toxicidad mitocondrial

ANTIVIRAL THERAPY

1st Meeting on Mitochondrial Toxicity & HIV Infection: Understanding the Pathogenesis for a Therapeutic Approach

Proceedings of the1st Meeting on Mitochondrial Toxicity and

HIV Infection: Understanding thePathogenesis for a Therapeutic Approach

Lectures presented in this meeting are published as part of Antiviral Therapy Volume 10.The page number given for each paper is correct for Volume 10, Supplement 2. The correct citation for a paper is:

Authors. Title. Antiviral Therapy 2005 10(Suppl 2):M Page number.

i

Antiviral Therapy 10, Supplement 2

ANTIVIRAL THERAPY

Fred Y Aoki (Winnipeg, Canada)Lawrence Banks (Trieste, Italy)Karen K Biron (Research Triangle Park, NC, USA)Michael Bray (Bethesda, MD, USA)David M Burger (Nijmegen, the Netherlands)Jeffrey I Cohen (Bethesda, MD, USA)Ann Collier (Seattle, WA, USA)Robert B Couch (Houston, TX, USA)Janet Englund (Houston, TX, USA)Delia Enria (Pergamino, Argentina)Michael Gale (Dallas, TX, USA)

José M Gatell (Barcelona, Spain)Lutz Gissmann (Heidelberg, Germany)Scott M Hammer (Boston, MA, USA)Martin Hirsch (Boston, MA, USA)Stanley M Lemon (Galveston, TX, USA) Yun-Fan Liaw (Taipei, Taiwan)Susan J Little (San Diego, CA, USA)Anna Lok (Ann Arbour, MI, USA)Michael Peter Manns (Hannover, Germany)Patrick Marcellin (Clichy, France)Julio SG Montaner (Vancouver, Canada)

Luc Perrin (Geneva, Switzerland)Thierry Poynard (Paris, France)Jonathan M Schapiro (Tel Hashomer, Israel)Raymond F Schinazi (Atlanta, GA, USA)Robert T Schooley (Denver, CO, USA)John J Treanor (Rochester, NY, USA)Stefano Vella (Rome, Italy)Patrick Yeni (Paris, France)

EDITORS-IN-CHIEF

Joep MA LangeNational AIDS Therapy Evaluation CentreAcademic Medical Centre University of Amsterdam, Pietersbergweg 9 1105 BM Amsterdam, the NetherlandsTel: +31 20 314 9300Fax: +31 20 314 9399E-mail: [email protected]

Douglas D RichmanUniversity of California, San DiegoDepartments of Pathology and Medicine 06799500 Gilman Drive, La JollaCA 92093-0679, USATel: +1 858 552 7439Fax: +1 858 552 7445E-mail: [email protected]

SECTION EDITORSHERPESVIRUSESRichard J WhitleyUniversity of Alabama at BirminghamSchool of Medicine, Division of Clinical Virology616 Children’s Hospital1600 7th Avenue South, BirminghamAL 35233-0001, USAFax: +1 205 934 8559

EMERGING VIRUSES AND BIODEFENCEClarence J PetersUniversity of Texas Medical Branch3.146 Keiller Building301 University BoulevardGalveston, TX 77555-0609, USAFax: +1 409 747 2429

HEPATITIS VIRUSESStephen LocarniniVictorian Infectious Diseases ReferenceLaboratoryWHO Collaborating Centres for Virus Referenceand Research, and Biosafety10 Wrekyn Street, North Melbourne 3051,Victoria, AustraliaFax: +61 3 9342 2666

CLINICAL HIVPeter ReissNational AIDS Therapy Evaluation CentreAcademic Medical CentreUniversity of Amsterdam, Pietersbergweg 91105 BM Amsterdam, the NetherlandsFax: +31 20 314 9399

Joe EronUniversity of North Carolina at Chapel Hill 211a W Cameron St, CB 7030, APCF Chapel Hill, NC 27599-7030, USA Fax: +1 919 966 1576

PRE-CLINICAL HIVAmalio TelentiInstitute of Microbiology, CHUV1011 Lausanne, SwitzerlandFax: +41 21 314 4095

PAPILLOMAVIRUSESWilliam BonnezInfectious Diseases Unit - Box 689University of Rochester Medical Center601 Elmwood AvenueRochester, NY 14642, USAFax: +1 585 442 9328

RESPIRATORY VIRUSESFrederick G HaydenDepartment of Internal MedicineBox 473, University of Virginia Health Sciences Center, CharlottesvilleVA 22908, USAFax: +1 434 924 9065

EDITORIAL OFFICE

MANAGING EDITORStephen Cameron

SENIOR PRODUCTION EDITORGavin Jamieson

PRODUCTION EDITORAngela Willcox

PRODUCTION ASSISTANTSarah Leboff

International Medical Press36 St Mary at HillLondon EC3R 8DUUK

Tel: +44 20 7398 0700Fax:+44 20 7398 0701E-mail: [email protected]://www.intmedpress.com

EDITORIAL BOARD

ii

CONTENTS


Organizing and Scientific Committee iv

Workshop supporters iv

Programme v

Review contents vii

Introduction M1

Reviews M3

Speakers’ affiliation M131

iii


Support for the 1st Meeting on Mitochondrial Toxicity and HIV Infection:Understanding the Pathogenesis for a Therapeutic Approach:

The meeting was supported by an unrestricted educational grant from:

This supplement was supported by:

ORGANIZING & SCIENTIFIC COMMITTEE

Professor Andrea CossarizzaChair of Immunology, Department of Biomedical Sciences, University of Modena and Reggio Emilia, Modena, Italy

Professor Roberto EspositoInfectious Diseases Clinics, University of Modena and Reggio Emilia, Modena, Italy

Dr Cristina MussiniInfectious Diseases Clinics, University of Modena and Reggio Emilia, Modena, Italy

www.unimore.it

iv


PROGRAMME

TIME TITLE PRESENTING AUTHOR

Thursday, May 19, 200518:00 Opening ceremony

Opening lecture: Chairmen: Roberto Esposito, Fernando Aiuti

Mitochondria in phenoptosis, programmed Vladimir Skulachev death of the organism

Friday, May 20, 2005SESSION 1

9.00-13.00 From the organelle to the clinic Chairmen: Gianni Di Perri, Adriano Lazzarin

Introductory remarks Kees Brinkman

Mitochondrial nucleoside pools in AIDS: William Lewis impact of NRTIs on a delicate cellular balance

Methodological considerations in human Patrick W. Mallon studies of gene expression in HIV-associated lipodystrophy

Mitochondrial RNA as a new marker for drug Andrea Cossarizza toxicity

Diagnosis of mitochondrial dysfunction in Jordi Casademont HIV-infected patients under HAART: possibilities beyond the standard procedures

HIV protease inhibitors as regulators of Walter Malorni mitochondrial-induced T cell apoptosis

SESSION 2

14.00-18.30 Clinical evidence of mitochondrial damage Chairmen: Roberto Cauda, Mauro Moroni

Lipodystrophy and mitochondria: from Oscar Mirò experimental hypothesis to clinical findings

Predictors of lipodystrophy and metabolic Massimo Galli alterations in the lipoicona cohort

Mitochondrial function in fat from HIV Mariana Gerschenson patients

Role of NRTI-induced adipocyte mtDNA Simon Mallal depletion in lipoatrophy

Mitochondrial toxicity in children perinatally Stephane Blanche exposed to nucleoside analogues. An update

Mitochondrial toxicity in HIV-infected children Alessandra Viganò

Viral hepatitis and its therapy influence Vincent Soriano mitochondrial damage in HIV-infected patients

Proceedings of the 1st Meeting on Mitochondrial Toxicity and HIVInfection: Understanding the Pathogenesis for a Therapeutic ApproachMay 19-21, 2005, Modena, Italy

v


Saturday, May 21, 2005SESSION 3

9.00-13.00 The challenge for mitochondrial recovery Chairmen: Andrea Cossarizza, Roberto Esposito

Kidney toxicity in HIV antiretroviral therapy Hélène C.F. Côté

Efficacy and safety of medical and surgical Giovanni Guaraldi interventions for treating morphological and metabolic alterations of HIV-related lipodyst-rophy in women: a 48-week observational study

Peripheral neuropathy: recent advances in Mike Youle pathophysiology and treatment

Effects of reducing stavudine dose or Ana Milinkovic switching from stavudine to tenofovir in HIV+ patients treated with standard dose stavudine-based triple therapy

Mitochondrial DNA during treatment Cristina Mussini interruptions

Uridine in the treatment of mitochondrial Ulrich Walker toxicity

Concluding remarks Peter Reiss, Andrea Cossarizza

vi


REVIEW CONTENTS

M1 Introduction Mitochondria, HIV infection and its treatment: where do we go from here?A Cossarizza & P Reiss

M3 Reviews On the possible ways nucleoside analogues can affect mitochondrial DNA contentand gene expression during HIV therapyH Côté

M13 Nucleoside reverse transcriptase inhibitors, mitochondrial DNA and AIDS therapyW Lewis

M29 HIV-protease inhibitors prevent mitochondrial hyperpolarization & redox imbalance and decrease endogenous UCP-2 expression in GP-120-activated humanT lymphocytesP Matarrese et al.

M47 Mechanisms of HIV and NRTI injury to the mitochondriaG Moyle

M53 Adverse effects of nucleoside analogues treatment: focus on HIV-infected childrenA Vigano & V Giacomet

M65 Diagnosis of mitochondrial dysfunction in HIV-infected patients under HAART: possibilities beyond the standard proceduresJ Casademont et al.

M73 Mitochondrial studies in HAART-related lipodystrophy: from experimental hypothesis to clinical findingsO Mirò et al.

M83 Mitochondrial DNA levels of PBMCs and subcutaneous adipose tissue from thigh,fat and abdomen of HIV-1 seropositive and negative individualsM Gerschenson et al.

M91 Altered mitochondrial RNA production in adopocytes from HIV infected individuals with lipodystrophyL Galluzzi et al.

M101 Methodological considerations in human studies of gene expression in HIV-associated lipodystrophyP Mallon et al.

M109 The role of hepatitis C virus (HCV) on mitochondrial DNA damage in HIV/HCV co-infected individualsC de Mendoza & V Soriano

M117 Uridine in the prevention and treatment of NRTI-related mitochondrial toxicityU Walker & N Venhoff

M125 HIV-associated antiretroviral toxic neuropathty (ATN): recent advances in pathophysiology and treatment M Youle

vii

1st Meeting on Mitochondrial Toxicity & HIV Infection: Understanding the Pathogenesis for a Therapeutic Approach M1

Modena, Italy 19–21 May 2005

Introduction

Mitochondria, HIV infection and its treatment:where do we go from here?Andrea Cossarizza1* and Peter Reiss2

1University of Modena and Reggio Emilia, Modena, Italy2Academic Medical Center, University of Amsterdam, The Netherlands & Clinical HIV Section Editor, Antiviral Therapy

*Corresponding author: Tel: +39 059 205 5415; Fax: +39 059 205 5426; E-mail: [email protected]

The idea of organizing a meeting on different aspectsof the interactions between mitochondria, HIV infec-tion and its treatment emerged as a result of thegrowing interest the scientific community has shown inthis topic during recent years. Many of the scientistswho have been conducting clinical as well as morebasic research in this field responded enthusiastically tothe invitation to present and discuss their ongoingresearch at the first international conference on“Mitochondrial toxicity and HIV infection: under-standing the pathogenesis for a therapeutic approach”,held in Modena (Italy) from May 19-21, 2005. Theinitiative for this conference was taken by ProfessorAndrea Cossarizza, Chair of Immunology at theUniversity of Modena and Reggio Emilia, and hiscolleagues from the Department of Infectious Diseasesat the same University, Professor Roberto Esposito andDr Cristina Mussini.

The meeting was made possible by un unrestrictededucational grant from Gilead Sciences, Italy, andpublication of part of the proceedings of the meeting inthis supplement of Antiviral Therapy was madepossible by an unrestricted grant from Sigma Tau, Italy.We wish to underline that the conference organizershad full responsibility for the content of theprogramme as well as the choice of speakers andsession chairs, without any interference from the phar-maceutical sponsors. All papers appearing in thissupplement underwent peer-review prior to beingconsidered for publication.

The meeting started with a lectura magistralis given byProfessor Vladimir Skulachev (State University ofMoscow, Russia), one of the founding fathers of thefield of “bioenergetics”, who provided an overview onprogrammed death in relation to ageing, at the level ofindividual cells (apoptosis), whole organisms (phenop-tosis) as well as subcellular organelles including

mitochondria (mitoptosis). This stimulated discussionon whether several of the adverse effects of treatment for HIV infection might be a reflection of “acceleratedageing” by mechanisms including mitochondrial toxicity.

The talks and related discussions that took place in thefollowing days revealed that several issues concerningthe detrimental effects which HIV, other concomitantinfections such as those with hepatitis C, and HIVtherapy may have on mitochondria warrant furtherinvestigation and clarification in the years to come.

What is becoming increasingly clear is that antiretrovi-rals, and nucleoside analogue reverse transcriptaseinhibitors (nRTI) in particular, may affect mitochon-dria in more ways than one. Inhibition by nRTI ofDNA γ-polymerase resulting in mitochondrial DNA(mtDNA) depletion remains one of the cornerstones bywhich nRTI may induce mitochondrial toxicity. It isevident however that nRTI and even other classes ofantiretrovirals such as HIV protease inhibitors, mayhave additional effects on mitochondria, for instanceby way of exerting direct effects on mtRNA transcrip-tion and mitochondrial enzymes. Differences betweenindividual agents as well as differences in the extent towhich these effects may play a role in different celltypes remain to be further delineated.

An important problem still remaining is the choice ofthe type of cell in which to best measure mitochondrialmarkers as a possible reflection of treatment toxicity.Blood obviously remains the easiest tissue to obtainfrom patients, but contamination with platelets whichcontain numerous mitochondria may yield poorlyinterpretable results when using whole blood orperipheral blood mononuclear cells (PBMCs). Betterpurified cell populations such as isolated CD4+ orCD8+ T lymphocytes, or platelet-depleted lymphocytes

Antiviral Therapy 10, Supplement 2M2


or monocytes may provide more reliable results andneed to be investigated further. Nevertheless, othertissues and cells coming directly from the organsystems affected by the treatment toxicity being studied(for instance adipose, hepatic or renal) may be moreinformative, and more appropriate when trying toassess the possible mitochondrial pathogenesis under-lying a specific drug toxicity.

In order for any marker of mitochondrial toxicity tobecome clinically useful for the early detection of drugtoxicity, its sensitivity, specificity and predictive valuewould have to be adequately demonstrated in the context of appropriate clinical studies. Several tech-nologies, assays and methodologies are nowadays usedby several groups to analyse different aspects of mitochondrial biology. Flow cytometry and confocalmicroscopy, utilizing specific fluorescent probes, candetect at the single cell level changes in several mito-chondrial parameters (including changes in internalmembrane potential or organelle mass), as well asmodification in the morphology of the cell or tissueunder investigation, and are widely used in differentlaboratories. Classic biochemical assays, which canmeasure different aspects of mitochondrial respiratorychain function, are also quite popular, even if theyoften require large amounts of biological material,classically skeletal muscle. Thanks to the improvementin molecular biological techniques, including assaysbased upon the real time polymerase chain reaction,the measurement of the amount of mitochondrial DNAper cell is becoming easier, and a variety of scientists –even if different genes are used as target – are obtainingsimilar results, also as far as the absolute number ofmtDNA copies in a given cell is concerned.Nevertheless, adequate quality control and assuranceprogrammes are key in order to allow comparison ofresults obtained by different groups of investigators.Of note, a task force focussing on the further stan-dardization of mtDNA quantification, involvinginvestigators in the US, Canada, Australia, and Europe,has just been created. Similar approaches should beadvocated for the evaluation of additional mitochon-drial markers such as the quantification ofmitochondrial RNA.

Conferences such as the one held in Modena will hope-fully contribute to the further unravelling of the rolemitochondria play in the setting of HIV infection andits treatment, ultimately leading to safer treatments forour patients.


In recent years, research into nucleoside reverse transcrip-tase inhibitor (NRTI)-related mitochondrial (mt) toxicityin HIV therapy has led to conflicting results and manyunanswered questions regarding the molecular mecha-nisms that lead to such toxicity. From the early hypothesisthat inhibition of the human mt polymerase γ by NRTIswas responsible for the drugs’ mt toxicity, an increasinglycomplex picture is emerging that probably involves

multiple mt pathways. Results have been presentedsuggesting that NRTIs affect not only mtDNA but alsomtRNA, nucleotide phosphorylation and the mt respira-tory chain. Based on the current level of knowledge, thisoverview addresses some of the potential mechanismsthrough which NRTIs could affect mitochondria and ulti-mately cause the toxicity symptoms observed in HIVpatients receiving NRTI-containing antiretroviral therapy.

Possible ways nucleoside analogues can affect mitochondrial DNA content and gene expressionduring HIV therapyHélène CF Côté

British Columbia Centre for Excellence in HIV/AIDS, Department of Pathology & Laboratory Medicine/University of British Columbia,Vancouver, BC, Canada

Tel: +1 604 822 9777; Fax: +1 604 822 7635; E-mail: [email protected]

Since mitochondrial (mt) toxicity was suggested as acommon pathway for the adverse effects of nucleosidereverse transcriptase inhibitors (NRTIs) [1–3], a bodyof evidence has accumulated that, for the most part,supports the model. The intention of this review is topoint out some of the limitations of HIV drug toxicityresearch, review the evidence relating NRTI toxicity tomtDNA damage (or not), and present the various path-ways of mt toxicity that could potentially contribute tosuch damage.

It has been known for some time that mt toxicitytends to be drug and tissue specific [4–9,39]. Morerecently, evidence has been mounting that NRTI-related mt toxicity in HIV is probably a complex,multifactorial phenomenon. Drug- and tissue-specificdifferences in inhibitory activity toward polymerasescould, of course, play a part, but a number of othervariables are emerging. Different rates of NRTIuptake and/or intracellular phosphorylation betweentissues could modulate specificity [11]. Patient charac-teristics such as gender, body weight or coinfectionstatus can influence the incidence and severity of mttoxicity symptoms. A plausible association betweenproinflammatory and immune activation cytokinelevels such as interferon and tissue necrosis factor, andthe heightened risk of NRTI toxicity in specific popu-lations has been suggested [11,12], but the mechanismbehind this effect remains unclear. Co-morbidities,

concomitant medications and genetic factors, as wellas HIV therapy-independent mt damage can all influ-ence and modulate mt toxicity and the developmentof symptoms.

Limitations of HIV mt toxicity research

Mitochondrial toxicity is a complex phenomenon, withmultiple factors involved. Several factors may havecontributed to the inconsistencies currently found in theliterature on HIV-related mt toxicity (Table 1). Firstly,the relatively low incidence of severe mt toxicity-relatedadverse events has presented a challenge to studies inthe HIV patient population. Secondly, many clinicalsymptoms suspected to have their aetiology in mt toxi-city such as peripheral neuropathy, myopathy or evenlipoatrophy can be challenging to quantify objectivelyin a standardized fashion. The majority of publicationsto date have studied relatively small observationalcohorts, often in cross-sectional designs. In smallstudies, a lack of statistically significant associationbetween mtDNA levels and a given clinical condition,although important to report, may be imputable toinsufficient power, thereby limiting the conclusions thatcan be reached. Another issue is the potential time lagbetween the NRTI-induced mt damage taking place andthe actual manifestation of the toxicity through clinicalsymptoms. As is the case of hyperlactataemia [16] and

Introduction


probably lipoatrophy, this time lag can also present achallenge to the demonstration of any relationship, letalone causation. In certain tissues with rapid turnoversuch as blood cells, depleted mtDNA levels usually‘rebound’ upon withdrawal of drug pressure [16]. Thisreadily available sample is thereby susceptible to treat-ment interruptions, planned or not. Finally, differencesin the type of sample studied as well as the techniquesand methodologies used could also explain some of thediscrepancies in the literature [13–15].

Potential pathways of mt toxicity (Figure 1)

mtDNA depletion

Cellular mtDNA content is significantly lower in HIV-infected patients than in uninfected controls [16–21].This important observation strongly suggests a virus-induced effect on the mitochondria and its genome, byan as yet unknown mechanism. That NRTI-containingtherapy exacerbates this effect is highly plausible. It haslong been known that NRTIs used in HIV therapy caninhibit the mt polymerase γ enzyme in vitro [22,23].Cell culture [24–29] and animal studies [30–34]provide strong evidence in support of the NRTIinhibiting mtDNA synthesis model. However, whetherthis mtDNA depletion is the pathogenesis for all clin-ical symptoms of toxicity observed in HIV patients onhighly active antiretroviral therapy (HAART) is lessclear. The DNA polymerase γ hypothesis by itself failsto explain the entire array of metabolic deficienciesassociated with NRTI-induced disorders [35]. Table 2presents a summary of some of the published studies onNRTI and related mt toxicity, divided in two groups:consistent and inconsistent with mtDNA depletion asthe pathogenesis of mt toxicity.

mtDNA depletion was first reported in muscle [54],fat [55] and nerve tissue [4] of HIV patients experi-encing drug-related symptoms of myopathy, lipoat-rophy and neuropathy, respectively. We reportedmtDNA depletion in peripheral blood buffycoat fromHIV-infected patients receiving NRTIs and havingsymptoms of mt toxicity including hyperlactataemia

HCF Côté


Table 1. Limitations and factors that may contribute to theinconsistency of findings in the HIV antiretroviral therapy mttoxicity literature

Low incidence of severe adverse event

Challenge to objectively grade or quantify certain adverse effects

Time lag between mt damage and clinical symptoms

Limited sample size

Cross-sectional as opposed to longitudinal design

Potential biases inherent to observational studies

Rapid cell turnover

Differences in sample type and sample processing

Differences in techniques and methodologies

mt, mitochondrial.

Figure 1. Schematic representation of several potential mechanisms by which NRTIs could affect mtDNA and mt gene expression(mtRNA), leading to mt toxicity

Direct mtDNA depletion through inhibition of replication by polymerase γ and early chain termination

Direct mtRNAs (mRNA, tRNA or rRNA) depletion through inhibition of RNA polymerase or down-regulation of transcription

Indirect depletion of mtDNA and mtRNAs through nucleoside/nucleotide pool imbalance caused by:

2

MRC dysfunction inhibiting de novo pyrimidine synthesis

3

Reduced ATP production inhibiting endogenous nucleoside phosphorylation

4

NRTI phosphorylation by mt kinasesinhibiting endogenous nucleoside phosphorylation5

Direct inhibition of MRC by non-phosphorylatednucleoside analogues

6

nucleosideanalogues

endogenous

kinases

dNTP

ATP

NRTI MRC(de novo)

2

mtDNAmtDNA

mtRNAs

mt proteins

nucleosides

4

6

5

NRTI

3

1

1

Pathways recently suggested or that are more speculative in nature are indicated by numbered squares. mtRNA: mRNA, rRNA or tRNA. dNTP, deoxynucleotides; MRC,mt respiratory chain; mt, mitochondrial; NRTI, nucleoside reverse transcriptase inhibitor.

[16]. The mtDNA depletion was reversible uponremoval of the NRTIs suspected of causing mt toxicity,as are most toxicity symptoms if the antiretroviraltherapy is changed or interrupted. We also found that the NRTI combination of stavudine (d4T) withdidanosine (ddI), two drugs associated with a greaterrisk of hyperlactataemia [5,56,57], was also associatedwith greater blood mtDNA depletion than the otherNRTI combinations studied [7]. These findings allappear consistent with the involvement of mtDNAdepletion in NRTI-induced mt toxicity. However, not allstudies of HIV therapy-related symptomatic mt toxicityshow mtDNA depletion (Table 2). Discrepancy andcontroversy also remains with respect to the effect ofNRTI-mediated mtDNA depletion on mt function.Several studies, using various tissues from HIV patients,have concluded that mtDNA levels and mt activities arepositively correlated [38,44,58]. However, others wouldsuggest otherwise and the relationship between mtDNAand mt function is somewhat unclear based on thecurrent HIV literature. For example, one study foundthat a decrease in blood cell mt mass and mtDNAcontent was not accompanied by a decrease incytochrome c oxidase gene expression or activity,leading the authors to suggest a compensatory mecha-nism up-regulating mt transcription or translation [59].Another study from the same group found thatdecreased peripheral blood mononuclear cell (PBMC)mtDNA was accompanied by a decrease in mt respira-tory chain (MRC) complex IV activity, but withoutevidence of mt dysfunction such as altered oxygenconsumption or lipid peroxidation [51].

Indeed, results have also been inconsistent withrespect to the association of mtDNA depletion withspecific clinical adverse effects widely attributed to mttoxicity such as lipoatrophy and hyperlactataemia(Table 2). For example, in cases of hyperlactataemiaand lipoatrophy, several studies have shown an associ-ation between the symptoms and mtDNA depletion inblood cells [16,10,18] while others have not[47,50,20]. In fat tissue, a few studies have suggestedan association between fat mtDNA copies/cell andthe presence of lipoatrophy [36,40,45]. Confocalmicroscopy analyses even offered direct evidence of arelationship between severity of adipose tissue toxicityand mtDNA depletion [40]. Recently, a significantdecrease in fat cell mtDNA but not PBMC mtDNAlevels was found in patients with peripheral neuropathyor lipodystrophy [43]. In contrast, another groupfound PBMC mtDNA decreased significantly inpatients with lipoatrophy compared with those withoutlipoatrophy while mtDNA levels in adipose tissue didnot differ significantly between the two groups [10].Thus, contradictory results prevail in adipose tissue aswell. These and other studies [60] clearly emphasize the

importance of the tissue assayed. The mtDNAmeasurements are also likely to be influenced by theseverity of the toxicity symptoms, as well as the timingof the tissue sample collection, issues that are rarelyaddressed in the current research.

Drug-related adverse events remain a commonreason for intentional lack of adherence or for therapychange or interruption in adherent patients [61,62]. Wecarried out an observational study on a cohort of HIV-infected individuals starting their first regimen, toexamine the relationship between blood buffycoatmtDNA and therapy change or discontinuation ‘for anyreason’. Within the first 6 months on therapy, wemeasured a greater blood cell mtDNA decrease frombaseline in those receiving the NRTI combinationd4T/ddI. A greater proportion of these patients alsoeventually changed or discontinued therapy ‘for anyreason’ during the study period. However, in the finalanalysis, despite the fact that all NRTI combinationsstudied showed a decline in mtDNA levels at the lastfollow-up, an inverse relationship was observed – ashorter time to therapy change/stop was associated withan increase in mtDNA from baseline, rather than adecline [63]. A number of confounding factors thatcould contribute to therapy changes or cessation couldnot be controlled for and may have contributed to thiscounterintuitive result. Alternatively, it could reflectsome compensatory mechanism as suggested by others[59], which would be consistent with the in vitro obser-vation that mt mass and mtDNA content initiallyincrease in response to oxidative stress [64].

