Download - Biotechnology applications

Transcript

Application of Techniques

Biotechnology

Applications of molecular genetic techniques

Recombinant DNA – Fig 20.1, 20.2Gene Cloning – Fig 20.3, 20.4cDNA library (MaCS only) – Fig 20.5DNA Fingerprinting using:

RFLP (restriction enzyme) PCR (OSC lab)

Recombinant DNA

DNA in which genes from two different sources (often different species) are combined in vitro into the same molecule

Method: Restriction enzymes Sticky ends on restriction fragment can

form complementary basepairs with single-stranded stretches on other DNA molecules that have been cut with the same enzyme

http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/bx15_01.jpg

Gene Cloning

Making multiple copies of a single gene

Step 1: Ligation Step 2: Transformation &

AmplificationStep 3: Selection

http://tainano.com/Molecular%20Biology%20Glossary.files/image053.gif

Fig. 20.1

Gene cloning step 1 LigationForming Recombinant DNALigation: gene of interest

inserted into a vectorCloning vector: a

plasmid into which the gene of interest is introduced

Plasmid: small circular DNA found in bacterial cells that is not the chromosomal DNA

Fig. 20.3

Gene cloning step 1 LigationForming Recombinant DNASteps:Restriction enzyme digestion:

of cloning vector at cloning site to remove gene of interest

Insert gene of interest into vector add DNA ligase to bond gene with vector

Cloning vector components

Cloning site: Where gene of interest will be inserted Where transcription can occur because

contains an upstream promoter Usually found in the middle of the lacZ gene

which is responsible for making the enzyme β-galactosidase

Antibiotic resistance gene: Selection for host cells that have resistance

Replication origin: allows plasmid to replicate in the host cell

Example of a Cloning Vector

Ligate the gene of interest into the vector such that it interrupts the genes responsible for making the enzyme β–galactosidase.

Gene Cloning Step 2 TransformationAmplify the recombinant DNA in vivoSteps:Transform

recombinant DNA into bacterial cell

Grow bacteria in a large batches (flasks)

As bacterial cells multiply, the gene of interest will be replicated with each cell

Gene Cloning Step 3SelectionSelection: Identify colonies of bacteria

containing the recombinant DNA with gene of interest

Possible bacterial clone products: A. bacteria without vector B. bacteria with vector without the gene C. bacteria with vector with the wrong gene D. bacteria with vector with the correct

gene

Plating and selecting colonies

Plating: taking a sample of the bacteria and growing them on plates

Plates have a medium containing: Antibiotics X-gal

Gene Cloning Step 3Selection Mechanisms

A. Select for bacterial clones that contain a vector (select for proper transformation)

Vector confers antibiotic resistant to bacterial because the vector contains an antibiotic resistant gene

Cells that transformed the vector will live

Antibiotic Resistance Bacteria are

grown on Petri plate containing a specific antibiotic (e.g. amplicillin).

Only bacteria which properly transformed (accepted the vector) will grow.

Selection for properly transformed cells containing vector

http://www.biotechlearn.org.nz/var/biotechlearn/storage/images/themes/from_genes_to_genomes/images/bacterial_transformation/4063-1-eng-AU/bacterial_transformation_large.jpg

Gene cloning step 3Selection Mechanisms

B.Select for bacterial clones that contain a vector and an inserted gene (proper ligation)

plasmids contain lac Z gene that codes for the β-galactosidase (β-gal)

β-gal acts on X-Gal (a clear soluble substrate) to produce a blue precipitate

β-galactosidase Reaction

X-gal (colourless)

5-bromo-4-chloro-3-hydroxyindole galactose

5,5'-dibromo-4,4'-dichloro-indigo, an intensely blue product which is insoluble

Spontaneous dimerization & oxidation

hydrolysis

β-galactosidase Screening

Bacteria are grown on Petri plates containing X-Gal.

Plasmids that have a gene inserted into the right place won’t have a functional β-gal enzyme.

These bacteria, when grown in X-gal, cannot process it and stays white.

β-galactosidase Screening

Bacteria which did not accept the new plasmid will have a working β-gal that will process X-gal into a blue product.

Gene cloning step 3Selection Mechanisms

C.Select for bacterial clones that contain the vector with the gene of interest

Perform DNA hybridization Make a paper blot of the

clones add probes complementary to

the gene of interest Visualize blot to see which

clones “light up” Match blot with cells on Petri

dish to choose the appropriate clones

Cloning Applications

Transgenic plantsPlants cells can also take in bacterial

plasmids.

