Unique Features in the Ribosome Binding Site Sequence of the ...

Unique Features in the Ribosome Binding Site Sequence of the Gram- positive Staphylococcus aureus fl-Lactamase Gene*

(Received for publication, April 23, 1981)

Jane R. McLaughlin, Cheryl L. Murray, and Jesse C. Rabinowitz From the Department of Biochemistry, Uniuersity of California, Berkeley, California 94720

The base sequence of the ribosome binding site region of the Gram-positive Staphylococcus aumus p-lactamase gene has been determined. The leader peptide sequence of 24 amino acids which precedes the N H 2 terminus of extracellular S. aumus 8-lactamase has also been established. This initiation site possesses two unique features not observed for most initiation sites recognized by Escherichia coli ribosomes. A novel initiation codon, UUG, initiates protein synthesis with methionine; and a very strong Shine-Ddgarno complementarity containing five G-C base pairs precedes the W G initiation codon. The strong Shine-Dalgarno complementarity may explain the reduced translational dependence on initiation factor IF-3 function that has been observed for the 8-lactamase mRNA and other mRNAs from Gram-positive bacteria. We suggest that this extent of complementarity between the mRNA and the ribosome may be a requirement for efficient initiation by Bacillus subtilis and other Gram-positive ribosomes, and may provide the basis for the observed inability of the Gram-positive systems to translate most of the mRNAs from Gram-negative bacteria.

The selection of initiation sites for protein synthesis is primarily a function of the 30 S ribosomal subunit (1-4). The 30-S particles isolated from Gram-positive bacteria such as Bacillus subtilis appear to recognize only a subset of the sites which are selected by the 30-S particles from Gram-negative bacteria such as Escherichia coli. In general, Gram-positive 30-S subunits discriminate against initiation sites in mRNAs isolated from Gram-negative bacteria (5-11). They are, however, perfectly competent in the selection of initiation sites in mRNAs from Gram-positive bacteria (7, 12-14). Thus, the ribosome binding sites in mRNAs from Gram-positive bacteria are distinct from those in mRNAs from Gram-negative bacteria in that they result in the formation of a productive initiation complex with Gram-positive ribosomes. Differences in the dependence upon the salt wash fraction for translation also distinguish mRNAs from Gram-positive and Gram-negative bacteria (7, 13-15).

The objective of this study has been to characterize the determinants of initiation site selection by B. subtilis ribosomes. There are several currently recognized structural features in mRNAs which contribute to initiation site selection by E. coli ribosomes. These include an initiation codon, a Shine-Dalgarno sequence complementary to the 3’ end of 16 S rRNA, and an appropriate spacing between these two regions. Of the 123 translational initiation region sequences, 119

* The ccsts of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

have the base triplet AUG and 4 have the triplet GUG that direct the binding of Met-tRNA”“‘ to initiate protein synthesis (4). Mutations that alter the initiation codon itself greatly reduce or abolish translation of the affected cistron (4, 16). A polypurine stretch of quite variable length (3-10 bases), known as the Shine-Dalgamo sequence, which is complementary to the 3’ end of E, coli 16-S rRNA, is located 5‘ to the initiation codon in all but one of the 123 E. coli ribosome binding sites that have been identified up to now. The Shine- Dalgarno complementarity is known to be involved in translational initiation (4). Finally, the number of nucleotides between the last base of Shine-Dalgarno complementarity and the first nucleotide of the initiation codon reduces translation efficiency if less than about 5 or greater than about 9 nucleotides (17-19). There is little doubt that additional determinants for initiation site selection exist (4), but so far none have been recognized that seem as universal as the three we have mentioned.

Analysis of the primary sequence of a translational initiation region known to be utilized efficiently by €3. subtilis ribosomes has provided a basis for comparison to the Gram-negative sites which are not efficiently recognized. Since E. coli ribosomes are capable of recognizing initiation sites in mRNAs from Gram-positive bacteria, it is expected that these mRNAs will possess, at the very least, the determinants discussed above. Perhaps additional determinants in the mRNA not required by E. coli ribosomes are required for recognition by B. subtilis ribosomes.

In the previous report, we were able to identify a protein made in similar amounts by both B. subtilis and E. coli cell- free transcription and translation systems as the Staphylococ- cus aureus p-lactamase which possesses an unprocessed leader sequence. We report here the sequence of the transcription and translation initiation regions of this gene, as well as the amino acid sequence of the leader peptide of this protein which may play a role in its secretion by Gram-positive bacteria. The ribosome binding site sequence reveals two features not observed for most of the 123 initiation sites recognized by E. coli ribosomes. A novel initiation codon, UUG, initiates protein synthesis with methionine. In addition, a very strong Shine-Dalgarno complementarity containing five G-C pairs precedes the UUG initiation codon. We suggest that ribosomes from B. subtilis and other Gram-positive bacteria require a more extensive Shine-Dalgarno complementarity than is acceptable for E. coli ribosomes. This requirement is consistent with a reduced dependence on initiation factor IF-3 for translation of Gram-positive mRNAs (13, 20). This hypothesis explains why the majority of translational start sites in mRNAs from Gram-negative bacteria are not recognized efficiently by ribosomes from Gram-positive bacteria.

EXPERIMENTAL PROCEDURES

MateriaEs-The sources of many materials have been cited previ-

11283

11284 UUG Translational Start; Gram-positive Leader Sequence

ously (14). In addition, adeno~ine-5'-[y-'~P]triphosphate (triethylam- monium salt) and ~-["S]methionine were purchased from Amersham. ~-[4,5-'H]Iysine and ~-[4,5-~HJleucine were from ICN. Sigmacote was from Sigma. Ultrapure urea was purchased from Schwarz/Mann. DNA-grade hydroxylapatite was purchased from BioRad. Restriction endonucleases were purchased from either New England Biolabs or Bethesda Research Laboratories and used according to the vendor's recommendations. Eco RI was a generous gift of Sung Ho Kim, Department of Chemistry, University of California, Berkeley. Eco RI* digestions (20 mM Tris-HC1, pH 8.8, 2 mM MgC12, 0.1 mM EDTA, and 20% glycerol) were carried out at 37 "C for 12-20 h in the presence of excess enzyme (50 units/pg of DNA). TI and Up RNases were purchased from Boehringer-Mannheim.

Determination of the DNA Sequence-All reagents were obtained from the sources previously cited (21). Carrier DNA for the chemical react,ions was purified +29 DNA (22) which was sonicated extensively. T4 polynucleotide kinase was purchased from P-L Biochemicals. Calf intestinal alkaline phosphatase (Grade I) was purchased from Boeh- ringer-Mannheim and purified on G-75. All procedures were carried out as described (21) except for the elution of labeled DNA fragments from agarose gels ranging from I-3% into a trough of hydroxylapatite paste which had been equilibrated in gel buffer (50 mM Tris, 380 mM glycine, and 0.1 mM EDTA).