Overall, poor correlation between mtDNA levels andvarious mt toxicity symptoms strongly suggest addi-tional mechanism(s), some of which are presented below.

mtRNA depletion

The mt genome encodes 13 polypeptides, all subunitsof the mt respiratory chain (MRC) and essential foroxidative phosphorylation. It is tempting to assumethat, in a manner similar to the effect of aging onmuscle [65], depletion of mtDNA by NRTIs may leadto decreases in mt gene expression and ultimately adecrease in mt function. Recent work, however, hasthrown doubt on this simplistic model. Non-HIVstudies have shown that despite severe mtDNA deple-tion, mt genes can be transcribed at normal levels[66,67]. In HIV patients, results once again have beensomewhat inconsistent. One study found that mtDNAdepletion was not accompanied by a decrease in PBMCmt gene expression [59]. A second showed no change inPBMC mtDNA or mtRNA levels between two groupsof patients initiating an antiretroviral regimen with orwithout d4T [52]. In contrast, Mallon et al. reportedsignificantly decreased mt gene expression in adipocytes


Mitochondrial nucleic acids in HIV therapy

HCF Côté


Table 2. Published studies with findings appearing consistent versus inconsistent with a relationship between mtDNA damageand NRTI-related mt toxicity

Consistent with relationship between mtDNA damage and mt toxicity

Specimen studied (tissue) Study/control, n mtDNA Associated with Reference

Subcutaneous fat 11/13 Decrease Lipoatrophy at biopsy site versus Walker et al., 2002 [36]no lipoatrophy

Blood buffycoat 8/47 Decrease Symptomatic hyperlactataemia Cote et al., 2002 [9]Subcutaneous fat 33/16 Decrease D drugs Cherry et al., 2002 [37]PBMCs 12/24 Decrease HAART +/– lipodystrophy, Miro et al., 2003 [38]

decline in MRC activityBlood buffycoat 214 Decrease Didanosine/stavudine, Cote et al., 2003 [7]

didanosine useSubcutaneous fat 69/7 Decrease Stavudine, fat wasting Nolan et al., 2003 [6]Subcutaneous fat 20/11 Decrease Stavudine or zidovudine Pace et al., 2003 [39]

versus no HAARTSubcutaneous fat 21/11 Decrease NRTI therapy versus no HAART Nolan et al., 2003 [40]Cord blood, placenta 8/5 Decrease NRTI therapy versus no HIV Shiramizu et al., 2003 [41]Peripheral blood 16/10 Mutations Lipoatrophy Martin et al., 2003 [42]Subcutaneous fat 28 Decrease Stavudine versus zidovudine Van der Valk et al., 2004 [10]PBMCs 28 Decrease HIV lipoatrophy Van der Valk et al., 2004 [10]Subcutaneous fat 25/10 Decrease Peripheral neuropathy, Rabing Christensen et al., 2004 [43]

lipodystrophy, HAARTSubcutaneous fat 7 Decrease Reduced COX activity Hammond et al., 2004 [44]PBMCs 69 Decrease Stavudine versus other drugs, de Mendoza et al., 2004 [18]

higher lactateLiver biopsy 34/35 Decrease D drugs Walker et al., 2004 [20]Subcutaneous fat 6/7 Decrease HIV lipoatrophy Gerschenson et al., 2004 [14]Subcutaneous fat 96/34 Decrease Thymidine analogue versus Hammond et al., 2004 [45]

non-thymidinePBMCs, muscle, fat 7 Increase Substituting stavudine, McComsey et al., 2005 [46]

improved lipoatrophy

Inconsistent with relationship between mtDNA damage and mt toxicity

Specimen studied (tissue) Study/control, n mtDNA Associated with Reference

Blood leukocytes 10/10 No difference Patients with or without McComsey et al., 2002 [47]lipoatrophy

Blood lymphocytes 6/12 No difference Children with or without Cossarizza et al., 2002 [48]lipodystrophy

PBMCs 33/16 No difference HAART with or without D drugs Cherry et al., 2002 [37]Blood lymphocytes 23/11 Increase Lipodystrophy, cholesterolaemia Cossarizza et al., 2003 [49]PBMCs 33/13 Decrease Low CD4, high viral load Miura et al., 2003 [17]PBMCs 94 No difference Lipoatrophy patients on thymidine Hoy et al., 2004 [50]

analogue versus switch to abacavirPBMCs 25/10 No difference Peripheral neuropathy, Rabing Christensen et al., 2004 [43]

lipodystrophy, HAARTBlood 157 No difference HIV treatment, lipodystrophy, Chiappini et al., 2004 [20]

lactate, clinical symptomsSubcutaneous fat 28 No difference Patients with or without Van der Valk et al., 2004 [10]

lipoatrophyPBMCs 42/25 Decrease No change in oxygen consumption Lopez et al., 2004 [51]

and lipid peroxidationPBMCs 7/7 No difference HIV lipoatrophy Gerschenson et al., 2004 [14]Longitudinal PBMCs 15/63 No difference Clinical adverse events Casula et al., 2004 [52]Subcutaneous fat 20/0 No difference Decreased mtRNA Mallon et al., 2004 [53]

D drugs: didanosine, stavudine and zalcitabine (dideoxynucleotides); COX, cytochrome c oxidase; HAART, highly active antiretroviral therapy; mt, mitochondrial; MRC,mt respiratory chain; NRTI, nucleoside reverse transcriptase inhibitor; PBMCs, peripheral blood mononuclear cells.

and blood monocytes after short periods on zidovudine(AZT)- or d4T-containing therapy [53,68].Importantly, this was not accompanied by any signifi-cant change in mtDNA content or metabolic parame-ters, and was independent of HIV [53,68]. The latterresults would imply that NRTIs can exert an effect,directly or indirectly, not only on mtDNA polymeriza-tion but could also regulate mt gene expression and/orinhibit mtRNA polymerization.

Interestingly, the DNA polymerase γ is capable ofcatalysing reverse transcription with a high efficiency,an activity that may be physiologically significant,especially considering that RNA-primed DNAsynthesis activity is required for initiation of mtDNAreplication [69]. Such activity could also be inhibitedby NRTIs. Another potential target of NRTIs could bethe mtRNA polymerase itself and the co-factorsrequired for mt transcription, some of which are regu-lated through phosphorylation [70] and are, therefore,susceptible to MRC dysfunction. In addition, NRTIscould impair ribonucleotide synthesis and/or utilizationin a manner similar to that hypothesized fornucleotides. All of the above could potentially translateinto altered mt messenger RNA (mRNA) levels.

The mt genome also encodes 22 mt transfer RNAs(tRNAs) and 2 ribosomal RNAs (rRNAs) that arenecessary for the translation of the 13 mtDNA-encodedpolypeptides. Mutations in mt tRNA genes have beenassociated with various neuromuscular and neurode-generative disorders, many sharing phenotypic similar-ities with HIV therapy mt toxicity symptoms [71,72].Any NRTI-induced mtDNA damage or any transcrip-tion inhibition could also affect these other mtRNAsand participate in mt toxicity.

Nucleotide pool imbalance

mtDNA depletion can be caused by NRTI incorpora-tion into elongating mtDNA or inhibition of the poly-merase γ, but even if these events occur, they areprobably not the only mechanisms at play. Imbalancesin the mt nucleotide pool have been suggested as thecause of mtDNA abnormalities in patients with inher-ited thymidine phosphorylase deficiencies [73,74]. In asimilar manner, nucleoside analogues used to treat HIVinfection can alter the endogenous cellular and mtnucleoside/nucleotide pools, potentially leading to thedisturbance of a wide range of nucleic acid pathwaysthat depend on these building blocks (Figure 1).

In its non-phosphorylated pro-drug form, AZT is apotent inhibitor of thymidine phosphorylation in heartand liver mitochondria [75–77]. Thus, the toxicity of AZTin some tissues may be mediated by disruption of thesubstrate supply of deoxythymidine triphosphate (dTTP)for mtDNA replication. De novo synthesis of pyrimidine

nucleotides [dTTP, deoxycytosine triphosphate (dCTP)and deoxyuridine triphosphate (dUTP)] is coupled tothe MRC [78]. Therefore, MRC dysfunction, whateverthe cause, leads to decreased mt ATP regeneration that,in turn, impairs pyrimidine synthesis as well as itsnucleotide phosphorylation [79], further enhancing thecycle of mt toxicity. Indeed, mtDNA-lacking cells donot synthesize pyrimidine nucleosides and requireexogenous uridine for growth [80]. Interestingly, this isconsistent with the observations that uridine can rescuemtDNA depletion induced by the pyrimidine analoguesAZT, d4T and zalcitabine (ddC) in vitro [81,82].

mtDNA damage (mutation, deletion)

Much attention has been paid to mtDNA quantity inrecent research. Also important, but technically chal-lenging to evaluate, is mtDNA quality. It is well-docu-mented that mtDNA damage in the form of mutationsand deletions accumulates over time, and plays a rolein the conditions and diseases associated with aging[83–85]. NRTI therapy also provides conditionspermissive for the development of peripheral bloodmtDNA mutations in vivo [42]. Furthermore, NRTI oroxidative agents have been shown to directly impair theenergy-producing system of mitochondria, causingdysfunction of cellular redox control, which eventuallyleads to loss of the mtDNA integrity [86].

In utero d4T exposure in mice leads to long-term mtdamage and dysfunction in heart mitochondria, lastingto adulthood [87]. This effect would not be mediatedby inhibition of the DNA polymerase γ but more prob-ably result from persistent mtDNA mutations in thecardiac tissue [87], and it provides indirect evidence ofNRTIs causing long-term decrease in mtDNA quality.

In the HIV population, large mtDNA deletions havebeen reported in a few cases of NRTI lactic acidosis[88,89]. Although it is unknown at this point whetherthese deletions predated HIV infection and HIVtherapy, one can hypothesize that the presence of suchdeletions would, in all likelihood, diminish the mito-chondria’s ability to compensate under NRTI drugpressure, thereby accelerating or exacerbating thedevelopment of mt toxicity symptoms.

Other potential mt toxicity mechanisms

Apart from the various ways by which NRTIs canaffect mt nucleic acids and their synthesis, there are anumber of mtDNA-independent, poorly understoodpotential mechanisms that have been suggested forNRTI-mediated toxicity and a few are presented below.

Before any measurable effect on mtDNA, short-termAZT treatment of cultured rat myotube can induce amarked, yet reversible reduction in mt membrane



potential [90]. This suggests that AZT can physicallyinterfere with the membrane structure and could leadto modifications of its physical characteristics. This isconsistent with the earlier observations that AZTexerts a short-term effect directly on the MRC [30],causing a decrease in ATP production [86], in additionto long-term alteration of the mtDNA. Similarly, in arat heart model, ddC can decrease ATP, increase reac-tive oxygen species (ROS) formation and mediate celldamage before changes to mtDNA occur [91].

Recently, thymidine analogues and a thymidinecatabolite were shown to enhance hepatic fat oxidationwithout affecting fat mtDNA, introducing NRTI catabolicproducts as possible players in HIV lipoatrophy [92].

The vicious circle of mt damage

Over time, ROS and free radicals damage the mtDNA,a phenomenon that forms the basis for one of the theo-ries on aging. This damage in turn increases ROSproduction and leads to further oxidative damage tothe mtDNA in human tissues, such as large-scale dele-tions and point mutations that accumulate with age[93,94,85]. There is also growing evidence that HIVitself can affect mitochondria and its nucleic acid [9,21]by an as yet unknown mechanism, possibly pre-disposing patients to mt toxicity [95,96]. Finally, it isnow well accepted that NRTIs used to treat HIV

infection can also damage mtDNA. This cumulativemtDNA damage eventually impairs MRC function,which itself can lead to further oxidative stress andmtDNA damage [85]. Long-term HIV therapy withNRTI-containing regimen in aging patients thusprovides the context for a ‘triple’ insult to the mito-chondria (Figure 2). One can hypothesize a synergistic,multifactorial model for mt toxicity, which wouldoperate at different rates depending on the tissue, thedrugs and the individual’s health and genetic background.

These are but a few of the various ways NRTIs andtheir intermediates are known or suspected to lead tomt toxicity in HIV patients receiving HAART. Furtherresearch with large controlled longitudinal studies,preferably with standardized assays [13,97], will beneeded to elucidate the mechanisms of NRTI-inducedmt toxicity and their relative contribution to clinicaltoxicity symptoms. This will be crucial in determiningthe marker(s) and samples most clinically relevant tomt toxicity testing, with the goal of preventing,predicting and monitoring mt toxicity in HIV patientson antiretroviral therapy.

Acknowledgements

Thanks to Christopher Alexander and Brian Scarth fortheir assistance with the manuscript.

Support

HCFC is supported by a Scholar Investigator Award fromthe Michael Smith Foundation for Health Research.

References1. Lewis W & Dalakas MC. Mitochondrial toxicity of

antiviral drugs. Nature Medicine 1995; 1:417–422.2. Brinkman K, ter Hofstede HJ, Burger DM, Smeitink JA &

Koopmans PP. Adverse effects of reverse transcriptaseinhibitors: mitochondrial toxicity as common pathway.AIDS 1998; 12:1735–1744.

3. Kakuda TN. Pharmacology of nucleoside and nucleotidereverse transcriptase inhibitor-induced mitochondrial toxi-city. Clinical Therapy 2000; 22:685–708.

4. Dalakas MC, Semino-Mora C & Leon-Monzon M.Mitochondrial alterations with mitochondrial DNA deple-tion in the nerves of AIDS patients with peripheralneuropathy induced by 2′3′-dideoxycytidine (ddC).Laboratory Investigation 2001; 81:1537–1544.

5. John M, Moore CB, James IR, Nolan D, Upton RP,McKinnon EJ & Mallal SA. Chronic hyperlactatemia inHIV-infected patients taking antiretroviral therapy. AIDS2001; 15:717–723.

6. Nolan D, Hammond E, James I, McKinnon E & Mallal S.Contribution of nucleoside-analogue reverse transcriptaseinhibitor therapy to lipoatrophy from the population to thecellular level. Antiviral Therapy 2003; 8:617–626.

7. Cote HC, Yip B, Asselin JJ, Chan JW, Hogg RS, Harrigan PR,O’Shaughnessy MV & Montaner JS. Mitochondrial:nuclearDNA ratios in peripheral blood cells from humanimmunodeficiency virus (HIV)-infected patients who received

HCF Côté


HIV ROS

mtDNA damage

NRTI

Figure 2. Potentially cumulative effect of HIV infection,increased ROS production and NRTIs on mtDNA damage(depletion/mutation/deletion)

NRTI, nucleoside reverse transcriptase inhibitor; mt, mitochondrial; ROS, reactive oxygen species.

selected HIV antiretroviral drug regimens. Journal ofInfectious Diseases 2003; 187:1972–1976.

8. Reiss P, Casula M, de Ronde A, Weverling GJ, Goudsmit J& Lange JM. Greater and more rapid depletion of mito-chondrial DNA in blood of patients treated with dual(zidovudine+didanosine or zidovudine+zalcitabine) vs single(zidovudine) nucleoside reverse transcriptase inhibitors.HIV Medicine 2004; 5:11–14.

9. Cote HCF, Brumme ZL, Chan JW, Guillemi S, de Ronde A, deBaar MP, O’Shaughnessy MV, Montaner JSG & Harrigan PR.Severe mitochondrial DNA depletion in post-mortem fat andliver tissue from a fatal case of lactic acidosis during HIVtherapy. 15th International AIDS Conference. 11–16 July2004, Bangkok, Thailand. Abstrast WePeB5915.

10. van der Valk M, Casula M, Weverlingz GJ, van Kuijk K,van Eck-Smit B, Hulsebosch HJ, Nieuwkerk P, van EedenA, Brinkman K, Lange J, de Ronde A & Reiss P. Prevalenceof lipoatrophy and mitochondrial DNA content of bloodand subcutaneous fat in HIV-1-infected patients randomlyallocated to zidovudine- or stavudine-based therapy.Antiviral Therapy 2004; 9:385–393.

11. Anderson PL, Kakuda TN & Lichtenstein KA. The cellularpharmacology of nucleoside- and nucleotide-analoguereverse-transcriptase inhibitors and its relationship to clin-ical toxicities. Clinical Infectious Diseases 2004;38:743–753.

12. Cossarizza A, Mussini C & Vigano A. Mitochondria in thepathogenesis of lipodystrophy induced by anti-HIV anti-retroviral drugs: actors or bystanders? Bioessays 2001;23:1070–1080.

13. Cossarizza A. Tests for mitochondrial function and DNA:potentials and pitfalls. Current Opinion in InfectiousDiseases 2003 16:5–10.

14. Gerschenson M, Shiramizu B, Tran D, O’Callaghan CO,LiButti DE & Shikuma CM. Mitochondrial DNA depletionin adipose tissues but not PBMC correlate with lipoatrophyin HIV-infected patients. 11th Conference on Retroviruses& Opportunistic Infections. 8–11 February 2004, SanFrancisco, CA, USA. Abstrast 710.

15. Banas B, Kost BP & Goebel FD. Platelets, a typical sourceof error in real-time PCR quantification of mitochondrialDNA content in human peripheral blood cells. EuropeanJournal of Medical Research 2004; 9:371–377.

16. Cote HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyMV & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV-infected patients. NewEngland Journal of Medicine 2002; 346:811–820.

17. Miura T, Goto M, Hosoya N, Odawara T, Kitamura Y,Nakamura T & Iwamoto A. Depletion of mitochondrialDNA in HIV-1-infected patients and its amelioration byantiretroviral therapy. Journal of Medical Virology 2003;70:497–505.

18. de Mendoza C, de Ronde A, Smolders K, Blanco F, Garcia-Benayas T, de Baar M, Fernandez-Casas P, Gonzalez-LahozJ & Soriano V. Changes in mitochondrial DNA copynumber in blood cells from HIV-infected patients under-going antiretroviral therapy. AIDS Research & HumanRetroviruses 2004; 20:271–273.

19. Miro O, Lopez S, Martinez E, Pedrol E, Milinkovic A, DeigE, Garrabou G, Casademont J, Gatell JM & Cardellach F.Mitochondrial effects of HIV infection on the peripheralblood mononuclear cells of HIV-infected patients who werenever treated with antiretrovirals. Clinical InfectiousDiseases 2004; 39:710–716.

20. Chiappini F, Teicher E, Saffroy R, Pham P, Falissard B,Barrier A, Chevalier S, Debuire B, Vittecoq D & LemoineA. Prospective evaluation of blood concentration of mito-chondrial DNA as a marker of toxicity in 157 consecutivelyrecruited untreated or HAART-treated HIV-positivepatients. Laboratory Investigation 2004; 84:908–914.

21. Walker UA, Bauerle J, Laguno M, Murillas J, Mauss S,Schmutz G, Setzer B, Miquel R, Gatell JM & Mallolas J.Depletion of mitochondrial DNA in liver under antiretro-viral therapy with didanosine, stavudine, or zalcitabine.Hepatology 2004; 39:311–317.

22. Martin JL, Brown CE, Matthews-Davis N & Reardon JE.Effects of antiviral nucleoside analogs on human DNApolymerases and mitochondrial DNA synthesis.Antimicrobial Agents & Chemotherapy 1994;38:2743–2749.

23. Lim SE & Copeland WC. Differential incorporation andremoval of antiviral deoxynucleotides by human DNApolymerase gamma. Journal of Biological Chemistry 2001;276:23616–23623.

24. Pan-Zhou XR, Cui L, Zhou XJ, Sommadossi JP & Darley-Usmar VM. Differential effects of antiretroviral nucleosideanalogs on mitochondrial function in HepG2 cells.Antimicrobial Agents & Chemotherapy 2000; 44:496–503.

25. Birkus G, Hitchcock MJ & Cihlar T. Assessment of mito-chondrial toxicity in human cells treated with tenofovir:comparison with other nucleoside reverse transcriptaseinhibitors. Antimicrobial Agents & Chemotherapy 2002;46:716–723.

26. Walker UA, Setzer B & Venhoff N. Increased long-termmitochondrial toxicity in combinations of nucleosideanalogue reverse-transcriptase inhibitors. AIDS 2002;16:2165–2173.

27. Lee H, Hanes J & Johnson KA. Toxicity of nucleosideanalogues used to treat AIDS and the selectivity of themitochondrial DNA polymerase. Biochemistry 2003;42:14711–14719.

28. Walker UA, Venhoff N, Koch EC, Olschewski M,Schneider J & Setzer B. Uridine abrogates mitochondrialtoxicity related to nucleoside analogue reverse transcriptaseinhibitors in HepG2 cells. Antiviral Therapy 2003;8:463–470.

29. Velsor LW, Kovacevic M, Goldstein M, Leitner HM, LewisW & Day BJ. Mitochondrial oxidative stress in humanhepatoma cells exposed to stavudine. Toxicology &Applied Pharmacology 2004; 199:10–19.

30. Masini A, Scotti C, Calligaro A, Cazzalini O, Stivala LA,Bianchi L, Giovannini F, Ceccarelli D, Muscatello U,Tomasi A & Vannini V. Zidovudine-induced experimentalmyopathy: dual mechanism of mitochondrial damage.Journal of Neurological Sciences 1999; 166:131–140.

31. Gaou I, Malliti M, Guimont MC, Letteron P, DemeilliersC, Peytavin G, Degott C, Pessayre D & Fromenty B. Effectof stavudine on mitochondrial genome and fatty acidoxidation in lean and obese mice. Journal of Pharmacology& Experimental Therapeutics 2001; 297:516–523.

32. Gerschenson M, Nguyen VT, St Claire MC, Harbaugh SW,Harbaugh JW, Proia LA & Poirier MC. Chronic stavudineexposure induces hepatic mitochondrial toxicity in adultErythrocebus patas monkeys. Journal of Human Virology2001; 4:335–342.

33. Gerschenson M, Nguyen V, Ewings EL, Ceresa A, Shaw JA,St Claire MC, Nagashima K, Harbaugh SW, Harbaugh JW,Olivero OA, Divi RL, Albert PS & Poirier MC.Mitochondrial toxicity in fetal Erythrocebus patas monkeysexposed transplacentally to zidovudine plus lamivudine.AIDS Research & Human Retroviruses 2004; 20:91–100.

34. Collins ML, Sondel N, Cesar D & Hellerstein MK. Effectof nucleoside reverse transcriptase inhibitors on mitochon-drial DNA synthesis in rats and humans. Journal ofAcquired Immune Deficiency Syndromes 2004;37:1132–1139.

35. Lund KC & Wallace KB. Direct, DNA pol-gamma-indepen-dent effects of nucleoside reverse transcriptase inhibitors onmitochondrial bioenergetics. Cardiovascular Toxicology2004; 4:217–228.

36. Walker UA, Bickel M, Lutke Volksbeck SI, Ketelsen UP,Schofer H, Setzer B, Venhoff N, Rickerts V & Staszewski S.Evidence of nucleoside analogue reverse transcriptaseinhibitor-associated genetic and structural defects of mito-chondria in adipose tissue of HIV-infected patients. Journalof Acquired Immune Deficiency Syndromes 2002;29:117–121.

37. Cherry CL, Gahan ME, McArthur JC, Lewin SR, Hoy JF& Wesselingh SL. Exposure to dideoxynucleosides isreflected in lowered mitochondrial DNA in subcutaneous



fat. Journal of Acquired Immune Deficiency Syndromes2002; 30:271–277.

38. Miro O, Lopez S, Pedrol E, Rodriguez-Santiago B, MartinezE, Soler A, Milinkovic A, Casademont J, Nunes V, GatellJM & Cardellach F. Mitochondrial DNA depletion andrespiratory chain enzyme deficiencies are present in periph-eral blood mononuclear cells of HIV-infected patients withHAART-related lipodystrophy. Antiviral Therapy 2003;8:333–338.

39. Pace CS, Martin AM, Hammond EL, Mamotte CD, Nolan DA& Mallal SA. Mitochondrial proliferation, DNA depletionand adipocyte differentiation in subcutaneous adiposetissue of HIV-positive HAART recipients. Antiviral Therapy2003; 8:323–331.

40. Nolan D, Hammond E, Martin A, Taylor L, Herrmann S,McKinnon E, Metcalf C, Latham B & Mallal S.Mitochondrial DNA depletion and morphologic changes inadipocytes associated with nucleoside reverse transcriptaseinhibitor therapy. AIDS 2003; 17:1329–1338.

41. Shiramizu B, Shikuma KM, Kamemoto L, Gerschenson M,Erdem G, Pinti M, Cossarizza A & Shikuma C. Placentaand cord blood mitochondrial DNA toxicity in HIV-infected women receiving nucleoside reverse transcriptaseinhibitors during pregnancy. Journal of Acquired ImmuneDeficiency Syndromes 2003; 32:370–374.

42. Martin AM, Hammond E, Nolan D, Pace C, Den Boer M,Taylor L, Moore H, Martinez OP, Christiansen FT &Mallal S. Accumulation of mitochondrial DNA mutationsin human immunodeficiency virus-infected patients treatedwith nucleoside-analogue reverse-transcriptase inhibitors.American Journal of Human Genetics 2003; 72:549–560.

43. Rabing Christensen E, Stegger M, Jensen-Fangel S, LaursenAL & Ostergaard L. Mitochondrial DNA levels in fat andblood cells from patients with lipodystrophy or peripheralneuropathy and the effect of 90 days of high-dose coenzymeQ treatment: a randomized, double-blind, placebo-controlled pilot study. Clinical Infectious Diseases 2004;39:1371–1379.

44. Hammond E, Nolan D, James I, Metcalf C & Mallal S.Reduction of mitochondrial DNA content and respiratorychain activity occurs in adipocytes within 6–12 months ofcommencing nucleoside reverse transcriptase inhibitortherapy. AIDS 2004; 18:815–817.

45. Hammond E, Nolan D, McKinnon E, James I & Mallal S.Differential effect of nucleoside reverse transcriptaseinhibitor (NRTI) regimens on adipocyte mitochondrialDNA depletion in HIV-infected patients. Antiviral Therapy2004; 9:L11.

46. McComsey GA, Paulsen DM, Lonergan JT, HessenthalerSM, Hoppel CL, Williams VC, Fisher RL, Cherry CL,White-Owen C, Thompson KA, Ross ST, Hernandez JE &Ross LL. Improvements in lipoatrophy, mitochondrialDNA levels and fat apoptosis after replacing stavudine withabacavir or zidovudine. AIDS 2005; 19:15–23.

