistance, Ibrahim et al. (2012)

reported that 55.1% of resistance and Atere et al. (2015) reported 52.1%resistance to

ofloxacin among the E.coli isolates. Whereas very little resistance than in the present

study was observed by Ferdosi et al. (2015) and Oluyege et al. (2015) who reported 8.8%

and 3.9% of resistance respectively.

The antibiotic azithromycin has shown 30.40% of resistance among the E.coli

isolates in the present investigation. Higher resistance to azithromycin by E.coli was

reported by Raihan et al. (2014) who found 100% of resistance, Aminu and David (2015)

observed 76.6% of resistance, Pant et al. (2015) observed 71.0% resistance, Chayani et

al. (2009) have shown 60.37% of resistance, Zinnah et al. (2008) observed 33% of

resistance. Aly et al. (2012) revealed 31% of resistance, which was similar to the present

findings for various clinical samples, whereas Akter et al. (2016) reported only 11.0%

resistance in their E.coli isolates.

In the present investigation chloramphenicol has shown 57.81% of resistance

among the E.coli isolates whereas higher resistance to chloramphenicol by E.coli isolates

was reported by Pant et al. (2015) who reported 70% of resistance and Vinita et al. (2010)

found 61.14% of resistance. Saeed et al. (2009) observed 58.6% of resistance, which was

almost similar to the present findings, whereas Ibrahim, et al.(2012), Melo et al.

122

(2015)and Joshi et al. (2012) reported 22.4%, 4.7% and 0% of resistance respectively,

which are lower than the present study in E.coli isolates of various sources.

The resistance to tetracycline was 54.69% in this study. Adenaike et al. (2016)

reported 54.0% resistance, which is similar to the present findings, whereas lower

resistance of 40.4% and 26% were reported by Aminu and David (2015) and Melo et al.

(2015) respectively. Very low resistance of 7.0% and 2.9% were reported by El-Shatoury

et al. (2015) and Aasmae et al. (2015) respectively. Higher resistance of 100% (Pant et

al., 2015 and Nsofor et al., 2016), 88.2% (Oluyege et al., 2015) 77.1% (Ibrahim et al.,

2012), 69.4% (Sabir et al., 2014) and 60% (Zinnah et al., 2008) than the present study for

the E. coli isolates obtained from different sources.

E.coli isolates in the present study have shown 20.31% of resistance to the antibiotic

tigecycline. Higher resistance than in the present study was observed by Mantzourani et

al. (2015) who found 100% resistance by the E.coli isolates, whereas Ali et al. (2014)

reported only 2.5% of resistance to tigecycline, on the contrary Nandi et al. (2014),

Behera et al. (2009) and Rossi et al. (2008) have reported 100% sensitivity to tigecycline

by the E.coli isolates.

Although it is extremely difficult to explain these conflicting data with regards to

both time and place of study, the variation is probably due to differential clonal expression

and drug pressure in community.

5.3. Isolation of E.coliphage and its characterization:

A total of 128 sewage samples from different organized, unorganized and various

animal sheds located in and around Tirupati were collected and processed for

E.coliphages isolation. A total of twenty two (22) E.coliphages were isolated from 128

sewage samples. E.coliphages were isolated by using tryptic soy agar. The plaques on

secondary streaking on E. coli mat culture gave the clearing zone around the streak lines.

The presence of E.coliphages were further confirmed by spot test where E. coli was grown

123

on nutrient agar and 10µl of isolated bacteriophages against E. coli was spotted on

different areas of nutrient agar plates and the clear zone around the spot was observed.

Shukla and Hirpurkar (2011) studied the presence of bacteriophages in sewage material

of cattle, pig, goat and poultry and isolated the bacteriophages against two most common

environmental bacteria viz.: B.subtilis and E. coli by double agar layer method. Mulani

et al. (2015) worked on host specific phages from environmental samples and found

potential activity of bacteriophages against E. coli using spot test, Mahadevan et al.

(2009) isolated host specific bacteriophages against E. coli from sewage water by using

spot test and Beheshti Maal et al. (2015) isolated two novel bacteriophages against E. coli

SBSWF-27 and E. coli PTCC-1399 by using spot test. Olieveira et al. (2009) isolated five

bacteriophages against E. coli from poultry sewage by using spot test method and

confirmed their presence by double layer technique.

Manjunath et al. (2013) used the sewage sample originated from hospital,

domestic, municipal waste and from the waste water treatment plant and isolated phage

DMEC-1 against the multidrug resistant E. coli by using double agar over layer method

and same method was used to isolate phages specific to E. coli O157 from waste water

treatment plant by Gunathilaka (2014). Sheng et al. (2006) isolated phage SH1 and

reported that phage was highly lytic and formed large clear plaques in all E. coli O157:H7

strains tested.

Jann et al. (1971) isolated bacteriophages against E. coli O8 strains and

Jamalludeen et al. (2009) worked on avian E. coli strains and isolated seven phages

against E. coli serogroups O1, O2 and O78 from wastewater. Calci et al. (1998) found

lytic bacteriophages to E. coli in the faecal samples of cattle, sheep, goat and reported that

sheep and goats have lowest mean density of bacteriophages based on the number of

PFU/gm of faeces.

124

Jensen et al. (1998) used agar overlay technique for the isolation of E. coliphages,

which were lytic against ATCC E. coli AB1157, BHR3, BHR4 and BHR5 and Duraisamy

et al. (2015) found 46 bacteriophages against E. coli by processing 10 hospital effluent

samples by using double agar layer method.

The findings of various scientists mentioned above revealed that spot test and

double agar layer method are the two most commonly used methods for the isolation of

bacteriophages.

5.3.1. Morphological characterization

5.3.1.1. Plaque morphology:

The observed plaques were circular with a diameter of 0.1 to 3mm (Fig. 19).

Similar to the present findings Bach et al. (2003) reported that the phages isolated against

E. coli from faeces were of same size. Various workers have observed varied plaque

diameter varying from (0.1-3.5mm). Pandey et al. (2013) and Calderone and Pickett

(1965) observed clear plaques of brucellaphage of variable size (0.5-3.5 mm) and Morris

and Corbel (1973) observed that the plaques of A422 were clear and varied in diameter

from 0.1 to 2.0 mm whereas the plaques of S708 and M51 were of two types i.e. small,

turbid plaques, 0.1 to 0.5 mm in diameter and large, clear plaques of 0.5 to 2.5 mm in

diameter.

5.3.2. Physical characterization

5.3.2.1. Heat:

The effect of heat on the activity of phage revealed that at 400C phage titre was

gradually decreased within three hours, whereas at 600C temperature treatment

completely inactivated the phage within 30 minutes (Table. 4.10). The results obtained in

this study were similar to the findings of Al-Mola and Al-Yassari (2010), who reported

that the effect of temperature on phage titre was significantly increased at a temperature

of 370C than at 500C and 650C. Allue-Guardia et al. (2012) conducted heat stability test

125

of phages and reported that at 600C there was complete inactivation of phages, Chachra

et al. (2012) subjected the brucellaphages to different temperatures and reported that there

was no growth at 700C and 1000C with in 20 min, Zaman and Arip (2012) characterized

the ability of bacteriophages at temperatures ranging between 100C-800C and reported

that phages were stable in a temperature range of 100C- 300C and became less stable

following exposure to 400C and 500C, Manjunath et al. (2013) examined the stability of

phages at room temperature and 600C and reported that there was 100 fold decrease in

titre at 600C temperature within 15 min and Pandey et al. (2013) reported that the effect

of heat on the activity of phages, were gradually deceased at 400C within three hours and

at 600C temperature, phages were completely inactivated within 10 min. Taj et al. (2014)

worked on the effect of various ranges of temperatures on T4 bacteriophage lytic activity

against E. coli and reported that at a temperature regimes of 400C, 550C and 700C the T4

bacteriophages were completely inactivated.

Temperature is one of the most important environmental factor that strongly

affects many aspects of the biological systems. One of the important characteristic of the

temperature, as environmental factor, is its fluctuation over a wide range of spatial and

temporal scales that makes possible as well as limits existence of life in different niches.

Influence of temperature upon the biological system is very vivid and it has been observed

that evolution of phenotypic traits, species distributions, and extinctions in many cases

can be traced to changes in temperature regimes (Vale et al.2008). Present study results

are in confirmation with the above findings as during the experiment it was observed that

yield of bacteriophage was highly temperature dependent

5.3.2.2. Sunlight:

The effect of sunlight on activity of phage showed that exposure to direct sunlight

gradually decreased the phage concentration and within three hours E.coliphage titre got

reduced. There are two ways that virus inactivation mechanisms occurs in sunlight, one

126

is through absorption of photons by the virus itself (direct and indirect endogenous

inactivation) and the second one is by reaction with reactive species formed by

photosensitizers in the water column (exogenous inactivation). The presence of

photosensitizing molecules decreased the rate of sunlight mediated inactivation of PV3

signaling that inactivation was dominated by endogenous mechanisms (Silverman et al.,

2013). The results obtained in this study were in accordance with Chachra et al. (2012),

who worked on brucellaphages and reported that the survivability of phages was

gradually decreased from 95.8% to 73% over a 90 min. period and Pandey et al. (2013)

described the effect of sunlight on activity of phages and reported that there was a gradual

decrease in phage concentration within 3 h exposure to direct sunlight.

5.3.2.3. UV light:

Exposing the phage to the UV light for five minutes caused complete inactivation

of bacteriophage. Inactivation of faecal coliforms and coliphages was mainly by shorter

wavelengths (UV-B) a result consistent with photobiological damage (Sinton et al.,

2002). The findings of this study were similar to the findings of Allue-Guardia et al.

(2012), who worked on Cdt phages and reported that the phages were very sensitive to

U.V treatment and Chachra et al. (2012) estimated the stability of the phage lysates

towards the UV light and reported that the U.V light killed the phages within the first 15

min of exposure. Pandey et al. (2013) determined the effect of UV light on the activity of

phage and reported that UV light had drastic effect on the phage survivability and also

reported that phages were completely inactivated within three minutes.

5.3.3. CHEMICAL CHARACTERIZATION

5.3.3.1. SDS

The effect of SDS treatment on activity of phage revealed that both 1% and0.1%

concentrations of SDS completely inactivated the phage within 15 minutes at 370C. SDS

is a strong anionic detergent, that can solubilize the proteins and lipids that form the

127

membranes. This will help the cell membranes and nuclear envelops to breakdown and

expose the chromosomes that contain the DNA. The results obtained in this study are

almost similar to the findings obtained by Chachra et al. (2012), who worked on

bacteriophages and reported that complete destruction of the phages was observed within

15 min of exposure to 10% SDS and Pandey et al. (2013) determined the stability of the

brucellaphages by subjecting them to SDS and reported that complete inactivation of

phage was observed within 15 min when exposed to 0.1% SDS

5.3.3.2. Phenol:

The effect of phenol treatment on activity of phage revealed that the phage gets

completely inactivated by 5% phenol within 15 minutes. It suggested that low

concentration exponent is associated with inactivation of the phage by an effect on the

protein coat of the particle and a high concentration exponent with an effect on its internal

structure (Cook and Brown, 1964). Pandey et al. (2013) worked on the activity of

brucellaphages against phenol (5% aqueous) and reported that complete inactivation of

the phages within 15 min, which is almost similar to the present study.

5.3.3.3. Chloroform

The effect of chloroform treatment on activity of phage showed that

10%chloroform completely inactivated the E.coliphages within 5 minutes at 370C. Phage

contain lipids as a structure components of their virions and so detection identity to only

a few families (Bertani and Bertani, 1986). Sands and lowlicht (1976) showed these lipids

are essential for maintaining the virus ability to infect new host. Any disruption of the

lipid components will lead to a loss of viability of the virus, lipids are soluble in non-

polar solvents such as ether and chloroform, which are capable of extracting and

disrupting the lipid components of the phages by interfering with the hydrophobic

interactions between lipid molecules. Non-polar solvents are capable of denaturing

proteins by disrupting the hydrophobic interaction between proteins, which can also lead

128

to a loss of viability (Camerini-Otera and Franklin, 1972).Similar to the findings obtained

in this study Al-Mola and Al-Yassari (2010) determined the sensitivity of phages to

chloroform and reported that chloroform completely inactivated the phage within five

minutes, Pandey et al. (2013) determined the effect of chloroform on the stability of

phages and reported that complete inactivation of phages within five minutes, whereas

Manjunath et al. (2013) reported that there was no decrease in the phage titre in

chloroform treated phages after 4 and 24 h incubated at room temperature.

5.3.3.4. Formalin

Exposure of phage to 40% formalin up to 15 minutes causes complete inactivation

of phages. The destructive action of formalin may be attributed by its alkylation of protein

and nucleic acids (De Benedictis et al., 2007). The results obtained in this study were in

accordance with Pandey et al. (2013), who reported that complete inactivation of phages

within 15 min. when exposed to 40% formalin.

5.3.4. Restriction Endonuclease digestion analysis:

Restriction enzymes such as EcoRI recognizes specific sequences of DNA and

cleaves the phosphodiester bond on each strand at that sequence. After digestion with a

restriction enzyme, the resulted fragments can be separated by agarose gel electrophoresis

and their corresponding sizes can be estimated (Vlab.amrita.edu., 2011). In the present

investigation phages appear to have similar profiles of the nucleic acid fragments

generated by digestion of their DNA with EcoRI.

The findings obtained in this study were in accordance with Goodridge et.al.

(2003), who performed restriction enzyme analysis with four enzymes and confirmed the

phages isolated against Escherichia coli, Jamalludeen et al. (2009) determined the

genome size of isolated phages EC-Nid1 and EC-Nid2 by using Restriction enzymes, Bao

et al. (2011) performed restriction enzyme analysis with EcoRI and Hind III to digest

genomes of the bacteriophages and Jamalludeen (2012) isolated Phages EC-NJ4 and EC-

129

NJ7 against Escherichia coli and also reported that the two phages appears to have similar

profiles of the nucleic acid fragments generated by restriction enzyme digestion.