Cell- free Transcription and Translation-B. subtilis cell-free transcription and translation assays were performed as described (14) except for the use of additional labeled amino acids. [%]Methionine (34 Ci/mmol), ['Hlleucine (4.4 Ci/mmol), and [3H]lysine (4.3 Ci/ mmol) were used at 25 p~ in the reaction mixtures. Reactions were increased 5-fold for the synthesis of larger amounts of labeled S. aureus 8-lactamase to be analyzed by automatic amino acid sequencing methods. In vitro protein products were separated electrophoretically on 15% SDS'-polyacrylamide gels and visualized by autoradiography. The 32,000-dalton /3-lactamase band was eluted as described (23) except for the use of purified extracellular S. aureus /3-lactamase as carrier. Elution was carried out in siliconized Eppendorf tubes (1.5 ml) at 37 "C overnight.

Determination ofAmino Acid Sequence-The labeled p-lactamase purified and isolated by electrophoresis (450 pl) was treated with 50 pl of 50% trichloroacetic acid and the mixture was incubated for 30 min in a boiling water bath. The resultant precipitate was collected by centrifugation and washed two times with 1 ml of ether/ethanol (1:l) and two times with 1 ml of ether as described (24). The final precipitate was air dried and dissolved in 250 pl of water. An equal volume of acetic acid was added to the sample and the solution was applied to a Beckman Model 890 Sequencer. The 1-chlorobutane extract from each cycle was dried under nitrogen and the radioactivity in each cycle extract was determined in a Beckman LS-8100 P Liquid Scintillation Counter using a double channel setting. Standards indicated 55% spillover of 3sS counts into the "H channel. All "H meas- urements were corrected for this spillover.

Purification of HindIII-Xba I C Fragment-0.6 mg of pJM13 DNA was digested with HindIII (180 units) and Xba I (132 units) for 20 h. The digest was phenol extracted and ethanol precipitated. The pellet was resuspended in 0.67 ml of buffer (20 mM Tris-HC1, 12 mM MgClp, 10 mM EDTA, and 150 mM KC]) and layered on two 11.1-ml linear 10-205'6 sucrose gradients in the same buffer. Samples were spun at 5 "C and 40,000 rpm for 20.2 h in the Spinco SW 41 rotor. Fractions, 250 pl, were collected from the top of the tube by pumping 30% sucrose into the bottom of the tube. 10-pl aliquots were analyzed by gel electrophoresis.

In Vitro Synthesis of ,@-Lactamuse mRNA by Clostridial RNA Polymerase: Determination of the Initiating NucZeotide-Transcrip- tion reactions contained 6 pg (0.7 pmol) of supercoil, Eco RI-digested, or Xba I-digested pJMl3 DNA and either 1.6 pg (3.2 pmol) of E. coli RNA polymerase (25) or 3.9 pg (8.3 pmol) of Clostridium acidi-urzci RNA polymerase (26). Reactions were performed at low ionic strength as described (14) except that 0.2 mM GTP, CTP, and UTP and 0.1 mM [Y-~'P]ATP (0.1 mCi) were used. After a 5-10 min incubation at 37 "C, KCl, ATP, and heparin were added to a final concentration of 160 mM, 0.2 mM, and 50 pg/ml, respectively. After 5 min, reactions were terminated by the addition of 12 pLI of 5X sample buffer (see below). A 10-pl aliquot of each reaction was counted as described (27) and the remainder was analyzed by gel electrophoresis.

Determination of the RNA Sequence-2.9 pmol (25 pg) of Xba I- digested pJMl3 was transcribed as described above except that 0.1 mM [y-"'P]ATP (0.5 mCi) was used. Prior to the addition of sample

I The abbreviation used is: SDS, sodium dodecyl sulfate.

buffer, the reaction was ethanol precipitated, dried, and resuspended in gel sample buffer (50 mM Tris, 380 mM glycine, 2 mM EDTA, 10% glycerol, 0.18 SDS, 0.05% bromphenol blue). Transcripts (7 X IO5 cpm) were separated by electrophoresis in a 2.5% agarose slab gel followed by autoradiography with an intensifying screen at room temperature for 2 h. The band containing the 750 base RNA was excised from the gel, ground with a siliconized glass rod, and shaken overnight at 4 O C with 0.7 ml of buffer (0.5 M ammonium acetate, 0.1% SDS, 1.0 mM EDTA, and 30 pg/ml of carrier tRNA). Agarose was removed by centrifugation and RNA was recovered from the super- natant by 3 ethanol precipitations. The pellet was resuspended in 11 p1 of 5 mM sodium acetate (pH 5.5).

Partial alkaline hydrolysis of the RNA was performed in 1.5-ml silicon-treated Eppendorf tubes as described (28) with 3 pl of the :j2P- labeled RNA sample. The volume after hydrolysis was reduced by lyophilization and the sample was resuspended in 10 pl of sample buffer for loading on the gel. Digestions with TI and U p RNases were performed as described except that 2 and 8 units of UP RNase were used and 0.01 and 1.0 units of TI RNase were used. The total TI digestion (1.0 unit) and the untreated samples contained only half as much 32P-RNA as the digestions which generated many more bands.

Gel Electrophoresis-RNA and protein were analyzed by electrophoresis as previously described (26). RNA sequencing gels (28) were 0.8 X 200 X 400 mm. DNA sequencing gels were 0.4 X 200 X 400 mm and either 10 or 15% polyacrylamide as described (21).

RESULTS

Positioning the P-Lactamase Gene on the 1250-base RNA-In the previous report (14), we mapped the position of the 1250-base transcript encoding S. aureus p-lactamase on pJM13 DNA. Transcription of Xba I-digested pJM13 DNA results in shortening of the 1250-base RNA to 750 bases. The Xba I recognition site must be within the p-lactamase gene since neither the 750 bases on the 5' end of the 1250-base transcript nor the 500 bases on its 3' end are sufficient to completely encode p-lactamase. We therefore sequenced in from the Xba I site in order t o align our DNA sequence with the codons determining the known amino acid sequence of extracellular 0-lactamase (29). Analysis of the amino acid sequence revealed the potential for the Xba I recognition sequence (TCTAGA) at amino acids 75-77 (Ile-Leu-Glu), 174- 176 (Leu-Leu-Asp), and 210-211 (Ser-Arg). The Xba I recognition sequence was found to be at amino acids 210-211 by aligning 30 codons prior to these with the DNA sequence we determined (data not shown). Thus, 80% of the P-lactamase coding sequence is located on the 840-base pair HindIII-Xba I C fragment (Fig. 1) of pJMl3 (14). The ribosome binding site sequence should be located some 700 base pairs away from the Xba I site to allow for the coding of some 230 amino acids including the leader peptide. Since transcription is initiated about 750 base pairs from the Xba I site, the p-lactamase gene must lie on the 5' end of the 1250-base RNA.