47. McComsey G, Tan DJ, Lederman M, Wilson E & WongLJ. Analysis of the mitochondrial DNA genome in theperipheral blood leukocytes of HIV-infected patients withor without lipoatrophy. AIDS 2002; 16:513–518.

48. Cossarizza A, Pinti M, Moretti L, Bricalli D, Bianchi R,Troiano L, Fernandez MG, Balli F, Brambilla P, Mussini C& Vigano A. Mitochondrial functionality and mitochon-drial DNA content in lymphocytes of vertically infectedhuman immunodeficiency virus-positive children withhighly active antiretroviral therapy-related lipodystrophy.Journal of Infectious Diseases 2002; 185:299–305.

49. Cossarizza A, Riva A, Pinti M, Ammannato S, Fedeli P,Mussini C, Esposito R & Galli M. Increased mitochondrialDNA content in peripheral blood lymphocytes from HIV-infected patients with lipodystrophy. Antiviral Therapy2003; 8:315–321.

50. Hoy JF, Gahan ME, Carr A, Smith D, Lewin SR,Wesselingh S & Cooper DA. Changes in mitochondrialDNA in peripheral blood mononuclear cells from HIV-infected patients with lipoatrophy randomized to receiveabacavir. Journal of Infectious Diseases 2004;190:688–692.

51. Lopez S, Miro O, Martinez E, Pedrol E, Rodriguez-Santiago B, Milinkovic A, Soler A, Garcia-Viejo MA,Nunes V, Casademont J, Gatell JM & Cardellach F.Mitochondrial effects of antiretroviral therapies in asymp-tomatic patients. Antiviral Therapy 2004; 9:47–55.

52. Casula M, Weverling G, de Baar M, Wit F, Stek M, Lange J& Reiss P. Longitudinal assessment of mitochondrial DNAand RNA in PBMC in a randomized comparative trial ofNRTI-sparing and NRTI-containing antiretroviral combina-tion therapy. 11th Conference on Retroviruses &Opportunistic Infections. 8–11 February 2004, SanFrancisco, CA, USA. Abstract 709.

53. Mallon PWG, Sedwell R, Unemori P, Merlin K, McGinleyC, Ammaranond P, Peperias M, Rafferty M, Williams K,Samaras K, Morey AL, Chisholm D, Kelleher A, CooperDA & Carr A. Nucleoside reverse transcriptase inhibitors(NRTI) decrease adipocyte and monocyte mitochondrial(mt) messenger RNA transcription in the absence ofchanges in mtDNA or cell morphology. Antiviral Therapy2004; 9:L56.

54. Arnaudo E, Dalakas M, Shanske S, Moraes CT, DiMauro S& Schon EA. Depletion of muscle mitochondrial DNA inAIDS patients with zidovudine-induced myopathy. Lancet1991; 337:508–510.

55. Shikuma CM, Hu N, Milne C, Yost F, Waslien C, ShimizuS & Shiramizu B. Mitochondrial DNA decrease in subcuta-neous adipose tissue of HIV-infected individuals withperipheral lipoatrophy. AIDS 2001; 15:1801–1809.

56. Boubaker K, Flepp M, Sudre P, Furrer H, Haensel A,Hirschel B, Boggian K, Chave JP, Bernasconi E, Egger M,Opravil M, Rickenbach M, Francioli P & Telenti A.Hyperlactatemia and antiretroviral therapy: the Swiss HIVCohort Study. Clinical Infectious Diseases 2001;33:1931–1937.

57. Moyle GJ, Datta D, Mandalia S, Morlese J, Asboe D &Gazzard BG. Hyperlactataemia and lactic acidosis duringantiretroviral therapy: relevance, reproducibility andpossible risk factors. AIDS 2002; 16:1341–1349.

58. Lopez S, Garrabou G, Martinez E, Domingo P, FontdevilaJ, Gatell JM, Infante AB, Gallart X, Milinkovic A,Cardellach F, Casademont J & Miro O. Mitochondrialstudies in adipose tissue of HIV-infected patients withoutfat redistribution. Antiviral Therapy 2004; 9:L20.

59. Miro O, Lopez S, Rodriguez de la Concepcion M, MartinezE, Pedrol E, Garrabou G, Giralt M, Cardellach F, GatellJM, Vilarroya F & Casademont J. Upregulatory mecha-nisms compensate for mitochondrial DNA depletion inasymptomatic individuals receiving stavudine plus didano-sine. Journal of Acquired Immune Deficiency Syndromes2004; 37:1550–1555.

60. Vittecoq D, Jardel C, Barthelemy C, Escaut L, Cheminot N,Chapin S, Sternberg D, Maisonobe T & Lombes A.Mitochondrial damage associated with long-term antiretro-viral treatment: associated alteration or causal disorder?Journal of Acquired Immune Deficiency Syndromes 2002;31:299–308.

61. Heath KV, Singer J, O’Shaughnessy MV, Montaner JS &Hogg RS. Intentional nonadherence due to adverse symp-toms associated with antiretroviral therapy. Journal ofAcquired Immune Deficiency Syndromes 2002;31:211–217.

62. Heath KV, Montaner JS, Bondy G, Singer J, O’ShaughnessyMV & Hogg RS. Emerging drug toxicities of highly activeantiretroviral therapy for human immunodeficiency virus(HIV) infection. Current Drug Targets 2003; 4:13–22.

63. Cote H, Yip B, Bruce S, Chan J, Wong H, Hogg R,Harrigan PR & Montaner J. Blood mitochondrial DNAlevels in a populational cohort of HIV+ patients receivingantiretroviral therapy (ART). 44th Interscience Conferenceon Antimicrobial Agents & Chemotherapy. 30 October–2 November 2004, Washington, DC, USA. Abstract H-165.

64. Lee HC, Yin PH, Lu CY, Chi CW & Wei YH. Increase ofmitochondria and mitochondrial DNA in response tooxidative stress in human cells. Biochemical Journal 2000;348:425–432.

HCF Côté




65. Welle S, Bhatt K, Shah B, Needler N, Delehanty JM &Thornton CA. Reduced amount of mitochondrial DNA inaged human muscle. Journal of Applied Physiology 2003;94:1479–1484.

66. Barthelemy C, Ogier de Baulny H, Diaz J, Cheval MA,Frachon P, Romero N, Goutieres F, Fardeau M & LombesA. Late-onset mitochondrial DNA depletion: DNA copynumber, multiple deletions, and compensation. Annals ofNeurology 2001; 49:607–617.

67. Seidel-Rogol BL & Shadel GS. Modulation of mitochon-drial transcription in response to mtDNA depletion andrepletion in HeLa cells. Nucleic Acids Research 2002;30:1929–1934.

68. Mallon P, Unemori P, Bowen M, Miller J, Winterbotham M,Kelleher A, Williams K, Cooper D & Carr A. Nucleosidereverse transcriptase inhibitors decrease mitochondrial andPPARgamma gene expression in adipose tissue after only 2weeks in HIV-uninfected healthy adults. 11th Conferenceon Retroviruses & Opportunistic Infections. 8–11 February2004, San Francisco, CA, USA. Abstract 76.

69. Murakami E, Feng JY, Lee H, Hanes J, Johnson KA &Anderson KS. Characterization of novel reverse transcrip-tase and other RNA-associated catalytic activities byhuman DNA polymerase gamma: importance in mitochon-drial DNA replication. Journal of Biological Chemistry2003; 278:36403–36409.

70. Prieto-Martin A, Montoya J & Martinez-Azorin F.Phosphorylation of rat mitochondrial transcription termi-nation factor (mTERF) is required for transcriptiontermination but not for binding to DNA. Nucleic AcidsResearch 2004; 32:2059–2068.

71. Florentz C, Sohm B, Tryoen-Toth P, Putz J & Sissler M.Human mitochondrial tRNAs in health and disease.Cellular & Molecular Life Sciences 2003; 60:1356–1375.

72. Finsterer J. Mitochondriopathies. European Journal ofNeurology 2004; 11:163–186.

73. Nishigaki Y, Marti R, Copeland WC & Hirano M. Site-specific somatic mitochondrial DNA point mutations inpatients with thymidine phosphorylase deficiency. Journalof Clinical Investigation 2003; 111:1913–1921.

74. Song S, Wheeler LJ & Mathews CK. Deoxyribonucleotidepool imbalance stimulates deletions in HeLa cell mitochon-drial DNA. Journal of Biological Chemistry 2003;278:43893–43896.

75. McKee EE, Bentley AT, Hatch M, Gingerich J & Susan-Resiga D. Phosphorylation of thymidine and AZT in heartmitochondria: elucidation of a novel mechanism of AZTcardiotoxicity. Cardiovascular Toxicology 2004;4:155–167.

76. McKee EE, Lynx MD, Susan-Resiga D, Bentley AT,D’Haenens JP, Cullen D & Ferguson M. Zidovudineinhibits thymidine phosphorylation: a novel site of poten-tial toxicity in non-mitotic cells. Antiviral Therapy 2004;9:L9.

77. Lynx MD, D’Haenens JP, Bentley AT, Susan-Resiga D &McKee EE. Zidovudine inhibits thymidine phosphorylation:a novel site of potential toxicity in non-mytotic cells.Antiviral Therapy 2004; 9:L22.

78. Ruckemann K, Fairbanks LD, Carrey EA, HawrylowiczCM, Richards DF, Kirschbaum B & Simmonds HA.Leflunomide inhibits pyrimidine de novo synthesis inmitogen-stimulated T-lymphocytes from healthy humans.Journal of Biological Chemistry 1998; 273:21682–21691.

79. Gattermann N, Dadak M, Hofhaus G, Wulfert M,Berneburg M, Loeffler ML & Simmonds HA. Severeimpairment of nucleotide synthesis through inhibition ofmitochondrial respiration. Nucleosides, Nucleotides &Nucleic Acids 2004; 23:1275–1279.

80. King MP & Attardi G. Human cells lacking mtDNA:repopulation with exogenous mitochondria by complemen-tation. Science 1989; 246:500–503.

81. Walker UA, Venhoff N, Koch EC, Olschewski M,Schneider J & Setzer B. Uridine abrogates mitochondrial

toxicity related to nucleoside analogue reverse transcriptaseinhibitors in HepG2 cells. Antiviral Therapy 2003;8:463–470.

82. Walker UA, Auclair M, Lebrecht D, Kornprobst M,Capeau J & Caron M. Uridine abrogates the adverse effectof stavudine and zalcitabine on adipose cell function.Antiviral Therapy 2004; 9:L10.

83. Miquel J. An integrated theory of aging as the result ofmitochondrial-DNA mutation in differentiated cells.Archives of Gerontology & Geriatry 1991; 12:99–117.

84. Gianni P, Jan KJ, Douglas MJ, Stuart PM & TarnopolskyMA. Oxidative stress and the mitochondrial theory ofaging in human skeletal muscle. Experimental Gerontology2004; 39:1391–1400.

85. Alexeyev MF, Ledoux SP & Wilson GL. MitochondrialDNA and aging. Clinical Science 2004; 107:355–364.

86. Yamaguchi T, Katoh I & Kurata S. Azidothymidine causesfunctional and structural destruction of mitochondria,glutathione deficiency and HIV-1 promoter sensitization.European Journal of Biochemistry 2002; 269:2782–2788.

87. Walker DM, Poirier MC, Campen MJ, Cook DL Jr, DiviRL, Nagashima K, Lund AK, Cossey PY, Hahn FF &Walker VE. Persistence of mitochondrial toxicity in heartsof female B6C3F1 mice exposed in utero to 3′-azido-3′-deoxythymidine. Cardiovascular Toxicology 2004;4:133–153.

88. Bartley PB, Westacott L, Boots RJ, Lawson M, Potter JM,Hyland VJ & Woods ML 2nd. Large hepatic mitochondrialDNA deletions associated with L-lactic acidosis and highlyactive antiretroviral therapy. AIDS 2001; 15:419–420.

89. Walker UA & Venhoff N. Multiple mitochondrial DNAdeletions and lactic acidosis in an HIV-infected patientunder antiretroviral therapy. AIDS 2001; 15:1449–1450.

90. Cazzalini O, Lazze MC, Iamele L, Stivala LA, Bianchi L,Vaghi P, Cornaglia A, Calligaro A, Curti D, Alessandrini A,Prosperi E & Vannini V. Early effects of AZT on mitochon-drial functions in the absence of mitochondrial DNAdepletion in rat myotubes. Biochemical Pharmacology2001; 62:893–902.

91. Skuta G, Fischer GM, Janaky T, Kele Z, Szabo P, Tozser J& Sumegi B. Molecular mechanism of the short-termcardiotoxicity caused by 2′,3′-dideoxycytidine (ddC):modulation of reactive oxygen species levels and ADP-ribosylation reactions. Biochemical Pharmacology 1999;58:1915–1925.

92. Maisonneuve C, Igoudjil A, Begriche K, Letteron P,Guimont MC, Bastin J, Laigneau JP, Pessayre D &Fromenty B. Effects of zidovudine, stavudine and beta-aminoisobutyric acid on lipid homeostasis in mice: possiblerole in human fat wasting. Antiviral Therapy 2004;9:801–810.

93. Lee HC & Wei YH. Mitochondrial alterations, cellularresponse to oxidative stress and defective degradation ofproteins in aging. Biogerontology 2001; 2:231–244.

94. Barrientos A, Casademont J, Cardellach F, Ardite E, EstivillX, Urbano-Marquez A, Fernandez-Checa JC & Nunes V.Qualitative and quantitative changes in skeletal musclemtDNA and expression of mitochondrial-encoded genes inthe human aging process. Biochemical & MolecularMedicine 1997; 62:165–171.

95. Lewis W. Defective mitochondrial DNA replication andNRTIs: pathophysiological implications in AIDS cardiomy-opathy. American Journal of Physiology, Heart &Circulatory Physiology 2003; 284:H1–H9.

96. Cossarizza A & Moyle G. Antiretroviral nucleoside andnucleotide analogues and mitochondria. AIDS 2004;18:137–151.

97. Hammond EL, Sayer D, Nolan D, Walker UA, Ronde A,Montaner JS, Cote HC, Gahan ME, Cherry CL, WesselinghSL, Reiss P & Mallal S. Assessment of precision andconcordance of quantitative mitochondrial DNA assays: acollaborative international quality assurance study. Journalof Clinical Virology 2003; 27:97–110.

Received 10 January 2005, accepted 19 April 2005

Nucleoside reverse transcriptase inhibitors, mitochondrial DNA and AIDS therapyWilliam Lewis

Department of Pathology, Emory University, Atlanta, GA, USA

Tel: +1 404 712 9005; Fax: +1 404 712 9007; E-mail: [email protected]


New, more effective antiretroviral therapeutic agents[1] and promise from HIV vaccine studies [2] have notprevented the AIDS epidemic’s global spread.Nucleoside reverse transcriptase inhibitors (NRTIs) incombinations called highly active antiretroviraltherapy (HAART) are cornerstones of AIDS therapy inthe developed world. Their extensive use has broughtserious side effects to light that appear to relate tomitochondrial dysfunction. This review addressessome mitochondrial changes attributed to NRTItherapy as a brief overview of some of the relevantliterature, with emphasis on the prevailing theories.

As alluded to above, the number of publications thatrelate to AIDS and mitochondrial dysfunction havegrown rapidly since the original clinical and basicobservations in the latter part of the 20th century[3–9]. Increased clinical interest in the entity coincidedwith increased frequency of side effects and increasedpatient survival. A number of reviews addresseddifferent aspects of the problem from basic [10–19],clinical laboratory [20–22] and patient care [23–26]perspectives.

Predisposition to NRTI toxicity

Presently, there is limited understanding of geneticpredispositions to NRTI toxicity or associated somaticmutations that may have pharmacogenetic implica-tions. Such information may be crucial to completeunderstanding of toxicological mechanisms of NRTIsin humans and, conversely, to rationally guide effectivetherapeutic strategies in patients receiving HAART.

Mitochondrial DNA replication defects

Mitochondrial DNA (mtDNA) replication defects,including mtDNA depletion in target (or possiblysurrogate) tissues, are frequently but not universallyobserved in both experimental and clinical reports.

Table 1 is an annotated list of some of the reports inthe literature that have addressed issues of mitochon-drial toxicity (MT) of individual NRTIs, targetorgans, basic and clinical findings, and diagnosticapproaches to the clinical problem. The subcellularpharmacological mechanism or mechanisms of MTare incompletely understood, but are generallybelieved to relate (at least in part) to inhibition ofDNA polymerase-γ (DNA pol-γ; the enzyme respon-sible for mtDNA replication in eukaryotes [27]) by thephosphorylated NRTIs. Enzyme kinetic changes inmtDNA with NRTI toxicity have been addressed by us[16,17] and other investigators [18,19].

Clinical and experimental findings related to MTfrom NRTI therapy with zidovudine (AZT) and relatedcompounds were first presented in the latter part of thelast century [3–5,8,9,28]. Hallmark features ofmtDNA depletion and energy depletion related clinical[3,4,16] and in vivo [9,28,29] experimental findings toinhibition kinetics with DNA pol-γ and phosphory-lated NRTIs in vitro [5,10,30–34]. Other observationssuggested that mitochondrial energy deprivation isconcomitant with, or the result of, mitochondrialoxidative stress in AIDS (for example, from HIV itself)or from NRTI therapy with its mitochondrial effects.In vivo studies with NRTI treatment of inbred mice[29,35] support this latter part of the hypothesis anddata from our group and others employing transgenicmice revealed that oxidative stress results from trans-genic expression of HIV Tat in the heart or liver[36–38]. The above-mentioned processes may resultfrom oxidative mtDNA damage, aberrant mtDNAreplication and/or altered mtRNA transcription. Theseevents are cornerstones of the ‘mitochondrial dysfunc-tion hypothesis’ [16,17] and remain foci in mylaboratory’s studies of toxicity of NRTIs and events incardiomyopathy (CM) in AIDS [8,39–41]. These prin-ciples apply to MT in other tissue targets demonstratedexperimentally [32,42–44].


Introduction and overview

W Lewis


Tabl

e 1.

Pub

lishe

d re

port

s of

the

mit

ocho

ndri

al t

oxic

ity

of in

divi

dual

NRT

Is

Anat

omic

or

NRT

Iti

ssue

tar

get

Clin

ical

evi

denc

e fo

r M

TEx

perim

enta

l evi

denc

e fo

r M

T

AZT

Live

r, he

art,

skel

etal

M

itoc

hond

rial m

yopa

thy;

rag

ged

red

fibr

es; d

ecre

ased

mtD

NA,

par

acry

stal

s;

Revi

ews

mus

cle

and

bone

ph

osph

ocre

atin

e de

plet

ion

[3,4

,24,

52,6

4–71

]M

echa

nism

s of

NRT

I tox

icit

y th

at f

ocus

on

mtD

NA

repl

icat

ion

mar

row

[13–

16,1

8,33

,47,

62,6

9,10

3–11

1]Po

lym

yosi

tis

vers

us A

ZT m

yopa

thy:

HIV

vs

NRT

Is [

205,

206]

Abse

nce

of m

itoc

hond

rial t

oxic

ity

[112

]AI

DS

myo

path

y no

t AZ

T-re

late

d [2

07,2

08]

Que

stio

ning

the

rel

atio

nshi

p to

mtD

NA

[218

]

Card

iom

yopa

thy

wit

h ca

rdia

c di

lata

tion

and

fai

lure

; mit

ocho

ndria

l cris

tae

DNA

pol-

γγhy

poth

esis

diss

olut

ion;

ele

vate

d se

rum

lact

ate;

Rey

e’s

synd

rom

e [1

1,40

,148

–151

]D

ecre

ased

mtD

NA,

mtR

NA,

mit

ocho

ndria

l pol

ypep

tide

s an

d m

itoc

hond

rial

Hep

atom

egal

y, s

teat

osis

, mit

ocho

ndria

l ult

rast

ruct

ural

cha

nge

[66,

144–

147]

ultr

astr

uctu

ral d

amag

e in

viv

o an

d in

vit

ro. L

ow K

ifo

r AZ

T-TP

wit

h D

NA

pol-

γ. F

ailu

re o

f ex

onuc

leol

ytic

exc

isio

n of

ter

min

ally

inco

rpor

ated

Paed

iatr

ic A

IDS

pati

ents

are

sus

cept

ible

to

NRT

I tox

icit

y [1

56]

AZT.

Mix

ed (c

ompe

titi

ve a

nd n

on-c

ompe

titi

ve) K

iw

ith

card

iac

DN

A po

l-γ

Paed

iatr

ic A

IDS

pati

ents

are

res

ista

nt t

o N

RTI t

oxic

ity

[13,

67,1

52–1

55]

agai

nst

vario

us t

empl

ates

[5,

7–9,

28,3

0–33

,40,

42,8

1,86

,113

–123

]M

T to

car

diov

ascu

lar

tiss

ues

in u

tero

[145

,157

–161

,209

–211

]Bi

oche

mic

al/c

ellu

lar

mec

hani

sms

prop

osed

for

DN

A po

l-γ

inhi

biti

on

[14,

16,1

8,19

,106

,219

–222

]Bo

ne m

arro

w t

oxic

ity

of N

RTIs

[21

2]M

echa

nism

of

NRT

I tox

icit

y un

rela

ted

to N

RTI t

ripho

spha

te [

223]

Dep

leti

on o

f m

tDN

A in

fat

[20

,162

]Sa

luta

ry e

ffec

t of

AZT

on

mtD

NA

[213

]Bi

oche

mic

al a

nd c

ell b

iolo

gica

l fin

ding

sm

tDN

A m

utat

ions

res

ult

from

NRT

Is [

143]

AZT

is t

oxic

to

skel

etal

and

car

diac

mus

cle

in v

ivo

[224

]W

orse

ning

of

mit

ocho

ndria

l gen

etic

illn

ess

by N

RTIs

[21

4]AZ

T de

plet

es m

tDN

A an

d re

leas

es la

ctat

e in

vit

ro[2

25]

Lact

ic a

cido

sis

from

NRT

Is [

130–

142]

AZT

caus

es o

xida

tive

str

ess

[29,

209]

Com

bina

tion

s ca

use

grea

ter

mtD

NA

depl

etio

n th

an s

ingl

e N

RTIs

[21

5]AZ

T de

plet

es g

luta

thio

ne [

129]

Hyp

erte

nsio

n an

d M

T [2

16]

AZT

inhi

bits

ade

nyla

te k

inas

e [1

25]

Mit

ocho

ndria

l phe

noty

pe f

rom

NRT

Is w

itho

ut m

tDN

A de

plet

ion

[217

]AZ

T in

hibi

ts a

deni

ne n

ucle

otid

e tr

ansl

ocat

or [

23,1

26]

AZT

inhi

bits

NAD

H-c

ytoc

hrom

e c

redu

ctas

e [2

26]

AZT

inhi

bits

mit

ocho

ndria

l per

mea

bilit

y tr

ansi

tion

and

apo

ptos

is [

223,

227]

AZT

inhi

bits

NAD

H o

xida

se [

127]

AZT

effe

cts

on h

uman

deo

xynu

cleo

tide

car

rier

in v

itro

[100

]AZ

T ch

ange

s ce

llula

r nu

cleo

tide

poo

ls [

84,2

28]

AZT

inhi

bits

pro

tein

gly

cosy

lati

on [

82]

AZT

inhi

bits

OXP

HO

S ea

rly [

119]

AZT

has

no e

ffec

t on

mit

ocho

ndria

[22

9]AZ

T ca

uses

hep

atic

mit

ocho

ndria

l def

ects

in v

ivo

[117

]U

ridin

e ab

roga

tes

NRT

I tox

icit

y in

vit

ro[2

30]

NRT

Is d

ecre

ase

mtD

NA

repl

icat

ion

in r

ats

and

hum

ans

[180

,231

]H

epG

2 ce

lls a

re e

xcel

lent

mod

els

for

NRT

I dys

func

tion

[23

2]

Oth

er f

indi

ngs

NRT

Is h

ave

no e

ffec

ts o

n m

tDN

A de

plet

ion

[109

] Cy

topl

asm

ic b

ysta

nder

gen

e ef

fect

[12

8]


NRTIs, mtDNA and AIDS therapy

Tabl

e 1.