5.4. In vitro studies to detect the activity of phages against target bacteria:

To detect the activity of phages against target bacteria in vitro studies were

conducted by taking the sewage sample and isolated phages were inoculated in to the

same and the samples were analysed at every five hour interval. The results of this study

revealed that there was complete inhibition of E.coli after 10 hours of incubation. The

results obtained in this study were almost similar to the results obtained by Beheshti Maal

et al. (2015) reported for the first time on invitro isolation and identification of two novel

bacteriophages that have lytic effect on E. coli PTCC1399 and E. coli SBSWF27 strains

as well as coliform population of Isfahan municipal wastewater and further he reported

that there was a 22-fold reduction in coliform load in wastewater with coliphages

incubation for two hours and Mulani et al. (2015) worked on potential activity of

bacteriophages against target bacteria by inoculating bacteriophages in actively growing

host and reported that there was 100% reduction in E. coli and Salmonella count within

nine hours.

The in vitro studies carried out to know the activity of bacteriophages against

E.coli determined that these phages readily killed the target bacteria. So use of

bacteriophages for reducing pathogenic bacteria in sewage along with other standard

methods like primary and secondary treatment could be considered as an effective and

simple alternative for replacement of costly instruments and establishment of the old

wastewater treatment plants (Beheshti Maal et al., 2014). Phage mediated bacterial

mortality has the capacity to influence treatment performance by controlling the

abundance of pathogenic bacteria (Periasamy and Sundaram, 2013). Many wastewater

treatment plants aim for the complete pathogen removal during treatment by using

disinfectants like chlorine which can harm the environment. Hence development of cheap

130

and eco-friendly approaches is necessary. Pathogen specific phages isolated from sewage

have the potential to eliminate the dreadful pathogens (Periasamy and Sundaram, 2013).

131

CHAPTER VI

SUMMARY

Escherichia coli strains are naturally inhabiting in the intestines of a variety of

animals and humans are harmless but some can cause debilitating conditions and

sometimes fatal conditions in humans, mammals and birds. Pathogenic strains are divided

into intestinal pathogens causing diarrhoea and extra-intestinal E. coli causing variety

infections like urinary tract infections (UTI), meningitis and septicaemia. In several

recent outbreaks of gastrointestinal tract diseases, the morbidity and mortality was

associated with shiga toxin producing E. coli (STEC). Human infections associated with

STEC can be variable from a simple or watery diarrhoea to haemorrhagic colitis (HC)

and haemolytic uremic syndrome (HUS). HUS is a life threatening sequelae,

characterized by acute renal failure, thrombocytopenia and microangiopathic haemolytic

anaemia. However, some individuals are experiences neurological symptoms like

convulsions and encephalopathy.

STEC strains produce verocytotoxins or shiga like toxins, encoded by stx1 and

stx2 and are responsible for severe infections in human beings. Several virulence factors

are responsible for pathogenicity of STEC, among them enterohaemolysin and intimin

are important, which are encoded by hlyA and eaeA respectively. Bovines are thought to

be primary reservoir of this pathogen and these pathogens are recovered from faecal

matter of healthy animals also. Animal based foods, which are contaminated with bovine

faecal matter are responsible for food borne infections. The food industry, restaurants and

private homes occasionally fail to meet adequate cooling, storage, preparation and other

hygiene standards and food may be contaminated with faecal flora due to improper

practices of those who prepare the food. The usage of antibiotics in the livestock industry

has been increased from many years that resulted the emergence of antibiotic resistant

132

pathogens. Thus the present study has triggered the efforts in developing alternatives to

the antibiotics and one such alternative is strongly lytic bacteriophages against E.coli.

Bacteriophages have been used in many applications including phage therapy, and

in control of food borne pathogens. The use of bacteriophages for bio-control has many

advantages when compared with other antimicrobial agents including high specificity,

self-replication and stability under different conditions. However, to obtain the more

efficacy phages, must be characterized and applied to different conditions.

A total of 128 samples collected from different sources viz: organized dairy farms

(n=28), unorganized dairy farms (n= 32) and animal sheds (n=68) were used for

Escherichia coli isolation. All the 128 isolates were found Gram negative cocobacillary

rods and confirmed by subjecting them to different biochemical tests. All the 128 isolates

were positive for Indole and Methyl red test whereas negative for Voges-Proskauer and

Citrate utilization tests. Further all the isolates were subjected to TSI test and urease test

and the results revealed that all the isolates produced acid butt, acid slant and also gas in

TSI agar test and no pink colour formation in the urease test. All the biochemical reactions

confirmed the presence of Escherichia coli. For the phenotypic detection of Shiga toxin

producing Escherichia coli all the isolates from different sources were streaked on SMAC

and the results revealed that none of the isolates have shown colourless colonies which is

a characteristic feature of E.coli O157:H7, but a total of 108 isolates have shown pink

colonies.

Antibiogram for E. coli was carried out to know the multidrug resistance of these

pathogens by using 14 antibiotic discs following the standard disc diffusion method.

Among the 128 isolates no isolates, was completely sensitive to any of the antibiotic test

discs used in this study. Maximum resistance was observed for ampicillin (92.19%),

followed by penicillin-G (76.56%), cefotaxime (71.10%), streptomycin (64.84%),

gentamicin (64.06%), chloramphenicol (57.81%),tetracycline (54.69%), cefoperazone

133

(51.56%), ofloxacin (44.53%), cefadroxil (39.06%),ciprofloxacin (38.28%),

azithromycin (30.40%), meropenem (27.34%), and tigecycline (20.31%).

For molecular characterization of E.coli isolated from dairy farm sewage, four

sets of primers derived from stx1, stx2. eaeA and hlyA genes were used for STEC

detection by multiplex PCR assay. The PCR assay was initially standardized by

optimizing the concentration of the components of the reaction mixture, annealing

temperature and cycling conditions. Optimal results were obtained using 5 µl of bacterial

lysate or 20 ng of diluted DNA as template in a reaction mixture consisting of 2.5 µl of

10X assay buffer for Taq polymerase containing 2.0 mM Magnesium chloride, one µl of

dNTP mix, 0.25 µM of each primer and one unit of Taq DNA polymerase in a final

reaction volume made up to 25 µl with molecular grade water.

Initial denaturation at 950C for five minutes followed by 35 cycles each of

denaturation at 940C for 45 seconds, annealing at 590C for 45 seconds and extension at

720C for one minute with a final extension period of 6 minutes at 720C was found to be

optimum for obtaining the desired PCR amplification of 180 bp for stx1, 255 bp for stx2,

384 bp for eaeA and 534 bp for hlyA genes of STEC.

Out of 28 samples from the organized dairy farm of Tirupati and surrounding

villages, 28 (100.00%) were positive for Escherichia coli by culture method. Out of 28

positives, 1 (3.57%) isolate was positive for Shiga toxin producing E.coli by PCR method

and carried stx1 gene.

Out of 32 samples from the unorganized dairy farms in and around Tirupati, 32

samples (100.00%) were positive for Escherichia coli by culture method. Out of 32

positives, two (6.25%) isolates were positive for Shiga toxin producing E. coli by PCR

method. Among the two Shiga toxin producing E. coli, one isolate carried stx1, whereas

another isolate carried a combination of stx1, stx2 and eaeA genes.

134

Out of 68 sewage samples from the animal sheds around Tirupati, 68 samples

(100.00%) were positive for Escherichia coli by culture method. Out of 68 positives, eight

(11.76%) isolates were positive for Shiga toxin producing E.coli by PCR method. Among

the eight Shiga toxin producing E.coli, three isolates carried stx1, four isolates carried

stx2 and one isolate carried both stx1and stx2genes

The isolates were used in screening of lytic bacteriophages recovered from

sewage and wastewater samples by double agar overlay method against E. coli. The

isolated phages produced discrete, clear and circular plaques on TSA plates with a

diameter of 0.1 to 3.0 mm.

Physical and chemical stability of phages was carried out by subjecting them to

temperature, sunlight, UV light, SDS, phenol, chloroform and formalin and exposed at

different time intervals. The phages were completely reduced when exposed at 400C for

a period of three hours whereas at 600C inactivation was observed within 30 min.

Complete reduction in the phage titre was noticed when exposed to direct sunlight and

UV light for a period of 3 h and 5 min respectively. The phage concentration was

completely reduced when exposed to 1% SDS, 0.1% SDS, 1% phenol, 5% phenol, 5%

chloroform, 10% chloroform and 40% formalin for a period of 15 min, 15 min, 30 min,

15 min, 5 min, 3 min and 15 min respectively.

The phage DNA was isolated and subjected to restriction enzyme digestion

analysis with EcoRI enzyme and found that the bands formed by the phages were below

48.5 kb.

The SEM observations of phage revealed that the phage had icosahedral head with

short tail. It was found that based on morphology the phage exhibited non-contractile tail

and belong to the order Caudovirales and family Podoviridae.

135

The invitro experiment was carried out to know the lytic activity of bacteriophages

on E. coli isolated from different sewage samples and showed that there was a 100%

reduction in the E. coli count after 10 h of incubation.

The analysis revealed that phages produce plaques on respective organisms and

tolerated different temperature ranges, sunlight, UV light, SDS, phenol, chloroform and

formalin. The isolated organisms were resistant to more of the drugs and so there is need

for alternative other than antibiotics. All these elements suggest that phages could be

useful as natural antimicrobials against Escherichia coli.

136

LITERATURE CITED

Aasmae, B., Volkova, J., Häkkinen, L., Orro, T., Tenson, T. and Kalmus, P. (2015).

Invitro antimicrobial resistance of intestinal Escherichia coli and Enterococci in

clinically healthy dogs in Estonia. Vet. Med. Zoot., 72 (94): 3-8.

Abuladze, T., Li, M., Menetrez, M. Y., Dean, T., Senecal, A. and Sulakvelidze, A. (2008).

Bacteriophages reduce experimental contamination of hard surfaces, tomato,

spinach, broccoli, and ground beef by Escherichia coli O157:H7. Appl. Environ.

Microbiol., 74:6230-6238

Ackermann, H. W. (2003). Bacteriophage observations and evolution. Research in

Microbiology, 154: 245-251.

Ackermann, H. W. (2007). 5500 phages examined in the electron microscope. Archives

of Virology, 152, 227–243.

Ackermann, H. W. (2011). Bacteriophage taxonomy. Microbiology Australia, 32(2), 90-

94.

Adams, M. H. (1959). Methods of study of bacterial viruses. In Bacteriophages.

Interscience Publishers, London, United Kingdom: 447-448.

Adams, M. R. and Moss, M. O. (2008). Food Microbiology. 3rd Edition. Royal Society

of Chemistry, Cambridge: 216-224.

Adenaike, O., Olonitola, O. S., Ameh, J. B. and Whong, C. M. Z. (2016). Incidence of

broad spectrum resistance in E. coli isolated from Zoborodo sold in Samaru, Zaria,

Nigeria. Int. J. Curr. Microbiol. App. Sci., 5(1): 796-801.

Akter, T., Hossain, M. J., Khan, Md. S., Sultana, H., Fatema, K., Al-Sanjee, S. and Datta,

137

S. (2016). Isolation and antimicrobial susceptibility pattern analysis of

Escherichia coli isolated from clinical samples of Bangladesh. Asian Journal of

Biomedical and Pharmaceutical Sciences, 6(54): 13-16.

Albert, J. M., Faruque, S.M., Faruque, A.S.G., Neogi, P.K.B., Ansaruzzaman, M.,

Bhuiyan, N.A., Alam, K. and Akbar, M.S. (1995). Controlled study of

Escherichia coli diarrheal infections in Bangladeshi children. J. Clin. Microbiol.,

33: 973 977.

Ali, I., Kumar, N., Ahmed, S., and Dasti, J. I., (2014). Antibiotic resistance in

uropathogenic E. coli strains isolated from non-hospitalized patients in Pakistan.

DOI: 10.7860/JCDR.

Allue-Guardia, A., Jofre, J. and Muniesa, M. (2012). Stability and Infectivity of

Cytolethal Distending Toxin Type V Gene-Carrying Bacteriophages in a Water

Mesocosm and under Different Inactivation Conditions. Appl. Environ.

Microbiol., 78 (16): 5818–5823.

Al-Mola, G. A. and Al-Yassari, I. H. (2010). Characterization of E. coli phage isolated

from sewage. J. Vet. Med. Sci., 9(2): 40-54.

Alshara, M. (2010). Antimicrobial Resistant Pattern of Escherichia coli Strains Isolated

from Paediatric Patients in Jordan. Acta Medica Iranica., 49: (5).

Aly, M.E.A., Tamer, M. E., and Magdy, A. A., (2012). Antibiotic resistance profile of E.

coli strains isolated from clinical specimens and food samples in Egypt. Intl. J.

Microbiol. Res., 3 (3): 176-182.

Aminu, R.F and David, I. (2015). Antimicrobial susceptibility of commensal

138

Escherichia coli from faeces of apparently healthy white Fulani cattle (Bos

indicus). Journal of Microbiology and Infections.,1:1.

Anago, E., Ayi-Fanou, L., Akpovi, C. D., Hounkpe, W. B., Tchibozo, M. A. D., Bankole,

H. S. and Sanni, A. (2015). Antibiotic resistance and genotype of beta-lactamase

producing Escherichia coli in nosocomial infections in Cotonou, Benin. Annals

of Clinical Microbiology and Antinicrobials, 14(5): 2-6.

Arabi, F.M.Z and Banazadehi, A (2013). Prevalence and antimicrobial susceptibility

patterns of uropathogens among patients referring to valieasr laboratory in

Najafabad, Isfahan, Iran. Middle-East J. Sci. Res., 13 (1): 85-90.

Asati, R.K (2013). Antimicrobial sensitivity pattern of Escherichia coli isolated from

urine samples of UTI patients and issues related to the rational selection of

antimicrobials. International Journal of Pharmacology and Therapeutics.,3(3).

at http://www.cdc.gov/ncidod/dbmd/diseaseinfo/diarrecoli_t.htm

Atere, V. A., Bamikole, A. M., Ajurojo, O. A. and Alo, O. S. (2015). Antimicrobial

resistance pattern of pathogenic Escherichia coli isolated from chicken liver and

trachea. J. Advancement in Medical and Life Sciences, 3(3): 1-4.

Babalova, E. G., Katsitadze, K. T., Sakvaredidze, L. A. and 10 other authors (1968).

Preventive value of dried dysentery bacteriophage. Zh. Mikrobiol. Epidemiol.

Immunobiol., 2: 143–145.

Bach, S. J., McAllister, T. A., Veira, D. M., Gannon, V. P. J. and Holley, R. A. (2003).