Isolation of the 840-base Pair HindIII-Xba I C Fragment- Restriction of pJM13 DNA with HindIII and Xba 1 endonucleases results in fragments A, B, and C (Fig. 1) of 8250 k 120, 4290 f 20, and 840 base pairs in length respectively. The 840- base pair fragment contains the transcription and translation initiation regions which are to be sequenced. Since this fragment is so much smaller than the 2 other fragments generated in the double digest it can be easily separated on a linear 10- 20% sucrose gradient (Fig. 1, fractions 18-21). The low molec- ular weight material (Fig. 1, fractions 4-10) which could be end labeled very efficiently is thereby eliminated and no extensive agarose or acrylamide removal step is required.

Restriction Mapping of HindIII-Xba I C Fragment-Rec- ognition sites for endonucleases Mnl I, Eco RI*, Rsa I, HinfI, and Fnu 4H-I were mapped within the 840-base pair fragment (Fig. 2). The Eco RI* site within the region we have sequenced has the specificity observed previously (30). That is, sequences which are cut differ from the canonical Eco RI* sequence at

UUG Translational Start; Gram-positive Leader Sequence 11285

A- B-

C-

FIG. 1. Electrophoretic analysis of sucrose gradient fractions to obtain pure HindIII-X6a I C fragment. 10-microliter aliquots of the designated fractions from a 10-20% sucrose gradient are analyzed on a 1% agarose gel. Bands are visualized by staining in ethidium bromide. Fractions 18-21 are pooled to obtain pure HindIII- Xba I C fragment for mapping and sequencing.

Leader Mature E-Laclornose

FIG. 2. Restriction map and sequencing strategy for initiation region of 8-lactamase gene. The restriction sites found in this fragment are mapped on the NO-base pair fragment. The arrows above represent the regions and strands which were sequenced. The position of the extracellular p-lactamase and its leader peptide on the fragment are indicated below the map.

only one end. The sequences AAATTA, TAATTG, and TAATTG at 109-114, 159-164, and 165-170 base pairs, respectively, from the HindIII site are not cut. There is a Dde I site 25 nucleotides from the HindIII site which is not shown on the map. No sites for Hpa I, Xma I, Bgl 11, Bum HI, Sma I, A h I, Hue 111, Sau 3A (Mbo I), Hha I, Tag I, HincII, Hue 11, Mbo 11, Aua I, Sal I, Pst I, Sac I, Bcl I, Kpn I, or Puu I were found within the 840-base pair fragment.

Sequencing Strategy-Both strands were sequenced in the region between the HindIII and Rsa I sites on the 840-base pair fragment as indicated by the arrows (Fig. 2). The paucity of restriction sites in this region led us to use Mnl I endonu- clease, although this enzyme is noted to rarely hydrolyze to completion, and Eco RI* which results in blunt ends that are not labeled efficiently in the polynucleotide kinase exchange reaction (21).

DNA Sequence of the NH2-terminal Region of S. aureus P-Lactamase-The DNA sequence shown (Fig. 3) is equivalent to the mRNA except for the replacement of T with U. The 5' end is the HindIII recognition site. The 3' region of the sequence is aligned with the 23 amino acids at the NH2 terminus of extracellular p-lactamase (Fig. 3, codons not underlined) (29). About 70 base pairs preceding the NH2-terminal lysine of the processed enzyme are expected to encode the leader sequence. There is, however, no AUG or even GUG initiation codon in this region. A perfect GGAGG sequence complementary to the 3' end of 16 S rRNA occurs 79-85 base pairs prior to the NHZ-terminal lysine of the processed enzyme

I I I I 5' A G C T T A C T A T G C C A T T A T T A A T A A C T T A G C C A T T T C A A C A C C T T C T T T C

I I I I I A A A T A T T T A T A A T A A A C T A T T G A C A C C G A T A T T A C A A T T G T A A ~

I l l I I I - T T G A T T T A T A A A A A T T A C A A C T G T A A T A T C G G A G G G T T T A T T D A A A - Met &

I I I I I A A G T T A A T A T T T T T A A T T G T A A T T G C T T T A G T T T T A A G T G C A T G T A A T ~ ~ I h P ~ L w ~ ~ ~ A l a L w V a I L w ~ A l a ~ A m

T C A A A C ~ G T T C A C A T G ~ C A A A G A G T T ~ A A T G A T T T A ~ A A A A A A A A T A T - Sur Am S6i S6i 2 & Lys Glu Lw Am Asp Lw Glu Lys Lvs Tyr

I I I I A A T G C T C A T A T T G G T G T T T A T G C T T T A G A T A C T A A A A G T . . . 3' Asn Ala His Ne Gg Val Tyr Ala Lw Asp Thr Lys Ser . . .

FIG. 3. DNA sequence of the initiation region of S. aumus 8-lactamase gene. The sequence shown is the nonsense strand, i.e. it is equivalent to the mRNA sequence. Sequences which are involved in recognition by RNA polymerase are underlined at 69-74 (TTGACA) and 93-98 base pairs (TATTAT) from the 5' end of the fragment. The transcriptional start site is designated by the arrow 105 base pairs from the HindIII site at the 5' end of the fragment. The Shine-Dalgarno complementarity (128-133 base pairs) and the initiation codon (140-142) for protein synthesis are also underlined. The 24 amino acids comprising the leader peptide (underlined) are predicted from the DNA sequence preceding 23 codons which corre- spond to the NHZ-terminal sequence of extracellular P-lactamase.

(Fig. 3). We therefore tentatively located the initiation codon for this protein at the TTG codon located 140 base pairs from the HindIII site. This region of the DNA sequencing gel is shown in Fig. 4. The amino acid sequence of the leader peptide predicted from the DNA sequence following this initiation site is 24 amino acids in length and is shown by the underlined codons in Fig. 3.

Automated Amino Acid Sequence Analysis-In order to confmn the initiation of p-lactamase synthesis at the UUG codon, the in vitro product was labeled with amino acids selected on the basis of the predicted sequence and analyzed on the automatic Sequencer. Based on the incorporation of methionine with a GUG valine initiation codon and a UUG reinitiation codon (31, 32), it was possible that the UUG leucine codon directed either methionine or leucine insertion. Consequently, p-lactamase was synthesized in two in vitro reactions, one containing [%]methionine and ["Hlleucine and the other containing ["S]methionine and [:'H]lysine. If the UUG is indeed the initiation codon, then methionine or leucine should be in position 1, leucine is expected in positions 4, 7, 12, 14, 27, and 30, and lysine is expected in positions 2, 3, and 25. The release of radioactivity at each cycle of Edman degradation is shown in Fig. 5. Methionine is the first amino acid and it is specified by the UUG initiation codon since leucine and lysine are both found at the positions through cycle 14 as predicted by the DNA sequence (Fig. 3). Resolution is inadequate to identify the residues at positions 25, 27, and 30. As expected from Sequencer analysis, the recovery of radioactivity decreases with increasing cycles, and there is some trailing of radioactivity from the previous cycle because of incomplete degradation at the previous cycle. This explains the increased ['Hllysine at cycle 3 compared to cycle 2 (Fig. 5 0 . The yield of "H-amino-acid was 36% of the total radioactivity applied to the Sequencer. Another 44% was recovered as undegraded sample. The specific activity of residues obtained in the early cycles is consistent with what is estimated from the total number of residues in the protein (e.g. 4.6 X lo4 cpm of ["H]leucine/26 leucine residues = 1770 cpm/leucine residue). The yield of [35S]methionine was 22% of the total radioactivity applied with an additional 23% being recovered as undegraded sample. The fraction of cell-free product initiated with formyl-methionine is small since similar results were obtained in Sequencer analysis of the product obtained with- out trichloroacetic acid treatment.