Con

tinu

ed

ddC

Perip

hera

l ner

vePa

infu

l per

iphe

ral n

euro

path

y [1

84–1

89]

ddC

inhi

bits

mtD

NA

repl

icat

ion

in c

ells

; cau

ses

mit

ocho

ndria

l str

uctu

ral

chan

ges

and

lipid

acc

umul

atio

n in

ner

ves

of d

dC-t

reat

ed r

abbi

ts

[5–7

,33,

81,1

15,1

68,1

79,1

81,1

90–1

94]

3TC

3TC

mus

cle

toxi

city

[19

5]

Carb

ovir

Favo

urab

le K

mw

ith

gapp

ed d

uple

x D

NA

[233

,234

]Li

mit

ed M

T of

car

bovi

r in

vit

ro [2

35]

ddI

Panc

reas

Cyto

fluo

rom

etry

in v

itro

to d

eter

min

e pa

ncre

atit

is [

201]

ddI h

as r

elat

ed h

epat

otox

icit

y [2

36]

ddI c

ause

d fa

tal h

epat

ic f

ailu

re in

chr

onic

hep

atit

is [

237]

ddI+

teno

fovi

r ca

used

fat

al la

ctic

aci

dosi

s [1

78]

d4T

Perip

hera

l ner

vePa

infu

l per

iphe

ral n

euro

path

y [1

63–1

65]

Dis

tort

ed c

rista

e an

d de

crea

sed

mtD

NA

in C

EM c

ells

[33

,168

,169

]La

ck o

f d4

T ne

urop

athy

[23

8]d4

T m

itoc

hond

rial n

euro

path

y in

viv

o[1

70]

Path

olog

ical

neu

ropa

thic

fea

ture

s w

ith

AZT

adm

inis

trat

ion

[238

]d4

T bi

oche

mic

al c

hang

es w

ith

DN

A po

l-γ

[171

]Tr

eatm

ent

of n

euro

path

y w

ith

acet

yl-L

-car

niti

ne s

ugge

sts

MT

[166

,167

]Li

ver

Live

r to

xici

ty f

rom

NRT

Is [

239]

; eva

luat

ion

by t

rans

mis

sion

EM

[24

0]d4

T he

pato

xici

ty a

brog

ated

by

anti

oxid

ant

porp

hyrin

[12

4]

Abac

avir

Hyp

erse

nsit

ivit

y re

acti

ons

prom

inen

t [2

41–2

43]

Teno

fovi

rM

itoc

hond

rial s

ide

effe

cts

not

clea

r; p

ancr

eati

tis

wit

h co

-adm

inis

trat

ion

of d

dI

may

rel

ate

to M

T [2

44,2

45]

(–)F

TC(–

)FTC

has

fav

oura

ble

safe

ty p

rofi

le [

196]

(–)F

TC k

inet

ics

wit

h D

NA

pol-

γfa

vour

eff

icac

y [1

97];

no e

ffec

t on

Hep

G2

mtD

NA

repl

icat

ion

[198

]

FIAU

Li

ver,

skel

etal

and

La

ctic

aci

dosi

s; h

epat

ic f

ailu

re a

nd s

teat

osis

; ren

al f

ailu

re; s

kele

tal a

nd

FIAU

exp

erim

enta

l stu

dies

dem

onst

rate

tox

icit

y [2

5,42

–44,

204,

254–

261]

: ca

rdia

c m

uscl

e,

card

iac

myo

path

y; p

erip

hera

l neu

ropa

thy;

dea

th [

25,9

3,14

1,24

6–25

1]FI

AU in

corp

orat

es in

to m

tDN

Ain

viv

o an

din

vit

ro; m

itoc

hond

rial

perip

hera

l ner

veLa

ctic

aci

dosi

s re

late

d to

nit

ric o

xide

[25

2]st

ruct

ural

def

ects

and

intr

acel

lula

r fa

t ac

cum

ulat

es in

vit

ro a

nd in

viv

o;

Abse

nce

of e

leva

ted

lact

ate

wit

h N

RTI t

hera

py [

253]

com

peti

tive

Kiof

FIA

U-T

P, F

MAU

-TP

wit

h D

NA

pol-

γ(0

.02

µM)

FddA

N

ewly

dev

elop

ed a

ntire

trov

iral f

or s

alva

ge [

202]

; pla

sma

leve

ls e

stab

lishe

d [2

62];

Pote

nt a

ntire

trov

iral a

ctiv

ity

[265

]sa

fety

con

cern

s st

op c

linic

al t

rial [

263,

264]

Phar

mac

okin

etic

s of

Fdd

A [2

66]

Acut

e ca

rdio

toxi

city

in v

ivo

[203

] Ph

arm

acol

ogic

al m

anuf

actu

re o

f Fd

dA [2

67];

prim

ate

phar

mac

okin

etic

s [2

68]

All

Clin

ical

tes

ting

Bl

ood

lact

ate/

pyru

vate

rat

ios

are

usef

ul [

54–5

6]Pl

asm

a la

ctat

e co

rrel

ates

wit

h N

RTI t

oxic

ity

and

card

iom

yopa

thy

wit

h w

ith

surr

ogat

e Pe

riphe

ral b

lood

dep

leti

on m

tDN

A co

rrel

ates

NRT

I eff

ects

[22

,46–

53]

AZT-

base

d H

AART

[39

]m

arke

rPe

riphe

ral b

lood

mtD

NA

does

not

cor

rela

te w

ith

NRT

I eff

ects

[72

,73]

Surr

ogat

e te

stin

g fo

r N

RTI t

oxic

ity

uncl

ear

[21,

74–7

7]Li

pody

stro

phy

corr

elat

es w

ith

mtD

NA

depl

etio

n in

aff

ecte

d ti

ssue

s [5

7–63

]PB

L m

tDN

A do

es n

ot c

orre

late

wit

h lip

odys

trop

hy in

chi

ldre

n w

ith

NRT

Is [

182]

3TC,

lam

ivud

ine;

AZT

, zid

ovud

ine;

d4T

, sta

vudi

ne; d

dC, z

alci

tabi

ne; D

NA

pol-

γ, D

NA

poly

mer

ase-

γ; d

dI, d

idan

osin

e; E

M, e

lect

ron

mic

rosc

opy;

Fdd

A, io

deno

sine

; FIA

U, f

ialu

ridin

e; (–

)FTC

, em

itra

cita

bine

; HAA

RT, h

ighl

y ac

tive

ant

iretr

ovira

lth

erap

y; M

T, m

itoc

hond

rial t

oxic

ity;

mtD

NA,

mit

ocho

ndria

l DN

A; N

ADH

, nic

otin

amid

e ad

enin

e di

nucl

eoti

de; N

RTI,

nucl

eosi

de r

ever

se t

rans

crip

tase

inhi

bito

r; O

XPH

OS,

oxi

dati

ve p

hosp

hory

lati

on; P

BL, p

erip

hera

l blo

od ly

mph

ocyt

e;-T

P,tr

isph

osph

ate.

Assessing NRTI toxicity

It is possible to make analogies between studies thataddress mechanisms of NRTI-induced MT and thosethat examine defects in genetic mitochondrial illnessesin which defective mitochondrial gene product, oxida-tive stress and environmental factors contribute todisease [45]. This has been the approach utilized bymany clinical studies in which mtDNA depletion insurrogate tissues (for example, blood cells) [22,46–53]and lactic acidaemia [54–56] support NRTI MT. Somestudies indicated depleted mtDNA in target tissueoccurred, particularly in fat tissue and skeletal muscle ofAIDS patients treated with NRTIs [3,4,24,52,57–71].Others suggested that mtDNA depletion in surrogatetissues was not a useful marker [72,73] or emphasizedthe intrinsic importance of sample handling and datainterpretation as potential pitfalls that could confoundproper interpretation of results [21,74–77].

The DNA pol-γ hypothesis follows principles of mito-chondrial medicine [78]. If the intramitochondrial poolof native nucleotides is disrupted by NRTI treatment,altered energetics may result from alterations inexpression of electron transport proteins encoded bymtDNA. In another system, the importance of mito-chondrial alterations in the development of low outputcongestive heart failure [79] related mitochondrial andcardiac dysfunction. Genetic mitochondrial illnessesmanifest with clinical findings that occur at a thresholdthat is based in part on the heteroplasmic effects of theassociated mtDNA mutation and the impact of oxidativephosphorylation (OXPHOS) on tissue functionaccording to the OXPHOS paradigm [80]. Energy depri-vation, possibly the initial phenotypic step of NRTItoxicity (based on mtDNA depletion), relates decreasedenergy abundance in tissues (for example, heart, as inour studies [8,39,40]) to decreased mitochondrial func-tion. Such a threshold underscores phenotypic change,particularly in tissues like myocardium. It should beunderstood that this might not be the only mechanismutilized or available to explain toxicity of NRTI in mito-chondria. Other mechanisms have been suggested thatrelate to mtDNA replication [81] or other aspects ofmitochondrial and cellular homeostasis [82,83] and areaddressed below.

Nucleotide pools, NRTIs and mtDNA replication

An overview of some aspects of NRTI cellular pharma-cology is offered here, but it is not exhaustive. On a massaction basis, sufficient intramitochondrial NRTI concen-tration is required to affect mtDNA replication.Specifically, NRTI triphosphate must compete with thenative moiety at the nucleotide-binding site of DNA

pol-γ to yield inhibition of mtDNA replication. On abiochemical basis, the important active pharmacological(and toxic) element of AZT is the triphosphate (AZT-TP). AZT-TP inhibits both HIV reverse transcriptase[84,85] and mammalian DNA pol-γ in vitro [32]. Itfollows that stoichiometrically sufficient phosphorylatedNRTI must be made available intramitochondrially forinhibition of mtDNA synthesis, subsequent depletion ofmtDNA [86] and development of toxic manifestations.The various mechanisms of internalization of nucleo-sides, their transport and the homeostasis ofmitochondrial nucleotide pools are key elements, as isthe phosphorylation of NRTIs. To date, the intramito-chondrial concentration of NRTIs has been difficultto determine.

AZT-like NRTIs are phosphorylated in three intra-cellular steps. Thymidine kinase (TK) phosphorylatesAZT to AZT-MP. Thymidylate kinase phosphorylatesAZT-MP to AZT-DP. Nucleoside diphosphate kinaseyields the active AZT-TP [87] from AZT-DP. At eachstep, phosphatases exist to maintain homeostasis.Accordingly, a key step in the pathophysiology of NRTIpharmacology and toxicity is regulation of naturaldeoxyribonucleotide triphosphate (dNTP) and NRTItriphosphate pool sizes in mitochondria that affectmtDNA replication – dysregulation of phosphorylationand dephosphorylation could impact mtDNA replica-tion. TK exists in isoforms: TK1 (cytosolic isoform) hasrelatively low activity in extracts of striated skeletalmuscle [88,89], while TK2 activity is higher. TK2 isreported to have a broader substrate range and phospho-rylates deoxycytidine (dCyd) and 5-substituteddeoxythymidine (dThd) and dCyd analogues [90].Dideoxynucleotides (ddNTPs) function as either compet-itive inhibitors of the natural substrates of polymerases(reviewed in [91]) or lead to chain termination [85,92].Since mtDNA depletion is a hallmark of treatment withAZT in skeletal muscle of humans and rodents [3,9], andfialuridine (FIAU; 1-[2-deoxy-2-fluoro-β-D-arabinofura-nosyl]-5-iodouracil) causes mtDNA depletion inwoodchucks and humans [12,93] (see below), it ispossible that genetic models exist to support the workinghypothesis. TK2 mutations represent an aetiology formtDNA depletion and have been associated syndromi-cally with that genetic finding. Two substitutionmutations in TK2 (His90Asn and Ile181Asn), resulted ina phenotype of infantile myopathy and mtDNA depletionin muscle [94]. In contrast to its cytoplasmic counterpart,mitochondrial ribonucleotide reductase is not well docu-mented, so import of deoxyribonucleosides and theirphosphorylated products (or the analogous NRTIs) intomitochondria must occur in mammalian tissues. dNTPssynthesized by the cytosolic ribonucleotide reductase canbe imported directly through the mitochondrialmembrane [95]. Import of deoxynucleosides into

W Lewis


mitochondria allows for subsequent phosphorylation bymitochondrially localized kinases [96] to nucleotides.Steady-state abundance is balanced by mitochondriallylocalized dephosphorylations by phosphatases [97–99].Import of NRTIs or NRTI phosphates could alter thestoichiometry of the intramitochondrial pool of nativenucleotides [100].

Overview of current NRTI therapy

NRTIs used to treat HIV infection [101] include zidovu-dine (AZT; 3′-azido-2′,3′-deoxythymidine), zalcitibine(ddC; 2′,3′-dideoxycytidine), didanosine (ddI; 2′,3′-dideoxyinosine), stavudine (d4T; 2′,3′-didehydro-3′-dideoxythymidine), lamivudine (3TC; 3-thiacytidine; cis-1-[2′-hydroxymethyl-5′-(1,3-oxathiolanyl)]cytosine),emtricitabine [(–)FTC], tenofovir and abacavir (theselatter compounds are not NRTIs, but related moieties).Because a large number of NRTIs are currently availableand most NRTIs are administered in HAART, resultantcombinations vary widely in their constituents [102].This amplifies the complexity of the problem and makesinterpretation difficult. Controls are not always availablefor some observations in clinical populations. From acommercial standpoint, NRTIs serve an importantmarket with features that include significant long-termpatient use of therapy, a growing patient population andabsence of competition from preventative or curativevaccines in the near future. Because of this, the search fornew NRTIs has led to development of many importantcompounds with therapeutic effectiveness but also somethat exhibited profound clinical toxicity (addressedbelow). Additionally, the diagnosis, identification,prediction and amelioration of mitochondrial toxiceffects have generated increasing attention.

Mechanisms of toxicity

As mentioned previously, the prevailing theory suggestsAZT-induced MT involves defective mtDNA replica-tion (reviewed in [13–16,18,33,47,62, 69,103–111]). Itshould be noted that the hypothesis is not universallyaccepted [112] and alternatives may prove to bepromising as data are published. On a biochemicalbasis, decreased mtDNA, mtRNA, mitochondrialpolypeptides and defective mitochondrial ultrastruc-ture, correlate with micromolar, mixed Kis fordideoxy-NRTI triphosphates in various experimentalsystems [5,7–9,28,30–33,40,42,81,86,113–124]. Someother explanations for MT from AZT and NRTIsinclude inhibition of adenylate kinase [125], adeninenucleotide translocator [23,126], NADH oxidase[127], protein glycosylation [82] and a ‘bystandereffect’ [128]. It should be noted that other mechanismsunrelated to mtDNA replication have also been

suggested (including, for example, glutathione (GSH)depletion [129]).

Zidovudine (AZT)

AZT was the first NRTI antiretroviral used in the treat-ment of AIDS and affords the greatest toxicologicalexperience. Both in clinical [3,4,24,52,64–71] and experi-mental studies [13–16,18,33,47,62,69,103–111], AZThas been implicated in the development of mitochondrialdiseases with features of myopathy, ragged red fibres,decreased mtDNA and defective mtDNA replication.AZT has worsened mitochondrial genetic illnesses, beenimplicated in the genesis of lactic acidosis [130–142] andhas caused mtDNA mutations [143]. With respect totoxicity in various target tissues, observationally basedclinical correlates were made in some of the early studiesin which AZT liver toxicity was associated with obesityand female gender [116,133]. Refined genetic correlateswere lacking. NRTI toxicity presents a variable andcomplex diagnostic phenotype in the treated populationand mimics key features of mitochondrial diseases.NRTI toxicity may serve as an important model systemfor relevant pharmacogenetic studies. Such a pharmaco-logically based review is beyond the scope of this work,but has been addressed elsewhere [11,16,17,106].Various organs and tissues have been described assusceptible (and resistant) to AZT toxicity. Table 1enumerates some of these, including the liver. In waysthat resemble FIAU (described below) hepatomegaly,steatosis and mitochondrial ultrastructural change[66,144–147] have been documented with AZT. Itshould also be noted that hepatic toxicity from didano-sine (ddI) and zalcitabine (ddC) has been reported[64,66,67]. The toxic mechanism is presumed to relateto liver mitochondria. Fatal hepatomegaly with severesteatosis [66], severe lactic acidosis [67] and adult Reye’ssyndrome [64] in AZT-treated HIV-seropositive patientswere all pathogenetically linked to AZT-induced hepato-toxicity. Clinical features resembled some of those seenin FIAU toxicity (below).

The cardiovascular system effects of AZT include CMwith cardiac dilatation and failure, mitochondrial cristaedissolution and elevated serum lactate [11,40,148–151].Conflicting reports have suggested resistance [13,67,152–155] or susceptibility to toxicity from AZT [156],but MT to cardiovascular tissues has been documentedin primates and in utero [145,157–161] with AZT andother NRTIs. AZT therapy more recently has beenimplicated in lipodystrophy in AIDS patients [20,162].

Stavudine (d4T)

d4T emerged as a first-line HAART component. Anumber of documented MTs [145,157–161] were



attributed to d4T (see Table 1). Like ddC (below),painful peripheral neuropathy [163–165] has beendescribed with d4T. One study suggested a lack of sucha relationship. A clinical ‘proof of principle’ used treat-ment of d4T mitochondrial neuropathy withacetyl-L-carnitine. The trial was considered successfuland suggested that MT was mechanistically related tod4T effects on mitochondria [166,167]. Preclinical andbasic studies further support MT of d4T. Distortedcristae and decreased mtDNA in CEM cells occurredwith d4T exposure [33,168,169] and d4T mitochon-drial neuropathy was generated in vivo [170]. Kineticsof inhibition with d4T and DNA pol-γ [171] resulted ina nanomolar Ki [124].

Clinical treatment with certain NRTIs (d4T/3TC)results in anion gap acidosis. Moreover, the lacticacidosis/hepatic steatosis syndrome may be morecommon than previously appreciated in adults andchildren treated with NRTIs. d4T treatment has alsobeen associated with lipodystrophy [172]. Mechanismswere posited to involve altered mitochondrial biogen-esis and/or oxidative changes, and adipocyte apoptosis[11,173].

d4T and other NRTIs have been suggested to relate todevelopment of lactic acidaemia. Some patients treatedwith NRTIs experienced lactic acidaemia [67,93,133,135,145,154,174–178] and a phenotype of mtDNAdepletion [46,123]. Depending on the biological systememployed in the study [21,63,162,179, 180], deleteriouseffects on mitochondrial structure and function inselected targets have been documented [8,11,44,181].Although the specificity of blood cell mtDNA depletionas a surrogate marker for NRTI toxicity has been docu-mented in some studies [58,156,162,182,183], theimpact of the studies was confounded by the controlgroups used [50]. In principle, mtDNA depletion is mech-anistically consistent with NRTI toxicity. However, theimpact of mitochondrial dysfunction in surrogate tissuesremains unclear [52], even in the face of a logical workinghypothesis. Methods for diagnosis usually include exam-ination of plasma lactate or lactate/pyruvate ratios[50,51], but require careful sample preparation andhandling to assure meaningful results and interpretations.Overall, depletion of mtDNA appears to be accepted asan important marker of the toxic process, and may evenserve as a diagnostic hallmark [3,9] to monitor successfulHAART therapy [46]. It should be emphasized that theideal surrogate tissue to monitor mtDNA depletion fromNRTIs remains to be determined and is an active focus ofclinical research and commercial enterprise.

Zalcitibine (ddC)

ddC is less popular today; nonetheless, painful periph-eral neuropathy attributed to mitochondrial dysfunction

has been associated with clinical ddC toxicity[184–189], and inhibition of mtDNA replication hasbeen observed in vitro and in vivo [5–7,33,81,115,168,179,181,190–194].

Lamivudine (3TC) and emitracibine [(–)FTC]

3TC is widely used in HAART and (–)FTC is becomingan important therapeutic tool since its recent additionto the armamentarium. Of the commonly used NRTIs,3TC appears to have a favourable safety profile, butlike the others, requires co-administration in a HAARTregimen, particularly because of induction of HIV resis-tance mutations. Toxicity to muscle is reportedclinically with 3TC [195], but basic evidence for toxi-city of 3TC monotherapy is lacking in our in vivosystems (Lewis et al., unpublished). Newly approved(–)FTC exhibits a relatively favourable safety profile[196] and kinetics with DNA pol-γ favour efficacy[197]. Studies with HepG2 cells also are supportive[198] of the safety of (–)FTC. It remains to be seen iflong-term toxicity is to occur.

Didanosine (ddI)

ddI remains an important element in HAART. Twoprincipal clinical toxicities have been recognized. Aswith ddC, a painful peripheral neuropathy has beendocumented with ddI therapy in humans [199,200].Early in the development of ddI, severe pancreatitis wasidentified as an important side effect with mortality[199]. Experimental work documented pancreaticchanges by flow cytometry [201]. Fatal hepatotoxicitywas described and lactic acidosis has occurred with co-administration of tenofovir.

Other NRTIs

One more recent and serious adverse event occurredwith a halogenated purine. Fluoro-dideoxyadenosine(FddA; 2′-fluoro-2′,3′-dideoxyadenosine) went intoclinical trial but was discontinued about 1 year laterbecause it exhibited severe adverse events includingprofound lactic acidosis [202,203]. A second seriousadverse event occurred with a halogenated pyrimidinein a hepatitis B trial. This tragic event occurred at theClinical Center at the National Institutes of Health.After in vitro studies documented significant efficacy,the pyrimidine nucleoside analogue FIAU went to clin-ical trial and experienced promising results early on.FIAU was later found in the trial to be extremely toxicto liver, skeletal and cardiac muscle, pancreas andperipheral nerves in treated patients. MT from FIAUwas profound. Lactic acidosis and hepatic failurerequired heroic clinical interventions and necessitated

W Lewis


early termination of the protocol, but some deathsoccurred. Abandonment of these compounds as phar-macological agents was subsequently confirmed bydocumenting MT in animal models [43,204] and inhumans [93] and defining inhibition kinetics in vitrowith DNA pol-γ that favoured toxicity to mitochondria[42,44]. These tragic trials underscore the necessity forexamining MT of NRTIs extensively using in vitro andin vivo testing.

Summary

NRTIs are cornerstones of antiretroviral therapy andperhaps the most important drugs developed for AIDStreatment. Judicious use of NRTIs in the fight againstHIV infection has afforded significant clinical advancesin AIDS treatment. Nonetheless, it is axiomatic toexpect side effects from NRTIs as well. A principaltoxicity of NRTIs relates to chronic and cumulativeMT in various tissues. The long-term impact of thistoxicity on affected patients is not clear except inextreme cases where morbidity was severe andmortality occurred. Because of chronicity and potentialfor severity, NRTI MT remains an important clinicalproblem. Further studies will help us unravel mecha-nisms of NRTI MT and the natural history ofmitochondrial biogenesis in humans and othermammalian systems.

Acknowledgments

Supported by DHHS, NIH HL072707 and HL063666.

References1. Condra JH, Miller MD, Hazuda DJ & Emini EA. Potential

new therapies for the treatment of HIV-1 infection. AnnualReview of Medicine 2002; 53:541–555.

2. Graham BS. Clinical trials of HIV vaccines. Annual Reviewof Medicine 2002; 53:207–221.


4. Dalakas MC, Illa I, Pezeshkpour GH, Laukaitis JP, CohenB & Griffin JL. Mitochondrial myopathy caused by long-term zidovudine therapy. New England Journal ofMedicine 1990; 322:1098–1105.

5. Chen CH & Cheng YC. Delayed cytotoxicity and selectiveloss of mitochondrial DNA in cells treated with the anti-human immunodeficiency virus compound2′,3′-dideoxycytidine. Journal of Biological Chemistry1989; 264:11934–11937.

6. Chen CH & Cheng YC. The role of cytoplasmic deoxycyti-dine kinase in the mitochondrial effects of the anti-humanimmunodeficiency virus compound, 2′,3′-dideoxycytidine.Journal of Biological Chemistry 1992; 267:2856–2859.

7. Chen CH, Vazquez-Padua M & Cheng YC. Effect of anti-human immunodeficiency virus nucleoside analogs onmitochondrial DNA and its implication for delayed toxi-city. Molecular Pharmacology 1991; 39:625–628.

8. Lewis W, Papoian T, Gonzalez B, Louie H, Kelly DP, PayneRM & Grody WW. Mitochondrial ultrastructural andmolecular changes induced by zidovudine in rat hearts.Laboratory Investigation 1991; 65:228–236.

9. Lewis W, Gonzalez B, Chomyn A & Papoian T. Zidovudineinduces molecular, biochemical, and ultrastructural changesin rat skeletal muscle mitochondria. Journal of ClinicalInvestigation 1992; 89:1354–1360.

10. Wright GE & Brown NC. Deoxyribonucleotide analogs asinhibitors and substrates of DNA polymerases.Pharmacology & Therapeutics 1990; 47:447–497.

11. Lewis W & Dalakas MC. Mitochondrial toxicity ofantiviral drugs. Nature Medicine 1995; 1:417–422.

12. Swartz MN. Mitochondrial toxicity – new adverse drugeffects. New England Journal of Medicine 1995;333:1099–1105.

13. Brinkman K, Smeitink JA, Romijn JA & Reiss P.Mitochondrial toxicity induced by nucleoside-analoguereverse-transcriptase inhibitors is a key factor in the patho-genesis of antiretroviral-therapy-related lipodystrophy.Lancet 1999; 354:1112–1115.

14. Kakuda TN. Pharmacology of nucleoside and nucleotidereverse transcriptase inhibitor-induced mitochondrial toxi-city. Clinical Therapeutics 2000; 22:685–708.

15. Kakuda TN, Brundage RC, Anderson PL & Fletcher CV.Nucleoside reverse transcriptase inhibitor-induced mito-chondrial toxicity as an etiology for lipodystrophy. AIDS1999; 13:2311–2312.

16. Lewis W, Copeland WC & Day B. Mitochondrial DNAdepletion, oxidative stress and mutation: mechanisms ofnucleoside reverse transcriptase inhibitor toxicity.Laboratory Investigation 2001; 81:777–790.

17. Lewis W, Day BJ & Copeland WC. Mitochondrial toxicityof NRTI antiviral drugs: an integrated cellular perspective.Nature Reviews Drug Discovery 2003; 2:812–822.

18. Johnson AA, Ray AS, Hanes J, Suo Z, Colacino JM,Anderson KS & Johnson KA. Toxicity of antiviral nucleo-side analogs and the human mitochondrial DNApolymerase. Journal of Biological Chemistry 2001;276:40847–40857.

19. Anderson KS. Perspectives on the molecular mechanism ofinhibition and toxicity of nucleoside analogs that targetHIV-1 reverse transcriptase. Biochimica & Biophysica Acta2002; 1587:296–299.

20. Cossarizza A, Mussini C & Vigano A. Mitochondria in thepathogenesis of lipodystrophy induced by anti-HIV anti-retroviral drugs: actors or bystanders? Bioessays 2001;23:1070–1080.

21. Cossarizza A, Troiano L & Mussini C. Mitochondria andHIV infection: the first decade. Journal of BiologicalRegulators & Homeostatic Agents 2002; 16:18–24.

22. Montaner JS, Cote HC, Harris M, Hogg RS, Yip B, ChanJW, Harrigan PR & O’Shaughnessy MV. Mitochondrialtoxicity in the era of HAART: evaluating venous lactateand peripheral blood mitochondrial DNA in HIV-infectedpatients taking antiretroviral therapy. Journal of AcquiredImmune Deficiency Syndromes 2003; 34(Suppl 1):S85–S90.

23. Barile M, Valenti D, Quagliariello E & Passarella S.Mitochondria as cell targets of AZT (zidovudine). GeneralPharmacology 1998; 31:531–538.

24. Cherry CL, McArthur JC, Hoy JF & Wesselingh SL.Nucleoside analogues and neuropathy in the era ofHAART. Journal of Clinical Virology 2003; 26:195–207.

25. Colacino JM. Mechanisms for the anti-hepatitis B virusactivity and mitochondrial toxicity of fialuridine (FIAU).Antiviral Research 1996; 29:125–139.

26. Herman JS & Easterbrook PJ. The metabolic toxicities ofantiretroviral therapy. International Journal of STD &AIDS 2001; 12:555–562; quiz 563–564.

27. Kaguni LS. DNA polymerase gamma, the mitochondrialreplicase. Annual Review of Biochemistry 2004;73:293–320.



28. Lamperth L, Dalakas MC, Dagani F, Anderson J & FerrariR. Abnormal skeletal and cardiac muscle mitochondriainduced by zidovudine (AZT) in human muscle in vitro andin an animal model. Laboratory Investigation 1991;65:742–751.

29. de la Asuncion JG, del Olmo ML, Sastre J, Millan A, PellinA, Pallardo FV & Vina J. AZT treatment induces molecularand ultrastructural oxidative damage to muscle mitochon-dria. Prevention by antioxidant vitamins. Journal ofClinical Investigation 1998; 102:4–9.

30. Izuta S, Saneyoshi M, Sakurai T, Suzuki M, Kojima K &Yoshida S. The 5′-triphosphates of 3′-azido-3′-deoxythymi-dine and 2′, 3′-dideoxynucleosides inhibit DNA polymerasegamma by different mechanisms. Biochemical &Biophysical Research Communications 1991;179:776–783.