Flavr Savr TomatoesBt toxin – natural herbicide

Animation: Gene cloning

http://www.sumanasinc.com/webcontent/animations/content/plasmidcloning.html

http://highered.mcgraw-hill.com/olc/dl/120078/micro10.swf

Genomic Library A collection of genes A complete set of recombinant plasmids

clones each carrying copies of particular segment of the genome (comprehensive)

However process of generating library can cut up genes because restriction enzymes do not respect gene boundaries (shotgun approach)

Animation: http://www.sumanasinc.com/webcontent/animations/content/dnalibrary.html

cDNA Library

cDNA = complementary DNAReverse transcribed from mRNAAnimation: Making a cDNA

http://highered.mcgraw-hill.com/olc/dl/120078/bio_h.swf

Refer to Fig 20.5http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/cdna.gif

Animation: Application of cDNA Chip technology

http://www.sumanasinc.com/webcontent/animations/content/dnachips.html

Microarrayhttp://highered.mcgraw-hill.com/olc/dl/120078/micro50.swf

Restriction Fragment Length Polymorphism (RFLP) An historic method for DNA fingerprinting Polymorphism:

Root word from Greek for “many forms” Differences in DNA sequences found among

the individuals in a population (e.g. alleles) Restriction fragment length

polymorphism: differences in DNA sequence on homologous

chromosomes that result in different DNA fragments when cut by a restriction enzyme

Most frequently found on noncoding regions

Polymorphism example Cut with EcoRI at restriction site: GAATTC Target sequence (probe): GCATGCATGCATGCATGCATG

Jack’s DNA sequence at a specific locus:First copy: Total length of fragment = ??? kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = ??? kb-GAATTC(3kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-

Jill’s DNA sequence at the same specific locus:First copy: Total length of fragment = ??? kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = ??? kb-GAATTC(1.2kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-

Polymorphism example Cut with EcoRI at restriction site: GAATTC Target sequence (probe): GCATGCATGCATGCATGCATG

Jack’s DNA sequence at a specific locus:First copy: Total length of fragment = 12.4kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = 4.3kb-GAATTC(3kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-

Jill’s DNA sequence at the same specific locus:First copy: Total length of fragment = 12.4kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = 2.5kb-GAATTC(1.2kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-

Identify fragment lengths on gel electrophoresis

Examples of DNA Fingerprints

RFLP Analysis

Individuals can be identified by looking at the polymorphisms

method only works when the sequence you are looking for contains the restriction site

RFLP overview 1. Restriction enzyme digestion: cut DNA in small fragments

2. Gel electrophoresis: separate fragments by size

3. Southern blotting: immobilize fragments

4. Hybridization: radioactive probe binding to fragments of interest

5. Autoradiography: visualizing the fragments of interest

http://static.ddmcdn.com/gif/dna-profiling.jpg

Animation: RFLP DNA Fingerprinting

http://highered.mcgraw-hill.com/olc/dl/120078/bio20.swf

Modern DNA Fingerprinting RFLP has disadvantages because you

can end up with too many fragments after cutting with the restriction enzyme

Modern approach is to use PCR to amplify the specific locus of interest E.g. OSC DNA Fingerprinting lab

Both require visualizing differences in fragment size by using gel electrophoresis

Using PCR to generate DNA Fingerprint

1. PCR: primers amplify the fragment of interest

2. Gel electrophoresis: separate fragments by size

3. No need to transfer to paper

4. Since PCR primers only amplifies fragment of interest, no need to hybridize a probe to locate fragment

5. Take a picture of the gel

XX

PCR

fewer bands

No x-ray film, just a picture

DNA Fingerprinting ApplicationPaternity testing: identifying the

father Animation:

http://www.sumanasinc.com/webcontent/animations/content/paternitytesting.html

Criminal cases: eliminating suspects Identifying a corpse

Ontario Science CentreDNA Fingerprinting LabGeneral ProceduresLab ReportThings you should know by the end

of the lab

General Procedures Isolate DNA from hair cells Use primers and PCR to amplify a specific

noncoding region on your chromosome Use gel electrophoresis to separate the

PCR fragment(s) by size Visualize the gel Determine whether you are homozygous

or heterozygous and the allele frequency (how “common or unique” you are relative to the general population)

DNA Isolation

Why take the hair sheath? What is the component of the shaft?

What is the function of Chelex? proteinase K?

Why incubate at 65oC? 100oC? What is vortexing? What was the

purpose for each time the sample was vortexed?

Why centrifuge? What is in the supernatant? pellet?

PCR

Why are certain items kept on ice? Which items are kept on ice?

What is the content of the master mix?

What is the function of MgCl2? buffer?

What is the name of the PCR machine?

Gel electrophoresis

What is the purpose of the buffer? Why is a polyacrylamide gel used

instead of agarose? What is resolving power? What are the components of the loading

dye? What are each of their functions? What is a DNA ladder? Why is it

necessary? Why is it necessary to stain the gel?

What was used as the stain?

Analysis What does D1S80 mean? How many repeats exist at this locus (it’s a

range)? How many bp make up the repeat? Given a sequencing gel, determine the

length and sequence of repeats. Given a gel and a DNA ladder, determine

the size of the DNA fragment. Given a gel, determine if an individual is

homozygous or heterozygous and their allele frequency.

Given allele frequencies, calculate genotypic frequencies. Express answers in fractions and in numbers of individuals.

General Why use disposable tips? When should a

tip be replaced with a new one? How do you read a micropipette? How do

you set the correct volume? What does the number at the top of the micropipette indicate?

How do you use a micropipette? What are the functions of the two stops?

What does aliquot mean? What is a VNTR? Describe at least 4 applications of DNA

fingerprinting.