Amino Acid Sequence of the P-Lactamase Leader Pep-


G A X C C+T

3’ G

‘G 5’

FIG. 4. Autoradiograph of /3-lactamase ribosome initiation region sequence. 5’-end labeled HindIII-Xba I C fragment was restricted with Hinff and the HindIII-Hinff fragment subjected to base specific chemical cleavage as described under “Experimental Procedures.” Xylene cyano1 dye was run 59 cm on a 10% polyacrylamide sequencing gel resulting in resolution of nucleotides 97-230 from the labeled end. The ribosome binding site region including the TTC initiation codon is designated.

tide-Twenty-four amino acids comprise the signal peptide of S. aureus p-lactamase. The sequence is Met-Lys-Lys-Leu-Ile- Phe-Leu-Ile-Val-Ile-Ala-Leu-Val-Leu-Ser-Ala-Cys-Asn-Ser- Asn-Ser-Ser-His-Ala (Fig. 3). The M, of this peptide is calculated to be 2832 which is consistent with the in vitro product being larger than the extracellular enzyme by about M , = 3100 as determined on SDS-polyacrylamide gels (14).

Determination of the Initiating Nucleotide of P-Lactamase mRNA-Since 0-lactamase mRNA is initiated 90 & 20 bases from the Hind111 site (14), we looked for the common elements of promoter recognition in this region of the sequence. The abundance of A and T residues in this region and the proposed position of the -35 sequence and the Pribnow box (Fig. 3) made it most likely that RNA synthesis was initiated with ATP. Transcription of pJM13 DNA in the presence of [y-”PI ATP indicates that the 1250-base mRNA encoding p-lactam-

I5.000

I0,OOO

5,000

0

1,500

1,000

500

0

1,500

1,000

500

0

I A [%]METHIONINE

IO 20

I n

B

m C

Dl 3c

Sequenator Cycle FIG. 5. Sequential Edman degradation of the cell-free /3-lac-

tamase. The cell-free /3-lactamase was doubly labeled with [”SI methionine and [’Hlleucine and with [”S]methionine and [’Hllysine. The preparation of the unprocessed product and the Edman degradation were carried out as described under “Experimental Proce- dures.” The total radioactivity applied to the sequencer was 1.9 X I d cpm of [:‘“S]methionine, 4.6 X 10‘ cpm of [:’H]leucine, and 4.2 X IO4 cpm of [’Hllysine. The methionine profile shown is from the methionine- and leucine-labeled product. The same result was obtained for the methionine- and lysine-labeled product.

ase is indeed initiated with ATP (Fig. 6, lanes a, 6, d, e). Since the homologous RNA polymerase from S. aureus was not available, transcripts formed by RNA polymerase from another Gram-positive bacterium, C. acidi-urici were analyzed (Fig. 6, lane d). p-lactamase mRNA is initiated with ATP and

Bases

3700 -c

2000 - 1250 -c

750 - 282 -

UUG Translational Start; Gram-positive Leader Sequence

FIG. 6. Determination of the initiating nucleotide of &lactamase mRNA. Transcription reactions were performed as described under “Experimental Procedures“ in the presence of [y-:l”PIATP at 3.4 X lo4 cpm/pmol (lanes a, b, and d-f) or [a-:”P]ATP (lane c) for markers. Transcripts in lune d are produced by C. acidi-urici RNA polymerase while all other reactions contained E. coli RNA polymerase. Substrates for transcription were 0.7 pmol each of EcoRI- digested pJM13 (lanes b and c), Xba I digested pJM13 (lane a ) , and supercoiled pJMl3 (lanes d and e) , and 0.8 pmol of +29 DNA (lane f ) . Transcription of @9 DNA serves as a negative control as well since the transcripts larger than Ala (282 bases) are initiated with GTP (27) and are not detected. The amount of [y-:’2P]ATP incorpo- rated in 7.5 min at 37 “C was 1.1.0.9.2.0, 1.5, and 0.9 pmol in reactions a, b, d, e, and f respectively. 70% of each reaction was analyzed electrophoretically.

produced quite efficiently by this polymerase? A notable difference from the transcription pattern observed with E. coli RNA polymerase is the absence of the 3700- and 2000- base RNAs which are also initiated with ATP (Fig. 6, lanes a, b, e) from a single promoter (14). The C. acidi-urici RNA polymerase is observed to exhibit unusual specificity with respect to promoter site utilization (26).

Location of the Transcriptional Initiation Site-The [ y ”PIATP-labeled p-lactamase mRNA transcribed by E. coli RNA polymerase from Xba I-digested pJM13 DNA was isolated and sequenced by the RNase cleavage method described previously (28). Total TI RNase digestion of this transcript results in a major product of 16 nucleotides in length (Fig. 7, lane e) indicating that the f i t G residue in the RNA is 16 bases downstream from the initiating nucleotide. This is consistent with RNA synthesis beginning at the A residue located 105 base pairs from the Hind111 end of the fragment (Fig. 3, arrow). In addition, partial TI RNase digestion products (Fig. 7, lane f ) include oligonucleotides of 24, 25, 27, 28, and 29 bases in length which can be aligned with the GGAGGG sequence (Fig. 3) in the ribosome binding site. The band of 18 nucleotides in length obtained upon total TI RNase digestion (Fig. 7, lane e) is thought to arise from contamination of the 750-base p-lactamase mRNA by a minor transcript of about 700 bases in length observed in transcription of supercoiled pJMl3 DNA (Fig. 6, lanes d and e). This transcript which could arise from the arsenate, arsenite, and antimony resistance operon (33) is unresolved from p-lactamase mRNA formed with Xba I-digested substrate. The presence of this

* Since highly active preparations of RNA polymerase are required for synthesis of detectable [y-:”P]ATP labeled transcripts, C. ucidi- urici rather than B. subtilis RNA polymerase was used because of the higher specific activity of the clostridial enzyme preparation available to us at the time this experiment was conducted. Both enzymes synthesize the p-lactamase mRNA.

m

c.

