Enterotoxin gene profiles of Staphylococcus aureus isolated from

clinical and sub-clinical isolates in Pakistan

Sadia Liaquat*, Ammara Khalid

Department of Bioinformatics and Biotechnology, Government College University

Faisalabad (GCUF), Faisalabad-38000, Pakistan

*Corresponding Author

ABSTRACT

Staphylococcus aureus is a common pathogen that colonizes and produces sickness in people

and domestic animals. It is the second leading cause of bacteremia and carries a mortality rate of

20 to 40%. S. aureus produces many toxins including enterotoxins which are critical in the

development of disease due to their super-antigenicity. Staphylococcal enterotoxins is the main

cause of staphylococcal food poisoning (SFP) resulting from ingestion of contaminated food

with preformed enterotoxins. The enterotoxins genes showed diversity among S. aureus strains

circulating around the world. To date, no comprehensive report is available related to the

prevalence of the enterotoxins in S. aureus isolates from Pakistan. Therefore, this study was

planned to investigate the distribution of enterotoxin genes among local isolates of S. aureus.

The present studies emphasized on 11 staphylococcal enterotoxins encoding genes (sea, seb, sec,

sed, see, seg, seh, sei, selJ, selP, ser). Different samples including sub-clinical (milk, dairy

products, juices and ready to eat foods) and clinical (nasal, urine, blood, stool and pus) were

collected for the isolation of S. aureus. After biochemical and molecular identification of S.

aureus isolates, the selected enterotoxins encoding genes were detected by PCR. More than

enterotoxins genes were detected in one or more local isolates of S. aureus. Overall 21 different

enterotoxin gene profiles were observed in our local isolates of S. aureus. The most prevalent

enterotoxin gene was sei (30.1%) followed by seb (15.5%), sec (13.5%), sea (12.6%), seg

(5.8%), selP (4.85%) and sed (3.88%). This study provided basic knowledge about the virulence

potential and super-antigenicity of our clinical and subclinical S. aureus isolates.

Key words: Staphylococcus aureus, enterotoxins, staphylococcal food poisoning, clinical, sub clinical

Introduction

Staphylococcus aureus is one of the common pathogen associated with severe diseases and

considered as a major public health threat around the world (Pesavento et al., 2007). Due to its

virulence potential S. aureus produces many heat stable toxins including staphylococcal

enterotoxins, exfoliative toxins and toxic shock syndrome toxins (Ferry & Etienne, 2009).

Amongst all protein toxins the most virulent toxin is Staphylococcal enterotoxins.

Staphylococcal enterotoxins have been divided into classical enterotoxins and enterotoxins like

proteins according to their serological natures (Argudín et al., 2010). Many studies have been

revealed that classical enterotoxins started from sea to see are the main cause of staphylococcal

food poisoning throughout the world (Balaban & Rasooly, 2000; Cha et al., 2006; Kérouanton et

al., 2007; Schmid et al., 2009; Veras et al., 2008; Wieneke et al., 1993). After oral administration

in primate model enterotoxins like proteins seg, seh, sei, ser, ses and set also showed the emetic

activity (Chiang et al., 2008; Omoe et al., 2005). Staphylococcal food poisoning is an

intoxication that occurs in the results of feeding contaminated foods (Jan Kluytmans et al.,

1997). Signs of the disease is vomiting, nausea, abdominal pain and diarrhea within 2-6 hours

(Balaban & Rasooly, 2000; Tranter, 1990) . Twenty two Staphylococcal enterotoxins have been

reported which cause food borne diseases in human due to the ingestion of contaminated foods

such as septicemia, food poisoning and toxic shock syndrome (Archer & Young, 1988;

Garthright et al., 1988; Olsen et al., 2000; Ortega et al., 2010; Yang et al., 2009). Staphylococcal

enterotoxins are resistant to extreme environmental condition like high temperature, high salt

concentration and high pH and proteolytic enzymes such as pepsin or trypsin (Kadariya et al.,

2014). Natural habitats of S. aureus are hands and nose, which is the major reason to spread the

food poisoning in humans through respiratory tract and improper handling (Fratamico et al.,

2005; JAJW Kluytmans & Wertheim, 2005). Uniplex PCR has been used for the detection of 11 staphylococcal enterotoxins encoding genes (sea, seb, sec, sed, see, seg, seh, sei, selJ, selP, ser)

(Blaiotta et al., 2004). The enterotoxins genes showed great diversity among S. aureus strains

circulating around the world. To date, no comprehensive report is available related to the

prevalence of the enterotoxins in S. aureus isolates from Pakistan. Therefore, this study was

planned to investigate the distribution of enterotoxin genes among local isolates of S. aureus.