Effect of bacteriophage DC22 on Escherichia coli O157:H7 in an artificial rumen

system (Rusitec) and inoculated sheep. Anim. Res., 52: 89-101.

Bakhshi, B., Najibi, S. and Sepehri-Seresht, S. (2014). Molecular characterization of

http://www.cdc.gov/ncidod/dbmd/diseaseinfo/diarrecoli_t.htm

139

enterohemorrhagic Escherichia coli isolates from cattle. J. Vet. Med. Sci., 76(9):

1195-1199.

Bao, H., Zhang, H. and Wang, R. (2011). Isolation and characterization of bacteriophages

of Salmonella enterica serovar Pullorum. Poultry Science, 90(10): 2370-2377.

Barati, S., Bonisdian, M., Habibian, R. and Jostejou, T. (2012). Antibiotic resistance of

enterotoxigenic and enteroaggrigative Escherichia coli isolated from

gastroenteritis cases. Asian Journal of Biomedical and Pharmaceutical sciences,

2(14): 54-58.

Barkocy-Gallagher, G. A., Arthur, T. M., Rivera-Betancourt, M., Nou, X., Shackelford,

S. D., Wheeler, T. L. and Koohmaraie, M. (2003). Seasonal prevalence of Shiga

toxin-producing Escherichia coli, including O157:H7 and non-O157 serotypes,

and Salmonella in commercial beef processing plants. J. Food Prot., 66(11),

1978-86.

Barnes, H. J. and Gross, W. B. (1997). Colibacillosis. Pages 131-139 in Diseases of

Poultry. 10th ed. B. W. Calnek, ed. Mosby-Wolf Publication Ltd., London, UK.

Bauer, A. W., Kirby, W. M. M., Sherris, J. C. and Tuck, M. (1966). Antibiotics

susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol.,

45: 493-496.

Behera, B., Das, A., Mathur, P., Kapil, A., Ravisekhar, G and Dhawan, B (2009).

Tigecycline susceptibility report from an Indian tertiary care hospital. Indian J

Med Res., 129: 446-450.

Beheshti Maal, K., Delfan, A. S. and Salmanizadeh, S. (2014). Isolation of Klebsiella

pneumoniae and Klebsiella oxytoca and their bacteriophages and their application

in waste treatment and coliforms phage therapy. Res. J. Environ. Sci., 8: 123-133.

140

Beheshti Maal, K., Delfan, A. S. and Salmanizadeh, S. (2015). Isolation and Identification

of two novel Escherichia coli Bacteriophages and their Application in wastewater

treatment and coliform’s phage therapy. Jundishapur. J. Microbiol., 8(3): 14945.

Bell, B. P., Goldoft, M., Griffin, P. M., Davis, M. A., Gordon, D. C., and Tarr, P. I.,

(1994). A multistate outbreak of Escherichia coli O157:H7-associated bloody

diarrhoea and hemolytic uremic syndrome from hamburgers. The Washington

experience. JAMA.272:1349–53.

Bertani, L. and Bertani, G. (1986). Preparation and characterization of temperate non-

inducible bacteriophage P2. J. Gen. Virol. 2: 357.

Bhan, M. K., Mahalanabis, D., Fontaine, O. and Pierce, N. F. (1994). Clinical trials of

improved oral rehydration salt formulations: a review. Bull World Health Organ,

72: 945-955.

Bhat, M. A., Nishikawa, Y. and Wani, S. A. (2008). Prevalence and virulence gene

profiles of Shiga toxin- producing Escherichia coli and enteropathogenic

Escherichia coli from diarrhoeic and healthy lambs in India. Small Ruminant

Reearch, 75: 65-70.

Biswas, R., Rabbani, R., Ahmed, H. S., Sarker, M. A. S., Zafrin, N. and Rahman, Md. M.

(2014). Antibiotic sensitivity pattern of urinary tract infection at a tertiary care

hospital. Bangladesh Crit. Care J., 2(1): 21-24.

Black, R. E. (1990). Epidemiology of traveler’s diarrhea and relative importance of

various pathogens. Rev. Infect. Dis., 12: 373-379.

Bonnedahl, J., Stedt J, Waldenström J, Svensson L, Drobni M, Olsen B (2015)

141

Comparison of Extended- Spectrum ß-Lactamase (ESBL) CTX-M Genotypes in

Franklin Gulls from Canada and Chile. PLoS ONE 10(10): 0141315.

Bonyadian, M., Momtaz, H., Rahimi, E., Habibian, R., Yazdani, A. and Zamani, M.

(2010). Identification and characterization of shiga toxin-producing Escherichia

coli isolates from patients with diarrhoea in Iran. Indian J. Med. Res., 132: 328-

331.

Booher, S. L., Cornick, N. A. and Moon, H. W. (2002). Persistence of Escherichia coli

O157:H7 in experimentally infected swine. Vet. Microbiol., 89(1), 69-81.

Boqvist, S., Aspan, A. & Eriksson, E. (2009). Prevalence of verotoxigenic Escherichia

coli O157:H7 in fecal and ear samples from slaughtered cattle in Sweden. J. Food

Prot., 72(8), 1709-12.

Bosilevac, J. M. and Koohmaraie, M. (2011). Prevalence and Characterization of Non

O157 Shiga Toxin-Producing Escherichia coli Isolates from Commercial Ground

Beef in the United States. Appl. Environ. Microbiol., 77(6): 2103-2112.

Botkin, D. J., Galli, L., Sankrapani, V., Soler, M., Rivas, M. and Torres, A. G. (2012).

Development of a multiplex PCR assay for detection of shiga toxin-producing

Escherichia coli, enterohemorrhagic E. coli and enteropathogenic E.coli strains.

Frontiers in Cellular and Infection Microbiology, 2(8):1-9.

Bradley, K. K., Williams, J. M., Burnsed, L. J., et al. (2012). Epidemiology of a large

restaurant-associated outbreak of Shiga toxin-producing Escherichia coli

O111:NM. Epidemiol. Infect.,140(9):1644-1654.

Brian, M. J., Frosolono, M., Murray, B. E., Miranda, A., Lopez,E. L., Gomez, H. F. and

142

Cleary, T. G. (1992). Polymerase chain reaction for diagnosis of

enterohemorrhagic Escherichia coli infection and hemolytic-uremic syndrome. J.

Clin. Microbiol., 30:1801–1806.

Brovko, L. Y., Anany, H. and Griffiths, M. W. (2012). “6 Bacteriophages for detection

and control of Bacterial Pathogens in Food and Food-Processing Environment.”

Advances in food and nutrition research, 67: 241.

Burnet, F. M. (1933). The classification of dysentery-coli bacteriophages. III. A

correlation of the serological classification with certain biochemical tests. J.

Pathol. Bacteriol., 37: 179–184.

Calci, K. R., Burkhardt, W., Watkins, W. D., and Rippey, S. R. (1998). Occurrence of

male-specific bacteriophage in feral and domestic animal wastes, human feces,

and human-associated wastewaters. Applied and Environmental

Microbiology, 64(12), 5027-5029.

Calderone J. G and Pickett, M. J. (1965). Characterization of brucellaphages. J. Gen.

Microbiol. 39:1-10.

Callaway, T. R., Edrington, T. S., Brabban, A. D., Keen, J. E., Anderson, R. C., Rossman,

M. L., Engler, M. J., Genovese, K. J., Gwartney, B. L., Reagan, J. O., Poole, T.

L., Harvey, R. B., Kutter, E. M. and Nisbet, D. J. (2006). Fecal prevalence of

Escherichia coli O157, Salmonella, Listeria, and bacteriophage infecting E. coli

O157:H7 in feedlot cattle in the southern plains region of the United States.

Foodborne Pathog. Dis., 3(3), 234-44.

Camerini- Otera, R. D. and Franklin, R. M. (1972). Structure and synthesis of a lipid-

containing bacteriophage. XII. The fatty acids and lipid content of bacteriophage

PM2. Virology, 49: 385.

143

Caprioli, A., Morabito, S., Brugere, H. and Oswald, E. (2005). Enterohaemorrhagic

Escherichia coli: emerging issues on virulence and modes of transmission. Vet.

Res., 36(3): 289311.

Castellani, A. and Chalmers, A. J. (1919). “Manual of Tropical Medicine”. 3rd ed.,

Williams wood and co., New York.

Centers for Disease Control and Prevention. (1995). Escherichia coli O157:H7 outbreak

linked to commercially distributed dry-cured salami— Washington and

California, 1994. Morbid. Mortal. Weekly Rep. 44:157– 160.

Centres for Disease Control and Prevention. E. coli. (2012).

Centres for Disease Control and Prevention. (1996-2012). Incidence of laboratory-

confirmed bacterial and parasitic infections, and postdiarrheal hemolytic uremic

syndrome (HUS), by year and pathogen, Foodborne Diseases Active Surveillance

Network (FoodNet), United States, 1996–2012.

Centres for Disease Control and Prevention. (2011). FoodNet 2011 Surveillance Report.

In: US Department of Health & Human Services, ed.

Cergole-Novella, M. C., Pignatari, A. C. C., Castanheira, M. and Guth, B. E. C. (2011).

Molecular typing of antimicrobial-resistant Shiga-toxin-producing Escherichia

coli strains (STEC) in Brazil. Research in Microbiology, 162: 117-123.

Cerqueira, A. M. F., Guth, B. E. C., Joaquim, R. M. and Andrade, J. R. C. (1999). High

occurrence of shiga toxin producing Escherichia coli (STEC) in healthy cattle in

Rio de Janeiro state, Brazil. Veterinary Microbiology, 70: 111-121.

Chachra, D., Kaur, H., Chandra, M. and Saxena, H. (2012). Isolation, Electron

144

Microscopy And Physicochemical Characterization Of A Brucellaphage Against

Brucella abortus Vaccine Strain S19. The Internet Journal of Microbiology,

10(2): 1-7.

Chandrasekaran, D., Venkatesan, P., Tirumurugaan, K. G., Nambi, A.

P.,Thirunavukkarasu, P.S., Kumanan , K., Vairamuthu, S and Ramesh, S

(2014). Veterinary World., 2231-0916.

Chayani, N., Tiwari, S., Sarangi, G., Mallick, B., Mohapatra, A., Paty, BP and Das, P

(2009). Role of azithromycin against clinical isolates of family enterobacteriaceae

a comparison of its minimum inhibitory concentration by three different methods.

Indian Journal of Medical Microbiology., 27(2): 107-10.

Cho, S., Bender, J. B., Diez-Gonzalez, F., Fossler, C. P., Hedberg, C. W., Kaneene, J. B.,

Ruegg, P. L., Warnick, L. D. and Wells, S. J. (2006). Prevalence and

characterization of Escherichia coli O157 isolates from Minnesota dairy farms

and country fairs. J. Food Prot., 69(2): 252-259.

Cobbold, R. N., Hancock, D. D., Rice, D. H., Berg, J., Stilborn, R., Hovde, C. J. and

Besser, T. E. (2007). Rectoanal junction colonization of feedlot cattle by

Escherichia coli O157:H7 and its association with supershedders and excretion

dynamics. Appl. Environ. Microbiol., 73(5): 1563-8.

Conedera, G., Dalvit, P., Martini, M., Galiero, G., Gramaglia, M., Goffredo, E., Loffredo,

G., Morabito, S., Ottaviani, D., Paterlini, F., Pezzotti, G., Pisanu, M., Semprini,

P. and Caprioli, A. (2004). Verocytotoxin-producing Escherichia coli O157 in

minced beef and dairy products in Italy. Int. J. Food Microbiol., 96(1): 67-73.

Conedera, G., Mattiazzi, E., Russo, F., Chiesa, E., Scorzato, I., Grandesso, S., Bessegato,

145

A., Fioravanti, A. and Caprioli, A. (2007). A family outbreak of Escherichia coli

O157 haemorrhagic colitis caused by pork meat salami. Epidemiol. Infect.,

135(2): 311-314.

Cook, A. M. and Brown, W. R. L. (1964). Inactivation of a bacteriophage by chemical

antibacterial agents. Journal of Pharmacy and Pharmacology, 16(8): 611-617.

Coombs, B. K., Gilmour, M. W. and Goodman, C.D. (2011). The evolution of virulence

in non-O157 Shiga toxin-producing Escherichia coli. Front. Microbiol.,

doi:10.3389/ fmicb.2011.000 90.

Cornick, N. A., Booher, S. L., Casey, T. A. and Moon, H. W. (2000). Persistent

Colonization of Sheep by Escherichia coli O157:H7 and Other E. coli Pathotypes.

Appl. Environ. Microbiol., 66(11): 4926-4934.

D’Herelle F. (1917). An invisible antagonist microbe of dysentery bacillus. Comptes

Rendus Hebdomadaires des Seances de L’academie des Sciences : 373-375.

D’Herelle, F. (1918). Technique de la recherche du microbe filtrant bacteriophage

(Bacteriophagum intestinale). C. R. Seances Soc. Biol. Filiales 81: 1160–1162.

Daini, O. A., Ogbulo, O. D. and Ogunledun, A. (2005). Quinolones Resistance and R-

plasmids of some gram negative enteric bacilli. Afr. J. Clin. And Exp. Micro. 6:

14-19.

Daniel, J.L, Payne, T.A and Feng, P (2012). Simultaneous identification of strains of

Escherichia coli serotype O157:H7 and their Shiga like toxin type by mismatch

amplification mutation assay- multiplex PCR. J. Clin. Microbiol. 33: 248–250.

Dastmalchi saei, H. and Ayremlon, N. (2012). Characterization of Shiga toxin-producing

146

Escherichia coli (STEC) in feces of healthy and diarrheic calves in Urmia region,

Iran. Iran J. Miccrobiol., 4(2): 63-69.

De Benedictis, P., Beato, M.S. and Capua, I. (2007). Inactivation of avian influenza

viruses by chemical agents and physical conditions: a review. Zoonoses Public

Health 54(2), 51-68.

Dean-Nystrom, E. A., Bosworth, B. T. and Moon, H. W. (1997). Pathogenesis of

Escherichia coli O157:H7 infection in neonatal calves. Adv. Exp. Med. Biol., 412:

47-51.