1

4

A

Y

11287

“ 1

FIG. 7. 5”terminal sequence of /3-lactamase mRNA. Autora- diograph of RNase U2 and TI digestion products from [y-:”P]ATP- labeled p-lactamase mRNA and separated by size on a 20% polyacrylamide gel. Lane a, untreated sample; lane b, 8 units of U2 RNase; lane c, 2 units of U2 RNase; lane d, partial alkaline hydrolysis; lane e, 1.0 unit of TI RNase; lane f, 0.01 unit of TI RNase. XC and BPB represent the positions of xylene cyano1 and bromphenol dye markers at the end of electrophoresis.

additional RNA species is most obvious with a total TI RNase digestion when the total radioactivity is in a single oligonucleotide Lid. Uz RNase cleavage at A residues further supports the

assignmzrt of the p-lactamase mRNA start site. At the higher


TABLE I Initiation sites recognized by B. subtilis ribosomes

Additional mRNA sequences recognized by B. subtilis ribosomes were obtained from a variety of sources. These include (a) this report; (b ) Shing Chang, personal communication; (c) (49); ( d ) (C. L. Murray and J. C. Rabinowitz, manuscript in preparation); (e) (50); ( f ) (50); (g) (51) and G. Lee and Janice Pero, personal communication; (h) (51) and G. Lee and Janice Pero, personal communication; ( i ) (52); (1) (34); ( k ) (17, 53); and (1) Carl Woese, personal communication. The SPOl middle gene RNA sequences begin at the 5’ end of the message, though not designated as such. Sequences are aligned at the initiation codon and regions complementary to the 3‘ end of B. subtilis rRNA and the anticodon loop of tRNAr“‘ are underlined. Free

energies of formation of the most stable double helical Shine-Dal- garno pairing (43) were calculated as (a) -16.4 kcal/mol (spacing = 6); (b) -20.2 kcal/mol (spacing = 11); (c) -16.6 kcal/mol (spacing = 8); (d) -18.0 kcal/mol (spacing = 8) ; (e) -17.8 kcal/mol (spacing = 7); ( f ) -13.0 kcal/mol (spacing = 5); ( g ) -19.0 kcal/rnol (spacing = 8); (h) -20.0 kcal/mol (spacing = 6); ( i ) -11.6 kcal/mol (spacing = 9); (1) -18.8 kcal/mol (spacing = 7); and ( k ) -21.0 kcal/mol (spacing = 9). Spacing is defined as the number of nucleotides between the last base of the Shine-Dalgarno complementary and the first base of the initiation codon (4). ErR, erythromycin resistance.

. U A C A A C U G U A A U A U C ~ U U U A U ~ A A A A G U U A A U A U U U U U A A U U G U A A U U G C U U 3’

AUAUUCAAACGGAGGGAGACGAUUUUG~AAUUAUGGUUCAGUACUUUAAAACUGAAAA

GACAACCAAUCAUAGGAGGAAUUACAC~AUAACUAUCAAUUAACUAUCAAUGAGGUAA

.. AAAUAU~UAGAAAGUGGGACGAAGAM~GCAA~AUGAUGCAGAGAGAAAUCACAAA ..

~ ~ ~ A U U U U A U M G G A G G A A ~ ~ ~ ~ ~ A U G G C A U U U U U A G U A U U U U U G U ~ U C A G C A C A G

U C A U A U A A C C A A A U U A A A G ~ U U A U M ~ C G A G A A A A A U A U A A A A C A C A G U C ~ ..

... AAAGGAGGAGAGGUUAUGCACACU

GAAUGGAAGGAGGUAACAAA~CCAA. .

GRAM-NEGATIVE

(I) T7 1 3 gene (Ilgase) p ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A G G A G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

0) A 1 7 A protem , AUUCCUAGGAGGUUUGACCIJ&J&CGAGCUUUUAGUACUCUC

EUKARYOTIC (k) SV40 IZK small t antlgen CCUGAUAAAGGAGGA~GAAGAAAAAUGAAGAAAAUGAAUACUCUGUACAAGAAAAUG

(11 16s rRNA 3‘ ,, UCUUU-ACUAG ... 5’

level of U p RNase (Fig. 7, lane b), the specificity of this enzyme is reduced resulting in additional cleavage a t G residues (28). Furthermore, an ApX linkage is apparently cleaved preferentially to an ApA linkage (28). This preference is evident in the lighter intensities of oligonucleotides of 3, 4, 5, and 6 bases in length relative to the 7-mer (Fig. 7, lane c). The partial and total RNase digestions in this analysis have allowed us to align the 5”terminal sequence of /3-lactamase mRNA with the DNA sequence (Fig. 3). The results indicate that RNA synthesis is initiated 35 nucleotides 5’ to the initiation codon for protein synthesis.

Features of Ribosome Binding Sites Recognized by B. subtilis Ribosomes-Analysis of the ribosome binding site region of S. aureus /3-lactamase mRNA has revealed not only the use of a novel initiation codon, but the presence of a very strong Shine-Dalgarno complementarity. In order to assess whether either or both of these features distinguish mRNAs recognized by B. subtilis ribosomes from those that are not, we have compiled a list of other mRNA sequences which are either presumed to or, in some cases, known to associate with B. subtiEis ribosomes (Table I). The initiation codon underlined has not been confwmed by NH2-terminal analysis of the protein product in some cases (Table I, e-h, k ) .

The reason for including some of the binding sites in this table should be mentioned. The T7 1.3 gene product is made in reduced amount by the B. subtilis system relative to the E. coli system but its initiation site is nonetheless utilized. In addition, this protein is synthesized in significant amounts by E. coli ribosomes in the absence of the salt wash fraction indicative of the “Gram-positive” character of this mRNA (13). The R17 A protein cistron is bound by Bacillus stearothermophilus ribosomes (34,35) and expected to be bound by B. subtilis ribosomes as well. The 12-kilodalton derivative of

SV40 small t antigen is an NH2-terminal deletion of small t antigen and may arise by an internal initiation at the sequence shown in Table I (17). The in vitro transcription and translation system from E. coli directed by HP 1 DNA (17) synthesized both authentic small t antigen and the 12-kilodalton protein. The in vitro B. subtilis system only produces the 12- kilodalton protein and at a lower efficiency than observed for the E. coli system (data not shown).

DISCUSSION

Messenger RNAs isolated from Gram-positive bacteria are distinguished from messenger RNAs isolated from Gram-negative bacteria (1) in their ability to be translated efficiently by B. subtilis ribosomes, and (2) in the extent to which they are translated in the absence of the salt wash fraction by both B. subtilis and E . coli ribosomes. The initiation site determinants for recognition by B. subtitis ribosomes, therefore, are expected to include not only the initiation codon, Shine-Dal- garno complementarity bases, and appropriate spacing of these regions, but one or more additional features which facilitate protein synthesis in the absence of the initiation factor fraction and which are required for efficient mRNA recognition by B. subtilis ribosomes. The determination of the primary sequence of the translation initiation region of the Gram-positive S. aureus /3-lactamase mRNA has revealed the surprising presence of a UUG initiation codon and a very strong Shine-Dalgarno complementarity. A survey of 10 additional initiation sites utilized by B. subtilis ribosomes indicates that there is much less variability in the extent of mRNA-rRNA complementarity than is observed for E. coli ribosome binding sites (4). A strong Shine-Dalgarno complementarity in the mRNA seems to be a more strict requirement for translation by B. subtilis ribosomes than by E. coli ribo-

UUG Translational Start; Gram-positive Leader Sequence 11289

somes. An additional feature, therefore, which distinguishes mRNAs from Gram-positive and Gram-negative bacteria is the consistency with which they possess a strong Shine-Dal- garno determinant that accounts for the reduced dependence on the initiation factor fraction for translation of these mRNAs.