Materials and Methods:

Sample collectionIn the period from September 2016 to June 2017, a total 200 samples including clinical

specimens (nasal, sputum, fluid, urine, blood, pus, semen, ear swab) and Subclinical samples

(milk, juices and ready to eat foods) were collected aseptically from various clinical laboratories

and zones of Faisalabad. Sterile release safe vessels were utilized for accumulation and

transportation of specimens and protected into 0.6 % nutrient agar in tryptic soya broth (TSB).

Isolation of S. aureusHemolysis on blood agar

All the isolates were tested for hemolysis on blood agar plate for overnight incubation at 37°C

(Ahmady & Kazemi, 2013). Blood agar plate prepared as 28 g of nutrient blood agar and 15 ml

of 5% of asceptic blood in 1 L distilled water. The results of hemolysis are recorded as α

hemolysis, β hemolysis, both α + β hemolysis and γ- hemolysis.

Mannitol salt agar plate

For confirmation of S. aureus picked up the colonies which produce β hemolysis and grow on

another media mannitol salt agar plate for overnight incubation at 37°C (Ahmady & Kazemi,

2013). Mannitol salt agar prepared as 111.1 g of mannitol salt agar powder in 1 L of distilled

water. Results of mannitol salt agar plates recorded as yellowish colonies. Then Isolates sub

cultured in tryptic soya broth (TSB).

Biochemical Identification S. aureusCatalase test

For identification of S. aureus catalase test was performed. Picked the S. aureus colonies and

dipped into the 3 % of hydrogen per oxide. If the bubbles are formed than it indicates the S.

aureus (Ahmady & Kazemi, 2013).

Coagulase test

For more identification of S. aureus coagulase test was performed. Pick up the colony of S.

aureus and mix with kit of coagulase (OXOID, UK) (Kateete et al., 2010).

DNA extraction

After isolation and identification genomic DNA was extracted using standard phenol chloroform

extraction method (Sambrook et al., 1989).

Molecular Assay

PCR amplification of 16sRNA and nuc was used as a conformational test of S. aureus (Brakstad

et al., 1992; Kateete et al., 2010). 25 ul of reaction mixture was prepared. The reaction mixture

contained 1 ul each of the nuc forward and reverse primer(5’-

GCGATTGATGGTGATACGGTT-3’and 3’AGCCAAGCCTTGACGAACTAAAGC – 5’

respectively), 16sRNA forward and reverse primer (5’- F-

AACTCTGTTATTAGGGAAGAACA-3’ and

3’- CCACCTTCCTCCGGTGATACGGTT- 5’respectively) see the Table 1 and Table 3.

Table 1: List of PCR ingredients

PCR amplification of both primers is done using Thermo cycler (BIO-RAD, Singapore) under

the optimized conditions initial denaturation at 94 °C for 5 min followed by 30 cycles and each

cycle has denaturation at 94 °C for 30 sec, annealing at 50 °C for 30 sec, extension at 72 °C at 30

Sr No PCR Reaction Ingredients Quantity per Reaction

1 10X Taq Buffer +KCl –MgCl2 2.5 µl

2 25Mm MgCl2 1.5 µl

3 2mM dNTPs 1 µl

4 Forward Primer 1 µl

5 Reverse Primer 1 µl

6 Taq Polymerase 0.2 µl

7 10 mM Tris Buffer 13µl

8 Genomic DNA as a template (diluted) 5µl

sec and final extension at 72 °C for 5 min. After amplification PCR amplicons were mixed with

2 ul of loading dye and electrophoresed in 2 % of agarose gel in TBE (Tris- Borate- EDTA)

buffer.

Polymerase chain reaction (PCR) technique was used to detect the 11 enterotoxin gene (sea, seb,

sec, sed, see, seg, seh, selJ, ser, sei, selP) see the Table 1 and Table 2 below.