Dean-Nystrom, E. A., Pohlenz, J. F., Moon, H. W. and O'Brien, A. D. (2000). Escherichia

coli O157:H7 causes more-severe systemic disease in suckling piglets than in

colostrum-deprived neonatal piglets. Infect. Immun., 68(4): 2356-8.

DebRoy, C., Roberts, E., Kundrat, J., Davis, M. A., Briggs, C. E. and Fratamico, P. M.

(2004). Detection of Escherichia coli serogroups O26 and O113 by PCR

amplification of the wzx and wzy genes. Appl. Environ. Microbiol. 70:1830–

1832.

Desmarchelier, P. M. and Fegan , N. (2003). Enteropathogenic Escherichia coli. Hocking

A. D (ed) Food borne microorganisms of public health significance. Australian

Institute of Food Science and Technology (NSW Branch), Sydney, 6(2): 267–310.

Dhanashree, B. and Mallya, P. S. (2008). Detection of shiga-toxigenic Escherichia coli

(STEC) in diarrheagenic stool and meat samples in Mangalore, India. Indian J.

Med. Res., 128: 271-277.

Donnenberg, M. S. (2002). Escherichia coli: Virulence Mechanisms of a Versatile

147

Pathogen. Amsterdam: Academic Press.

Donnenberg, M. S. and Whittam, T. S. (2001). Pathogenesis and evolution of virulence

in enteropathogenic and enterohemorrhagic Escherichia coli. J. Clin. Inv., 107(5):

539.

Doyle, M. P. (1991). Escherichia coli O157:H7 and its significance in foods. Int. J. Food

Microbiol., 12:289.

Doyle, M. E., Kaspar, C. W. and Weiss, R. (2006). Human Illness Caused by E. coli

O157:H7 from Food and Non-food Sources. 2006.

http://fri.wisc.edu/docs/pdf/FRIBrief_EcoliO157H7humanillness.pdf.

Duckworth, D. H. (1999). History of virology: bacteriophages. In Encyclopedia of

virology, pp. 725-730. Edited by A. Granoff and R. G. Webster. Memphis, TN:

Academic Press.

Duraisamy, N., Ramesh, N., Krishnakumar, V., Rajesh, P., Solomon, E. K. and Kannan,

V. R. (2015). Distribution, Isolation and Characterization of lytic bacteriophages

against multi-drug resistant and extended-spectrum of β-lactamase producing

pathogens from hospital effluents. Asian J. Pharm. Clin. Res., 8(2): 384-389.

Duris, J.W., Haack, S.K and Fogarty, L.R (2009). Gene and antigen markers of Shiga-

toxin Producing E. coli from Michigan and Indiana river water: Occurrence and

relation to recreational water quality criteria. J. Environ. Qual., 38:1878–1886.

Dutta, S., Guin, S., Ghosh, S., Pazhani, G. P., Rajendran, K., Bhattacharya, M. K.,

Takeda, Y., Balakrish Nair, G. and Ramamurthy, T. (2013). Trends in the

Prevalence of Diarrheagenic Escherichia coli among Hospitalized Diarrheal

Patients in Kolkata, India. PLos ONE, 8(2): 56068.

http://fri.wisc.edu/docs/pdf/FRIBrief_EcoliO157H7humanillness.pdf

148

Dutta, T. K., Roychoudhury, P., Bandyopadhyay, S., Wani, S. A. and Hussain, I. (2011).

Detection and characterization of shiga toxin producing Escherichia coli (STEC)

and enteropathogenic Escherichia coli (EPEC) in poultry birds with diarrhoea.

Indian J. Med. Res., 133: 541-545.

Edelman, R., Karmali, M. A. and Fleming, P. A. (1988). Summary of the International

Symposium and Workshop on Infections due to Verocytotoxin (Shiga-like toxin)-

producing Escherichia coli. J. Infect. Dis., 157:1102– 1104.

Elder, R. O., Keen, K. J., Siragusa, G. R., Barkocy-Gallagher, G. A., Koohmarate, M. and

Laegreid, W. W. (2000). Correlation of enterohemorrhagic Escherichia coli O157

prevalence in feces, hides and carcassesof beef cattle during processing.

Proceedings National of Academic Sciences, U.S.A, 28: 2999-3003.

EL-Jakee, J., Moussa, E. I., Mohamed, Kh. F. and Mohamed, G. (2009). Using

Molecular Techniques for Characterization of Escherichia coli Isolated from

Water Sources in Egypt. Global Veterinaria., 3(5): 354-362.

El-Rahman, A. A., El-Wafa, W. M. A. and Ibrahim, A. N. (2015). Prevalence of antibiotic

resistant E. coli in some environmental sources polluted with wastewater. J.

Microbiol. Biotech. Res., 5 (5):17-24

El-Shatoury, E. H., El-Leithy, M. A., Abou-Zeid, M. A., El-Taweel, G. E. and El-

Senousy, W. M. (2015). Antibiotic susceptibility of shiga toxin producing E. coli

O157:H7 isollated from different water sources. The Open Conference

Proceedings Journal, 6: 30-34.

Emond, E. and Moineau, S. (2007). Bacteriophages and food fermentations. In: McGrath,

149

S., Van Sinderen, D. eds. Bacteriophage: Genetics and Molecular Biology.

Horizon Scientific Press/ Caister Academic Press: 93-124.

Erickson, M. C., and Doyle, M. P. (2007). Food as a vehicle for transmission of Shiga

toxin-producing Escherichia coli. J. Food Prot. 70:2426–2449.

Eryulmaz, M., Merve, E.B., Muharrem, M., Yildiz and Ahmet Akin (2010).

Antimicrobial Resistance of Urinary Escherichia coli Isolates. Trop J Pharm Res.,

9(2): 205-209.

Escherich, T. (1885). “Die Darmbakterien des Neugeborenen and Sauglinge”. Fortschr.

Med., 3: 515-522

Esseili, M. A., Issmat I. Kassem and Von Sigler. (2008). Optimization of DGGE

community fingerprinting for characterizing Escherichia coli communities

associated with fecal pollution. Water Research, 42: 4467-4476.

European Centre for Disease Prevention and Control. (2012). Annual epidemiological

report Reporting on 2010 surveillance data and 2011 epidemic intelligence data.

Ferdosi-Sh. E., Javanian, M., Moradian-K, M., et al. Resistance patterns of Escherichia

coli causing urinary tract infection. Caspian J Intern Med 2015; 6(3):148-151.

Fotadar, U., Zaveloff, P. and Terracio, L. (2005), “Growth of Escherichia coli at elevated

temperatures”. J. Basic Microbiol., 45(5): 403-404.

Fratamico. P.M and Bagi, K.L (2012). Detection of Shigatoxin producing Escherichia

coli in ground beef using the Gene Discreal-timePCRsystem Frontiers in

Cellular and Infection Microbiology., 2(152).

150

George, M. and Garrity. (2005). “The Gamma proteobacteria”. Bergey’s Manual of

Systematic Bacteriology. 2nd ed., New York, Springer: 1108.

Goodridge, L., Gallaccio, A. and Griffiths, M. W. (2003). Morphological, host range and

genetic characterization of two coliphages. Appl. Environ. Microbiol., 69(9):

5364-5371.

Gowing, M. M. (1993). Large virus-like particles from vacuoles of Phaeodarian

radiolarians and from other marine samples. Marine Ecology Progress Series,

101, 33-43.

Grabow, W. O. K. (2000). Bacteriophages update on application as models for viruses in

water. Water SA, 27: 251 268.

Grauke, L. J., Kudva, I. T., Yoon, J. W., Hunt, C. W., Williams, C. J. and Hovde, C. J.

(2002). Gastrointestinal tract location of Escherichia coli O157:H7 in ruminants.

Appl. Environ. Microbiol., 68(5), 2269-77.

Griffin, P. M. (1995). Escherichia coli O157:H7 and other enterohaemorrhagic

Escherichia coli. In: Blaser, M.J., Smith, J.I., Ravdin, H.B., Greenberg, H. B.

and Guerrant, R. L. Infections of the gastrointestinal tract. Raven Press,

NewYork: 121-145.

Gu, J., Liu, X., Li, Y., Han, W., Lei, L., et al. (2012). A method for generation phage

cocktail with great therapeutic potential. PLoS ONE, 7(3).

Gunathilaka, G. U. (2014). Characterization of bacteriophages from environmental water

samples and the potential of bacteriophages tailspike proteins (tsp) in bacteria

detection. Thesis submitted to the graduate School of Wayne State University,

Detroit, Michigan in partial fulfilment of the requirements for the degree of Master

of Science.

151

Haack, S.K., Duris, J.W., Fogarty, L.R., Kolpin, D.W., Focazio, M.J., Furlong, E.T and

Meyer, M.T (2009). Comparing waste water chemicals, indicator bacteria

concentrations, and bacterial pathogen genes as faecal pollution indicators.

J. Environ. Qual. 38: 248–258.

Habrun, B., Komp, G.,e Zeljko., C., Spicic, I., Miroslav, B., and Mario, M (2010).

Antimicrobial sensitivity of Esherichia coli, samonella spp., Pasteurella

multocida, Streptococcus suis and Actinobacillus pleuropneumoniae isolated

from diagnostic samples from large pig breeding farms in Croatia. Vet. Arhiv.,

80 (5): 571-583.

Halabi, M., Orth, D., Grif, K., Wiesholzer-Pittl, M., Kainz, M., Schoberl, J., Dierich,

M.P., Allerberger, F and Wurzner, R (2008). Prevalence of Shiga toxin-,

intimin- and Haemolysin genes in Escherichia coli isolates from drinking water

supplies in a rural area of Austria. Int. J. Hyg. Environ. Health., 211: 454–457.

Hancock, D., Besser, T., Lejeune, J., Davis, M. and Rice, D. (2001). The control of VTEC

in the animal reservoir. Int. J. Food Microbiol., 66(1-2), 71-8.

Harper, D. R. and Enright, M. C. (2011). Bacteriophages for the treatment of

Pseudomonas aeruginosa infections. Journal of applied microbiology, 111(1), 1-

7.

Hartl, D. L. and Dykhuizen, D. E. (1984). The population genetics of Escherichia coli.

Ann. Rev. Genet., 18:31-68

Hausler, T. (2003). Gesund durch Viren. Munchen: Piper Verlag (in Germany).

Hauswaldt, S., Nitschke, M., Sayk, F., Solbach, W. and Knobloch, J. K. (2013). Lessons

152

Learned From Outbreaks of Shiga Toxin Producing Escherichia coli. Curr. Infect.

Dis. Rep., 15(1):4-9.

Heijnen, L. and Medema, G. (2006). Quantitative detection of E. coli, E. coli O157 and

other Shiga toxin producing E. coli in water samples using a culture method

combined with real-time PCR. J. Water Health 4: 487–498.

HillaHadas, Monica Einav, Itzhak Fishov and Arieh Zaritsky. (1997). Bacteriophage T4

development depends on the physiology of ts host Escherichia coli. Microbiology,

143: 179 185.

Holmes, F. O. (1948). Order Virales. In Bergey’s Manual of Determinative Bacteriology

(6th edn) (Breed, R.S. et al., eds). Williams & Wilkins, Baltimore, MD: 1126–

1286.

Hui, Y. H., Pierson, M. D. and Gorham, J. R. (2001). Bacterial pathogens. In: Foodborne

Disease Handbook. New York: Marcel Dek. 2nd ed. : 170-196.

Hussain, A., Razvi, N., Anjum, F. and Humayoun, R. (2015). Resistance pattern of 3rd

generation cephalosporins. World Journal of Pharmacy and Pharmaceutical

Sciences, 4(4): 34-44.

Ibrahim, M.E., Bilal, N.E and Hamid, M.E (2012). Increased multi-drug resistant

Escherichia coli from hospitals in Khartoum state, Sudan. African Health

Sciences., 12(3): 368 - 375

Ibrahim, M., Humodi, A., Saeed, Elhassan , M.M. and Hamid, E.M (2010). Increase in

resistance among uropathogens E. coli to empirical therapy.

Ingledew, W. J. and Poole, R. K. (1984). “The respiratory chains of Escherichia coli”.

153

Microbiol. Rev., 48(3): 222-271.

Inu Rawal, Harshada Joshi and Chaudhary, B. L. (2013). Molecular identification of

Escherichia coli isolated from lakes of Udaipur (Raj), India. Asian Jr. of

Microbiol. Biotech. Env. Sc., 15(1): 129-131.

Jackson, M. P., Newland, J.W., Holmes, R. K. and O’Brien, A. D. (1987). Nucleotide

sequence analysis of the structural genes for Shiga-like toxin I encoded by

bacteriophage 933J from Escherichia coli. Microbial Pathogenesis 2, 147–153.

Jakaria, A. T. M., Islam, M. A. and Khatum, M. M. (2012). Prevalence, characteristics

and antibiogram profiles of Escherichia coli isolated from apparently healthy

chickens in Mymensingh, Bangladesh. Microbes and Health, 1(1): 27-29.

Jamalludeen, N. (2012). Isolation and characterization of virulent bacteriophages against

Escherichia coli serogroups O1, O2, and O78. Proceeding of the Eleventh

Veterinary Scientific Conference: 56-63.

Jamalludeen, N., She, Y. M., Lingohr, E. J. and Griffiths, M. (2009). Isolation and

characterization of virulent bacteriophages against Escherichia coli serogroups

O1, O2, and O78. Poultry Science Association Inc., 88 :1694–1702.

Jann, K., Schmidt, G. and Barbara Wallenfels. (1971). Isolation and Characterization of

Escherichia coli bacteriophage ϕ 8 specific for E. coli strains belonging to sero-

group 08. Journal of General Microbiology, 67: 289-297.

Jay, J. M. (2000). Modern Food Microbiology. Maryland: Aspen Publishers. 6th ed.:536.

Jay, M. T., Cooley, M., Carychao, D., Wiscomb, G.W., Sweitzer, R.A., Crawford-

Miksza, L., Farrar, J.A., Lau, D. K., O'Connell, J., Millington, A., Asmundson, R.

154

V., Atwill, E. R. and Mandrell, R. E. (2007). Escherichia coli O157:H7 in feral

swine near spinach fields and cattle, central California coast. Emerg. Infect. Dis.,

13(12), 1908-11.

Jensen, E. C., Schrader, H. S., Rieland, B., Thompson, T. L., Lee, K. W., Nickerson, K.