Until now, the UUG codon has not been reported to serve as an initiation codon for synthesis of a wild type protein. An amber mutation in the E. coli lactose repressor gene (corre- sponding to amino acid 60) is reported to result in reinitiation at the UUG leucine codon (amino acid 62). The restart poly- peptide accumulates at 10% of the wild type repressor level (36). The UUG initiation codon for S. aureus p-lactamase is utilized efficiently in vitro by both B. subtilis and E. coli ribosomes (14). In addition, the initiation at the UUG codon must be very efficient in vivo since p-lactamase can account for as much as 0.5% of the dry weight of S. aureus cell cultures (37).

The fact that AUG initiation codons are also found among the additional mRNAs recognized by B. subtilis ribosomes (Table I) indicates that the UUG initiation codon is not required for translation by B. subtilis ribosomes. The SPOl middle gene (Table I, g) may be another example of a UUG initiation although the NH2 terminus of the protein encoded by this gene has not been characterized. Furthermore, it is expected that B. subtilis ribosomes will also recognize the MS2 A protein cistron which is homologous to the R17 A protein cistron (Table I, j ) except for a GUG initiation codon (4). Although there are only 11 sites in the catalogue of ribosome binding sites recognized by B. subtilis, the frequency of initiation at codons other than AUG is much higher than observed for the catalogue of E. coli ribosome binding sites (4/123) (4).

The bias against initiation codons other than AUG in the catalogue of E. coli ribosome binding sites is not well understood. Unless a particular mRNA is predominantly dependent upon initiator codon-anticodon interactions for the recognition of an initiation site, i.e. the other determinants are weaker, the presence of an AUG initiation codon is expenda- ble. The reduced stability of the base pairing between the anticodon of initiator tRNA""' and either a GUG or UUG initiation codon may be compensated for by other RNA- RNA interactions. For instance, other determinants in the mRNA initiation site may facilitate the correct binding of the initiator tRNAMet. Indeed, two different oligodeoxyribonucleotides, deoxy(AATTCTAGGATTTAATCATG) and deoxy(AATTCTAGGATTTAATC),are reportedrst imu- late the binding o f - t R N A M e t to E. coli ribosomes equally well (38). All four GUG initiation codons utilized by E . coli ribosomes as well as the UUG initiation codon of S. aureus P-lactamase utilized by both E. coli and B. subtilis ribosomes are preceded by an even stronger Shine-Dalgarno complementarity than the AGGA of these oligodeoxyribonucleotides. Furthermore, a viable initiation precursor is formed by E. coli 30 S ribosomal subunits and MS2 RNA or QP RNA in the absence of initiator tRNA (39). Thus, the AUG initiation codon may not be required for the initial selection of initiation sites for protein synthesis. The proposed requirement for a more stable Shine-Dalgarno interaction by B. subtilis ribosomes may contribute to the higher frequency with which initiation codons other than AUG are tolerated in the current catalogue of B. subtzlis ribosome binding sites. It should also be noted that the P site of E. coli ribosomes has an intrinsic affinity for the initiator tRNA in the presence of mRNA since N-Met-tRNA binding is favored with polyxanthidylic acid which has neither an initiation codon nor a region of Shine- Dalgarno complementarity (40).

Finally, the nucleotides adjacent to the initiation codon may also influence the anticodon-initiation codon interaction. Initiation codons followed at the 3' side by the nucleotide A have been shown to increase E. coli ribosome binding to mutants in the Q/? phage coat protein RNA initiation site by greater than 3-fold (16). This stimulation of initiation complex formation may be a result of the additional base pairing with the U residue 5' to the anticodon in the initiator tRNA. It is also possible that the interaction between the initiator tRNA and a class of tRNAs that recognize codons beginning with the nucleotide A is favored, thereby enhancing the rate of formation of the fist peptide bond. The nature of the residues adjacent to the amber codons is known to affect the efficiency of the suppressor tRNA in reading a particular site (41). Another study (42) suggests that the presence of a pyrimidine residue 5' to the initiation codon is preferred for the formation of a ribosome-oligonucleotide-Wet-tRNA'" initiation complex. All but one of the initiation codons utilized by B. subtilis ribosomes have either a pyrimidine 5' or an A residue 3' to the initiation codon (S. aureus /?-lactamase and 629 22.4 kilodalton protein initiation codons have both). The impor- tance of this potential additional stability in the codon-anticodon interaction during the initiation of protein synthesis by B. subtilis ribosomes remains unclear.

The UUG initiation codon for S. aureus /?-lactamase is preceded by 35 nucleotides to the 5' end of the mRNA. An obvious determinant of initiation site selection within this region is the extensive Shine-Dalgarno complementarity (GGAGGG) which can form 5 G-C base pairs with the 3' end of 16 S rRNA (by looping out the A residue in the sequence ... CCUCCAC ...). Adjacent G-C pairs lend considerably more stability to the formation of double helical regions than other nucleotide stacks (43). In fact, all the initiation sites recognized by B. subtilis ribosomes are characterized by the potential for quite strong mRNA-rRNA base pairing. The free energies of the Shine-Dalgarno interactions with 16 S rRNA range between -11.6 and -21.0 kcal/mol (see Table I) for these mRNAs. A much larger range of free energies (-4 to -22 kcal/mol) is calculated for the Shine-Dalgarno interactions present in initiation sites recognized by E. coli ribosomes (4).

The sites recognized by E. coli ribosomes have free energies for the formation of mRNA-rRNA base pairing of this region distributed about an average of -11.6 kcal/mol. The limited number of available initiation sites recognized by B. subtilis ribosomes have free energies for formation of the Shine-Dal- garno interaction distributed about an average of -17 kcal/ mol. These numbers provide an indication of the relative stabilities of the Shine-Dalgmo interactions involved in initiation of protein synthesis by E. coli and B. subtilis ribosomes. Although the accumulation of additional sites that are utilized by B. subtilis ribosomes may somewhat modify the range of stabilities that are sufficient, we believe that B. subtilis ribosomes require a more stable Shine-Dalgarno complementarity for initiation of protein synthesis than is tolerated by E. coli ribosomes.