Table 2 : List of enterotoxin gene primers with their product size and PCR profile

Gene Primer sequence 5’ to 3’

Annealing

Temperatur

e(C)

Pcr product

size (bps)

References

SeaF-GCAGGGAACAGCTTTAGGCR-

GTTCTGTAGAAGTATGAAACACG50 520

(Monday &

Bohach, 1999a)

Seb

F-GTATGATGATAATCATGTATCAGCAAR-

CGTAAGATAAACTTCAATCTTCAC

AT

50 625

(Salgado-Pabón

et al., 2014)

Sec F-AGATGAAGTAGTTGATGTGTATGG

R-CACACTTTTAGAATCAACCG50 or 57 451

(Mehrotra et al.,

2000)

Sed F- CCAATAATAGGAGAAAATAAAAG

R-ATTGGTATTTTTTTTCGTTC50 or 57 278

(Mehrotra et al.,

2000)

See F-TGTATGTATGGAGGTGTAAC

R-GCCAAAGCTGTCTGAG50 213

(Sharma et al.,

2000)

Ser (Chiang et al.,

F-AGATGAGTTTGGAATACCCTAT

R-CTATCAGCTGTGGAGTGCAT50 123 2008)

Seg F-GTTAGAGGAGGTTTTATG

R-TTCCTTCAACAGCTGGAGA57 198

(Bania et al.,

2006)

Seh F-CAACTGCTGATTTAGCTCAG

R-CCCAAACATTAGCACCA52 173

(Bania et al.,

2006)

Sei F-GGCCACTTTATCAGGACA

R-AACTTACAGGCAGTCCA52 328

(Bania et al.,

2006)

selJ F-GTTCTGGTGGTAAACCA

R-GCGGAACAACAGTTCTGA50 131

(Bania et al.,

2006)

selP F-TCAAAAGACACCGCCAA

R-ATTGTCCTTGAGCACCA52 396

(Bania et al.,

2006)

Nuc

F-GCGATTGATGGTGATACGGTT

R-

AGCCAAGCCTTGACGAACTAAAG

C

50 or 57 280

(Kilic et al.,

2010)

16sRNA

F-

AACTCTGTTATTAGGGAAGAACA

R-

CCACCTTCCTCCGGTGATACGGTT

50 228

(Monday &

Bohach, 1999b)

Results

Detection of Staphylococcus aureus with different phenotypic test

Blood agar and mannitol salt agar are the most common methods for isolation of S. aureus. On

blood agar plate creamy white or light yellow zones that showed beta-hemolysis and on mannitol

salt agar plate gold yellow colonies are formed. Out of 200 total isolates of S. aureus 152

samples were positive for blood agar and MSA test (76%). Catalase and Coagulase tests are

very reliable methods for identifying the S. aureus. S. aureus produces an enzyme catalase which

converts hydrogen peroxide into water and air bubbles. All MSA positive samples showed

positive results for catalase test and 69.9% showed positive results for coagulase test. Coagulase

production is identified using coagulase kit (OXIOD, UK). S. aureus secret an enzyme coagulase

which has the ability to change the soluble fibrinogen into insoluble fibrin in the plasma and clot

is formed. On molecular level 103 (67.7%) of the 152 MSA-positive Staphylococcus

aureus showed positive for nuc.

PCR based identification of Enterotoxins encoding genes

11 enterotoxins genes (sea, seb, sec, sed, see, seg, seh, selJ, ser, sei, selP) were

detected by PCR using T100TM thermal cycler (BIO-RAD, Singapore) see figure 1. Enterotoxins

genes was mostly detected in Pus samples followed by urine, milk, sputum, juices, ready to eat

foods, ear swab and stool see Table 3.

Figure 1: PCR detection of 11 enterotoxins genes

Table 3: Detection of enterotoxin gene from local isolates with respect to their source of

isolation

SampleSource

Sea seb sec sed see Ser seg seh sei selJ selP

Pus 4 7 6 1 0 0 2 0 16 0 2

Urine 6 5 5 3 0 0 0 0 8 0 2

Ear swabs

0 0 0 0 0 0 1 0 1 0 0

Sputum 2 0 0 0 0 0 0 0 3 0 0

Fluid 0 1 1 0 0 0 0 0 0 0 0

Stool 0 1 1 0 0 0 0 0 1 0 0

Milk 1 1 1 0 0 0 1 0 2 0 1

Jiuces 0 1 0 0 0 0 2 0 0 0 0

Ready toeat foods

0 0 0 0 0 0 0 0 0 0 0

DiscussionStaphylococcus aureus (S. aureus) is gram positive cocci presents in the form of grapes