W. and Kokjohn, T. A. (1998). Prevalence of Broad-Host-Range lytic

Bacteriophages of Sphaerotilus natans, Escherichia coli and Pseudomonas

aeruginosa. Appl. Environ. Microbiol., 64(2): 575-580.

Jeyasanta, K. I., Aiyamperumal, V., and Patterson, J. (2012). Prevalence of Antibiotic

Resistant Escherichia coli in Sea Foods of Tuticorin Coast, Southeastern India.

Advan. Biol. Res., 6 (2): 70-77.

Jiao Yong-Jun ZX-y, Guo Xi-Ling, Shi Zhi-Yang, Feng Zhen-Qing and Wang Hua.

(2009). Monoclonal Antibody S2C4 Neutralizes The Toxicity of Shiga Toxin 2

and Its Variants. Progress as Biochemistry and Biophysics, 36(6):736-742.

Jordan, D. M., Booher, S. L. and Moon, H. W. (2005). Escherichia coli O157:H7 does

not require intimin to persist in pigs. Infect. Immun., 73(3), 1865-7.

Joshi, S., Rashmi, S and Singh, P (2012). Antibiotic resistance profile of

Escherichia coli isolates from Colibacillosis in and around Pantnagar, India.

Vet. World., 5(7): 405-408.

Karadeniz, E., Sarigullu, F. E., Untac, I. and Colak, O. (2012). Plasmid profile analysis

of phage sensitive E. coli strains from Human sewage system. Journal of animal

Science Advances, 2(10): 873-878.

Karmali, M. A. (1989). Infection by verocytotoxin-producing Escherichia coli. Clin.

155

Microbiol. Rev., 2:15–38.

Karmali, M. A., Mascarenhas, M., Shen, S., Ziebell, K., Johnson, S., Reid-Smith, R., et

al. (2003). Association of genomic O island 122 of Escherichia coli EDL 933 with

Verocytotoxin producing Escherichia coli seropathotypes that are linked to

epidemic and/or serious disease. J. Clin. Microbiol., 41: 4930-4940.

Karmali, M. A., Petric, M., Lim, C., Fleming, P. C., Arbus, G. S. and Lior, H. (1985).The

association between haemolytic uremic syndrome and infection by Verotoxin-

producing Escherichia coli. J. Infect. Dis. 151:775–782.

Karmali, M. A., Steele, B. T., Petric, M. and Lim, C. (1983). Sporadiccasesof hemolytic

uremic syndrome associated with fecal cytotoxin and cytotoxinproducing

Escherichia coli. Lancet :619–620

Karpman, D., Hakansson, A., Maria-Thereza R. Perez, Isaksson, C., Eric Carlemalm,

Caprioli, A. and Svanborg, C. (1998). Apoptosis of Renal Cortical Cells in the

Hemolytic-Uremic Syndrome: In Vivo and In Vitro Studies. American Society for

Microbiology (INFECTION AND IMMUNITY), 66(2): 636–644.

Kesava Naidu, G., Rajendra Goud, N., Gaddad, S. M. and Shivannavar, C. T. (2011).

Detection of Shiga toxin genes (stx1 and stx2) and molecular characterization of

shiga-toxigenic Escherichia coli isolated from diverse sources in Gulbarga region,

India. Pharmacophore, 2(5): 253-265.

Khan, M.A., Naqvi, B.S., Rizvi, M., Zeb-un-Nisa and Atta Abbas (2014). Resistance

pattern of cephadroxil monohydrate and ceftrioaxone sodium against different

clinical isolates. IJAMSCR., 2(1): 45-50.

156

Kiranmayi, C. B., Krishnaiah, N. and Mallika, E. N. (2010). Escherichia coli O157:H7 –

An emerging pathogen in foods of animal origin. Vety. World, 3: 382-389.

Kleanthous, H., Smith, H. R., Scotland, S. M., Gross, R. J., Rowe, B., Taylor, C. M. and

Milford, D. V. (1990). Haemolytic uremic syndromes in the British Isles, 1985-8:

association with verocytotoxin producing Escherichia coli. Part 2:

Microbiological aspects. Arch. Dis. Child. 65(7): 722-727.

Kobori, D., Rigobelo, E. C., Macedo, C., Marin, J. M. and Avila, F. A. (2004). Virulence

properties of Shiga toxin-producing Escherichia coli isolated from cases of

Bovine Mastitis in Brazil. Revue Elev. Med. Vet. Pays trop., 57(1-2): 15-20.

Kolling, G. L. and Matthews, K. R. (2001). Examination of Recovery In Vitro and In

Vivo of Nonculturable Escherichia coli O157:H7. Appl. Environ. Microbiol.,

67(9): 3928–3933.

Konowalchuk, J., Speirs, J. I. and Stavric, S. (1977). Vero response to a cytotoxin of

Escherichia coli. Infect. Immun. 18: 775-779.

Kornacki, J. L. and Marth, E. L. (1982). Foodborne illness caused by Escherichia coli: a

review. J. Food Prot., 45:1051.

Kumar, H. S., Indrani Karunasagar, Karunasagar, I., Tsukamoto Teizou, Kensuke Shima

and Shinji Yamasaki. (2004). Characterization of Shiga toxin-producing

Escherichia coli (STEC) isolated from seafood and beef. FEMS microbial.

Letters, 233: 173-178.

Kumar, R. and Prasad, A. (2010). Detection of E.coli and Staphylococcus in Milk and

Milk Products in and around Pantnagar. Vety. World., 3(11):495-496.

157

Kumar, R., Umashanker Keshri and Manoj Kumar (2013). Antimicrobials Sensitivity

and Resistance Pattern of Bacterial Isolates at a Tertiary Care Hospital in

Jharkhand, India. RIBPS., 4(1): 1248-1255.

Kutter, E. and Sulakvelidze, A. (2004). Bacteriophages: biology and applications, CRC

Press.

La Ragione, R. M., Best, A., Woodward, M. J. and Wales, A. D. (2009). Escherichia coli

O157:H7 colonization in small domestic ruminants. FEMS Microbiol. Rev., 33(2),

394-410.

Lappe, N., Doran, G., O’Connor, J., O’Hare, C. and Cormican, M. (2009).

Characterization of bacteriophages used in the Salmonella enterica serovar

enteritidis phage-typing scheme. Journal of Medical Microbiology, 58(1): 86-93.

Lawrence Broxmeyer. (2004). Bacteriophages antibacterials with a future? Medical

Hypotheses, Elsevier, 62: 889-893.

Lee, J. H., Vinal, A. C. and Dallas, W. S. (2003). Nucleotide sequence comparison

between heat-labile toxin B-subunit cistrons from Escherichia coli of human and

porcine origin. Infect Immun 48: 73–77.

Lienemann, T., Pitkanen, T., Antikainen, J., Molsa, E., Miettinen, I., Haukka, K., Vaara,

M and Siitonen, A (2011). Shiga toxin-producing Escherichia coli O100:H: stx

(2e) in drinking water contaminated by waste water in Finland. Curr. Microbiol.

62: 1239–1244.

Lim Esther, L. L., Alison, B., Peter, C. and Ruth, P. (2012). Foodborne disease in New

Zealand 2011, In: Institute of Environmental Science and Research Limited.

Lin, A., Nguyen, L., Lee, T., Clotilde, L. M., Kase, J. A., Son, I., Carter, J. M. and Lauzon.

158

C. R. (2011). Rapid O serogroup identification of the ten most clinically relevant

STECs by Luminex microbeadbased suspension array. J. Microbiol. Methods

87:105–110.

Lopez, E. L., Diaz, M., Grinstein, S., Devoto, S., Mendilaharzu, F., Murray, B. E.,

Ashkenazi, S., Rubeglio, E., Woloj, M. and Vasquez, M. (1989). Hemolytic

uremic syndrome and diarrhoea in Argentine children: The role of Shiga-like

toxins. J. Infect. Dis., 160: 469–475.

Low, J. C., McKendrick, I. J., McKechnie, C., Fenlon, D., Naylor, S. W., Currie, C.,

Smith, D. G., Allison, L. and Gally, D. L. (2005). Rectal carriage of

enterohemorrhagic Escherichia coli O157 in slaughtered cattle. Appl. Environ.

Microbiol., 71(1), 93-7.

Lwoff, A., Home, R. and Tournier, P. (1962) A system of viruses. In Basic Mechanisms

in Animal Virology. Cold Spring Harb. Symp. Quant. Biol. 27: 51–62.

Mahadevan, M. S., Nagananda, G. S., Das, A., Bhattacharya, S. and Suryan, S.. (2009).

Isolation of Host- Specific Bacteriophages from Sewage against Human

Pathogens. Asian J. Biotechnol., 1(4): 163-170.

Mahmud MAA, Islam MN, Khan MFR, Hussain MM and Rahman MM (2016).

Prevalence and antibiotic sensitivity of bacteria isolated from respiratory system

of cattle. International Journal of Natural and Social Sciences, 3(2): 21-29.

Maloo, A., Sunil, B., Rutuja, D., Gajbhiye, S.N., Syed and Dastager, G (2014).

Occurrence and distribution of multiple antibiotic-resistant bacteria

of Enterobacteriaceae family in waters of Veraval coast, India. Environmental

and Experimental Biology., 12: 43–50.

159

Manikandan, C and Amsath, A (2014). Antibiotic susceptibility pattern of Escherichia

coli isolated from urine samples in Pattukkottai, Tamilnadu. Int.J.Curr.

Microbiol. App.Sci., 3(10): 449-457.

Manjunath, N. S., Agsar, D., Jagannath, K. V., Rangaswamy, B. E., Surya Chandra Rao,

Anand, S. and Yogisha, S. (2013). Characterization and in vitro efficacy studies

of wide host range lytic bacteriophage ΦDMEC-1 infecting Escherichia coli

isolated from pyogenic skin infections.

Manning, S. D., Motiwala, A. S., Springman, A. C., Qi, W., Lacher, D. W., Ouellette, L.

M., et al. (2008). Variation in virulence among clades of Escherichia coli

O157:H7 associated with disease outbreaks. PNAS, 105: 4868-4873.

Mantzourani, I., Panopoulou, M., Theodoridou, I., Tsirogiannis, I.,V.Papaemmanouil,

B., Johnson, B., Biedenbach, D., Bouchillon, S., Stavropoulou, E., and

Bezirtzoglou, E (2015). Comparative Antimicrobial Susceptibility Profiling

of Tigecycline and Other Antibiotics against Clinical and Environmental

Isolates. Int.J.Curr.Microbiol.App.Sci ., 4(4): 384-396.

Martin, J. L., Ithn Eugirgr, D., ALfz Ink and SiegfriesdcHerer. (1993). Isolation,

classification and molecular characterization of bacteriophages for Enterobacter

species. J. Gen. Microbiol., 139: 2627 2633.

Martinez-Freijo, P., Fluit, A. C., Schmitz, F. J., Grek, V. S., Verhoef, J. and Jones, M. E.

(1999). Many class I integrons comprise distinct stable structures occurring in

different species of Enterobacteriaceae isolated from widespread geographic

regions in Europe. Antimicrob. Agents Chemother., 43:686-689.

Mary, C and Usha, M. S (2013). Incidences of multi-drug resistance Escherichia coli

160

isolates in Panipuri sold in Bangalore. IFRJ., 20(2): 1007-1009.

Mathias, C. B. Kirshner, A. T. K. and Velimirov, B. (1995). Seasonal variations of virus

abundance and viral control of bacterial production in a backwater system of

Danube river. Appl. Environ. Microbiol., 61: 3734-3740.

Mead, P. S. and Griffin, P. M. (1998). Escherichia coli O157:H7. Lancet, 352(9135),

1207-12.

Melo, D. B., Menezes, A. P. de. O., Reis, J. N. and Guimaraes, A. G. (2015).

Antimicrobial resistance and genetic diversity of Escherichia coli isolated from

humans and foods. Brazilian Journal of Microbiology, 46 (4): 1165-1170.

Merchant, I. A. and Packer, R. A. (1967). Veterinary bacteriology and virology. The lowa

State University Press, Ames, lowa, USA. 7th edition: 211-305.

Merril, C. R., Scholl, D. and Adhya, S. L. (2003). The prospect for bacteriophage therapy

in Western medicine. Nat. Rev. Drug Discov., 2: 489–497.

Mishra, M., Patel, A.K and Behera, N (2013). Prevalence of Multidrug Resistant

E. coli in the river Mahanadi of Sambalpur. Curr Res Microbiol Biotechnol., 1(5):

239-244

Momtaz, H., Farzan, R., Rahimi, E., Safarpoor, F., Dehkordi, and Souod, N.,(2012)

Molecular Characterization of Shiga Toxin-Producing Escherichia coli

Isolated From Ruminant and Donkey Raw Milk Samples and Traditional Dairy

Products in Iran. The ScientificWorld Journal doi:10.231342.

Momtaz, H. and Jamshidi, A. (2013). Shiga toxin-producing Escherichia coli isolated

from chicken meat in Iran: serogroups, virulence factors and antimicrobial

resistance properties. Poultry Science, 92: 1305-1313.

161

Momtaz, H., Rahimi, E. and Moshkelani, S. (2012a). Molecular detection of

antimicrobial resistance genes in E. coli isolated from slaughtered commercial

chickens in Iran. Veterinarni Medicina, 57(4): 193-197.

Morris, J. A. and Corbel, M. J. (1973). Properties of a new phage lytic for Brucella suis.

J. Gen. Virol., 21:539-554.

Morrison, D. M., Tyrell, D. L. J. and Jewell, L. D. (1985). Colonic biopsy in Verotoxin-

induced hemorrhagic colitis and thrombotic thrombocyopenic purpura (TTP). Am.

J. Clin. Pathol., 86:108–112.

Mulani, M. S., Azhar, S., Azharuddin, S. and Tambe. S. (2015). Harnessing the Power of

Bacteriophage for Pathogen Reduction in Wastewater. Int. J. Curr. Microbiol.

App. Sci., Special Issue-2 152-161.

Muniesa, M., Jofre, J., García-Aljaro, C and Blanch, A.R (1999). Occurrence of

Escherichia coli O157:H7 and other enterohemorrhagic Escherichia coli in the

environment. Environ. Sci. Technol., 40: 7141–7149.