Several lines of evidence support this notion. Stimulation by the salt wash fraction of the binding of salt-washed E . coli ribosomes to the three R17 RNA cistrons appears to be inversely correlated with the length or stability of the Shine- Dalgarno complementarity. Binding to the R17 A protein initiation region is stimulated only 3-fold by salt wash addition (20). The T7 1.3 gene product, ligase, is one of three T7 DNA- directed proteins synthesized by E. coli ribosomes in the absence of salt wash in electrophoretically detectable amounts (13). T7 ligase and R17 A protein are thus far the only identified Gram-negative ribosome binding sites utilized by B. subtilis ribosomes. Complementarities as extensive as that


seen for the R17 A protein are rare among the E. coli ribosome binding sites and frequently masked in secondary structure such that a stimulation of 50-100-fold by salt wash addition is generally observed for the translation of mRNAs from Gram- negative bacteria (7, 13). In contrast to the marked dependence upon the initiation factor fraction for translation of Gram-negative mRNAs, the translation of mRNAs isolated from Gram-positive bacteria is much more independent ofthe salt wash fraction (7) and specifically of initiation factor IF3 (13). Synthesis of S. aureus p-lactamase by B. subtilis ribosomes is stimulated only 3.6-fold by initiation factor fraction addition (14). Formation of $129 proteins by B. subtilis and E. coli ribosomes is stimulated 2.5-fold and 5-fold respectively by the addition of the salt wash fraction. Thus, the facilitation of protein synthesis in the absence of the initiation factor fraction is a common feature of mRNAs recognized by B. subtilis ribosomes. The strong Shine-Dalgarno complementarities present in the initiation sites utilized by B. subtilis ribosomes may result in the characteristic reduced dependence upon ribosomal salt wash proteins for stabilization of the mRNA-30 S particle complex. In addition, the increased stability of the mRNA-rRNA interaction may actually be required by B. subtilis ribosomes for efficient transition to the elongation state (15).

There is some indication that B. subtilis ribosomes do in fact bind mRNA more tightly than do E. coli ribosomes. Whereas slow cooled cultures of E. coli are virtually free of complexed couples (70 S ribosomes tightly associated with message), no conditions have been found which eliminate complexed couples from B. subtilis cultures (44). Further- more, B. subtilis RNA is observed to have a dissociating effect on uncomplexed 70 S ribosomes which is unexpected on the basis of results in E. coli and suggests that the RNA may be interacting with one or both subunits to prevent reassociation (44). Certainly interactions in addition to the Shine-Dalgarno base pairing contribute to these observations. The greater degree of Shine-Dalgarno complementarity required for the utilization of an initiation site by B. subtilis ribosomes compared to E. coli ribosomes may reflect a more general increase in the dependence of the B. subtilis translational machinery on RNA-RNA interactions which would tend to enhance the stability of mRNA-ribosome complexes. One might argue, for example, that since B. stearothermophilus ribosomal protein SI2 is unable to substitute adequately for E. coli 512 in the translation of R17 RNA by E. coli ribosomes (in contrast to all of the other 30 S proteins tested) (3), the function which is missing from the Gram-positive S12 must be compensated for by features in the mRNA. Messenger RNAs recognized by E. coli ribosomes would not be required to possess these features and would not be translated by ribosomes from Gram-positive bacteria unless these features are present.

The spacing between the initiation codon and the Shine- Dalgarno complementarity sequence is another parameter which can be compared for initiation sites utilized by B. subtilis ribosomes and those utilized by E. coli ribosomes. The spacing in initiation sites recognized by B. subtilis ribosomes varies between 5 and 10 nucleotides. The average spacing for these 11 sites is 7-8 nucleotides, just as observed for the 123 E . coli ribosome binding sites (4). The optimal orientation of the Shine-Dalgarno complementarity sequence to the initiation codon required for recognition by both E. coli and B. subtilis ribosomes therefore appears to be similar. The abundance of A and U nucleotides surrounding the G-rich base pairing regions in the initiation sites bound by B. subtilis ribosomes (Table I) is also a preference which is revealed in computerized comparisons of E. coli ribosome binding sites (4, 45) .

The 24 amino acid leader sequence of S. aureus p-lactamase that was predicted and confumed in this study has many of the general features observed in other prokaryotic signal peptides. The NH2 terminal region is basic, containing 2 lysine residues. A hydrophobic section of 11 amino acids is located between positions 11 and 21 from the cleavage site. Of the amino acids in the S. aureus signal peptide, 58% are hydrophobic compared to 37% in the extracellular enzyme. Inter- estingly, a cysteine residue occurs in the leader sequence, whereas cysteine is not found in the extracellular enzyme. Finally, as in many prokaryotic signal sequences, an alanine residue is located at the cleavage site.

The promoter sequence of the S. aureus @-lactamase gene is recognized by RNA polymerases from C, acidi-urici, B. subtilis, and E. coli. It contains a Pribnow box sequence (TATTAT) differing from the sequence (TATAAT) most commonly found in promoters utilized by the E. coli enzyme at only one nucleotide. The -35 region sequence (TTGACA) is identical to the sequence observed in most E. coli promoters.

The regulation of the synthesis of fl-lactamase in S. aureus is not well understood and has been reviewed (46). The staphylococcal plasmid (pI258 pen I-443), from which the penicillin resistance gene sequenced in this report was derived, is constitutive for 0-lactamase synthesis. Wild type penicillin- ase plasmids are inducible, and constitutivity in this case is a result of a point mutation in the regulatory gene pen I (some- times referred to as bla I). Although the gene product encoded by pen I has not been identified, genetic data suggests that it is a repressor protein. As a result, it is intriguing to note the presence of two sequences at nucleotides 75-98 and 105-129 from the Hind111 site which are inverted repeats of one another. The region can be drawn in the form of a cruciform structure having double-stranded stems that contain 22 hy- drogen-bonded base pairs and single-stranded loops consisting of 6 nucleotides. The significance of such a structure is not clear. However, these sequences are within the transcriptional intiation region of the ,B-lactamase gene. Such regions of symmetry are known to specify operator sequences for the E. coli lactose operon and the bacteriophage X CI and cro genes (47, 48). Determination of whether this extensive inverted repeat is involved in the regulation of fl-lactamase synthesis will require additional study.

Acknowledgment-We thank Professor Terrance Leighton for many helpful discussions.

1. 2.

3.

4.

5.

6.

7.

8.

9. 10. 11.

12.

13.