like bunches and causes wide range of disease in humans (Jan Kluytmans et al., 1997). S. aureus

produces many toxins including enterotoxins which is responsible for Staphylococcal food

poisoning (Fraser & Proft, 2008). Staphylococcal enterotoxins (SEs) are the toxin which is also

known as gastrointestinal exotoxins produced by S. aureus. Staphylococcal enterotoxins (SEs)

show great resistance against high temperature, high pH and high salt concentration (Larkin et

al., 2009). This study was focused on determination of enterotoxin gene profiles of S. aureus

isolates from Faisalabad region. Total 200 samples including clinical and sub clinical samples

were collected from the different areas and clinical laboratories of Faisalabad and test for

identification of S. aureus (blood agar test, mannitol salt agar test, catalase test and coagulase

test). For molecular level S. aureus identification is done by PCR using two primers 16sRNA

and Nuclease (nuc) gene. S. aureus detected in 152 samples of 200 samples (76%) and 103

samples of 152 samples (67.7 %) gave positive results against S. aureus. The highest prevelance

in enterotoxin genes showed by the staphylococcal enterotoxins I sei (30.1%) followed by seb

(15.5%), sea (12.6%), sec (13.5%), seg (5.8%), and selP (4.85%) then sed (3.88%). Four

enterotoxins encoding genes (see, ser, seh and selJ) were not found in our local isolates of S.

aureus. The sei and seb showed the highest prevelance in different studies around the world. In

current study sei (30.1%) gene also showed the highest prevelance among all enterotoxin genes

followed by seb (15.5%). In previous studies sei gene also showed high prevelance in different

countries (Ahmady & Kazemi, 2013; Becker et al., 2003; Blaiotta et al., 2004; Chiang et al.,

2008; Jarraud et al., 1999; Jarraud et al., 2001; McLauchlin et al., 2000; Roetzer et al., 2016;

Zschöck et al., 2005). In current study according to the Table 3 sei showed highest prevelance in

pus samples followed by urine, sputum, milk, ear swab and stool. In current study other

enterotoxins genes seb, sea, sec, seg, selP and sed also detected in S. aureus isolates. Where as in

previous studies these gene also showed the prevelance in different countries (Argudín et al.,

2010; Becker et al., 2003; Chiang et al., 2008; da Silva et al., 2015; Dauwalder et al., 2006; De

Buyser et al., 2001; Jones et al., 2002; Kitamoto et al., 2009; Rall et al., 2010; Rosec & Gigaud,

2002; Wongboot et al., 2013). Out of total isolates only 23 samples of pus, 20 samples of urine,

4 samples, 3 samples of juices, 2 samples of fluids, 3 samples of stool and 3 samples of milk

give positive results to one or more enterotoxin genes. In current study see, ser seh and selJ were

not detected in our S. aureus isolates. But these genes were reported in S. aureus strains from

other countries (Argudín et al., 2010; Bianchi et al., 2014; Chiang et al., 2008; Rall et al., 2010).

Based on these detected enterotoxin encoding genes 21 virulence profiles were identified in all

studied S. aureus isolates. Enterotoxin gene was mostly detected in clinical samples as compared

to sub clinical samples. The presence of sea, seb, sec, seg, sei and selP genes in clinical and

subclinical sample is due to food handlers. As hand is the natural habitat of the S. aureus. In

many previous studies researcher find that food poisoning may be due to food handlers

(Fratamico et al., 2005; JAJW Kluytmans & Wertheim, 2005). Comparison between current

studies and previous studies focusing enterotoxins gene is that isolates of S. aureus collected

form the Faisalabad, Pakistan are less virulent than the isolates of S. aureus collected in different

countries. As see, ser, seh, selJ have no prevelance in isolates of S. aureus but these genes had a

highest prevelance in other countries rather than Pakistan. These all genes have the ability to

cause the severe staphylococcal food poisoning in humans.

Conclusion

S. aureus produces many toxins including enterotoxins which cause the food poisoning. We used

Blood agar and MSA test for the isolation of S. aureus and catalase and coagulase test used for

the identification of S. aureus in different isolates of Pakistan. This study was planned to detect

the 11 staphylococcal enterotoxins genes in local isolates of S. aureus. The conclusion of this

study is that many enterotoxins genes were detected in more than 1 staphylococcal isolates of

Pakistan. Enterotoxin genes were mostly detected in clinical isolates as compared to sub-clinical

isolates. Enterotoxins genes detected in isolates of Pakistan are less virulent than the isolates of

other countries.