Munsi, Md. N., Sarker, N. R., Khatun, R. and Alam, M. K. (2015). Identification and

antibiogram study of bacterial species isolated from samples of different locations

in Bangladesh. Asian J. Med. Biol. Res., 1(3): 457-462.

Mustika, O. C., Pinatih, K. J. P. and Suardana, I. W. (2015). Antibiotic resistance profiles

of Escherichia coli O157:H7 in cattle at South-Kuta, Badung Regency, Bali,

Indonesia. Global Veterinaria, 15(5): 480-484.

Nandi, P., Kumar, S., Biswas, T., Mitra, G., Chejara, SK and Roy, S (2014). In vitro

162

susceptibility pattern of Tigecycline against MRSA, ESBL producing Escherichia

coli, Klebsiella species and Acinetobacter isolates in a rural tertiary care hospital.

IJMDS., 4(1).

Nart, P., Naylor, S. W., Huntley, J. F., McKendrick, I. J., Gally, D. L. and Low, J. C.

(2008). Responses of cattle to gastrointestinal colonization by Escherichia coli

O157:H7. Infect. Immun., 76(11), 5366-72.

Nataro, J. P. and Kaper, J. B. (1998). Diarrheagenic Escherichia coli. J. Clin. Microbiol.,

11:142-201

Naylor, S. W., Low, J. C., Besser, T. E., Mahajan, A., Gunn, G. J., Pearce, M. C.,

McKendrick, I. J., Smith, D. G. and Gally, D. L. (2003). Lymphoid follicle-dense

mucosa at the terminal rectum is the principal site of colonization of

enterohemorrhagic Escherichia coli O157:H7 in the bovine host. Infect. Immun.,

71(3), 1505-12.

Neher, S., Hazarika, A. K., Barkalita, L. M., Borah, P., Bora, D. P. and Sharma, R. K.

(2016). Isolation and characterization of Shiga toxigenic Escherichia coli of

animal and bird origin by multiplex polymerase chain reaction. Vety. World, 9(2):

123-127.

Niranjan, V and Malini, A (2014). Antimicrobial resistance pattern in Escherichia coli

causing urinary tract infection among inpatients. Indian J Med Res.,139: 945-948.

Nitika, A., Asthana Ashish, K., Madan Molly and Dixit, V. A. (2014). Antibiotic

resistance pattern in E. coli causing community-acquired urinary tract infections.

Journal of Advance Researches in Biological Sciences, 6(3&4): 209-212

Nitikshan, R. V., Naveen Kumar, R., bharathi Kulkani, Kashinath, L., Bhaskar, V. and

163

Polasa, K. (2014). E. coli pathotypes and their antibiotic resistance in young

children with diarrhea in Hyderabad, India. Int. J. Curr. Microbiol. App. Sci., 3(9):

647-654.

Nontongana, N., Sibanda, T., Ngwenya, E and Anthony, I.O (2014). Prevalence and

Antibiogram Profiling of Escherichia coli Pathotypes Isolated from the Kat River

and the Fort Beaufort Abstraction Water. Int. J. Environ. Res. Public

Health.,11: 8213-8227.

Nsofor, C. A., Onichukwu, O. and Ohiaeri, G. (2016). Antibiotic susceptibility pattern of

Escherichia coli isolates from human and animal specimens in Owerri, Nigeria.

Bull. Env. Pharmacol. Life Sci., 5(4): 33-36.

O’Brien, A. D., Lively, T. A., Chen, M. E., Rothman, S. W. and Formal, S. B. (1983).

Escherichia coli O157:H7 strains associated with haemorrhagic colitis in the

United States produce a Shigella dysenteriae 1 (Shiga) like cytotoxin. Lancet: 702.

Ohieku, J.D and Magaji, R.A (2013). Urinary Tract Infections Associated with

Escherichia Coli: A 2005 to 2009 Clinical Assessment of Trends in

Fluoroquinolones Activities in Maiduguri-City, Nigeria. Journal of Applied

Pharmaceutical Science., 3 (8): 084-091.

Oliveira, A., Sillankorva, S., Quinta, R., Henriques, A., Sereno, R. and Azeredo, J. (2009).

Isolation and characterization of bacteriophages for avian pathogenic E. coli

strains. J. Appl. Microbiol., 106(6): 1919-1927.

Oluyege, A. O., Ojo-Bola, O. and Oludada, O. E. (2015). Carriage of antibiotic resistant

commensal E. coli in Infants below 5 months in Ado-Ekiti. Int. J. Curr. Microbiol.

App. Sci., 4(5): 1096-1102.

OzFoodNet Working Group. (2012). Monitoring the Incidence and Causes of Diseases

164

Potentially Transmitted by Food in Australia: Annual Report of the OzFoodNet

Network, 2010: Communicable Diseases Intelligence.

Panahee, M. and Pourtaghi, H. (2016). Virulence gene profiles of shiga-toxin producing

Escherichia coli isolates from retail raw meat in Iran. Bulg. J. Vet. Med. (online

first).

Pandey, S., Chachra, D., Chandra, M. and Saxena, H. M. (2013). Protein profiling and

physico-chemical characterization of an isolated phage against Brucella abortus

strain 19. Afr. J. Microbiol. Res., 7(14): 1233-1238.

Pant, D. R., Chaudhary, N. and Upadhyaya, S. (2015). Isolation and identification of

Escherichia coli (E. coli) from children suspecting urinary tract infection (UTI).

International Journal Of Health Sciences And Research, 5(2): 163-168.

Paton, A. W. and Paton, J. C. (2005). Multiplex PCR for Direct Detection of Shiga

Toxigenic Escherichia coli strains producing the novel subtilase cytotoxin. J.

Clin. Microbiol., 43(6): 2944-2947.

Paton, J. C. and Paton, A. W. (1998). Pathogenesis and diagnosis of Shigatoxin producing

Escherichia coli infections. Clin. Microbiol. Rev., 11: 450–479.

Pavia, A. T., Nichols, C. R., Green, D. P., Tauxe, R. V., Mottice, S. and Greene, K. D.

(1990). Hemolytic uremic syndrome during an outbreak of Escherichia coli

O157:H7 infections in institutions for mentally retarded persons: clinical and

epidemiologic observations, J. persons: clinical and epidemiologic observations.

Pennington, H. (2010). Escherichia coli O157. Lancet 376: 1428-1435.

Periasamy, D. and Sundaram, A. (2013). A novel approach for pathogen reduction in

wastewater treatment. J. Environ. Health Sci. Eng., 1112: 1-9.

Preethishree, P., Rekha Rai, Vimal kumar, K., Asha Pai, K. B. and Pratibha Bhat, U.

165

(2016). Uropathogens and their antibiotic susceptibility pattern at a tertiary care

teaching hospital in Coastal Karnataka, India. Int. J. Curr. Microbiol. App. Sci.,

5(1): 23-31.

Price, S. B., Wright, J. C., DeGraves, F. J., Castanie-Cornet, M. P. and Foster, J. W.

(2004). Acid resistance systems required for survival of Escherichia coli O157 :

H7 in the bovine gastrointestinal tract and in apple cider are different. Appl.

Environ. Microbiol., 70:4792-4799

Pritchard, G. C., Willshaw, G. A., Bailey, J. R., Carson, T. and Cheasty, T. (2000).

Verocytotoxin-producing Escherichia coli O157 on a farm open to the public:

outbreak investigation and longitudinal bacteriological study. Vet. Rec., 147(10),

25964.

Public Health Agency of Canada (PHAC). E. coli. (2015).

Raghu, H. V., Manju, G., Manjunath, B. M., Santhosh Mishra and Praveen Sawale.

(2012). Beneficial face of bacteriophages application in food processing. Int. J.

Quality Res., UDK, 6: 101-108.

Rahim, N., Dr. Syed Baqir Shyum Naqvi., Bashir, S., Rafiq, K and Shagufta Nesar

(2014). Assessment of Different Brands of Cefadroxil for Their In Vitro

Antibacterial Activity against Staphylococcus aureus and Escherichia coli.

IJPSI., 3(2): 2319 – 6718.

Raihan, Md., Ismail Hossain, A., Mostafizer, M., Rahman, Md., Zohorul Islam., Das,

B.C., Habib, A., Belal, S.H., Islam, K (2014). Prevalence and Antimicrobial

Resistance Profile of Escherichia coli and Salmonella Isolated from Diarrheic

Calves. Journal of Animal Health and Production., 2 (1): 12 – 15.

Ram, S., Vajpayee, P and Shanker, R (2007). Prevalence of multi-antimicrobial-

166

agent resistant, Shiga toxin and enterotoxin producing Escherichia coli in surface

waters of river Ganga. Environ. Sci. Technol. 41: 7383–7388.

Rangel, J. M., Sparling, P. H., Crowe, C., Griffin, P. M. and Swerdlow, D. L. (2005).

Epidemiology of Escherichia coli O157:H7 Outbreaks, United States, 1982–

2002. Emerg. Infect. Dis., 11(4) (serial on the internet)

Ranjini, C. Y., Kasukurthi, L. R., Madhumati, B. and Rajendran, R. (2016). Prevalence

of multidrug resistance and extended spectrum beta-lactamases among

uropathogenic Escherichia coli isolates in a tertiary care hospital in South India:

An alarming trend. Community Acquired Infection, 2(1): 19-24..

Rasheed, M. U., Jamil, K., Thajuddin, N., Pasupuleti, M., Ahamed, P. and

Muthukumaresan, K. P. (2014). Distribution of the stx1, stx2 and hlyA genes:

Antibiotic profiling in Shiga-toxigenic E. coli strains isolated from food sources.

Int. J. Curr. Microbiol. App. Sci., 3(5): 348-361.

Rehman, M.U., Rashid, M., Javeed Ahmad, SK., Wani, S.A and Farooq, S (2013).

Multi-drug resistance among Shiga toxin producing Escherichia coli isolated

from bovines and their handlers in Jammu region, India. Vet. World., 6(14):

2231-0916.

Rene, N. B., Danielle, R. D., Debrah, L. D. and Susan, E. B. (2007). Isolation of a

bacteriophage from sewage sludge and characterization of its bacterial host cell.

Rivier Acad. J., 3.

Renter, D. G., Sargeant, J. M., Hygnstorm, S. E., Hoffman, J. D. and Gillespie, J. R.

(2001). Escherichia coli O157:H7 in free-ranging deer in Nebraska. J. Wildl. Dis.,

37(4): 75560.

Richardson, S. E., Rotman, T. A., Jay, V., Smith, C. R., Becker, L. E., Petric, M., Olivieri,

167

N. F. and Karmali, M. A. (1992). Experimental verocytotoxemia in rabbits. Infect.

Immun., 60:4154–4167.

Riley, L. W. (1987). The epidemiologic, clinical, and microbiological features of

hemorrhagic colitis. Annu. Rev. Microbiol., 41:383–407.

Riley, L. W., Remis, R. S., Helgerson, S. D., McGee, H. B., Wells, J. G., Davis, B. R.,

Hebert, R. J., Olcott, E. S., Johnson, L. M., Hargrett, N. T., Blake, P. A. and

Cohen, M. L. (1983). Hemorrhagic colitis associated with a rare Escherichia coli

serotype. N. Engl. J. Med., 308:681–685.

Rivas, M. (2009). Epidemiology of STEC/ VTEC in South America In: Proceedings of

VTEC, 2009, 7th International symposium on shiga toxin (verocytotoxin) –

producing Escherichia coli Infections. Buenos Aires- Argentina, May, 10-13 : 13.

Robati, R. and Gholami, S. (2013). Estimation of virulence genes of Shiga toxin

producing Escherchia coli from juice purchase and vegetables in Tehran/Iran.

Euro. J. Exp. Bio., 3(2): 457-462.

Robson, W. L. M., Leung, A. K. C. and Kaplan, B. S. (1993). Hemolytic-uremic

syndrome. Curr. Prob. Pediatr., 23:16-33.

Rossi, F., Patricia, G., Bernardo, R., Daniel, C and Michael, J D (2008). Rates of

Antimicrobial Resistance in Latin America (2004-2007) and in vitro Activity

of the Glycylcycline Tigecycline and of Other Antibiotics. BJID., 12(5):405-415.

Ruska, H. (1943). Versuch zu einer Ordnung der Virusarten. Arch. Ges. Virusforsch, 2,

480–498.

Sabir, S., Aftab Ahmad, A., Tayyaba, I., Muhammad Asad, A., Rehman Khan, M and

168

Muhammad, N (2014). Isolation and antibiotic susceptibility of E. coli

from urinary tract infections in a tertiary care hospital Pak. J Med Sci., 30 (2).

Saeed, M.A., Abdul, H., Aamir, A., Mashkoor, M, Saira, B., Ayesha, T., Amna, A.,

Tayyaba, I and Yasra, S (2009). A profile of drug resistance genes and integrons

in E. coli causing surgical wound infections in the Faisalabad region of

Pakistan. The Journal of Antibiotics ., 62: 319–323.

Sahilah, A. M., Nor’ Aishah, H., Noraida, I. and Ahmad Azuhairi, A. (2010). Detection

of shiga toxin 1 and 2 (stx1 and stx2) genes in Escherichia coli O157:H7 isolated

from retail beef in Malaysia by Multiplex Polymerase Chain Reaction (PCR).

Sains Malaysiana, 39(1): 57-63.

Sambrook, J. and Russel, D. W. (2001). Molecular cloning: A Laboratory Manual, 3rd

edn. Vol. 2. Cold Spring Harbor Lab Press, New Yark, 2: 8.1-8.125.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular cloning: A Laboratory

Manual. 2nd ed. Cold Spring Harbor Lab Press, Cold Spring Harbor, New Yark.

Sanchez, S., Lee, M. D, Harmon, B. G., Maurer, J. J. and Doyle, M. P. (2002). Zoonosis

Update: Animal issues associated with Escherichia coli O157:H7. Veterinary

Medicine Today, 221: 1122-1126.

Sands, J.A. and Lowlieht, R.A. (1976). Temporal origin of viral phospholipids of

enveloped bacteriophage. Can. S. Microbiol. 22: 154

Savarino, S. J., Hall, E. R., Bassily, S. and 14 other authors. (2002). Introductory

evaluation of an oral, killed whole cell enterotoxigenic Escherichia coli plus

cholera toxin B submit vaccine in Egyptian infants. Pediatr. Infect. Dis. J., 21:

322-330.