REFERENCES Lodish, H. F. (1974) Nature 251,385-388 Goldberg, M. L., and Steitz, J. A. (1974) Biochemistry 13, 2123-

2129 Held, W. A., Gette, W. R., and Nomura, M. (1974) Biochemistry

13,2115-2122 Gold, L., Pribnow, D., Schneider, T., Shinedling, S., Singer, B. S.,

and Stormo, G. (1981) Annu. Rev. ofMicrobiol35,365-403. Stallcup, M. R., and Rabinowitz, J. C . (1973) J. Biol. Chem. 248,

Stallcuu. M. R., and Rabinowitz, J. C. (1973) J. Biol. Chem. 248, 3209-3215

321613219 StallcuD. M. R.. Sharrock. W. J.. and Rabinowitz. J. C. (1976) J.

BioLAChem. 251,2499-2510 '

Biochem. Biophys. Res. Commun. 58,92-98 Stallcup, M. R., Sharrock, W. J., and Rabinowitz, J . C. (1974)

Leffler, S., and Szer, W. (1974) J. Biol. Chem. 249, 1465-1468 Lodish, H. F. (1970) Nature 226, 705-707 Legault-Demare, L., and Chambliss, G . H. (1975) Mol. Gen. Genet.

Leventhal, J. M., and Chambliss, G. H. (1979) Biochim. Biophys.

McLaughlin, J. R., Murray, C. L., and Rabinowitz, J. C. (1981)

142, 277-287

Acta 564,162-171

UUG Translational Start; GI

Proc. Natl. Acad. Sci. U. S. A. 78,4912-4916

Biol. Chem. 256,11273-11282

Biol. 135,627-638

565

14. McLaughlin, J. R., Murray, C. L., and Rabinowitz, J. C. (1981) J.

15. Sharrock, W. J., Gold, B. M., and Rabinowitz, J. C. (1979) J. Mol.

16. Taniguchi, T., and Weissman, C. (1978) J. Moi. Biol. 118, 533-

17. Thummel, C. S., Burgess, T. L., and Tjian, R. (1981) J. Virol. 37,

18. Roberts, T. M., Bikel, I., Yocum, R. R., Livingston, D. M., and Ptashne, M. (1979) Proc. Natl. Acad. Sei. U. S. A. 76, 5596- 5600

19. Singer, B. S., Gold, L., Shineding, S. T., Colkitt, M., Hunter, L. R., Pribnow, D., and Nelson, M. A. (1981) J. Mol. Biol. 149, 405-432

20. Steitz, J . A., Wahba, A. J., Laughrea, M., and Moore, P. B. (1977) Nucleic Acids Res. 4, 1-15

21. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65, 499-560

22. Davison, B. L., Murray, C. L., and Rabinowitz, J. C . (1980) J. Biol. Chem. 255,8819-8830

23. Hager, D. A., and Burgess, R. R. (1980) Anal. Biochem. 109,76- 86

24. Inouye, S., Wang, S., Sekizawa, J., Halegoua, S., and Inouye, M. (1977) Proc. Natl. Acad. Sei. U. S. A. 74, 1004-1008

25. Burgess, R. R., and Jendrisak, J. J. (1975) Biochemistry 14,4634- 4638

26. Murray, C. L., and Rabinowitz, J. C. (1981) J. Biol. Chem. 256,

27. Davison, B. L., Leighton, T., and Rabinowitz, J. C. (1979) J. Biol.

28. Donis-Keller, H., Maxam, A. M., and Gilbert, W. (1977) Nucleic

29. Ambler, R. P. (1975) Biochem. J. 151,197-218 30. Pribnow, D., Sigurdson, D. C., Gold, L., Singer, B. S., Napoli, C.,

Brosius, J., Dull, T. J., and Noller, H. F. (1981) J. Mol. Biol.

31. Files, J . G., Weber, K., Coulondre, C. , and Miller, J . H. (1975)

32. Steege, D. A. (1977) Proc. Natl. Acad. Sei. 77. S. A. 74,4163-4167 33. Novick, R. P., Murphy, E., Gryczan, T. J., Baron, E., and Edel-

683-697

5153-5161

Chem. 254,9220-9226

Acids Res. 4,2527-2538

149,337-376

Proc. Natl. Acad. Sei. U. S. A. 95,327-330

Pam-positive Leader Sequence 11291

man, I. (1979) Plasmid 2, 109-129 34. Steitz, J. A. (1969) Nature (Lond.) 224,957-964 35. Sprague, K. U., Steitz, J. A,, Grenley, R. M., and Stocking, C. E.

36. Platt, T., Weber, K., Ganem, D., and Miller, J. H. (1972) Proc.

37. Richmond, M. H. (1975) Methods Enzymol. 43,664-672 38. Jay, E., Seth, A. K., and Jay, G. (1980) J. Biol. Chem. 255,3809-

3812 39. Van Duin, J., Overbeek, G. P., and Backendorf, C. (1980) Eur. J.

Biochem. 110,593-597 40. van der Laken, K., Bakker-Steeneveld, H., Berkhout, B., and van

Knippenberg, P. H. (1980) Eur. J . Biochem. 104.19-23 41. Bossi, L., and Roth, J. R. (1980) Nature 286, 123-127 42. Ganoza. M. C.. Fraser. A. R.. and Neilson. T. (1978) Biochem. 17.

(1977) Nature (Lond.) 267,462-465

Natl. Acad. Sei. U. S. A. 69, 897-901

2769-2775 ’

, , ,~ ~

43. Tinoco. I.. Borer. P. N., Denaler. B.. Levine. M. D.. Uhlenbeck. 0. C., Crothers, D. M., and &alia, J. (1973) Nat. New Biol. 246, 40-41

44. Sharrock, W. J., and Rabinowitz, J. C. (1979) J. Mol. Biol. 135,

45. Scherer, G . F. E., Walkinshaw, M. D., Arnott, S., and Morre, D. J. (1980) Nucleic Acids Res. 8, 3895-3907

46. Dyke, K. G. H. (1979) in Beta Lactamases (Hamilton-Miller, J. M. T., and Smith J . T., ed) pp. 291-310, Academic Press, San

47. Rezinikoff, W. S., and Abelson, J. N. (1978) in The Operon (Miller, Francisco

J . H., and Reznikoff, W. S., ed) p. 221-243, Cold Spring Harbor Laboratories, Cold Spring Harbor

48. Ptashne, M. (1978) in The Operon (Miller, J. H., and Reznikoff, W. S., ed) pp. 325-343, Cold Spring Harbor Laboratories, Cold Spring Harbor

49. Yoshikawa, H., Friedmann, T., and Ito, J . (1981) Proc. Natl. Acad. Sei. U. S. A. 78, 1336-1340

50. Horinouchi, S., and Weisblum, B. (1980) Proc. Natl. Acad. Sci.

51. Lee, G., and Pero, J. (1981) J. Mol. Biol., in press 52. Dunn, J. J., and Studier, F. W. (1981) J. Mol. Biol. 148, 303-330 53. Fiers, W., Contreras, R., Haegeman, G., Rogiers, R., Van der

Voorde, A., Van Heuverswyn, H., Van Herreweghe, J., Vol- ckaert, G., and Ysebaert, M. (1978) Nature 273, 113-120

611-626

U. S. A. 77,7079-7083

Unique Features in the Ribosome Binding Site Sequence of the ...

Documents

Transcript of Unique Features in the Ribosome Binding Site Sequence of the ...