31. Konig H, Behr E, Lower J & Kurth R. Azidothymidinetriphosphate is an inhibitor of both human immunodeficiencyvirus type 1 reverse transcriptase and DNA polymerasegamma. Antimicrobial Agents & Chemotherapy 1989;33:2109–2114.

32. Lewis W, Simpson JF & Meyer RR. Cardiac mitochondrialDNA polymerase-gamma is inhibited competitively andnoncompetitively by phosphorylated zidovudine.Circulation Research 1994; 74:344–348.

33. Martin JL, Brown CE, Matthews-Davis N & Reardon JE.Effects of antiviral nucleoside analogs on human DNApolymerases and mitochondrial DNA synthesis.Antimicrobial Agents & Chemotherapy 1994;38:2743–2749.

34. Parker WB & Cheng YC. Mitochondrial toxicity of NRTIanalogs. Journal of NIH Research 1994; 6:57–61.

35. Bialkowska A, Bialkowski K, Gerschenson M, Diwan BA,Jones AB, Olivero OA, Poirier MC, Anderson LM,Kasprzak KS & Sipowicz MA. Oxidative DNA damage infetal tissues after transplacental exposure to 3′-azido-3′-deoxythymidine (AZT). Carcinogenesis 2000;21:1059–1062.

36. Choi J, Opalenik SR, Wu W, Thompson JA & Forman HJ.Modulation of glutathione synthetic enzymes by acidicfibroblast growth factor. Archives of Biochemistry &Biophysics 2000; 375:201–209.

37. Choi J, Liu RM, Kundu RK, Sangiorgi F, Wu W, Maxson R& Forman HJ. Molecular mechanism of decreasedglutathione content in human immunodeficiency virus type1 Tat-transgenic mice. Journal of Biological Chemistry2000; 275:3693–3698.

38. Raidel SM, Haase C, Jansen NR, Russ RB, Sutliff RL,Velsor LW, Day BJ, Hoit BD, Samarel AM & Lewis W.Targeted myocardial transgenic expression of HIV Tatcauses cardiomyopathy and mitochondrial damage.American Journal of Physiology. Heart & CirculatoryPhysiology 2002; 282:H1672–H1678.

39. Lewis W, Haase CP, Raidel SM, Russ RB, Sutliff RL, HoitBD & Samarel AM. Combined antiretroviral therapycauses cardiomyopathy and elevates plasma lactate intransgenic AIDS mice. Laboratory Investigation 2001;81:1527–1536.

40. Lewis W, Grupp IL, Grupp G, Hoit B, Morris R, SamarelAM, Bruggeman L & Klotman P. Cardiac dysfunctionoccurs in the HIV-1 transgenic mouse treated with zidovu-dine. Laboratory Investigation 2000; 80:187–197.

41. Lewis W & Grody WW. AIDS and the heart: review andconsideration of pathogenetic mechanisms. CardiovascularPathology 1992; 1:53–64.

42. Lewis W, Meyer RR, Simpson JF, Colacino JM & PerrinoFW. Mammalian DNA polymerases alpha, beta, gamma,delta, and epsilon incorporate fialuridine (FIAU)monophosphate into DNA and are inhibited competitivelyby FIAU triphosphate. Biochemistry 1994;33:14620–14624.

43. Lewis W, Griniuviene B, Tankersley KO, Levine ES,Montione R, Engelman L, de Courten-Myers G, AscenziMA, Hornbuckle WE, Gerin JL & Tennant BC. Depletionof mitochondrial DNA, destruction of mitochondria, and

accumulation of lipid droplets result from fialuridine treat-ment in woodchucks (Marmota monax). LaboratoryInvestigation 1997; 76:77–87.

44. Lewis W, Levine ES, Griniuviene B, Tankersley KO,Colacino JM, Sommadossi JP, Watanabe KA & Perrino FW.Fialuridine and its metabolites inhibit DNA polymerasegamma at sites of multiple adjacent analog incorporation,decrease mtDNA abundance, and cause mitochondrialstructural defects in cultured hepatoblasts. Proceedings ofthe National Academy of Sciences, USA 1996;93:3592–3597.

45. Schapira AH & Cooper JM. Mitochondrial function inneurodegeneration and ageing. Mutation Research 1992;275:133–143.

46. Cote HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyMV & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV- infected patients.New England Journal of Medicine 2002; 346:811–820.


48. Cote HC, Yip B, Asselin JJ, Chan JW, Hogg RS, HarriganPR, O’Shaughnessy MV & Montaner JS. Mitochondrial:nuclear DNA ratios in peripheral blood cells from humanimmunodeficiency virus (HIV)-infected patients whoreceived selected HIV antiretroviral drug regimens. Journalof Infectious Diseases 2003; 187:1972–1976.

49. Montaner JS, Cote HC, Harris M, Hogg RS, Yip B,Harrigan PR & O’Shaughnessy MV. Nucleoside-relatedmitochondrial toxicity among HIV-infected patientsreceiving antiretroviral therapy: insights from the evalua-tion of venous lactic acid and peripheral bloodmitochondrial DNA. Clinical Infectious Diseases 2004;38(Suppl 2):S73–S79.

50. Rastegar DA. Mitochondrial DNA and nucleoside toxicity.New England Journal of Medicine 2002; 347:216–218.Author reply.

51. Chariot P, Bourokba N & Brivet F. Mitochondrial DNAand nucleoside toxicity. New England Journal of Medicine2002; 347:216–218. Author reply.

52. Casademont J, Miro O & Cardellach F. MitochondrialDNA and nucleoside toxicity. New England Journal ofMedicine 2002; 347:216–218. Author reply.

53. Polo R, Martinez S, Madrigal P & Gonzalez-Munoz M.Factors associated with mitochondrial dysfunction in circu-lating peripheral blood lymphocytes from HIV-infectedpeople. Journal of Acquired Immune Deficiency Syndromes2003; 34:32–36.

54. Chariot P, Monnet I, Mouchet M, Rohr M, Lefaucheur JP,Dubreuil-Lemaire ML, Chousterman M & Gherardi R.Determination of the blood lactate: pyruvate ratio as anoninvasive test for the diagnosis of zidovudine myopathy.Arthritis & Rheumatism 1994; 37:583–586.

55. McComsey G & Lonergan JT. Mitochondrial dysfunction:patient monitoring and toxicity management. Journal ofAcquired Immune Deficiency Sydromes 2004; 37:S30–S35.

56. ter Hofstede HJ, Willems HL & Koopmans PP. Serum L-lactate and pyruvate in HIV-infected patients with andwithout presumed NRTI-related adverse events comparedto healthy volunteers. Journal of Clinical Virology 2004;29:44–50.

57. Pace CS, Martin AM, Hammond EL, Mamotte CD, NolanDA & Mallal SA. Mitochondrial proliferation, DNA deple-tion and adipocyte differentiation in subcutaneous adiposetissue of HIV-positive HAART recipients. Antiviral Therapy2003; 8:323–331.

58. Miro O, Lopez S, Pedrol E, Rodriguez-Santiago B,Martinez E, Soler A, Milinkovic A, Casademont J, NunesV, Gatell JM & Cardellach F. Mitochondrial DNA deple-tion and respiratory chain enzyme deficiencies are presentin peripheral blood mononuclear cells of HIV-infectedpatients with HAART-related lipodystrophy. AntiviralTherapy 2003; 8:333–338.

W Lewis


59. Walker UA & Brinkman K. NRTI induced mitochondrialtoxicity as a mechanism for HAART related lipodystrophy:fact or fiction? HIV Medicine 2001; 2:163–165.

60. Nolan D, Moore C, Castley A, Sayer D, Mamotte C, JohnM, James I & Mallal S. Tumour necrosis factor-alpha gene–238G/A promoter polymorphism associated with a morerapid onset of lipodystrophy. AIDS 2003; 17:121–123.




64. Jolliet P & Widmann JJ. Reye’s syndrome in adult withAIDS. Lancet 1990; 335:1457.

65. Chariot P & Gherardi R. Partial cytochrome C oxidasedeficiency and cytoplasmic bodies in patients with zidovu-dine myopathy. Neuromuscular Disorders 1991;1:357–363.

66. Freiman JP, Helfert KE, Hamrell MR & Stein DS.Hepatomegaly with severe steatosis in HIV-seropositivepatients. AIDS 1993; 7:379–385.

67. Chattha G, Arieff AI, Cummings C & Tierney LM Jr.Lactic acidosis complicating the acquired immunodeficiencysyndrome. Annals of Internal Medicine 1993; 118:37–39.

68. Casademont J, Barrientos A, Grau JM, Pedrol E, Estivill X,Urbano-Marquez A & Nunes V. The effect of zidovudineon skeletal muscle mtDNA in HIV-1 infected patients withmild or no muscle dysfunction. Brain 1996;119:1357–1364.

69. Cherry CL & Wesselingh SL. Nucleoside analogues andHIV: the combined cost to mitochondria. Journal ofAntimicrobial Chemotherapy 2003; 51:1091–1093.

70. Grau JM, Masanes F, Pedrol E, Casademont J, Fernandez-Sola J & Urbano-Marquez A. Human immunodeficiencyvirus type 1 infection and myopathy: clinical relevance ofzidovudine therapy. Annals of Neurology 1993;34:206–211.

71. Manji H, Harrison MJ, Round JM, Jones DA, Connolly S,Fowler CJ, Williams I & Weller IV. Muscle disease, HIVand zidovudine: the spectrum of muscle disease in HIV-infected individuals treated with zidovudine. Journal ofNeurology 1993; 240:479–488.

72. Chiappini F, Teicher E, Saffroy R, Pham P, Falissard B,Barrier A, Chevalier S, Debuire B, Vittecoq D & Lemoine A.Prospective evaluation of blood concentration of mitochon-drial DNA as a marker of toxicity in 157 consecutivelyrecruited untreated or HAART-treated HIV-positivepatients. Laboratory Investigation 2004; 84:908–914.


74. Cossarizza A. Tests for mitochondrial function and DNA:potentials and pitfalls. Current Opinion in InfectiousDiseases 2003; 16:5–10.

75. Janes MS, Hanson BJ, Hill DM, Buller GM, Agnew JY,Sherwood SW, Cox WG, Yamagata K & Capaldi RA.Rapid analysis of mitochondrial DNA depletion by fluores-cence in situ hybridization and immunocytochemistry:potential strategies for HIV therapeutic monitoring. Journalof Histochemistry & Cytochemistry 2004; 52:1011–1018.

76. Petit C, Mathez D, Barthelemy C, Leste-Lasserre T,Naviaux RK, Sonigo P & Leibowitch J. Quantitation ofblood lymphocyte mitochondrial DNA for the monitoringof antiretroviral drug-induced mitochondrial DNA deple-tion. Journal of Acquired Immune Deficiency Syndromes2003; 33:461–469.

77. Henry K, Erice A, Balfour HH Jr, Schmeling M,Berthiaume J & Wallace K. Lymphocyte mitochondrialbiomarkers in asymptomatic HIV-1-infected individualstreated with nucleoside reverse transcriptase inhibitors.AIDS 2002; 16:2485–2487.

78. Luft R. The development of mitochondrial medicine.Proceedings of the National Academy of Sciences, USA1994; 91:8731–8738.

79. Katz AM. Is the failing heart energy depleted? CardiologyClinics 1998; 16:633–644.

80. Wallace DC. Mitochondrial diseases in man and mouse.Science 1999; 283:1482–1488.

81. Eriksson S, Xu B & Clayton DA. Efficient incorporation ofanti-HIV deoxynucleotides by recombinant yeast mitochon-drial DNA polymerase. Journal of Biological Chemistry1995; 270:18929–18934.

82. Hall ET, Yan JP, Melancon P & Kuchta RD. 3′-Azido-3′-deoxythymidine potently inhibits protein glycosylation. Anovel mechanism for AZT cytotoxicity. Journal ofBiological Chemistry 1994; 269:14355–14358.

83. Prakash O, Teng S, Ali M, Zhu X, Coleman R, DabdoubRA, Chambers R, Aw TY, Flores SC & Joshi BH. Thehuman immunodeficiency virus type 1 Tat protein potenti-ates zidovudine-induced cellular toxicity in transgenic mice.Archives of Biochemistry & Biophysics 1997;343:173–180.

84. Furman PA, Fyfe JA, St Clair MH, Weinhold K, RideoutJL, Freeman GA, Lehrman SN, Bolognesi DP, Broder S,Mitsuya H & Barry DW. Phosphorylation of 3′-azido-3′-deoxythymidine and selective interaction of the5′-triphosphate with human immunodeficiency virusreverse transcriptase. Proceedings of the National Academyof Sciences, USA 1986; 83:8333–8337.

85. Mitsuya H, Weinhold KJ, Furman PA, St Clair MH,Lehrman SN, Gallo RC, Bolognesi D, Barry DW & BroderS. 3′-Azido-3′-deoxythymidine (BW A509U): an antiviralagent that inhibits the infectivity and cytopathic effect ofhuman T-lymphotropic virus type III/lymphadenopathy-associated virus in vitro. Proceedings of the NationalAcademy of Sciences, USA 1985; 82:7096–7100.

86. Simpson MV, Chin CD, Keilbaugh SA, Lin TS & PrusoffWH. Studies on the inhibition of mitochondrial DNA repli-cation by 3′-azido-3′-deoxythymidine and otherdideoxynucleoside analogs which inhibit HIV-1 replication.Biochemical Pharmacology 1989; 38:1033–1036.

87. Connolly KJ & Hammer SM. Antiretroviral therapy: strate-gies beyond single-agent reverse transcriptase inhibition.Antimicrobial Agents & Chemotherapy 1992; 36:509–520.

88. Eriksson S, Munch-Petersen B, Kierdaszuk B & Arner E.Expression and substrate specificities of human thymidinekinase 1, thymidine kinase 2 and deoxycytidine kinase.Advances in Experimental Medicine & Biology 1991;309:239–243.

89. Eriksson S, Kierdaszuk B, Munch-Petersen B, Oberg B &Johansson NG. Comparison of the substrate specificities ofhuman thymidine kinase 1 and 2 and deoxycytidine kinasetoward antiviral and cytostatic nucleoside analogs.Biochemical & Biophysical Research Communications1991; 176:586–592.

90. Munch-Petersen B, Cloos L, Tyrsted G & Eriksson S.Diverging substrate specificity of pure human thymidinekinases 1 and 2 against antiviral dideoxynucleosides.Journal of Biological Chemistry 1991; 266:9032–9038.

91. Mitsuya H, Yarchoan R & Broder S. Molecular targets forAIDS therapy. Science 1990; 249:1533–1544.

92. Toji L & Cohen SS. The enzymatic termination of poly-deoxynucleotides by 2′,3′-dideoxyadenosine triphosphate.



Proceedings of the National Academy of Sciences, USA1969; 63:871–877.

93. McKenzie R, Fried MW, Sallie R, Conjeevaram H, DiBisceglie AM, Park Y, Savarese B, Kleiner D, Tsokos M,Luciano C, Pruett T, Stotka J, Straus SE & Hoofnagle JH.Hepatic failure and lactic acidosis due to fialuridine(FIAU), an investigational nucleoside analogue for chronichepatitis B. New England Journal of Medicine 1995;333:1099–1105.

94. Saada A, Shaag A, Mandel H, Nevo Y, Eriksson S &Elpeleg O. Mutant mitochondrial thymidine kinase in mito-chondrial DNA depletion myopathy. Nature Genetics2001; 29:342–344.

95. Bridges EG, Jiang Z & Cheng YC. Characterization of adCTP transport activity reconstituted from human mito-chondria. Journal of Biological Chemistry 1999;274:4620–4625.

96. Johansson M & Karlsson A. Cloning of the cDNA andchromosome localization of the gene for human thymidinekinase 2. Journal of Biological Chemistry 1997;272:8454–8458.

97. Rampazzo C, Johansson M, Gallinaro L, Ferraro P,Hellman U, Karlsson A, Reichard P & Bianchi V.Mammalian 5′(3′)-deoxyribonucleotidase, cDNA cloning,and overexpression of the enzyme in Escherichia coli andmammalian cells. Journal of Biological Chemistry 2000;275:5409–5415.

98. Rampazzo C, Gallinaro L, Milanesi E, Frigimelica E,Reichard P & Bianchi V. A deoxyribonucleotidase in mito-chondria: involvement in regulation of dNTP pools andpossible link to genetic disease. Proceedings of the NationalAcademy of Sciences, USA 2000; 97:8239–8244.

99. Mazzon C, Rampazzo C, Scaini MC, Gallinaro L, KarlssonA, Meier C, Balzarini J, Reichard P & Bianchi V. Cytosolicand mitochondrial deoxyribonucleotidases: activity withsubstrate analogs, inhibitors and implications for therapy.Biochemical Pharmacology 2003; 66:471–479.

100. Dolce V, Fiermonte G, Runswick MJ, Palmieri F & WalkerJE. The human mitochondrial deoxynucleotide carrier andits role in the toxicity of nucleoside antivirals. Proceedingsof the National Academy of Sciences, USA 2001;98:2284–2288.

101. Cohen J. Therapies. Confronting the limits of success.Science 2002; 296:2320–2324.

102. Yeni PG, Hammer SM, Carpenter CC, Cooper DA, FischlMA, Gatell JM, Gazzard BG, Hirsch MS, Jacobsen DM,Katzenstein DA, Montaner JS, Richman DD, Saag MS,Schechter M, Schooley RT, Thompson MA, Vella S &Volberding PA. Antiretroviral treatment for adult HIVinfection in 2002: updated recommendations of theInternational AIDS Society – USA Panel. Journal of theAmerican Medical Association 2002; 288:222–235.

103. Pan-Zhou XR, Cui L, Zhou XJ, Sommadossi JP & Darley-Usmar VM. Differential effects of antiretroviral nucleosideanalogs on mitochondrial function in HepG2 cells.Antimicrobial Agents & Chemotherapy 2000; 44:496–503.

104. Moyle G. Clinical manifestations and management of anti-retroviral nucleoside analog-related mitochondrial toxicity.Clinical Therapeutics 2000; 22:911–936; discussion 898.

105. Brinkman K. Editorial response: hyperlactatemia andhepatic steatosis as features of mitochondrial toxicity ofnucleoside analogue reverse transcriptase inhibitors.Clinical Infectious Diseases 2000; 31:167–169.

106. Lewis W. Mitochondrial DNA replication, nucleosidereverse-transcriptase inhibitors, and AIDS cardiomyopathy.Progress in Cardiovascular Diseases 2003; 45:305–318.

107. Lewis W. Mitochondrial dysfunction and nucleoside reversetranscriptase inhibitor therapy: experimental clarificationsand persistent clinical questions. Antiviral Research 2003;58:189–197.

108. Lee H, Hanes J & Johnson KA. Toxicity of nucleosideanalogues used to treat AIDS and the selectivity of themitochondrial DNA polymerase. Biochemistry 2003;42:14711–14719.

109. Note R, Maisonneuve C, Letteron P, Peytavin G, Djouadi F,Igoudjil A, Guimont MC, Biour M, Pessayre D &Fromenty B. Mitochondrial and metabolic effects of nucle-oside reverse transcriptase inhibitors (NRTIs) in micereceiving one of five single- and three dual-NRTI treat-ments. Antimicrobial Agents & Chemotherapy 2003;47:3384–3392.

110. Macchi B & Mastino A. Pharmacological and biologicalaspects of basic research on nucleoside-based reverse tran-scriptase inhibitors. Pharmacological Research 2002;46:473–482.

111. Dieterich DT. Long-term complications of nucleosidereverse transcriptase inhibitor therapy. AIDS Reader 2003;13:176–184.

112. Moyle G. Toxicity of antiretroviral nucleoside andnucleotide analogues: is mitochondrial toxicity the onlymechanism? Drug Safety 2000; 23:467–481.

113. Ahluwalia GS, Gao WY, Mitsuya H & Johns DG. 2′,3′-Didehydro-3′-deoxythymidine: regulation of its metabolicactivation by modulators of thymidine-5′-triphosphatebiosynthesis. Molecular Pharmacology 1996; 50:160–165.

114. Benbrik E, Chariot P, Bonavaud S, Ammi-Said M, FrisdalE, Rey C, Gherardi R & Barlovatz-Meimon G. Cellularand mitochondrial toxicity of zidovudine (AZT), didano-sine (ddI) and zalcitabine (ddC) on cultured human musclecells. Journal of the Neurological Sciences 1997;149:19–25.

115. Cherrington JM, Allen SJW, Bischofberger N & Chen MS.Kinetic interaction of the diphosphates of 9-(2-phosphonyl-methoxyethyl) adenine and other anti-HIV active purinecongeners with HIV reverse transcriptase and human DNApolymerases alpha, beta and gamma. Antiviral Chemistry& Chemotherapy 1995; 6:217–221.

116. Corcuera Pindado MT, Lopez Bravo A, Martinez-Rodriguez R, Picazo Talavera A, Gomez Aguado F, RoldanContreras M, Perez Alvarez MJ, Fernandez Garcia A &Alonso Martin MJ. Histochemical and ultrastructuralchanges induced by zidovudine in mitochondria of ratcardiac muscle. European Journal of Histochemistry 1994;38:311–318.

117. Corcuera T, Alonso MJ, Picazo A, Gomez F, Roldan M,Abad M, Munoz E & Lopez-Bravo A. Hepatic morpholog-ical alterations induced by zidovudine (ZDV) in anexperimental model. Pathology, Research & Practice 1996;192:182–187.

118. Hobbs GA, Keilbaugh SA & Simpson MV. The Friendmurine erythroleukemia cell, a model system for studyingthe association between bone marrow toxicity induced by3′-azido-3′-dideoxythymidine and dideoxynucleoside inhibi-tion of mtDNA replication. Biochemical Pharmacology1992; 43:1397–1400.

119. Hobbs GA, Keilbaugh SA, Rief PM & Simpson MV.Cellular targets of 3′-azido-3′-deoxythymidine: an early(non-delayed) effect on oxidative phosphorylation.Biochemical Pharmacology 1995; 50:381–390.

120. Nusbaum NJ & Joseph PE. AZT incorporation into mito-chondria: study in a human myeloid cell line. DNA & CellBiology 1996; 15:363–366.

121. Schroder JM, Kaldenbach T & Piroth W. Nuclear andmitochondrial changes of co-cultivated spinal cord, spinalganglia and muscle fibers following treatment with variousdoses of zidovudine. Acta Neuropathologica 1996;92:138–149.

122. Semino-Mora MC, Leon-Monzon ME & Dalakas MC. Theeffect of L-carnitine on the AZT-induced destruction ofhuman myotubes. Part II: treatment with L-carnitineimproves the AZT-induced changes and prevents furtherdestruction. Laboratory Investigation 1994; 71:773–781.

123. Wang H, Lemire BD, Cass CE, Weiner JH, Michalak M,Penn AM & Fliegel L. Zidovudine and dideoxynucleosidesdeplete wild-type mitochondrial DNA levels and increasedeleted mitochondrial DNA levels in cultured Kearns–Sayresyndrome fibroblasts. Biochimica & Biophysica Acta 1996;1316:51–59.

W Lewis


124. Velsor LW, Kovacevic M, Goldstein M, Leitner HM, LewisW & Day BJ. Mitochondrial oxidative stress in humanhepatoma cells exposed to stavudine. Toxicology &Applied Pharmacology 2004; 199:10–19.

125. Barile M, Valenti D, Hobbs GA, Abruzzese MF, KeilbaughSA, Passarella S, Quagliariello E & Simpson MV.Mechanisms of toxicity of 3′-azido-3′-deoxythymidine. Itsinteraction with adenylate kinase. BiochemicalPharmacology 1994; 48:1405–1412.

126. Barile M, Valenti D, Passarella S & Quagliariello E. 3′-Azido-3′-deoxythmidine uptake into isolated rat livermitochondria and impairment of ADP/ATP translocator.Biochemical Pharmacology 1997; 53:913–920.

127. Pereira LF, Oliveira MB & Carnieri EG. Mitochondrialsensitivity to AZT. Cell Biochemistry & Function 1998;16:173–181.

128. Sanda A, Zhu C, Johansson M & Karlsson A. Bystandereffects of nucleoside analogs phosphorylated in the cytosolor mitochondria. Biochemical & Biophysical ResearchCommunications 2001; 287:1163–1166.

129. Yamaguchi T, Katoh I & Kurata S. Azidothymidine causesfunctional and structural destruction of mitochondria,glutathione deficiency and HIV-1 promoter sensitization.European Journal of Biochemistry 2002; 269:2782–2788.

130. Gopinath R, Hutcheon M, Cheema-Dhadli S & HalperinM. Chronic lactic acidosis in a patient with acquiredimmunodeficiency syndrome and mitochondrial myopathy:biochemical studies. Journal of the American Society ofNephrology 1992; 3:1212–1219.

131. Gerard Y, Maulin L, Yazdanpanah Y, De La Tribonniere X,Amiel C, Maurage CA, Robin S, Sablonniere B, DhennainC & Mouton Y. Symptomatic hyperlactataemia: anemerging complication of antiretroviral therapy. AIDS2000; 14:2723–2730.

132. Chariot P, Dubreuil-Lemaire AL & Gherardi R. Lacticacidosis and AIDS. Annals of Internal Medicine 1993;119:344–345.

133. Olano JP, Borucki MJ, Wen JW & Haque AK. Massivehepatic steatosis and lactic acidosis in a patient with AIDSwho was receiving zidovudine. Clinical Infectious Diseases1995; 21:973–976.

134. Sundar K, Suarez M, Banogon PE & Shapiro JM.Zidovudine-induced fatal lactic acidosis and hepatic failurein patients with acquired immunodeficiency syndrome:report of two patients and review of the literature. CriticalCare Medicine 1997; 25:1425–1430.

135. Shaer AJ & Rastegar A. Lactic acidosis in the setting ofantiretroviral therapy for the acquired immunodeficiencysyndrome. A case report and review of the literature.American Journal of Nephrology 2000; 20:332–338.

136. Bartley PB, Westacott L, Boots RJ, Lawson M, Potter JM,Hyland VJ & Woods ML 2nd. Large hepatic mitochondrialDNA deletions associated with L-lactic acidosis and highlyactive antiretroviral therapy. AIDS 2001; 15:419–420.

137. Powderly WG. Long-term exposure to lifelong therapies.Journal of Acquired Immune Deficiency Syndromes 2002;29(Suppl 1):S28–S40.

138. Bartlett JG. Toxicity of antiretroviral agents. Hopkins HIVReport 1999; 11:2,12.

139. Antoniades C, Macdonald C, Knisely A, Taylor C &Norris S. Mitochondrial toxicity associated with HAARTfollowing liver transplantation in an HIV-infected recipient.Liver Transplantation 2004; 10:699–702.