169

Schmidt, H., L. Beutin, and H. Karch. (1995). Molecular analysis of the plasmid-encoded

hemolysin of Escherichia coliO157:H7 strai EDL 933.Infect. Immun. 63:1055–

1061

Schmidt, H., Geitz, C., Tarr, P.I., Frosch, M and Karch, H (1994). Non-O157:H7

pathogenic Shiga toxin-producing Escherichia coli: and genetic profiling of

virulence traits and clonality. Journal of Infectious Diseases 179, 115–123.

Scotland, S. M., Rowe, B., Smith, H.R., Willshaw, G.A and Gross. R.J (1990). Vero

cytotoxin producing strains of Escherichia coli from children with haemolytic

uremic syndrome and their detection by specific DNA probes. J. Med. Microbiol.

25:237–243

Sheng, H., Knecht, H. J., Kudva, I. T. and Hovde, C. J. (2006). Application of

Bacteriophages To Control Intestinal Escherichia coli O157:H7 Levels in

Ruminants. Appl. Environ. Microbiol., 72(8): 5359–5366.

Shukla, S. and Hirpurkar, S. D. (2011). Recovery status of bacteriophages of different

livestock farms of Veterinary College, Adhartal, Jabalpur, India. Veterinary

World, 4(3):117-119.

Silverman, A. I., Peterson, B. M., Boehm, A. B., McNeill, K. and Nelson, K. L. (2013).

Sunlight inactivation of human viruses and bacteriophages in coastal waters

containing natural photosensitizers. Environ. Sci. Technol., 47(4):1870-8.

Singh, P. and Prakash, A. (2008). Isolation of Escherechia coli, staphylococcus aureus

and listeria monocyogenes from milk products sold under market conditions at

agra region. Acta agricultural slovenica., 92(1): 83-88.

170

Sinton, L. W., Hall, C. H., Lynch, P. A. and Davies-Colley, R. J. (2002). Sunlight

inactivation of fecal indicator bacteria and bacteriophages from waste

stabilization pond effluent in fresh and saline waters. Applied and Environmental

Microbiology, 68(3): 1122-1131.

Smith, H. W. and Huggins, M. B. (1982). Successful treatment of experimental

Escherichia coli infections in mice using phage: its general superiority over

antibiotics. J. Gen. Microbiol., 128: 307–318.

Smith, C.J., Olszewski, A.M and Mauro, S.A (2009). Correlation of Shiga toxin

gene frequency with commonly used microbial indicators of recreational

water quality. Appl. Environ. Microbiol. 75: 316–21.

Snyder, J. D. and Merson, M. H. (1982). The magnitude of the global problem of acute

diarrhoeal disease: a review of active surveillance data. Bull World Health Organ,

60: 605–613.

Sohail , M., Mohsin, K., Hafiz. G.M.S., Hasnain, J and Abdul, A. K (2015). Character-

istics and Antibiotic Resistance of Urinary Tract Pathogens Isolated From Punjab,

Pakistan. Jundishapur J Microbiol., 8(7).

Son, I., Binet, R., Maounounen-Laasri, A., Lin, A., Hammack, T. S. and Kase, J. A.

(2014). Detection of five shiga toxin-producing Escherichia coli genes with

multiplex PCR. Food Microbiol., 40: 31-40.

Spencer, R. (1955). A marine bacteriophage. Nature, 175: 690.

Stephan, R and Schumacher, S (2000). Resistance patterns of non-O157 Shiga toxin-

producing Escherichia coli (STEC) strains isolated from animals, food and

asymptomatic human carriers in Switzerland. Letters in Applied Microbiology.,

32:11-117.

171

Sudershan, R.V., Kumar, R.N., Kulkarni, B., Kashinath, L., Bhaskar, V., and Polasa, K.

(2014). E. coli pathotypes and their antibiotic resistance in young children

with diarrhoea in Hyderabad, India. Int.J.Curr.Microbiol.App.Sci 3(9): 647-654.

Suganya, D., Kanimozhi, K. K., Panneerselvam, A. and Dhanapaul, K. (2016). Molecular

characterization of Diarrheagenic Escherichia coli from Tiruchirappalli District,

Tamilnadu, India. India. Int. J. Curr. Microbiol. App. Sci., 5(3): 478-484.

Sulakvelidze, A. (2001) Bacteriophages as therapeutic agents. Ann. Med., 33: 507–509.

Sulakvelidze, A., Alavidze, Z. and Morris, J. G. (2001). Jr: Bacteriophage therapy.

Antimicrob Agents Chemother, 45:649-659.

Summers, W. C. (1999). Felix d’Herelle and the Origins of Molecular Biology. Yale

University Press New Haven, CT.

Summers, W. C. (2001). Bacteriophage therapy. Annu. Rev. Microbiol., 55: 437-451.

Sundvall, P., Marie, E., Ronny, G., Sigvard, M., Nils, R., Lars, J and Peter, U (2014).

Antimicrobial resistance in urinary pathogens among Swedish nursing home

residents remains low: a cross-sectional study comparing antimicrobial

resistance from 2003 to 2012. BMC Geriatrics., 14(30): 1471-2318.

Susan, M. T., Scott-Tucker, A., Cooper, L. M. and Henderson, I. R. (2006). Weapons of

mass destruction virulence factors of the global killer Enterotoxigenic Escherichia

coli. FEMS Microbiol. Lett., 263: 10 20.

Taj, M. K., Ling, J. X., Bing, L. L., Qi, Z., Taj, I., Hassani, T. M., Samreen, Z. and

Yunlin, W. (2014). Effect of dilution, temperature and pH on the lysis activity of

T4 phage against E. coli BL21. J. Anim. Plant Sci., 24(4):1252-1255.

Tanvir, R., Rubeena, H and Shahida, H (2012). Prevalence of Multiple Drug Resistant

172

Escherichia coli in Patients of Urinary Tract Infection Registering at

Diagnostic Laboratory in Lahore, Pakistan. Pakistan J. Zool., 44(3): 707-712.

Tarr, P. I., Gordon, C. A. and Chandler, W. L. (2005). Shiga-toxin-producing Escherichia

coli and haemolytic uraemic syndrome. Lancet, 365(9464): 1073-86.

Tesh, V. L., and A. D. O’Brien. 1991. The pathogenic mechanisms of Shiga toxin and the

Shiga-like toxins. Mol. Microbiol., 5:1817–1822

Thiele, D., Coia, J.E., Hanson, M.F and Thomson, F.M (1990). A comparison of

Immunomagnetic separation, direct culture and polymerase chain reaction for

the detection of verotoxin-producing Escherichia coli O157 in human feces.

J. Med. Microbiol., 44: 219–222.

Toroglu, S., Dincer, S and Hatice, K (2005). Antibiotic resistnace in gram negative

Bacteria isolated from Aksu river in Tuirkey. Annals of Microbiology, 55(3):

229-233.

Tuttle, J., Gomez, T., Doyle, M. P., Wells, J. G., Zhao, T., Tauxe, R. V., et al. (1999).

Lessons from a large outbreak of Escherichia coli O157:H7 infections: insights

into the infectious dose and method of widespread contamination of hamburger

patties. Epidemiol. Infect., 122:185–92.

Twort, F. W. (1915). An investigation on the nature of ultra-microscopic viruses.

Lancet:1241-1243.

Vale, P. F., Sternman, M. and Little, T. J. (2008). Temperature dependent costs of

parasitism and maintenance of polymorphism under genotype by environment

interactions. J. Evol. Biol., 21: 1418-1427.

Vally, H., Hall, G., Dyda, A., et al. (2012). Epidemiology of Shiga toxin producing

173

Escherichia coli in Australia, 2000-2010. BMC Public Health, 12:63.

Vij, A.S., Shashi, C and Jigyasa, S (2014). Two years retrospective study of antibiotic

Resistance pattern of uropathogens especially Escherichia coli in north India.

CIBTech Journal of Microbiology., 3(2): 29-36.

Vinita, R., Umesh and Priyanka, P (2010). Antibiotic Resistance Pattern of Urinary

Tract Isolates of Escherichia coli from Kumaun Region. J. Commun. Dis. 42

(1): 63-66.

Virpari, P. K., Nayak, J. B., Brahmbhatt, M. N. and Thaker. C. H. (2013). Study on

isolation, molecular detection of virulence gene and antibiotic sensitivity pattern

of Escherichia coli isolated from milk and milk products. Vet. World, 6(8): 541-

545.

Vlab.amrita.edu. (2011). Restriction digestion. Retrieved 28 june 2016, from

vlab.amrita.edu/?sub=3&brch=77&sim=694&cnt=1.

Vladimir Pyatov., Irena Vrtkova., and Ales Knoll (2014). Detection of Aminoglycoside,

Sulfonamide and Tetracycline resistance genes in Escherichia coli isolated from

bovine milk samples. MENDELNET.

Vogt, R. L. and Dippold, L. (2005). “Escherichia coli O157:H7 outbreak associated with

consumption of ground beef”. Public Health Rep., 120(2):174-178.

Walsh, C. (2003). Where will new antibiotics come from? Nat. Rev. Microbiol., 1:65-70.

Walters, S.P., Thebo, A. L. and Boehm, A. B. (2011). Impact of urbanization and

agriculture on the occurrence of bacterial pathogens and stx genes in coastal

waterbodies of central California. Water Res. 45: 1752–1762.

Weinbauer, M. G. (2004). Ecology of prokaryotic viruses. FEMS Microbiol. Rev., 28:

174

127–181.

Wetzel, A. N. and LeJeune, J. T. (2006). Clonal dissemination of Escherichia coli

O157:H7 subtypes among dairy farms in northeast Ohio. Appl. Environ.

Microbiol., 72(4), 26216.

Wildy, P. (1971). Classification and nomenclature of viruses. First Report of the

International Committee on Nomenclature of Viruses. S. Karger, Basel.

William A. Petri Jr., Mark Miller, Henry J.Binder, Myron M. Levine, Rebecca

Dillingham and Richard L. Guerrant. (2008). Enteric infections, diarrhea, and

their impact on function and development. J. Clin. Invest., 118: 1277 1290

World Health Organization. (1998). Zoonotic non-O157 shiga toxin producing

Escherichia coli (STEC). Report of a WHO scientific Working Group Meeting.

WHO/CSR/APH/98.8. Geneva, Switzerland.

World Health Organization. (2011). Enterohaemorrhagic Escherichia coli.

Zakeri, A. and Kashefi, P. (2012). Antimicrobial susceptibilities of avian Escherichia coli

isolates in Tabriz, Iran. Afr. J. Biotechnol., 11(9): 4467-4470.

Zaman, S. F. J. and Arip, Y. M. (2012). Isolation and characterization of phage specific

to E. coli O157:H7. Proceedings of The 2nd Annual International Conference

Syiah Kuala University 2012 and The 8th IMT-GT Uninet Biosciences

Conference, Banda Aceh, 22-24 November 2012.

Zende, R. J., Chavhan, D. M., Suryawanshi, P. R., Rai, A. K. and Vaidya, V. M. (2013).

PCR detection and serotyping of enterotoxigenic and shigatoxigenic Escherichia

coli isolates obtained from chicken meat in Mumbai, India. Vety. World., 6(10):

770-773.

175

Zhang Y, Laing C, Steele M, Ziebell K, Johnson R, Benson AK, et al. (2007). Genome

evolution in major Escherichia coli O157:H7 lineages. BMC Genomics, 8: 121.

Zinnah, M. A., Bari, M. R., Islam, M. T., Hossain, M. T., Rahman, M. T., Haque, M. H.,

Ruma, S. R. P. and Islam, M. A. (2007). Characterization of Escherichia coli

isolated from samples of different biological and environmental sources. Bangl.

J. Vet. Med., 5(1 and 2): 25-32.

Zinnah, M.A., Haque, M.H., Islam, M.T., Hossain, M.T., Bari, M.R., Babu, S.A.M.,

Rahman, M.T and Islam, M.A (2008). Drug sensitivity pattern of Escherichia

coli isolated from samples of different biological and environmental sources.

Bangl. J. Vet. Med., 6 (1): 13–18.

176

ANNEXURE- I

Medium gm / L

Tryptic soya broth

Casein enzymic hydrolysate 17.00 g

Peptic digest of soyabean meal 3.00 g

Sodium chloride 5.00 g

Dipotassium phosphate 2.50 g

Dextrose 2.50 g

pH 7.3±0.2

Tryptic soya agar

EMB agar

Peptic digest of animal tissue 10.00 g

Dipotassium phosphate 2.00 g

Lactose 5.00 g

Sucrose 5.00 g

Eosin-Y 0.40 g

Methylene blue 0.065 g

Agar 13.50 g

Luria Bertani broth

Casein enzymatic hydrolate 1.50 g

Yeast extract 5.00g


pH 7.5±0.2

Casein enzymatic hydrolysate 15.0 g

Agar 15.0 g

Soyatone (soya peptone) 5.0 g


pH 7.3±0.2

177

Muller-Hinton agar

Beef, infusion from 300.0 g

Casein acid hydrolysate 17.50 g

Agar 17.00 g

Starch 1.50 g

pH 7.3±0.2

MacConkey agar


Casein enzymatic hydrolate 1.50 g

Pancreatic digest of gelatine 17.00 g

Lactose 10.00 g

Bile salts 1.50 g


Crystal violet 0.001 g

Neutral red 0.03g

Agar 15.00 g

Sorbitol MacConkey agar


Spdium chloride 5.00 g

Potassium peptone 3.00 g

Biles salt 1.50 g

Neutral red 0.03 g

Crystal violet 0.001

178

ANNEXURE – II

1. Indole test

This test demonstrates the ability of certain bacteria to decompose the amino acid

tryptophane to indole which accumulates in the medium.

Medium

Peptone (containing sufficient tryptophane) 20.0 g

Sodium chloride (NaCl) 5.0 g

Distilled water 1000 ml

Adjust the pH to 7.4 dispense and sterilize by autoclaving at 1210C for 15 minutes.

Kovac’s reagent composition

Amyl or isoamyl alcohol 150.0 ml

P-Dimethyl-amino benzaldehyde 10.0 g

Concentrated Hydrochloric acid 50.0 ml

Dissolve the aldehyde in the alcohol and slowly add the acid. Prepare in small

quantities and store in the refrigerator. Shake gently before use.