Conflict of Interest

All the authors have provided consent for publications

Author’s contribution

The manuscript and all experiments were done by Ammara Khalid while Sadia Liaquat

designed the all experiments.

Acknowledgments

All the authors are gratefully acknowledge for the contribution

ReferencesAhmady, M., & Kazemi, S. (2013). Detection of the enterotoxigenic genes (sei, sej) in

Staphylococcus aureus isolates from bovine mastitis milk in the West Azerbaijan of Iran.

Comparative clinical pathology, 22(4), 649-654.

Archer, D. L., & Young, F. E. (1988). Contemporary issues: diseases with a food vector. Clinical

microbiology reviews, 1(4), 377-398.

Argudín, M. Á., Mendoza, M. C., & Rodicio, M. R. (2010). Food poisoning and Staphylococcus

aureus enterotoxins. Toxins, 2(7), 1751-1773.

Balaban, N., & Rasooly, A. (2000). Staphylococcal enterotoxins. International journal of food

microbiology, 61(1), 1-10.

Bania, J., Dabrowska, A., Bystron, J., Korzekwa, K., Chrzanowska, J., & Molenda, J. (2006).

Distribution of newly described enterotoxin-like genes in Staphylococcus aureus from

food. International journal of food microbiology, 108(1), 36-41.

Becker, K., Friedrich, A. W., Lubritz, G., Weilert, M., Peters, G., & von Eiff, C. (2003).

Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins

among strains of Staphylococcus aureus isolated from blood and nasal specimens.

Journal of clinical microbiology, 41(4), 1434-1439.

Bianchi, D., Gallina, S., Bellio, A., Chiesa, F., Civera, T., & Decastelli, L. (2014). Enterotoxin

gene profiles of Staphylococcus aureus isolated from milk and dairy products in Italy.

Letters in applied microbiology, 58(2), 190-196.

Blaiotta, G., Ercolini, D., Pennacchia, C., Fusco, V., Casaburi, A., Pepe, O., & Villani, F. (2004).

PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains

isolated from meat and dairy products. Evidence for new variants of seG and seI in S.

aureus AB‐8802. Journal of applied microbiology, 97(4), 719-730.

Brakstad, O. G., Aasbakk, K., & Maeland, J. A. (1992). Detection of Staphylococcus aureus by

polymerase chain reaction amplification of the nuc gene. Journal of clinical

microbiology, 30(7), 1654-1660.

Cha, J., Lee, J., Jung, Y., Yoo, J., Park, Y., Kim, B., & Lee, Y. (2006). Molecular analysis of

Staphylococcus aureus isolates associated with staphylococcal food poisoning in South

Korea. Journal of applied microbiology, 101(4), 864-871.

Chiang, Y.-C., Liao, W.-W., Fan, C.-M., Pai, W.-Y., Chiou, C.-S., & Tsen, H.-Y. (2008). PCR

detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types

in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. International

journal of food microbiology, 121(1), 66-73.

da Silva, S. d. S. P., Cidral, T. A., Soares, M. J. d. S., & de Melo, M. C. N. (2015). Enterotoxin-

encoding genes in Staphylococcus spp. from food handlers in a university restaurant.

Foodborne pathogens and disease, 12(11), 921-925.

Dauwalder, O., Thomas, D., Ferry, T., Debard, A.-L., Badiou, C., Vandenesch, F., . . . Monneret,

G. (2006). Comparative inflammatory properties of staphylococcal superantigenic

enterotoxins SEA and SEG: implications for septic shock. Journal of leukocyte biology,

80(4), 753-758.

De Buyser, M.-L., Dufour, B., Maire, M., & Lafarge, V. (2001). Implication of milk and milk

products in food-borne diseases in France and in different industrialised countries.

International journal of food microbiology, 67(1), 1-17.

Ferry, T., & Etienne, J. (2009). Toxin-mediated syndromes. Staphylococci in Human Disease,

1(12), 484.

Fraser, J. D., & Proft, T. (2008). The bacterial superantigen and superantigen‐like proteins.

Immunological reviews, 225(1), 226-243.