141. Claessens YE, Chiche JD, Mira JP & Cariou A. Bench-to-bedside review: severe lactic acidosis in HIV patientstreated with nucleoside analogue reverse transcriptaseinhibitors. Critical Care 2003; 7:226–232.

142. Montessori V, Harris M & Montaner JS. Hepatotoxicity ofnucleoside reverse transcriptase inhibitors. Seminars inLiver Disease 2003; 23:167–172.

143. Martin AM, Hammond E, Nolan D, Pace C, Den Boer M,Taylor L, Moore H, Martinez OP, Christiansen FT &Mallal S. Accumulation of mitochondrial DNA mutationsin human immunodeficiency virus-infected patients treatedwith nucleoside-analogue reverse-transcriptase inhibitors.American Journal of Human Genetics 2003; 72:549–560.

144. Radovanovic J, Todorovic V, Boricic I, Jankovic-Hladni M& Korac A. Comparative ultrastructural studies on mito-chondrial pathology in the liver of AIDS patients: clustersof mitochondria, protuberances, ‘minimitochondria’,vacuoles, and virus-like particles. Ultrastructural Pathology1999; 23:19–24.

145. Chariot P, Drogou I, de Lacroix-Szmania I, Eliezer-VanerotMC, Chazaud B, Lombes A, Schaeffer A & Zafrani ES.Zidovudine-induced mitochondrial disorder with massiveliver steatosis, myopathy, lactic acidosis, and mitochondrialDNA depletion. Journal of Hepatology 1999; 30:156–160.

146. Shapiro SH & Klavins JV. Concentric membranous bodiesand giant mitochondria in hepatocytes from a patient withAIDS. Ultrastructural Pathology 1993; 17:557–563.

147. Bissuel F, Bruneel F, Habersetzer F, Chassard D, Cotte L,Chevallier M, Bernuau J, Lucet JC & Trepo C. Fulminanthepatitis with severe lactate acidosis in HIV-infectedpatients on didanosine therapy. Journal of InternalMedicine 1994; 235:367–371.

148. Sinnwell TM, Sivakumar K, Soueidan S, Jay C, Frank JA,McLaughlin AC & Dalakas MC. Metabolic abnormalitiesin skeletal muscle of patients receiving zidovudine therapyobserved by 31P in vivo magnetic resonance spectroscopy.Journal of Clinical Investigation 1995; 96:126–131.

149. Herskowitz A, Willoughby SB, Baughman KL, SchulmanSP & Bartlett JD. Cardiomyopathy associated with anti-retroviral therapy in patients with HIV infection: a reportof six cases. Annals of Internal Medicine 1992;116:311–313.

150. D’Amati G, Kahn HJ, Butany J & Silver MD. Altereddistribution of desmin filaments in hypertrophic cardiomy-opathy: an immunohistochemical study. Modern Pathology1992; 5:165–168.

151. Lewis W. Pathologic changes in the hearts of patients withAIDS. In Cardiology in AIDS 1998; pp. 233–254. Editedby SE Lipshultz. New York: Chapman and Hall.

152. Lipshultz SE, Easley KA, Orav EJ, Kaplan S, Starc TJ,Bricker JT, Lai WW, Moodie DS, Sopko G, McIntosh K &Colan SD. Absence of cardiac toxicity of zidovudine ininfants. Pediatric Pulmonary and Cardiac Complications ofVertically Transmitted HIV Infection Study Group. NewEngland Journal of Medicine 2000; 343:759–766.

153. Al-Attar I, Orav EJ, Exil V, Vlach SA & Lipshultz SE.Predictors of cardiac morbidity and related mortality inchildren with acquired immunodeficiency syndrome.Journal of the American College of Cardiology 2003;41:1598–1605.

154. Brinkman K. Evidence for mitochondrial toxicity: lacticacidosis as proof of concept. Journal of HIV Therapy2001; 6:13–16.

155. Brinkman K, ter Hofstede HJ, Burger DM, Smeitink JA &Koopmans PP. Adverse effects of reverse transcriptaseinhibitors: mitochondrial toxicity as common pathway.AIDS 1998; 12:1735–1744.

156. Shiramizu B, Shikuma KM, Kamemoto L, Gerschenson M,Erdem G, Pinti M, Cossarizza A & Shikuma C. Briefreport: placenta and cord blood mitochondrial DNA toxi-city in HIV-infected women receiving nucleoside reversetranscriptase inhibitors during pregnancy. Journal ofAcquired Immune Deficiency Syndromes 2003;32:370–374.

157. Agbaria R, Manor E, Barak J & Balzarini J.Phosphorylation of 3′-azidothymidine in maternal and fetalperipheral blood mononuclear cells during gestation and atterm. Journal of Acquired Immune Deficiency Syndromes2003; 32:477–481.



158. Ha JC, Nosbisch C, Abkowitz JL, Conrad SH, Mottet NK,Ruppenthal GC, Robinette R, Sackett GP & Unadkat JD.Fetal, infant, and maternal toxicity of zidovudine(azidothymidine) administered throughout pregnancy inMacaca nemestrina. Journal of Acquired ImmuneDeficiency Syndromes & Human Retrovirology 1998;18:27–38.

159. Ha JC, Nosbisch C, Conrad SH, Ruppenthal GC, SackettGP, Abkowitz J & Unadkat JD. Fetal toxicity of zidovudine(azidothymidine) in Macaca nemestrina: preliminary obser-vations. Journal of Acquired Immune DeficiencySyndromes 1994; 7:154–157.

160. Divi RL, Walker VE, Wade NA, Nagashima K, Seilkop SK,Adams ME, Nesel CJ, O’Neill JP, Abrams EJ & PoirierMC. Mitochondrial damage and DNA depletion in cordblood and umbilical cord from infants exposed in utero toCombivir. AIDS 2004; 18:1013–1021.

161. Gerschenson M, Nguyen V, Ewings EL, Ceresa A, Shaw JA,St Claire MC, Nagashima K, Harbaugh SW, Harbaugh JW,Olivero OA, Divi RL, Albert PS & Poirier MC.Mitochondrial toxicity in fetal Erythrocebus patas monkeysexposed transplacentally to zidovudine plus lamivudine.AIDS Research & Human Retroviruses 2004; 20:91–100.

162. Cherry CL, Gahan ME, McArthur JC, Lewin SR, Hoy JF& Wesselingh SL. Exposure to dideoxynucleosides isreflected in lowered mitochondrial DNA in subcutaneousfat. Journal of Acquired Immune Deficiency Syndromes2002; 30:271–277.

163. Browne MJ, Mayer KH, Chafee SB, Dudley MN, PosnerMR, Steinberg SM, Graham KK, Geletko SM, Zinner SH,Denman SL, Dunkle LM , Kaul S , Mclaren C , SkowronG, Kouttab NM, Kennedy TA, Weitberg AB & Curt GA.2′,3′-didehydro-3′-deoxythymidine (d4T) in patients withAIDS or AIDS-related complex: a phase I trial. Journal ofInfectious Diseases 1993; 167:21–29.

164. Cohen P, Sande M & Volberding P. The AIDS KnowledgeBase: A Textbook on HIV Disease from the University ofCalifornia, San Francisco. 2nd edn 1994. Boston: LittleBrown and Company.

165. Cupler EJ & Dalakas MC. Exacerbation of peripheralneuropathy by lamivudine. Lancet 1995; 345:460–461.

166. Hart AM, Wilson AD, Montovani C, Smith C, Johnson M,Terenghi G & Youle M. Acetyl-L-carnitine: a pathogenesisbased treatment for HIV-associated antiretroviral toxicneuropathy. AIDS 2004; 18:1549–1560.

167. Venhoff N, Setzer B, Lebrecht D & Walker UA. Dietarysupplements in the treatment of nucleoside reverse tran-scriptase inhibitor-related mitochondrial toxicity. AIDS2002; 16:800–802.

168. Medina DJ, Tsai CH, Hsiung GD & Cheng YC.Comparison of mitochondrial morphology, mitochondrialDNA content, and cell viability in cultured cells treatedwith three anti-human immunodeficiency virus dideoxynu-cleosides. Antimicrobial Agents & Chemotherapy 1994;38:1824–1828.

169. Cui L, Locatelli L, Xie MY & Sommadossi JP. Effect ofnucleoside analogs on neurite regeneration and mitochon-drial DNA synthesis in PC-12 cells. Journal ofPharmacology & Experimental Therapeutics 1997;280:1228–1234.


171. Lim SE, Ponamarev MV, Longley MJ & Copeland WC.Structural determinants in human DNA polymerase gammaaccount for mitochondrial toxicity from nucleosideanalogs. Journal of Molecular Biology 2003; 329:45–57.

172. Saint-Marc T, Partisani M, Poizot-Martin I, Bruno F,Rouviere O, Lang JM, Gastaut JA & Touraine JL. Asyndrome of peripheral fat wasting (lipodystrophy) inpatients receiving long-term nucleoside analogue therapy.AIDS 1999; 13:1659–1667.

173. Harrison DG. Cellular and molecular mechanisms ofendothelial cell dysfunction. Journal of ClinicalInvestigation 1997; 100:2153–2157.

174. Brinkman K, Vrouenraets S, Kauffmann R, Weigel H &Frissen J. Treatment of nucleoside reverse transcriptaseinhibitor-induced lactic acidosis. AIDS 2000;14:2801–2802.

175. Carr A, Morey A, Mallon P, Williams D & Thorburn DR.Fatal portal hypertension, liver failure, and mitochondrialdysfunction after HIV-1 nucleoside analogue-inducedhepatitis and lactic acidaemia. Lancet 2001;357:1412–1414.

176. Miller KD, Cameron M, Wood LV, Dalakas MC & KovacsJA. Lactic acidosis and hepatic steatosis associated with useof stavudine: report of four cases. Annals of InternalMedicine 2000; 133:192–196.

177. Mokrzycki MH, Harris C, May H, Laut J & Palmisano J.Lactic acidosis associated with stavudine administration: areport of five cases. Clinical Infectious Diseases 2000;30:198–200.

178. Murphy MD, O’Hearn M & Chou S. Fatal lactic acidosisand acute renal failure after addition of tenofovir to anantiretroviral regimen containing didanosine. ClinicalInfectious Diseases 2003; 36:1082–1085.

179. Tsai CH, Doong SL, Johns DG, Driscoll JS & Cheng YC.Effect of anti-HIV 2′-beta-fluoro-2′,3′-dideoxynucleosideanalogs on the cellular content of mitochondrial DNA andon lactate production. Biochemical Pharmacology 1994;48:1477–1481.

180. Gaou I, Malliti M, Guimont MC, Letteron P, DemeilliersC, Peytavin G, Degott C, Pessayre D & Fromenty B. Effectof stavudine on mitochondrial genome and fatty acidoxidation in lean and obese mice. Journal of Pharmacology& Experimental Therapeutics 2001; 297:516–523.

181. Anderson TD, Davidovich A, Feldman D, Sprinkle TJ,Arezzo J, Brosnan C, Calderon RO, Fossom LH, DeVriesJT & DeVries GH. Mitochondrial schwannopathy andperipheral myelinopathy in a rabbit model of dideoxycyti-dine neurotoxicity. Laboratory Investigation 1994;70:724–739.

182. Cossarizza A, Pinti M, Moretti L, Bricalli D, Bianchi R,Troiano L, Fernandez MG, Balli F, Brambilla P, Mussini C& Vigano A. Mitochondrial functionality and mitochon-drial DNA content in lymphocytes of vertically infectedhuman immunodeficiency virus-positive children withhighly active antiretroviral therapy-related lipodystrophy.Journal of Infectious Diseases 2002; 185:299–305.


184. Yarchoan R, Pluda JM, Thomas RV, Mitsuya H, BrouwersP, Wyvill KM, Hartman N, Johns DG & Broder S. Long-term toxicity/activity profile of 2′,3′-dideoxyinosine inAIDS or AIDS-related complex. Lancet 1990;336:526–529.

185. Dubinsky RM, Yarchoan R, Dalakas M & Broder S.Reversible axonal neuropathy from the treatment of AIDSand related disorders with 2′,3′-dideoxycytidine (ddC).Muscle & Nerve 1989; 12:856–860.

186. Merigan TC, Skowron G, Bozzette SA, Richman D,Uttamchandani R, Fischl M, Schooley R, Hirsch M, Soo W,Pettinelli C, Schaumburg H & the ddC Study Group of theAIDS Clinical Trials Group. Circulating p24 antigen levelsand responses to dideoxycytidine in humanimmunodeficiency virus (HIV) infections. A Phase I and IIstudy. Annals of Internal Medicine 1989; 110:189–194.

187. Berger AR, Arezzo JC, Schaumburg HH, Skowron G,Merigan T, Bozzette S, Richman D & Soo W. 2′,3′-Dideoxycytidine (ddC) toxic neuropathy: a study of 52patients. Neurology 1993; 43:358–362.

W Lewis


188. Dalakas MC. Peripheral neuropathy and antiretroviraldrugs. Journal of the Peripheral Nervous System 2001;6:14–20.

189. Cicalini S, Forcina G & De Rosa FG. Infective endocarditisin patients with human immunodeficiency virus infection.Journal of Infection 2001; 42:267–271.

190. Feldman D, Brosnan C & Anderson TD. Ultrastructure ofperipheral neuropathy induced in rabbits by 2′,3′-dideoxy-cytidine. Laboratory Investigation 1992; 66:75–85.

191. Anderson TD, Davidovich A, Arceo R, Brosnan C, ArezzoJ & Schaumburg H. Peripheral neuropathy induced by2′,3′-dideoxycytidine. A rabbit model of 2′,3′-dideoxycyti-dine neurotoxicity. Laboratory Investigation 1992;66:63–74.

192. Starnes MC & Cheng YC. Inhibition of humanimmunodeficiency virus reverse transcriptase by 2′,3′-dideoxynucleoside triphosphates: template dependence, andcombination with phosphonoformate. Virus Genes 1989;2:241–251.

193. Keilbaugh SA, Hobbs GA & Simpson MV. Anti-humanimmunodeficiency virus type 1 therapy and peripheralneuropathy: prevention of 2′,3′-dideoxycytidine toxicity inPC12 cells, a neuronal model, by uridine and pyruvate.Molecular Pharmacology 1993; 44:702–706.

194. Feldman D & Anderson TD. Schwann cell mitochondrialalterations in peripheral nerves of rabbits treated with 2′,3′-dideoxycytidine. Acta Neuropathologica 1994; 87:71–80.

195. Ojetti V, Gasbarrini A, Migneco A, Flore R, SantoliquidoA, De Martini D, Agnes S, Gentiloni Silveri N & Pola P.Lamivudine-induced muscle mitochondrial toxicity.Digestive & Liver Disease 2002; 34:384–385.

196. Feng JY, Murakami E, Zorca SM, Johnson AA, JohnsonKA, Schinazi RF, Furman PA & Anderson KS. Relationshipbetween antiviral activity and host toxicity: comparison ofthe incorporation efficiencies of 2′,3′-dideoxy-5-fluoro-3′-thiacytidine-triphosphate analogs by humanimmunodeficiency virus type 1 reverse transcriptase andhuman mitochondrial DNA polymerase. AntimicrobialAgents & Chemotherapy 2004; 48:1300–1306.

197. Faraj A, Agrofoglio LA, Wakefield JK, McPherson S,Morrow CD, Gosselin G, Mathe C, Imbach JL, SchinaziRF & Sommadossi JP. Inhibition of humanimmunodeficiency virus type 1 reverse transcriptase by the5′-triphosphate beta enantiomers of cytidine analogs.Antimicrobial Agents & Chemotherapy 1994;38:2300–2305.

198. Cui L, Schinazi RF, Gosselin G, Imbach JL, Chu CK,Rando RF, Revankar GR & Sommadossi JP. Effect of beta-enantiomeric and racemic nucleoside analogues onmitochondrial functions in HepG2 cells. Implications forpredicting drug hepatotoxicity. Biochemical Pharmacology1996; 52:1577–1584.

199. Lambert JS, Seidlin M, Reichman RC, Plank CS, LavertyM, Morse GD, Knupp C, McLaren C, Pettinelli C,Valentine FT & Dolin R. 2′,3′-Dideoxyinosine (ddI) inpatients with the acquired immunodeficiency syndrome orAIDS-related complex. A Phase I trial. New EnglandJournal of Medicine 1990; 322:1333–1340.

200. Cooley TP, Kunches LM, Saunders CA, Ritter JK, PerkinsCJ, McLaren C, McCaffrey RP & Liebman HA. Once-dailyadministration of 2′,3′-dideoxyinosine (ddI) in patientswith the acquired immunodeficiency syndrome or AIDS-related complex. Results of a Phase I trial. New EnglandJournal of Medicine 1990; 322:1340–1345.

201. Foli A, Benvenuto F, Piccinini G, Bareggi A, Cossarizza A,Lisziewicz J & Lori F. Direct analysis of mitochondrialtoxicity of antiretroviral drugs. AIDS 2001; 15:1687–1694.

202. Hanna L. FddA: antiretroviral in development. BETABulletin of Experimental Treatments for AIDS 1998:7–8.

203. Comereski CR, Kelly WA, Davidson TJ, Warner WA,Hopper LD & Oleson FB. Acute cardiotoxicity of nucleo-side analogs FddA and FddI in rats. Fundamental &Applied Toxicology 1993; 20:360–364.

204. Tennant BC, Baldwin BH, Graham LA, Ascenzi MA,Hornbuckle WE, Rowland PH, Tochkov IA, Yeager AE,Erb HN, Colacino JM, Lopez C, Engelhardt JA, BowsherRR, Richardson FC, Lewis W, Cote PJ, Korba BE & GerinJL. Antiviral activity and toxicity of fialuridine in thewoodchuck model of hepatitis B virus infection.Hepatology 1998; 28:179–191.

205. Walsh K, Kaye K, Demaerschalk B, Stewart S, Crukley J &Hammond R. AZT myopathy and HIV-1 polymyositis: onedisease or two? Canadian Journal of Neurological Sciences2002; 29:390–393.

206. Prime KP, Edwards SG, Pakianathan MR, Holton JL,Scaravilli F & Miller RF. Polymyositis masquerading asmitochondrial toxicity. Sexually Transmitted Infections2003; 79:417–418.

207. Simpson DM, Citak KA, Godfrey E, Godbold J & WolfeDE. Myopathies associated with human immunodeficiencyvirus and zidovudine: can their effects be distinguished?Neurology 1993; 43:971–976.

208. Simpson DM, Slasor P, Dafni U, Berger J, Fischl MA &Hall C. Analysis of myopathy in a placebo-controlledzidovudine trial. Muscle & Nerve 1997; 20:382–385.

209. Gerschenson M, Erhart SW, Paik CY, St Claire MC,Nagashima K, Skopets B, Harbaugh SW, Harbaugh JW,Quan W & Poirier MC. Fetal mitochondrial heart andskeletal muscle damage in Erythrocebus patas monkeysexposed in utero to 3′-azido-3′-deoxythymidine. AIDSResearch & Human Retroviruses 2000; 16:635–644.

210. Gerschenson M, Nguyen VT, St Claire MC, Harbaugh SW,Harbaugh JW, Proia LA & Poirier MC. Chronic stavudineexposure induces hepatic mitochondrial toxicity in adultErythrocebus patas monkeys. Journal of Human Virology2001; 4:335–342.

211. Gerschenson M & Poirier MC. Fetal patas monkeys sustainmitochondrial toxicity as a result of in utero zidovudineexposure. Annals of the New York Academy of Sciences2000; 918:269–281.

212. Agarwal RP & Olivero OA. Genotoxicity and mitochon-drial damage in human lymphocytic cells chronicallyexposed to 3′-azido-2′,3′-dideoxythymidine. MutationResearch 1997; 390:223–231.

213. Miura T, Goto M, Hosoya N, Odawara T, Kitamura Y,Nakamura T & Iwamoto A. Depletion of mitochondrialDNA in HIV-1-infected patients and its amelioration byantiretroviral therapy. Journal of Medical Virology 2003;70:497–505.

214. Mackey DA, Fingert JH, Luzhansky JZ, McCluskey PJ,Howell N, Hall AJ, Pierce AB & Hoy JF. Leber’s hereditaryoptic neuropathy triggered by antiretroviral therapy forhuman immunodeficiency virus. Eye 2003; 17:312–317.

215. Reiss P, Casula M, de Ronde A, Weverling GJ, Goudsmit J& Lange JM. Greater and more rapid depletion of mito-chondrial DNA in blood of patients treated with dual(zidovudine+didanosine or zidovudine+zalcitabine) vs.single (zidovudine) nucleoside reverse transcriptaseinhibitors. HIV Medicine 2004; 5:11–14.

216. Newman MD. Bone disorders, hypertension, and mito-chondrial toxicity in HIV disease. Topics in HIV Medicine2003; 11:10–15.

217. Miller RF, Shahmonesh M, Hanna MG, Unwin RJ,Schapira AH & Weller IV. Polyphenotypic expression ofmitochondrial toxicity caused by nucleoside reverse tran-scriptase inhibitors. Antiviral Therapy 2003; 8:253–257.


219. Copeland WC, Ponamarev MV, Nguyen D, Kunkel TA &Longley MJ. Mutations in DNA polymerase gamma causeerror prone DNA synthesis in human mitochondrial disor-ders. Acta Biochimica Polonica 2003; 50:155–167.

220. Feng JY, Johnson AA, Johnson KA & Anderson KS.Insights into the molecular mechanism of mitochondrialtoxicity by AIDS drugs. Journal of Biological Chemistry2001; 276:23832–23837.



221. Graziewicz MA, Day BJ & Copeland WC. The mitochon-drial DNA polymerase as a target of oxidative damage.Nucleic Acids Research 2002; 30:2817–2824.

222. Lewis W. Defective mitochondrial DNA replication andNRTIs: pathophysiological implications in AIDS cardiomy-opathy. American Journal of Physiology. Heart &Circulatory Physiology 2003; 284:H1–H9.

223. Elimadi A, Morin D, Albengres E, Chauvet-Monges AM,Allain V, Crevat A & Tillement JP. Differential effects ofzidovudine and zidovudine triphosphate on mitochondrialpermeability transition and oxidative phosphorylation.British Journal of Pharmacology 1997; 121:1295–1300.

224. Freyssenet D, DiCarlo M, Escobar P, Grey J, Schneider J &Hood DA. Zidovudine (AZT) induced alterations in mito-chondrial biogenesis in rat striated muscles. CanadianJournal of Physiology & Pharmacology 1999; 77:29–35.

225. Birkus G, Hitchcock MJ & Cihlar T. Assessment of mito-chondrial toxicity in human cells treated with tenofovir:comparison with other nucleoside reverse transcriptaseinhibitors. Antimicrobial Agents & Chemotherapy 2002;46:716–723.

226. Modica-Napolitano JS. AZT causes tissue-specific inhibi-tion of mitochondrial bioenergetic function. Biochemical &Biophysical Research Communications 1993;194:170–177.

227. Petit F, Arnoult D, Lelievre JD, Moutouh-de Parseval L,Hance AJ, Schneider P, Corbeil J, Ameisen JC & EstaquierJ. Productive HIV-1 infection of primary CD4+ T cellsinduces mitochondrial membrane permeabilization leadingto a caspase-independent cell death. Journal of BiologicalChemistry 2002; 277:1477–1487.

228. Frick LW, Nelson DJ, St Clair MH, Furman PA & KrenitskyTA. Effects of 3′-azido-3′-deoxythymidine on the deoxynu-cleotide triphosphate pools of cultured human cells.Biochemical & Biophysical Research Communications1988; 154:124–129.

229. Herzberg NH, Zorn I, Zwart R, Portegies P & Bolhuis PA.Major growth reduction and minor decrease in mitochon-drial enzyme activity in cultured human muscle cells afterexposure to zidovudine. Muscle & Nerve 1992;15:706–710.

230. Walker UA, Venhoff N, Koch EC, Olschewski M,Schneider J & Setzer B. Uridine abrogates mitochondrialtoxicity related to nucleoside analogue reverse transcriptaseinhibitors in HepG2 cells. Antiviral Therapy 2003;8:463–470.

231. Collins ML, Sondel N, Cesar D & Hellerstein MK. Effectof nucleoside reverse transcriptase inhibitors on mitochon-drial DNA synthesis in rats and humans. Journal ofAcquired Immune Deficiency Syndromes 2004;37:1132–1139.

232. Pinti M, Troiano L, Nasi M, Ferraresi R, Dobrucki J &Cossarizza A. Hepatoma HepG2 cells as a model for invitro studies on mitochondrial toxicity of antiviral drugs:which correlation with the patient? Journal of BiologicalRegulators & Homeostatic Agents 2003; 17:166–171.

233. White EL, Parker WB, Macy LJ, Shaddix SC, McCaleb G,Secrist JAd, Vince R & Shannon WM. Comparison of theeffect of Carbovir, AZT, and dideoxynucleoside triphos-phates on the activity of human immunodeficiency virusreverse transcriptase and selected human polymerases.Biochemical & Biophysical Research Communications1989; 161:393–398.

234. Parker WB, White EL, Shaddix SC, Ross LJ, Buckheit RWJr, Germany JM, Secrist JAd, Vince R & Shannon WM.Mechanism of inhibition of human immunodeficiency virustype 1 reverse transcriptase and human DNA polymerasesalpha, beta, and gamma by the 5′-triphosphates of carbovir,3′-azido-3′-deoxythymidine, 2′,3′-dideoxyguanosine and 3′-deoxythymidine. A novel RNA template for the evaluationof antiretroviral drugs. Journal of Biological Chemistry1991; 266:1754–1762.

235. Parker WB, Shaddix SC, Vince R & Bennett LL Jr. Lack ofmitochondrial toxicity in CEM cells treated with carbovir.Antiviral Research 1997; 34:131–136.

236. Moreno A, Quereda C, Moreno L, Perez-Elias MJ, MurielA, Casado JL, Antela A, Dronda F, Navas E, Barcena R &Moreno S. High rate of didanosine-related mitochondrialtoxicity in HIV/HCV-coinfected patients receiving ribavirin.Antiviral Therapy 2004; 9:133–138.

237. Fleischer R, Boxwell D & Sherman KE. Nucleosideanalogues and mitochondrial toxicity. Clinical InfectiousDiseases 2004; 38:E79–E80.

238. von Giesen HJ, Hefter H, Jablonowski H & Arendt G.Stavudine and the peripheral nerve in HIV-1 infectedpatients. Journal of Neurology 1999; 246:211–217.