Method

Inoculate the medium and incubate for 48 hours at 370C. Sometimes a period of 96

hours at 370C may be required for optimum accumulation of indole. Add 0.5 ml Kovac’s

reagent and shake gently. A red colour ring in the alcohol layer indicates a positive

reaction.

2. Methyl red test

The methyl red test media is employed to detect the production of sufficient acid

during the fermentation of glucose.

179

Medium

Peptone (Glucose phosphate peptone water) 5.0 g

Dipotassium hydrogen phosphate 5.0 g


Glucose 10% solution 50.0 ml

Dissolve the peptone and phosphate, adjust the pH to 7.6, filter dispense in 5ml amounts

and sterilize at 1210C. for 15 min. sterilize the glucose solution by filtration and add 0.25

ml to each tube (final concentration 0.5%).

Methyl red indicator solution

Methyl red 0.1 g

Ethanol 300 ml


Method

Inoculate the liquid medium lightly from a young agar slope culture and incubate

at 370C for 48 hours. Add about five drops of the methyl red reagent. Mix and read

immediately. Positive tests are bright red and negative tests are yellow. If the results after

48 hours are equivocal, the test should be repeated with cultures that have been incubated

for 5 days. For some organisms, incubation at 300C for 5 days is preferable to incubation

at 370C for 2 or 5 days.

3. Voges – Proskauer test

This is test usually done in conjunction with methyl red test. Since the production

of acetyl methyl carbinol or butylenes glycol usually results in insufficient acid

accumulating during fermentation to give a methyl red positive reaction.

Medium

Glucose phosphate peptone water as for methyl red test.

180

Method

Incubate at 370C or 300C for 48 hours. Add 1ml of 40% potassium hydroxide and 3

ml of 5% solution of α –naphthalene absolute ethanol. A positive reaction is indicated by

the development of a pink colour in 2 – 5 minutes, becoming in crimson in 30 min. the

tube can be shaken at intervals to ensure maximum aeration.

4. Citrate utilization test

This is a test for the ability of an organism to utilize citrate as the sole carbon and

energy source for growth and an ammonium salt as the sole source of nitrogen.

Simmons medium

Simmons citrate medium is modification of the Koser’s medium with agar and

indicator added.

Koser’s medium 1000 ml

Agar 20.0 g

Bromothymol blue (0.2%) 40.0 ml

Dispense, autoclave at 1210C for 15 min and allow to set slopes.

Method

Inoculate from a saline suspension of the organism to be tested. Incubate for 96

hours at 370C. Positive reaction indicates the blue colour and streak of growth and

negative reaction indicates the original colour and no growth.

5. Triple sugar iron agar test

Triple Sugar Iron Agar (TSI Agar) is used for the differentiation of gram-negative

enteric bacilli based on carbohydrate fermentation and the production of hydrogen

sulphide.

181

TSI Agar contains three sugars (dextrose, lactose and sucrose), phenol red for

detecting carbohydrate fermentation and ferrous ammonium sulphate for detection of

hydrogen sulphide production (indicated by blackening in the butt of the tube).

Medium


Casein enzymatic hydrolysate 10.0 g

Yeast extract 3.0 g

Beef extract 3.0 g

Lactose 10.0 g

Sucrose 10.0 g

Dextrose 1.0 g

Ferrous sulphate 0.2 g


Sodium thiosulphate 0.3 g

Phenol red 0.024 g

Agar 12.0 g


pH 7.4±0.2

Method

To inoculate, carefully touch only the center of an isolated colony on an enteric

plated medium with a cool, sterile needle, stab into the medium in the butt of the tube,

and then streak back and forth along the surface of the slant. Several colonies from each

primary plate should be studied separately, since mixed infections may occur.

Incubate with caps loosened at 35°C and examine after 18-24 hours for

carbohydrate fermentation, gas production and hydrogen sulphide production. Any

combination of these reactions may be observed. Do not incubate longer than 24 hours

182

because the acid reaction in the slant of lactose and sucrose fermenters may revert to an

alkaline reaction.

Results

Compare reactions produced by the unknown isolate with those produced by the

known control organisms.

A yellow (acidic) colour in the slant and butt indicates that the organism being

tested ferments dextrose, lactose and/or sucrose.

A red (alkaline) colour in the slant and butt indicates that the organism being

tested is a non-fermenter.

Hydrogen sulphide production results in a black precipitate in the butt of the

tube.

Gas production is indicated by splitting and cracking of the medium.

6. Rapid Urease test broth

Rapid Urease test broth is recommended for rapid detection of urease production.

Medium

Yeast extract 0.10 g

Urea 20.0 g

Monopotassium phosphate 0.091 g

Disodium phosphate 0.095 g

Phenol red 0.010 g

pH 6.8±0.2

Suspended 20.30 g in 1000 ml distilled water, mixed well and sterilized by filtration. Do

not autoclaved or heat the medium. Dispensed in sterile tubes.

Method

Inoculate from a saline suspension of the organism to be tested. Incubate at 370C

overnight. Positive reaction indicates the cerise colour and negative reaction indicates the

original colour.

183

7. Motility test

Motility test medium is recommended for detection of bacterial motility.

Medium

Tryptose 10.0 g


Agar 5.0 g


Final pH (at 250C) 7.2±0.2

Dissolve the contents in distilled water, adjust the pH to 7.2±0.2 and make up the

volume to 1000 ml with distilled water. Dispense in tubes and sterilize at 1210C for 15

min. Allow tubed medium to cool in an upright position.

Method

Inoculation is done by stabbing through centre of the medium. Incubate at 370C

for 24 h. Non-motile organisms grow only along the line of inoculation whereas motile

organisms grow away from the line of inoculation or may show growth even throughout

the medium. If the results after incubation are weak or equivocal, then the motility should

be confirmed by flagellum strain or by direct wet microscopy (hanging drop method).

7. Gram’s stain

A. Ammonium oxalate crystal violet

Solution 1:

Crystal violet 2.0 g

Ethyl alcohol (95 per cent) 20.0 ml

Solution 2:

Ammonium oxalate 0.8 g

184

Distilled water 80.0 ml

Solution 1 and 2 was mixed well and then filtered.

B. Gram’s iodine solution

Iodine 1.0 g

Potassium iodine 2.0 g

The ingredients were dissolved in distilled water to make total

volume of 300 ml and filtered.

C. Acetone or Ethyl alcohol (decolourizer)

D. Safranin (counter stain)

Safranin-O (2.5 per cent solution) in

95 per cent alcohol

10.0 ml

Distilled water 100.0 ml

185

ANNEXURE-III

1. Ethydium bromide (1%)

Ethydium bromide 1 g


2. Phenol: Chloroform: Isoamyl alcohol

Phenol 25 ml

Chloroform 24 ml

Isoamyl alcohol 1 ml

3. TBE (1X)

Tris base 10.8 g

Boric acid 5.5 g

EDTA Disodium salt 0.76 g

The ingredients were dissolved in distilled water to make up total volume of 1000 ml

4. Agarose gel loading buffer (6X)

Bromophenol blue 0.25% (w/v)

Xylene cyanol FF 0.25% (w/v)

Ficoll 15% (w/v), (Type 400; Pharmacia)

Dissolved in appropriate volume of deionized water

5. TE buffer (pH 8.0)

Tris base 0.06 g

EDTA 0.0075 g

Deionized water up to 50 ml

186

6. SM buffer

Reagent Amount Final concentration

Sodium chloride (NaCl) 5.8 g 100 mM

Magnesium sulphate (MgSO4.7H2O) 2 g 8 mM

Tris-Cl (1 M, pH 7.5) 50 ml 50 mM


Dissolved the NaCl and MgSO4.7H2O in 800 ml of distilled water, added the Tris-Cl and

adjusted the volume to 1000 ml with distilled water. Sterilized the buffer by autoclaving

for 20 min at 15 psi on liquid cycle and allowed to cool. The SM buffer was stored

indefinitely at room temperature.

187

ANNEXURE-IV

Table. 1: Isolation of E. coliphage from sewage samples

S.no Location of the organized, unorganized dairy

farm and animal sheds

Isolation of

bacteriophages against

E. coli

1. Organized farm, C.V.Sc, Tirupati +

2. Animal shed-1, Vidyanagar ---

3. Animal shed-2, Vidyanagar ---

4. Animal shed, Thummalagunta ---

5. Organized farm-1, S.V. Goshala, Tirupati ---

6. Organized farm-2, S. V. Goshala, Tirupati +

7. Organized farm-3, S. V. Goshala, Tirupati ---




11. Animal shed-1 Peruru +

12. Animal shed-2, Peruru ---

13. Unorganized farm, Peruru +

14. Animal shed-1, Perumalla palli ---

15. Unorganized farm, Perumalla palli ---

16. Unorganized farm-1, Pudhipatla +

17. Animal shed-1, Pudhipatla ---

18. Animal shed-2, Pudhipatla +

19. Animal shed-3, Pudhipatla ---

20. Unorganized farm-2, Pudhipatla ---

21. Animal shed-2, Perumalla palli ---

22. Unorganized farm-1, Srinivasamangapuram (S.M

puram) ---

23. Animal shed-1, S.M puram +

24. Animal shed-2, S.M puram ---

25. Unorganized farm-2, S.M puram ---

26. Unorganized farm-3, S.M puram +

27. Organized farm-1, S.M puram ---

28. Animal shed-1, Thondawada ---

29. Animal shed-2, Thondawada +

30. Unorganized farm- Thondawada ---

31. Organized farm-2 S.M puram +

32. Animal shed-1, Kaluru ---

33. Animal shed-2, Kaluru ---

188

34. Unorganized farm- Nerabaily ---

35. Animal shed-Nerabaily ---

36. Animal shed- Lakshmipuram ---

37. Organized farm, Varadhayapalem ---

38. Animal shed, Mallavaram ---

39. Organized farm-1, Iskan temple, Tirupati ---

40. Organized farm-2, Iskan temple, Tirupati ---

41. Animal shed-1, Anuru ---

42. Animal shed-2, Anuru +

43. Animal shed-1, Ksheerasaagaram ---

44. Unorganized farm, Ksheerasaagaram ---

45. Animal shed-2, Ksheerasaagaram ---

46. Animal shed, Chokkamadugu ---

47. Animal shed-1, Pulluru ---

48. Animal shed-2, Pulluru ---

49. Unorganized farm, Pulluru ---

50. Organized farm-1, L R S, Palamaneru ---

51. Animal shed-1, Katikepalli +

52. Animal shed-2, Kaikepalli ---

53. Organized farm-2, L R S, Palamaneru +

54. Animal shed-1, Medawada ---

55. Unorganized farm-1, Medawada +

56. Animal shed-2, Medawada ---

57. Unorganized farm-1, Dwarakanagar ---

58. Animal shed, Dwarakanagar +

59. Unorganized farm-2, Dwarakanagar ---

60. Organized farm-3, L R S, Palamaneru ---

61. Animal shed-1, Chinnatayyar ---

62. Animal shed-2, Chinnatayyar ---

63. Organized farm, Near Bhakarapeta ---

64. Animal shed, Mangunta +

65. Animal shed-1, Kollagunta ---

66. Animal shed-2, Kollagunta ---

67. Animal shed, V.V.puram ---

68. Unorganized farm-2, Medawada ---

69. Animal shed, Padhmapuram ---

70. Animal shed-1, Srirangarajapuram ---

71. Animal shed-2, Srirangarajapuram ---

72. Unorganized farm, Srirangarajapuram ---

73. Animal shed, Pathapalem ---

74. Organized farm, Bangarupalem ---

75. Organized farm, Putturu ---

189

76. Unorganized farm-1, Kaapukandreega ---

77. Unorganized farm-2, Kaapukandreega ---

78. Animal shed, Kaapukandreega ---

79. Organized farm-1, Srikalahasthi ---

80. Animal shed, DK maripalli ---

81. Unorganized farm, DK maripalli ---

82. Animal shed-1, Venugopalapuram +

83. Animal shed-2, Venugopalapuram ---

84. Organized farm-2, Srikalahasthi ---

85. Unorganized farm, Repalli ---

86. Animal shed, Repalli ---

87. Organized farm, Kollagunta ---

88. Animal shed-1, GMR puram ---

89. Animal shed-2, GMR puram ---

90. Organized farm, Yeguva kamma kangreega ---

91. Unorganized farm, Maddikuppam ---

92. Animal shed, Maddikuppam ---

93. Animal shed, Dasarigunta ---

94. Unorganized farm, Dasarigunta ---

95. Animal shed-1, Venkatapuram +

96. Animal shed-2, Venkatapuram ---

97. Animal shed, Kothapalli mitta ---

98. Unorganized farm, Kothapalli mitta ---

99. Animal shed, CK puram ---

100. Unorganized farm, CK puram ---

101. Organized farm, R.K.V.B peta ---

102. Animal shed-1, Settivanattem ---

103. Animal shed-2, Settivanattem ---

104. Organized farm, Aarimakula palli ---

105. Animal shed, Aarimakula palli ---

106. Animal shed, Vadamalapeta ---

107. Unorganized farm, Vadamalapeta +

108. Animal shed, Thaduku ---

109. Organized farm, Krishna ramapuram ---

110. Organized farm, Jeevakona ---

111. Animal shed, Parameswara mangalam ---

112. Animal shed, Vepagunta ---

113. Unorganized farm, Vepagunta ---

114. Organized farm, Rajula kangreega ---

115. Unorganized farm-1, M. kothuru ---

116. Unorganized farm-2, M. kothhuru ---

117. Animal shed, Chinthamandi ---

118. Unorganized farm, Chinthamandi ---

190

119. Animal shed-1, VKR puram +

120. Animal shed-2, VKR puram ---

121. Unorganized farm, Gundrajukuppam ---

122. Animal shed, Gundrajukuppam ---

123. Organized farm, S.S konda ---

124. Animal shed, Adavikothuru ---

125. Unorganized farm, Mudipalli ---

126. Animal shed, SS konda ---

127. Animal shed, Therani +

128. Unorganized farm, Inam bakham ---

ISOLATION AND CHARACTERIZATION OF LYTIC …...iii CERTIFICATE This is to certify that the thesis...

Documents

Transcript of ISOLATION AND CHARACTERIZATION OF LYTIC …...iii CERTIFICATE This is to certify that the thesis...