Fratamico, P., Bayles, D., Bhunia, A., & Smith, J. (2005). Molecular approaches for detection,

identification, and analysis of foodborne pathogens. Foodborne pathogens microbiology

and molecular biology, 1-13.

Garthright, W. E., Archer, D. L., & Kvenberg, J. E. (1988). Estimates of incidence and costs of

intestinal infectious diseases in the United States. Public health reports, 103(2), 107.

Jarraud, S., Cozon, G., Vandenesch, F., Bes, M., Etienne, J., & Lina, G. (1999). Involvement of

enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet

fever. Journal of clinical microbiology, 37(8), 2446-2449.

Jarraud, S., Peyrat, M. A., Lim, A., Tristan, A., Bes, M., Mougel, C., . . . Lina, G. (2001). egc, a

highly prevalent operon of enterotoxin gene, forms a putative nursery of superantigens in

Staphylococcus aureus. The Journal of Immunology, 166(1), 669-677.

Jones, T. F., Kellum, M. E., Porter, S. S., Bell, M., & Schaffner, W. (2002). An outbreak of

community-acquired foodborne illness caused by methicillin-resistant Staphylococcus

aureus. Emerging infectious diseases, 8(1), 82.

Kadariya, J., Smith, T. C., & Thapaliya, D. (2014). Staphylococcus aureus and staphylococcal

food-borne disease: an ongoing challenge in public health. BioMed research

international, 2014.

Kateete, D. P., Kimani, C. N., Katabazi, F. A., Okeng, A., Okee, M. S., Nanteza, A., . . . Najjuka,

F. C. (2010). Identification of Staphylococcus aureus: DNase and Mannitol salt agar

improve the efficiency of the tube coagulase test. Annals of clinical microbiology and

antimicrobials, 9(1), 23.

Kérouanton, A., Hennekinne, J., Letertre, C., Petit, L., Chesneau, O., Brisabois, A., & De

Buyser, M. (2007). Characterization of Staphylococcus aureus strains associated with

food poisoning outbreaks in France. International journal of food microbiology, 115(3),

369-375.

Kilic, A., Muldrew, K. L., Tang, Y.-W., & Basustaoglu, A. C. (2010). Triplex real-time

polymerase chain reaction assay for simultaneous detection of Staphylococcus aureus and

coagulase-negative staphylococci and determination of methicillin resistance directly

from positive blood culture bottles. Diagnostic microbiology and infectious disease,

66(4), 349-355.

Kitamoto, M., Kito, K., Niimi, Y., Shoda, S., Takamura, A., Hiramatsu, T., . . . Hosokawa, M.

(2009). Food poisoning by Staphylococcus aureus at a university festival. Jpn J Infect

Dis, 62(3), 242-243.

Kluytmans, J., Van Belkum, A., & Verbrugh, H. (1997). Nasal carriage of Staphylococcus

aureus: epidemiology, underlying mechanisms, and associated risks. Clinical

microbiology reviews, 10(3), 505-520.

Kluytmans, J., & Wertheim, H. (2005). Nasal carriage of Staphylococcus aureus and prevention

of nosocomial infections. Infection, 33(1), 3-8.

Larkin, E., Carman, R., Krakauer, T., & Stiles, B. (2009). Staphylococcus aureus: the toxic

presence of a pathogen extraordinaire. Current medicinal chemistry, 16(30), 4003-4019.

McLauchlin, J., Narayanan, G., Mithani, V., & O'neill, G. (2000). The detection of enterotoxins

and toxic shock syndrome toxin genes in Staphylococcus aureus by polymerase chain

reaction. Journal of food protection, 63(4), 479-488.

Mehrotra, M., Wang, G., & Johnson, W. M. (2000). Multiplex PCR for detection of genes

forStaphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1,

and methicillin resistance. Journal of clinical microbiology, 38(3), 1032-1035.

Monday, S., & Bohach, G. (1999a). Properties of Staphylococcus aureus enterotoxins and toxic

shock syndrome toxin-1. The comprehensive sourcebook of bacterial protein toxins, 2nd

ed. Academic Press, London, England, 589-610.

Monday, S., & Bohach, G. (1999b). Properties of Staphylococcus aureus enterotoxins and toxic

shock syndrome toxin-1. The Comprehensive Sourcebook of Bacterial Protein Toxins,

589-610.