239. Verucchi G, Calza L, Manfredi R & Chiodo F. Incidence ofliver toxicity in HIV-infected patients receiving isolateddual nucleoside analogue antitretroviral therapy. Journal ofAcquired Immune Deficiency Syndromes 2003;33:546–548.

240. Van Huyen JP, Landau A, Piketty C, Belair MF, Batisse D,Gonzalez-Canali G, Weiss L, Jian R, Kazatchkine MD &Bruneval P. Toxic effects of nucleoside reverse transcriptaseinhibitors on the liver. Value of electron microscopyanalysis for the diagnosis of mitochondrial cytopathy.American Journal of Clinical Pathology 2003;119:546–555.

241.Peyriere H, Guillemin V, Lotthe A, Baillat V, Fabre J, FavierC, Atoui N, Hansel S, Hillaire-Buys D & Reynes J.Reasons for early abacavir discontinuation in HIV-infectedpatients [see comment]. Annals of Pharmacotherapy 2003;37:1392–1397.

242. Hughes DA, Vilar FJ, Ward CC, Alfirevic A, Park BK,Pirmohamed M. Cost-effectiveness analysis of HLS B*5701genotyping in preventing abacavir hypersensitivity.Pharmacogenetics 2004; 14:335–342.

243. Carr A, Workman C, Smith DE, Hoy J, Hudson J, DoongN, Martin A, Amin J, Freund J, Law M & Cooper DA;Mitochondrial Toxicity (MITOX) Study Group. Abacavirsubstitution for nucleoside analogs in patients with HIVlipoatrophy: a randomized trial. Journal of the AmericanMedical Association 2002; 288:207–215.

244. Martinez E, Milinkovic A, de Lazzari E, Ravasi G, BlancoJL, Larrousse M, Mallolas J, Garcia F, Miro JM & GatellJM. Pancreatic toxic effects associated with co-administra-tion of didanosine and tenofovir in HIV-infected adults.Lancet 2004; 364:65–67.

245. De Clercq E. Clinical potential of the acyclic nucleosidephosphonates cidofovir, adefovir, and tenofovir in treat-ment of DNA virus and retrovirus infections. ClinicalMicrobiology Reviews 2003; 16:569–596.

246. Institute of Medicine (US). Committee to Review theFialuridine (FIAU/FIAC) Clinical Trials. Review of theFialuridine (FIAU) Clinical Trials, 1995. Washington, DC:National Academy Press.

247. Stevenson W, Gaffey M, Ishitani M, McCullough C,Dickson R, Caldwell S, Lobo P & Pruett T. Clinical courseof four patients receiving the experimental antiviral agentfialuridine for the treatment of chronic hepatitis B infec-tion. Transplantation Proceedings 1995; 27:1219–1221.

248. Honkoop P, Scholte HR, de Man RA & Schalm SW.Mitochondrial injury. Lessons from the fialuridine trial.Drug Safety 1997; 17:1–7.

249. Brahams D. Deaths in US fialuridine trial. Lancet 1994;343:1494–1495.

250. Odeh M. Lactic acidosis and acquired immunodeficiencysyndrome. Journal of Internal Medicine 1994;236:478–479.

251. Crowley VE & Olukogu AO. The chemical pathology ofAIDS. Annals of Clinical Biochemistry 1995; 32(Pt5):511–512.

252. Torre D & Speranza F. Is there a role for nitric oxide inhyperlactataemia syndromes and mitochondrial dysfunctionassociated with HIV therapy? Lancet Infectious Diseases2003; 3:609–610.

253. Wohl DA, Pilcher CD, Evans S, Revuelta M, McComsey G,Yang Y, Zackin R, Alston B, Welch S, Basar M, KashubaA, Kondo P, Martinez A, Giardini J, Quinn J, Littles M,

W Lewis


Wingfield H & Koletar SL; Adult AIDS Clinical TrialsGroup A5129 Team. Absence of sustained hyperlactatemiain HIV-infected patients with risk factors for mitochondrialtoxicity. Journal of Acquired Immune DeficiencySyndromes 2004; 35:274–278.

254. de la Asuncion JG, del Olmo ML, Sastre J, Pallardo FV &Vina J. Zidovudine (AZT) causes an oxidation of mito-chondrial DNA in mouse liver. Hepatology 1999;29:985–987.

255. Klecker RW, Katki AG & Collins JM. Toxicity, metabolism,DNA incorporation with lack of repair, and lactate produc-tion for 1-(2′-fluoro-2′-deoxy-beta-D-arabinofuranosyl)-5-iodouracil in U-937 and MOLT-4 cells. MolecularPharmacology 1994; 46:1204–1209.

256. Richardson FC, Engelhardt JA & Bowsher RR. Fialuridineaccumulates in DNA of dogs, monkeys, and rats followinglong-term oral administration. Proceedings of the NationalAcademy of Sciences, USA 1994; 91:12003–12007.

257. Cui L, Yoon S, Schinazi RF & Sommadossi JP. Cellular andmolecular events leading to mitochondrial toxicity of 1-(2-deoxy-2-fluoro-1-beta-D-arabinofuranosyl)-5-iodouracil inhuman liver cells. Journal of Clinical Investigation 1995;95:555–563.

258. Lewis W & Tankersley KO. Triphosphorylated fialuridineand metabolites inhibit cardiac mitochondrial DNA poly-merase gamma (DNA polymerase-gamma): alternativesubstrates for thymidine triphosphate (dTTP). Circulation1995; 92:I186.

259. Horn DM, Neeb LA, Colacino JM & Richardson FC.Fialuridine is phosphorylated and inhibits DNA synthesis inisolated rat hepatic mitochondria. Antiviral Research 1997;34:71–74.

260. Wang J & Eriksson S. Phosphorylation of the anti-hepatitisB nucleoside analog 1-(2′-deoxy- 2′-fluoro-1-beta-D-arabino-furanosyl)-5-iodouracil (FIAU) by human cytosolic andmitochondrial thymidine kinase and implications for cyto-

toxicity. Antimicrobial Agents & Chemotherapy 1996;40:1555–1557.

261. Colacino JM, Malcolm SK & Jaskunas SR. Effect of fialuri-dine on replication of mitochondrial DNA in CEM cells andin human hepatoblastoma cells in culture. AntimicrobialAgents & Chemotherapy 1994; 38:1997–2002.

262. Roth JS, Ford H Jr, Tanaka M, Mitsuya H & Kelley JA.Determination of 2′-beta-fluoro-2′,3′-dideoxyadenosine, anexperimental anti-AIDS drug, in human plasma by high-performance liquid chromatography. Journal ofChromatography. B, Biomedical Sciences & Applications1998; 712:199–210.

263. Highleyman L. Lodenosine trials stopped due to safetyconcerns. BETA Bulletin of Experimental Treatments forAids 1999; 12:4.

264. Anonymous. Lodenosine trial halted. AIDS Patient Care &STDs 2000; 14:61.

265. Ruxrungtham K, Boone E, Ford H Jr, Driscoll JS, Davey RTJr & Lane HC. Potent activity of 2′-beta-fluoro-2′,3′-dideoxyadenosine against human immunodeficiency virustype 1 infection in hu-PBL-SCID mice. Antimicrobial Agents& Chemotherapy 1996; 40:2369–2374.

266. Srinivas NR & Shyu WC. Single dose and multiple dosepharmacokinetics of 2′-fluoro-2′,3′-dideoxyadenosine and2′-fluoro-2′,3′-dideoxyinosine, anti-HIV agents, in rats.European Journal of Drug Metabolism & Pharmacokinetics1999; 24:329–334.

267. Izawa K, Takamatsu S, Katayama S, Hirose N, Kozai S &Maruyama T. An industrial process for synthesizing lodeno-sine (FddA). Nucleosides, Nucleotides & Nucleic Acids2003; 22:507–517.

268. Roth JS, McCully CM, Balis FM, Poplack DG & Kelley JA.2′-beta-fluoro-2′,3′-dideoxyadenosine, lodenosine, in rhesusmonkeys: plasma and cerebrospinal fluid pharmacokineticsand urinary disposition. Drug Metabolism & Disposition1999; 27:1128–1132.



Received 13 January 2005, accepted 22 March 2005

It has been demonstrated that HIV protease inhibitors (PIs)are able to inhibit apoptosis of both infected and unin-fected T cells. It was hypothesized that the mechanismsunderlying this effect are associated with a specific activityof these drugs against mitochondrial modificationsoccurring in the execution phase of apoptosis. In this work,we investigated the activity of PIs towards the earlychanges occurring in mitochondrial membrane potentialin freshly isolated uninfected human T lymphocytes sensi-tized to CD95/Fas-induced physiological apoptosis viapre-exposure to HIV envelope protein gp120. The resultsobtained clearly indicate that PIs are capable of hindering

early morphogenetic changes bolstering T cell apoptosis,that is, cell polarization and mitochondrial hyperpolariza-tion. The target effect on mitochondria appeared to becharacterized by a specific activity of PIs in the mainte-nance of their homeostasis either in intact cells or incell-free systems, that is, isolated mitochondria. PIs seemto act as boosters of mitochondrial defense mechanisms,including modulation of endogenous uncouplers. Theseresults add new insights in the field of PI mitochondrialtoxicity mechanisms and pharmacological perspectives forthe use of these drugs in the control of immune systemhomeostasis.

HIV protease inhibitors prevent mitochondrialhyperpolarization and redox imbalance and decreaseendogenous uncoupler protein-2 expression ingp120-activated human T lymphocytesPaola Matarrese1, Antonella Tinari2, Lucrezia Gambardella1, Elisabetta Mormone1, Piero Narilli4, MarinaPierdominici3, Roberto Cauda5 and Walter Malorni*1

1Departments of Drug Research and Evaluation, 2Technology and Health, and 3Cell Biology and Neurosciences, Istituto Superiore diSanitá, viale Regina Elena 299-00161 Rome, Italy4Department of General Surgery and Organ Transplantation, University of Rome ‘La Sapienza’, Rome, Italy5Department of Infectious Diseases, Catholic University, Rome, Italy



Given the important role of apoptosis in the pathogen-esis and progression of HIV infection, several studieshave been focused specifically on the mechanisms ofapoptosis in both HIV-infected and uninfected CD4+cells [1,2]. As a general rule, two different apoptoticpathways leading to activation of cell-specificprograms have been proposed [3]. These two pathwaysrefer to different initiation patterns, that is, receptor-dependent or independent [4]. In particular, changes ofmitochondrial membrane potential (MMP) have beenhypothesized to play a key role in apoptotic cascade. Infact, alterations of MMP have been associated with therelease of apoptogenic factors that directly or indi-rectly, that is, via apoptosome formation, lead to theexecution of apoptosis. A major role of mitochondriahas also previously been suggested in the process ofCD4+ T cell death [5,6].

Several drugs employed in clinical practice powerfullycounteract the reduction of CD4+ cells by apoptosis in

HIV infection. In fact, an important aspect of highlyactive antiretroviral therapy (HAART) is representedby immune reconstitution [7]. This is a therapeuticapproach that involves, among others, drugs ofdifferent natures, such as HIV reverse transcriptaseinhibitors, for example, zidovudine (AZT), and HIVprotease inhibitors (PIs). Some of these, for example,indinavir (IDV), saquinavir (SQV) and lopinavir(LPV), are known to induce viral load lowering as wellas the reduction of cell loss. It has also been suggestedthat AZT might be considered as an apoptotic inducer[8] whilst various PIs can be considered as apoptosis-hindering drugs [7,9]. Some in vitro and ex vivo studieshave in fact suggested that PIs are able to inhibitperipheral blood mononuclear cell loss and restoreimpaired T-cell proliferative response [10]. Strikingly,this occurred independently from any viral infection[10]. Although a target activity of PIs towards mito-chondria was hypothesized [11,12], the mechanism

Introduction


underlying this activity still remains poorly understood[9,13]. In the present work, we analysed the earliermechanisms involved in the subcellular effects of PIsconsidered as ‘mitochondriotropic’ drugs. The resultsreported herein document a series of changes, that is,cell polarization, induced by gp120 HIV protein infreshly isolated human T lymphocytes and the conse-quent proneness to CD95/Fas-induced apoptosis.These events were accompanied by mitochondrialhyperpolarization. PIs infer, with these subcellularevents, hijacking T cells towards apoptotic resistancevia a target effect on mitochondrial homeostasis.Furthermore, they also suggest for the first time thatthe mechanisms involved in PI activity include themodulation of the expression of endogenous mito-chondrial uncoupler proteins (UCPs).

Materials and methods

Isolation and activation of peripheral bloodlymphocytesHuman peripheral blood lymphocytes (PBLs) fromhealthy donors (HDs) were isolated from freshlyheparinized blood through a Ficoll-Hypaque densitygradient centrifugation and washed three times inphosphate-buffer saline (PBS), pH 7.4. (Lympholyte-H;Cedarlane Laboratories, Hornby, ON, Canada). PBLswere subcultured in 25 cm2 or 75 cm2 Falcon plasticflasks at a density of approximately 1×106 cells/ml inRPMI 1640 (Gibco-BRL Life Technologies, Milan,Italy) containing 10% fetal calf serum, (FlowLaboratories, Irvine, Scotland), 1% non-essentialamino acids, 5 mM L-glutamine, penicillin (100 IU/ml)and streptomycin (100 mg/ml) at 37°C in a humidified5% CO

2atmosphere.

In vitro treatmentsPurified T cells were activated for 72 h, in the presenceor absence of 100 nM IDV (Merck Sharp & DohmeLtd, Hotteson, UK), SQV (Roche Registration, WelwynGarden City, UK) or LPV (Abbott Laboratories,Queenborough, UK), with i) interleukin 2 (IL2,60 IU/ml; Gibco-BRL); ii) IL2 and phytohaemoagglu-tinin (PHA 2 µg/ml; Sigma Chemical Co, St Louis, MO,USA); iii) HIV-1 gp120 (3 µg/ml; Intracell Corp,Cambridge, MA, USA); and iv) IL2 and HIV-1 gp120.Isolated human lymphocytes (resting or differently acti-vated) were treated with 500 ng/ml of an anti-humanFas IgM monoclonal antibodies (mAbs) (α-Fas, cloneCH11; Upstate Biotechnology, Lake Placid, NY, USA).For dose-dependent studies, T lymphocytes weretreated with 100 nM, 1 µM and 10 µM IDV for 72 h.Because of overlapping results obtained by using thethree different PIs, only results obtained with IDV, thusconsidered as representative, are shown in this paper.

Evaluation of cell surface receptorsThe surface expression of molecules associated with Tcell activation (CD69, CD38 and HLA-DR) and celldeath (CD95/Fas) was verified by flow cytometry onresting and activated lymphocytes. For this purpose,mAbs directly conjugated to fluorochromes PE, FITC orPerCP to human CD95, CD38, HLA-DR and CD69(Becton Dickinson, Mountain View, CA, USA) were used.Appropriate fluorochrome-conjugated immunoglobulinswere used as negative controls.

Apoptosis evaluationQuantitative evaluation of apoptosis was performed byusing the following flow and static cytometry methods:i) double staining using the annexin V-FITC apoptosisdetection kit (Eppendorf, Milan, Italy). This techniqueallows cells that have lost membrane integrity (and aretherefore considered necrotic) to show red stainingwith propidium iodide (40 µg/ml) throughout thenucleus and to be easily distinguished from the livingcells and ii) staining with the chromatin dye Hoechst(Molecular Probes, Eugene, OR, USA) as previouslydescribed [14].

Mitochondrial membrane potential (MMP) in livingcellsThe MMP of control and treated lymphocytes wasstudied by using the JC-1 probe. Following this method,cells were stained with 10 µM of 5-5′,6-6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazol-carbocyanine iodide(JC-1; Molecular Probes) as previously described [15].Tetramethylrhodamine ester (1 µM TMRM (red fluo-rescence); Molecular Probes) was also used to confirmdata obtained by JC-1.

Redox balanceResting and differently activated lymphocytes (5×105),either treated or untreated with IDV, were incubated in495 µl of Hanks’ balanced salt solution (HBSS) (GibcoBR2, Burlington, ON, Canada) pH 7.4 with 10 µMdihydrorhodamine 123 (DHR 123; Molecular Probes)or 1 µM dihydroethidium (DHE; Molecular Probes) inpolypropylene test tubes for 15 min at 37°C. Themedian values of fluorescence intensity histogramswere used to provide semi-quantitative analysis of reac-tive oxygen intermediate (ROI) production.

ImmunocytochemistryImmunofluorescence analyses were performed bydouble staining as follows. Control and treated lympho-cyte samples were incubated with mAb to CD95/Fas(Chemicon International, Temecula, CA, USA) directlyconjugated with FITC for 1 h at 4°C. Cells were thenwashed, fixed with 4% paraformaldehyde (w/v in PBS)for 1 h at room temperature and then made permeable

P Matarrese et al.


by 0.5% (v/v) Triton X-100 for 5 min. After washing,samples were incubated for 1 h at 4°C with a mAb toezrin (Becton Dickinson, Mountain View, CA, USA).Negative controls were incubated with isotypicimmunoglobulins. After washing, samples and isotypiccontrols were incubated for 45 min at room tempera-ture with anti-mouse IgG TRITC-conjugate (SigmaChemical Co). All samples were mounted with specificmedium and analysed by intensified video microscopy(IVM) as previously reported [16].

Evaluation of uncoupler protein 2 (UCP-2) expressionWestern blot. Aliquots of total protein extracts (20 µg)from T cells after different treatments were size frac-tioned by 12% SDS-PAGE and, after transfer to nitro-cellulose membrane, filters were incubated withprimary polyclonal antibody (Pab) against UCP-2(Calbiochem Co, Darmstadt, Germany). Detection wasachieved using HRP-conjugated secondary Pab and bythe ECL detection system (Amersham-Pharmacia,Arlington Heights, IL, USA). Densitometric analyseswere carried out by using a densitometer (BiomedInstruments, Inc, Fullerton, CA, USA) and results wereexpressed as arbitrary units (AU).

Flow cytometry. Control and IDV-treated lymphocyteswere washed, fixed with 4% paraformaldehyde (w/v inPBS) for 1 h at room temperature and then permeabi-lized by 0.5% (v/v) Triton X-100 for 5 min. For quan-tification of uncoupler protein 2 (UCP-2), samples wereincubated for 1 h at room temperature with specificPab (Calbiochem). Negative controls were incubatedwith normal rabbit serum. After several washings,samples and isotypic controls were incubated in thedark for 45 min at room temperature with Alexa488-conjugated anti-rabbit IgG (Molecular Probes), washedand analysed on a cytometer.

Transmission electron microscopy (TEM)For TEM examination, cells were fixed in 2.5% cacody-late-buffered (0.2 M, pH 7.2) glutaraldehyde for 20min at room temperature and post-fixed in 1% OsO4 incacodylate buffer for 1 h at room temperature. Fixedspecimens were dehydrated through a graded series ofethanol solutions and embedded in Agar 100 (AgarAids, Cambridge, UK). Serial ultrathin sections werecollected on 200-mesh grids and then counterstainedwith uranyl acetate and lead citrate. Sections wereobserved with a Philips 208 electron microscope at80 kV.

Preparation of isolated mitochondriaGp120-, IDV+gp120- and carbonyl cyanide p-trifluo-romethoxyphenyl hydrazone (FCCP)+gp120-treated PBLwere collected by centrifugation. After three washings in

PBS, cells were resuspended in Homo buffer (10 mMHepes, pH 7.4; 1 mM ethylene glycol-bis(β-aminoethylether) N,N′,N′′-tetraacetic acid (EGTA), 0.1 M sucrose,5% bovine serum albumin (BSA), 1 mM phenylmethyl-sulphonyl fluoride and complete protease inhibitor cock-tail (Roche, Indianapolis, IN, USA) and maintained for10 min on ice. After this time, cells were homogenizedwith about 100 strokes of a Teflon homogenizer with B-type pestle as previously reported [17] for 10 min at 4°Cto remove intact cells and nuclei, and the supernatantswere further centrifuged at 10 000×g at 4°C for 10 minto precipitate the heavy membrane fractions (enriched inmitochondria). These fractions were then purified bystandard differential centrifugation. The mitochondrialpellet obtained was resuspended in swelling buffer (SB)containing 0.1 M sucrose, 0.5 M sodium succinate,50 mM EGTA at pH 7.4, 1 M phosphoric acid (H3PO4),0.5 M 3-(N-morpholino) propane sulphonic acid(MOPS) and 2 mM rotenone, kept on ice and usedwithin 2 h of the preparation. Protein content in themitochondrial preparation was determined by a spec-trophotometric method using BSA as standard. Thepurity of the mitochondria preparation was assessed byWestern blot, checking subunit I of cytochrome coxidase (mAb; Chemicon, Temecula, CA, USA).

Swelling experimentsMitochondria (0.5 mg protein/ml) from each sample(gp120, IDV+gp120 and FCCP+gp120) were resus-pended in SB at a final volume of 3 ml and separated intotwo samples. In the first sample, to induce mitochondrialswelling mimicking physiological conditions, we used1 µg/ml of recombinant Bid protein cleaved by caspase 3(t-Bid; PeproTech, Inc, Rocky Hill, NJ, USA).Mitochondria from gp120, IDV+gp120-treated andFCCP+gp12-treated lymphocytes were incubated with 1µg/ml t-Bid 2 h at 37°C. In the second, control sample,mitochondria from the same samples were incubated inSB without t-Bid.

Flow cytometry analysis. We analysed the ∆Ψ of isolatedmitochondria by using a cytofluorimetric method afterstaining with 1 µM TMRM. Using this method, theincorporation of the dye TMRM was monitored in theFL3 channel: low levels of TMRM incorporation(revealed by a decrease of red fluorescence) indicated alow ∆Ψ. On this basis, in our experiments we tested theeffect produced by t-Bid on the ∆Ψ of gp120-,IDV+gp120- or FCCP+gp120-treated samples. As ageneral rule, we recorded 5 min control samples(without t-Bid) and, after this time, we started torecord t-Bid-treated samples for a total recording timeof 25 min. All samples were analysed with a FACScancytometer (Becton Dickinson) equipped with a 488argon laser. To exclude debris, samples were gated


HIV protease inhibitors supply mitochondria homeostasis

based on light-scattering properties in the sidescattering and forward scattering modes duringanalyses. The red fluorescence emission (due to TMRMdye) of untreated mitochondria was set up in corre-spondence of the 102 channel and considered as basalemission. Dot plots of red fluorescence emission as afunction of the time, obtained in each condition weused, were statistically analysed by using CellQuestTM

software (Version 3.3) on a Macintosh (BectonDickinson) in order to determine the percentage ofmitochondria with depolarized membrane.

Analysis of cytochrome c releaseCytochrome c (CytC) was evaluated in supernatantsfrom isolated mitochondria by a sensitive and specificimmunoassay, using a commercial ELISA kit (R&DSystems, Minneapolis, MN, USA) according to themanufacturer’s instructions. The light emitted was quan-tified by using a microtitre plate reader at 405 nm. CytCconcentration was expressed in ng/ml.

Data analysis and statisticsAll samples were analysed with a FACScan cytometer(Becton Dickinson) equipped with a 488 argon laser. Atleast 20 000 events were acquired. Data were recordedand statistically analysed using CellQuestTM. Theexpression level of considered proteins was expressed asthe median value of fluorescence emission curve and thestatistical significance was calculated using the para-metric Kolmogorov–Smirnov (K/S) test. Statisticalanalysis of apoptosis data was performed by usingStudent’s t-test or one-way variance analysis by usingthe StatView® program (Version 5.0) for Macintosh(SAS Institute, Inc, Cary, NC, USA). All data reportedin this paper were verified in at least four different HDsand expressed as mean ± standard deviation (SD). OnlyP<0.01 was considered as significant.

Results

IDV hinders gp120-induced T-cell polarizationViral envelope protein gp120 was able to induce a widevariety of changes in human T lymphocytes that aretypical of activation, for example, i) the increasedexpression of T-cell activation markers and ii) the redis-tribution of molecules of importance in determininglymphocyte polarization and fate, that is, survival orapoptosis. In particular, regarding the first point, weevaluated the surface expression of CD69 (Figure 1A),HLA-DR (Figure 1B) and CD38 (Figure 1C). A signifi-cant increase of these molecules on the surface of T cellswas detected after gp120 administration (Figure 1).Interestingly, these results were comparable with thoseobtained by using typical activating factors such as IL2and PHA (Figures 1A–C). Importantly, pre-exposure of

human lymphocytes to PIs was ineffective in this respectand the up-regulation of these activation markersremained still detectable (Figure 3A–C). Regarding themolecules of importance in determining T cell fate, thefollowing results were obtained. Firstly, CD95/Fasexpression was significantly increased by administrationof gp120 either given alone or in association with IL2(Figure 1D). Furthermore, in consideration of the well-known ability of various PIs to impair T cell apoptosis[11,18], specific measurements of CD95/Fas expressionwere carried out in the presence of IDV. Notably, asdescribed above for activation markers (Figures 1A–C),the presence of IDV did not influence this parameterand the gp120-induced over-expression of CD95/Faswas well detectable either in the presence or absence ofIDV (Figure 1D). Secondly, a peculiar rearrangement ofthis molecule was observed. In particular, cellular local-ization of CD95/Fas was found to be modified bygp120. In fact, whilst control resting T cells appear non-polarized (Figure 2A, first row), gp120-treated cellsunderwent profound shape changes mainly representedby cell polarization. They appeared characterized by anaccumulation of CD95/Fas molecules at one pole of thecell – positive patches at the cell surface, confined in thesubcellular erniations called uropods were detectable byIVM analyses (Figure 2A, second row, left panel).

This polarization of the CD95 molecule was paral-leled by a rearrangement of a cytoskeletal moleculepreviously demonstrated to play a key role inCD95/Fas-induced cell death, representing a pre-requi-site for Fas signalling to occur: the ezrin molecule[16,19]. In fact, after gp120 exposure, in most of thelymphocytes the ezrin molecule appeared localized atone pole of the cell. Importantly, this cytoskeletonprotein also appeared to co-localize with CD95/Fas atthe uropod level (Figure 2A, second row, middle andright panels; compare with resting cells shown in thefirst row). Notably, IDV treatment was capable ofhindering these processes and both CD95/Fas and ezrinremained randomly distributed at the cell surface or inthe cell cytoplasm, respectively, and no co-localizationof these molecules was detectable (Figure 2A, thirdrow).