Olsen, S. J., MacKinnon, L. C., Goulding, J. S., Bean, N. H., & Slutsker, L. (2000). Surveillance

for foodborne-disease outbreaks—United States, 1993–1997. MMwR CDC Surveill

Summ, 49(1), 1-62.

Omoe, K., Imanishi, K. i., Hu, D.-L., Kato, H., Fugane, Y., Abe, Y., . . . Uchiyama, T. (2005).

Characterization of novel staphylococcal enterotoxin-like toxin type P. Infection and

immunity, 73(9), 5540-5546.

Ortega, E., Abriouel, H., Lucas, R., & Gálvez, A. (2010). Multiple roles of Staphylococcus

aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic

resistance. Toxins, 2(8), 2117-2131.

Pesavento, G., Ducci, B., Comodo, N., & Nostro, A. L. (2007). Antimicrobial resistance profile

of Staphylococcus aureus isolated from raw meat: A research for methicillin resistant

Staphylococcus aureus (MRSA). Food Control, 18(3), 196-200.

Rall, V., Sforcin, J., Augustini, V., Watanabe, M., Fernandes Jr, A., Rall, R., . . . Araújo Jr, J.

(2010). Detection of enterotoxin genes of Staphylococcus sp isolated from nasal cavities

and hands of food handlers. Brazilian Journal of Microbiology, 41(1), 59-65.

Roetzer, A., Gruener, C. S., Haller, G., Beyerly, J., Model, N., & Eibl, M. M. (2016).

Enterotoxin Gene Cluster-Encoded SEI and SElN from Staphylococcus aureus Isolates

are Crucial for the Induction of Human Blood Cell Proliferation and Pathogenicity in

Rabbits. Toxins, 8(11), 314.

Rosec, J., & Gigaud, O. (2002). Staphylococcal enterotoxin genes of classical and new types

detected by PCR in France. International journal of food microbiology, 77(1), 61-70.

Salgado-Pabón, W., Case-Cook, L. C., & Schlievert, P. M. (2014). Molecular analysis of

staphylococcal superantigens. Methicillin-Resistant Staphylococcus Aureus (MRSA)

Protocols, 169-185.

Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: a laboratory manual:

Cold spring harbor laboratory press.

Schmid, D., Fretz, R., Winter, P., Mann, M., Höger, G., Stöger, A., . . . de Martin, A. (2009).

Outbreak of staphylococcal food intoxication after consumption of pasteurized milk

products, June 2007, Austria. Wiener klinische Wochenschrift, 121(3), 125-131.

Sharma, N. K., Rees, C. E., & Dodd, C. E. (2000). Development of a single-reaction multiplex

PCR toxin typing assay for Staphylococcus aureusstrains. Applied and Environmental

Microbiology, 66(4), 1347-1353.

Tranter, H. S. (1990). Foodborne staphylococcal illness. The Lancet, 336(8722), 1044-1046.

Veras, J. F., do Carmo, L. S., Tong, L. C., Shupp, J. W., Cummings, C., dos Santos, D. A., . . .

Jett, M. (2008). A study of the enterotoxigenicity of coagulase-negative and coagulase-

positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil.

International Journal of Infectious Diseases, 12(4), 410-415.

Wieneke, A., Roberts, D., & Gilbert, R. (1993). Staphylococcal food poisoning in the United

Kingdom, 1969–90. Epidemiology & Infection, 110(3), 519-531.

Wongboot, W., Chomvarin, C., Engchanil, C., & Chaimanee, P. (2013). Multiplex PCR for

detection of superantigenic toxin genes in methicillin-sensitive and methicillin-resistant

Staphylococcus aureus isolated from patients and carriers of a hospital in northeast

Thailand. Southeast Asian J Trop Med Public Health, 44, 660-671.

Yang, M., Kostov, Y., Bruck, H. A., & Rasooly, A. (2009). Gold nanoparticle-based enhanced

chemiluminescence immunosensor for detection of Staphylococcal Enterotoxin B (SEB)

in food. International journal of food microbiology, 133(3), 265-271.

Zschöck, M., Kloppert, B., Wolter, W., Hamann, H., & Lämmler, C. (2005). Pattern of

enterotoxin genes seg, seh, sei and sej positive Staphylococcus aureus isolated from

bovine mastitis. Veterinary microbiology, 108(3), 243-249.