Altogether these results seem to indicate that: i)gp120 activation can predispose T lymphocytes to Fas-mediated apoptosis via uropod formation, CD95 polar-ization and ezrin cytoskeleton reorganization and ii) thepresence of IDV was capable of impairing theseprocesses. Ultrastructural analysis by TEM also pointout some morphogenetic changes caused by gp120,such as cell shape remodelling, as well as mitochondriaultrastructural changes. In particular, gp120 administra-tion led to: i) a redistribution of organelles, mainly ofmitochondria, at one pole of the cell and ii) an alter-ation of their ultrastructural features (Figure 2B, middle

P Matarrese et al.


panel; compare with resting cells shown in Figure 2B,left panel). The first was characterized by the appear-ance of clusters of coalescent mitochondria migrated toone pole of the cell (Figure 2B, middle panel). Thesecond was represented by ultrastructural modificationsof mitochondria in terms of increased electrondensityand changes in the morphological features of cristae(Figure 2B, middle panel, inset; compare with controlcell mitochondria shown in the inset in Figure 2B, leftpanel). Importantly, IDV administration (Figure 2B,right panel) prevented the mitochondrial morphologyand distribution changes being similar to those detectedin resting lymphocytes (compare left and right panels inFigure 2B).

Mitochondrial membrane potentialIt has previously been reported that during T lympho-cyte activation, an early increase of MMP clearlyoccurs [20,21]. This alteration was associated with Tcell sensitization to Fas-induced apoptosis [18,22,23].On the basis of these published data, the aim was toassess the early effects of HIV-1 gp120 protein on mito-chondrial function, that is, on mitochondrial ∆Ψ.Thus, MMP was evaluated in T cells exposed to gp120by using two different probes specifically employed inflow cytometry studies, that is, TMRM and JC-1 [15].Figure 3A shows the results obtained in lymphocytesfrom a representative HD, whereas in Figure 3B themean of values obtained by analysing four different



Figure 1. IDV does not influence gp120-induced increase of activation markers

40

CD69

exp

ress

ion

35

30

25

20

15

10

5

0

restin

g IL2

IL2/PH

Agp1

20

gp120/IL2

restin

g+IDV

IL2+IDV

IL2/PH

A+IDV

gp120+IDV

gp120/IL2

+IDV

60

HLA

-DR

expr

essi

on

50

40

30

20

10

0

restin

g IL2

IL2/PH

Agp1

20

gp120/IL2

restin

g+IDV

IL2+IDV

IL2/PH

A+IDV

gp120+IDV

gp120/IL2

+IDV

250

CD38

exp

ress

ion

200

150

100

50

0

restin

g IL2

IL2/PH

Agp1

20

gp120/IL2

restin

g+IDV

IL2+IDV

IL2/PH

A+IDV

gp120+IDV

gp120/IL2

+IDV

45

40

CD95

/Fas

exp

ress

ion 35

30

25

20

15

10

5

0

restin

g IL2

IL2/PH

Agp1

20

gp120/IL2

restin

g+IDV

IL2+IDV

IL2/PH

A+IDV

gp120+IDV

gp120/IL2

+IDV

Quantitative cytofluorimetric analysis of surface expression of activation markers CD69, HLA-DR and CD38, and of CD95 molecule in resting and differently activatedlymphocytes. Note that the significant (P<0.01) increase of (A) CD69, (B) HLA-DR, (C) CD38 and (D) CD95 due to lymphocyte activation was not modified by IDV.Data represent the mean of four independent experiments and are expressed as median values of fluorescence intensity histograms obtained by semiquantitativeflow cytometry analyses. IDV, indinavir; IL2, interleukin 2; PHA, phytohaemoagglutinin.

A B

C D

P Matarrese et al.


Figure 2. IDV hinders gp120-induced T cell polarization

CD95 ezrin merge

resting

resting

gp120

gp120

IDV+gp120

IDV+gp120

(A) Immunofluorescence analysis of CD95 and ezrin molecules after double staining of T lymphocytes with specific antibodies. Micrographs show that, after gp120administration, the CD95 molecule was polarized at the uropod (second row, green fluorescence) where it co-localized with ezrin (second row, red fluorescence) asdemonstrated by merge pictures in the right column (second row, yellow fluorescence). In IDV/gp120-treated lymphocytes, the uropod formation was inhibited andno CD95/ezrin co-localization was detectable (third row) as in resting cells (first row). (B) Ultrastructural analysis by TEM of resting and gp120-activated T lympho-cytes in the presence or absence of IDV. Control (untreated cells) display mitochondria randomly distributed throughout the cell cytoplasm (left panel). After gp120treatment, mitochondria appeared to have migrated to one pole of the cell, characterized by electron dense matrix and rearrangement of cristae (middle panel).These alterations were prevented by IDV (right panel). Results obtained from a representative HD out of four are shown. IDV, indinavir.

A

B



Figure 3. IDV hinders mitochondria hyperpolarization and redox changes associated with T lymphocyte activation

104103102101100

104103102101100

70

% o

f cel

ls w

ith h

yper

pola

rized

mito

chon

dria

60

50

40

30

20

10

0resting IL2 IL2

PHAgp120 IL2

gp120resting IL2 IL2

PHAgp120

IDV

IL2gp120

70

Supe

roxi

de a

nion

pro

duct

ion

(arb

itrar

y un

its)

60

50

40

30

20

IDV

restin

g IL2

IL2 PH

Agp1

20

IL2 gp

120 IL2

IL2 PH

Agp1

20

IL2 gp

120res

ting

100

80

70

40

cell

coun

t

20

0

resting M=44.1gp120 M=68.5

IDV+gp120 M=46.9

DHE (FL2)

70

Hyd

hrog

en p

erox

ide

prod

uctio

n(a

rbitr

ary

units

) 60

50

40

30

IDV

restin

g IL2

IL2 PH

Agp1

20

IL2 gp

120 IL2

IL2 PH

Agp1

20

IL2 gp

120res

ting

100

80

70

40

cell

coun

t

20

0

resting M=30.7

gp120 M=60.4

IDV+gp120 M=23.5

DHR123 (FL2)

104103102101100

100

101

102

103

104

J-ag

greg

ates

J-monomers

resting

104103102101100

100

101

102

103

104 gp120

104103102101100

100

101

102

103

104 IDV+gp120

(A) Quantitative cytofluorimetric analyses of MMP in resting (left panel) and in gp120-activated lymphocytes in the presence or absence of IDV as detected usingthe JC-1 probe. J-aggregates (red fluorescence, ordinate) increased after gp120 administration, when mitochondrial membrane became hyperpolarized (middlepanel). This mitochondria hyperpolarization was significantly (P<0.01) prevented by IDV (right panel). Numbers in the boxed areas represent the percentage of cellswith hyperpolarized mitochondria, while in the area under the dashed line, the percentage of cells with depolarized mitochondria is reported. Results obtained froma representative HD out of four are shown. (B) Flow cytometry MMP analysis performed in different activating conditions. Results obtained by pooling together datafrom four different HDs are reported. (C–F) Semiquantitative cytofluorimetric analyses of ROI production performed by using DHE (C and D) and DHR123 (E and F) inresting and gp-120-activated lymphocytes in the presence (or absence) of IDV. Values reported represent the median values of the fluorescence intensity histograms.In (E) and (F), the means ±SD of the results obtained form four different HDs are reported. Note that, independently from the activating condition used, IDV wascapable of significantly (P<0.01) preventing either anion superoxide (C,D) or hydrogen peroxide (E and F) production. HD, healthy donors; IDV, indinavir; IL2, inter-leukin 2; MMP, mitochondrial membrane potential; PHA, phytohaemoagglutinin; ROI, reactive oxygen intermediate.

A

B

C D

E F

HDs are reported. We found that, with respect tocontrol samples (Figure 3A, left panel, boxed area andFigure 3B), gp120 induced a marked increase of MMP(hyperpolarization) in a significant percentage of cells(Figure 3A, middle panel, boxed area and Figure 3B).Of note is that the mitochondrial hyperpolarizationphenomenon, as detected by flow cytometry, seems tocorrespond to changes in the mitochondrial structuralfeatures, as revealed by TEM analysis and shown inFigure 2B (middle panel). Importantly, pre-exposure toIDV completely impaired this mitochondrial hyperpo-larization state and the percentage of cells withincreased MMP was similar to that found in controlsamples (Figures 3A, compare right and left panels,boxed areas, and histograms in Figure 3B).

IDV hinders redox changes associated with gp120administrationProduction of reactive oxygen species was associatedwith mitochondrial changes occurring during T cellactivation [23,24]. We thus evaluated two of the majorparameters of importance in defining the redox state ofa cell: superoxide anion and hydrogen peroxideproduction by a semiquantitative flow cytometryanalysis. It has been found that gp120 was able to actas a mild pro-oxidant compound leading to anincreased production of both superoxide anion (Figure3C, a representative HD; Figure 3D, mean resultsobtained from lymphocytes from four different HDs)and hydrogen peroxide (Figure 3E, a representativeHD; Figure 3F, mean results obtained from lympho-cytes from four different HDs). Interestingly, IDV treat-ment was able to significantly protect lymphocytesfrom gp120-induced oxidative imbalance, as demon-strated by fluorescence median values very similar tothose found in control samples.

IDV hinders T cell sensitization to CD95/Fas-mediatedapoptosisThe increase of CD95/Fas cell surface expression, theezrin/CD95/Fas polarization and co-localization, aswell as mitochondria hyperpolarization and pro-oxidant conditions are known to be associated with anincreased susceptibility to Fas-induced apoptosis[19,22,25]. In the following experiments we evaluatedwhether gp120 administration was able to sensitize Tcells to various apoptotic stimuli. The analysis of apop-tosis, after double staining of cells with annexinV-FITC and propidium iodide, clearly indicated thati) gp120 was not able to induce apoptosis per se (Figure4A, first row, middle panel) but ii) it was able to sensi-tize T cells to CD95/Fas-mediated apoptotic triggering(Figure 4A, second row, middle panel) and that iii) IDVwas capable of significantly preventing lymphocyteapoptosis (Figure 4A, second row, right panel).

Furthermore, the anti-apoptotic activity exerted byIDV was also assessed in T lymphocytes activated bystandard protocols and exposed to triggering α-Fas(Figure 4B). Data reported in Figure 4B, clearly showthat IDV also significantly (P<0.01) prevented Fas-induced apoptosis in lymphocytes activated by IL2,IL2/PHA or IL2/gp120.

On the basis of these results, we then consideredwhether IDV treatment was capable of hindering apop-tosis associated with agents specifically influencingmitochondrial homeostasis. To this purpose, thecytokine interferon-α (IFN-α) and the drug stau-rosporin (STS), known to be able to modify mitochon-drial homeostasis [26,27] were used. However, theseagents were used at low concentrations and were,therefore, unable to induce any pro-apoptotic effect perse. The results obtained are shown in Figures 5A and5B and can be summarized as follows. Firstly, in thepresence of low concentrations of IFN-α (Figure 4A,boxed area) and STS (Figure 4B, boxed area) thepercentage of cells with hyperpolarized mitochondriawas significantly increased with respect to restingcontrol lymphocytes without any sign of cell death (seeFigure 3A, left panel). Secondly, according to the aboveresults (see Figure 3), lymphocytes were hypersensitiveto α-Fas-triggering that also induced, as a late event,depolarization of mitochondrial membrane, typical ofapoptotic execution. This was demonstrated by thehigh percentage of cells characterized by low red fluo-rescence emission when stained by JC-1 (see area underdotted line). Thirdly, and most importantly, in contem-poraneous treatments with IDV and IFN-α (IDV/IFN-α) or IDV and STS (IDV/STS), we observed asignificant impairment of IFN-α and STS-mediatedincrease of ∆Ψ, a reduction of T lymphocyte α-Fas-induced apoptosis and, accordingly, an inhibition of∆Ψ loss, that is, mitochondria depolarization typical ofapoptotic execution phase (Figures 5C and 5D, respec-tively; in Figure 5E mean values from four differentHDs are shown).

IDV inhibits t-Bid-induced swelling in isolated mitochondriaThe above results seem to suport a direct effect of IDVon mitochondria polarization state. In order to furtheranalyse this point, we first investigated whether IDVwas able to prevent mitochondrial swelling in isolatedmitochondria. To this end, we treated mitochondriaisolated from human T lymphocytes with recombinantBid protein cleaved by caspase 3 (t-Bid). It is in factwell known that Bid, a pro-apoptotic protein belongingto the Bcl-2 family, represents a key effector of theCD95-induced apoptotic pathway acting on mitochon-dria [28]. Figure 6A shows a representative profile ofthe swelling induced by 1 µg/ml t-Bid on mitochondria

P Matarrese et al.


isolated from gp120-activated lymphocytes monitoredby means of variations in TMRM fluorescence. It isvery evident that t-Bid induced a rapid decrease ofMMP (swelling phenomenon) in a significantpercentage of cells (19.6%, grey area). In particular, theMMP, expressed as a median value of the TMRM fluo-rescence curve significantly decreased from 249.4 to

89.4 (Figure 6B; control: plain black histogram; t-Bid:empty black histogram). Importantly, in accordancewith the above results obtained in intact cells, mito-chondria derived from IDV-treated gp120-activatedlymphocytes were more resistant to t-Bid-inducedswelling, being the percentage of depolarized mito-chondria significantly lower than that found in



Figure 4. IDV hinders CD95/Fas-mediated apoptosis in activated T cells

% a

popt

otic

cel

ls

60

50

40IgM control

α-Fas (CH11)30

20

10

0

restin

g

IL2/PH

Agp1

20

IL2/gp

120

restin

g+IDVIL2

IL2+IDV

IL2/gp

120+IDV

gp120+IDV

IL2/PH

A+IDV

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

PI

Annexin V-FITC

resting gp120 IDV+gp120

IgM

α-Fas

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

(A) Percentage of apoptotic cells (as revealed by annexin V/propidium iodide double staining) in gp120-activated PBL from a representative HD. Note that gp120 i) did not induce apoptosis per se, ii) sensitized T cells to CD95-induced apoptosis and iii) that IDV was able to significantly reduce apoptosis (P<0.01) independentlyfrom the activating stimulus taken into consideration. (B) Mean ±SD of the results obtained in four different HDs. PI, propidium iodide.

A

B

P Matarrese et al.


Figure 5. IDV is capable of hindering apoptosis associated with agents specifically influencing mitochondrial homeostasis

IFN-α 1000 IU

STS 1 nM

control IgM

JC-1

control IgM

+ α-Fas

+ α-Fas

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104102100

100

102

104

104102100

100

102

104

104102100

100

102

104

104102100

100

102

104

Annexin V/PI JC-1

Cytofluorimetric analysis of MMP (by JC-1) and of CD95-induced apoptosis (by annexin V/propidium iodide double staining) in PBL of a representative HD treatedwith 1000 IU IFN-α (A,C) or 1 nM STS (B,D) in the absence (A,B) or presence (C,D) of IDV. In the JC-1 dot plots, numbers in the boxed areas represent the percentagesof cells with hyperpolarized mitochondria, while in the area under the dashed line, the percentage of cells with depolarized mitochondria is reported. In annexinV/propidium iodide dot plots, numbers reported in the lower and upper right quadrants represent the percentages of annexin V single positive cells and annexinV/propidium iodide double positive cells, respectively. In (E) the analysis of CD95-induced apoptosis is reported as mean ±SD of the results obtained from fourdifferent HDs. Note that IDV was capable of significantly (P<0.01) preventing apoptosis either in INF-α- or in STS-treated lymphocytes. HD, healthy donors; IDV, indi-navir; IFN, interferon; IL2, interleukin 2; MMP, mitochondrial membrane potential; PBL, peripheral blood lymphocytes; STS, staurosporin.

A

B



Figure 5 continued

80

% a

popt

otic

cel

ls

70

60

50

40

30

20

IFN-α STS IFN-α/IDV STS/IDV

10

0

control IgM

α-Fas

IDV + IFN-α

IDV + STS

control IgM

control IgM

+ α-Fas

+ α-Fas

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104103102101100

100

101

102

103

104

104102100

100

102

104

104102100

100

102

104

104102100

100

102

104

104102100

100

102

104

C

D

E

P Matarrese et al.


Figure 6. IDV inhibits t-Bid-induced mitochondrial swelling

200

160

120

80

40

0104103102101

t-Bid M=89.4 control M=249.4

100

104103102101100

104103102101100

200

160

120

80

40

0

t-Bid M=165.4

IDV M=196.3

200

160

120

80coun

tco

unt

coun

t

40

0

t-Bid M=154.3FCCP M=171.4

MM

P

300

250

200

150

100

50

0

Contro

l

CaCL2 3

00 µMgp1

20

gp120+t-B

id

IDV+gp120

IDV+gp120+t-B

id

FCCP+gp1

20

FCCP+gp1

20+t-Bid

ng/m

l

454035302520151050

triton

X100

CaCL2 3

00 µMgp1

20

IDV+gp120

gp1

20+t-Bid

IDV+gp120+t-B

id

100

101

102

103

104

5 min 25 min0

TMRM

(FL3

)

time

100

101

102

103

104

5 min 25 min0

TMRM

(FL3

)

time

100

101

102

103

104

5 min 25 min0

TMRM

(FL3

)

time

Cytofluorimetric dot plots represent the profile of the mitochondrial swelling monitored by means of variations in TMRM fluorescence as a function of time in mito-chondria isolated from untreated lymphocytes. (A) Swelling was evaluated after treatment with t-Bid [histograms in (B) show the corresponding MMP values],(C) after treatment with IDV [histograms in (D) show the corresponding MMP values), or (E) with the uncoupler FCCP [histograms in (F) show the correspondingMMP values]. Results obtained in freshly isolated T lymphocytes from a representative HD are shown. (A,C,E) Numbers in grey areas in represent the percentage ofmitochondria that underwent MMP decrease. Note that i) t-Bid induced swelling in a high percentage (19.6%) of mitochondria of untreated lymphocytes [(A), greyarea], while ii) mitochondria derived from IDV- and FCCP-treated lymphocytes were significantly more resistant to t-Bid-induced swelling as shown by the percent-ages reported in grey areas of (B) and (C), and iii) parallel evaluations indicated the MMP loss induced by t-Bid (B) was counteracted by both IDV (D) and FCCP (F).(G) MMP mean values ±SD obtained by evaluating lymphocytes from three different healthy donors. Note the significant protection (P<0.001) exerted by both IDVand FCCP against t-Bid induced depolarization. Calcium chloride, able to induce MMP loss, represented a positive control. Gp120 was not able per se to induce mito-chondrial membrane depolarization. (H) Results obtained by evaluating CytC release from isolated mitochondria treated with gp120 are reported. Calcium chloride,used as positive control, as well as recombinant t-Bid were able to induce the release of a significant amount of CytC. Conversely, treatment with IDV significantly(P<0.001) decreased the amount of CytC released from isolated mitochondria. Gp120 was not able to induce CytC release per se. CytC, cytochrome c; IDV, indinavir;FCCP, carbonyl cyanide p-trifluoromethoxyphenyl hydrazone; MMP, mitochondrial membrane potential, TMRM, tetramethylrhodamine ester.

A B

C D

E F

G H

gp120-treated samples (Figure 6C; 5.4%, grey area). Infact, the median value of the TMRM fluorescencecurve obtained from mitochondria isolated from IDV-treated lymphocytes was only lightly modified (medianvalues reduced from 196.3 to 165.4, Figure 6D;control: plain black histogram; t-Bid: emptyhistogram). As a control for this series of experiments,we used the protonophore uncoupler carbonyl cyanidefluorophenyl-hydrazone (FCCP), known to be capableof hindering MMP loss at low concentrations [18,29].Interestingly, FCCP, similarly to IDV, significantlyprevented t-Bid-induced mitochondrial swelling (Figure6E, grey area) as well as the decrease of MMP asmeasured by TMRM fluorescence emission (Figure 6F;control: plain black histogram; t-Bid: emptyhistogram). Mean values ±SD obtained from three inde-pendent experiments are shown in Figure 6G. A signif-icant ‘protection’ exerted by both IDV and FCCPtowards MMP changes induced by t-Bid was detected.

We have also evaluated the ability of t-Bid to inducethe release of CytC from mitochondria purified fromhuman lymphocytes. The supernatants obtained fromgp120-treated mitochondria (swelling experiments),before any TMRM staining, were analysed by means ofELISA methodology. Figure 6H shows i) as expected,calcium chloride 300 µM, used as positive control,induced the release of a significant amount of CytC;ii) recombinant t-Bid also induced CytC release,although in a minor extent; and iii) either IDV or a‘baby dose’ of the FCCP compound (not shown),significantly (P<0.01) decreased the amount of CytCreleased from isolated mitochondria.

These data suggest that IDV could act similarly toFCCP given at low concentration, that is, via amitochondrial uncoupler-like activity. A family ofendogenous uncoupling proteins are normallydetectable in the inner mitochondrial membrane ofdifferent tissues. These are called uncoupler proteins(UCPs) and are able to regulate cell energy and mito-chondrial membrane potential ‘protecting’ cells fromROI production and apoptosis [30,31]. On the basis ofthese considerations, an analysis of the expression ofUCP-2 (an ubiquitously expressed UCP isoform) wasthus performed either by flow cytometry or by Westernblotting (WB) analyses.

The results obtained clearly indicated an IDV-dependent down-regulation of UCP-2 protein ingp120-activated T cells (Figure 7A, empty greyhistogram) with respect to gp-120-activated controlcells (Figure 7A, empty black histogram; UCP-2 expres-sion in resting T cells is shown as a plain histogram).Statistical analyses of these data by K/S tests also indi-cated that this IDV-induced UCP-2 decrease was highlysignificant (Figure 7A, right panels). Mean values ±SDobtained on T cells from four different HDs are

reported in Figure 7B. These results show a clear-cutdose–effect response of IDV in gp-120-activatedlymphocytes. In fact, a increased down-regulation ofUCP-2 expression was detectable with increasing IDVconcentrations. Notably, as expected [18], no effect ofIDV was found in resting T cells. These results wereconfirmed by WB analyses, as demonstrated by the useof increasing doses of IDV, that is, 0.1, 1 and 10 µM(see densitometric measurements in Figure 7C).

Discussion

Freshly isolated lymphocytes represent a peculiarmodel for studying apoptotic cell death. In fact, restingT cells have been considered as apoptotic-resistant cells[32]. By contrast, once activated, for example, by IL-2and PHA, they become susceptible to different pro-apoptotic stimuli, including the CD95/Fas ‘physiolog-ical’ receptor triggering. Interestingly, among variouschanges occurring in activated T cells, two of them aregathered the attention of immunologists involved in thestudy of immune system homeostasis: cell polarization(the migration of organelles and surface molecules atone pole of the cell) and an early mitochondrial changedetectable by different flow cytometry methods – anincrease of MMP (a mitochondrial hyperpolarization)[21,33]. In this context, several studies have beencarried out as regards the activity of HIV PIs. Thesecompounds have been demonstrated to impair apop-tosis, improving T cell survival and to act indepen-dently from the presence of HIV particles inside T cells.The ability of various PIs to lead to the so-calledimmune reconstitution has in turn stimulated aplethora of experimental studies aimed at the compre-hension of their mechanisms of action. In these studies,PIs have been demonstrated to be able to hinder apop-tosis via a target effect on mitochondria [7,18]. Inparticular, the mitochondrial hyperpolarization state asdetectable in T lymphocytes following activation withIL-2/PHA administration, was suggested to represent aprerequisite for apoptotic susceptibility of T cells andwas found to be inhibited by PI treatments [18].Accordingly, in the present work, we shepherd throughthe mechanisms underlying this peculiar effect exertedby PIs by using a model system that, in our opinion,could be of great relevance in AIDS pathogenesisstudies, that is, gp120-treated, freshly isolated humanT lymphocytes. Engagingly, the administration of HIVenvelope protein gp120, which is responsible forHIV–host cell interaction and detectable in the blood ofHIV-infected patients, was capable of inducing a seriesof changes. Namely, gp120 induces a significantincrease of some activation markers and overexpres-sion of CD95/Fas; organelle, cytoskeletal componentsand surface molecule polarization; mitochondrial



P Matarrese et al.


Figure 7. IDV decreases UCP-2 expression in gp120-treated T lymphocytes

104103102

Channels101

K/S analysisresting vs gp120

D=0.09p>0.05

100

% e

vent

s%

eve

nts

200

0

40

80

120

160

104103102101

negativecontrol M=3.6

gp120 M=64.1

IDV 100 nM+GP120 M=51.4

resting M=68.2

100

UCP

-2 e

xpre

ssio

n(a

rbita

ry u

nits

)

90

75

60

45

30control IDV 100 nM IDV 1 µM IDV 10 µM

resting

gp120-activated

cell

coun

t

UCP-2 expression

100

60

80

40

20

0

100

60

80

40

20

0

104103102

Channels101

K/S analysisresting vs IDV+

gp120D=00.81p>0.001

100

AU 0.82

gp12

0gp

120/I

DV 100 n

M

gp12

0/IDV 1

µM

gp12

0/IDV 10

µM

0.64 0.51 0.16

UCP-2

(A) Quantitative flow cytometry analysis of UCP-2 protein expression in gp120-activated lymphocytes treated with IDV in comparison with resting untreatedlymphocytes. Note UCP-2 down-regulation detectable after IDV treatment (grey curve). Statistical analyses (K/S test) indicated that IDV significantly (P<0.01)decreased UCP-2 expression in gp120-activated cells only, whilst resting lymphocytes remained unaffected (right hand panels). Numbers reported indicate themedian values of fluorescence intensity histograms obtained in T lymphocytes isolated from a representative HD. (B) Semiquantitative flow cytometry analysis ofUCP-2 expression in both resting and gp120-activated lymphocytes treated with different doses of IDV. Results are shown as means ±SD of the data obtained fromsix different HDs. Note the dose-dependent decrease of the UCP-2 protein. (C) Western blotting analysis of UCP-2 protein shows an IDV-induced dose-dependentdecrease of UCP-2 expression in gp120-activated lymphocytes. Densitometric analyses confirmed the dose dependent activity of IDV. These results are expressed inarbitrary units (AU). IDV, indinavir; UCP-2, uncoupler protein 2.

A

B

C

ultrastructural changes and hyperpolarization; and anincreased apoptotic susceptibility. Conversely, the pres-ence of PIs, particularly IDV, was irrelevant withregards to cell surface molecule overexpression,including that of CD95/Fas, while it significantlyreduced cell polarization state and also blocked bothMMP changes and apoptosis. Hence, PIs do not act bydown-regulating cell surface molecules of importancein apoptotic triggering, that is, CD95/Fas, but,conversely, they specifically act by impairing cellmorphogenetic changes influencing apoptotic prone-ness and blocking MMP increase. The importance ofcell re-modeling, that is, uropod formation and cellpolarization, as well as of mitochondrial ‘stabilization’,that is, the blockade of hyperpolarization state, waspreviously described in other in vitro and ex vivosystems [18,34,35]. Hence, our results clearly indicatethat HIV-gp120 may act as a sort of ‘booster’ of T cellalterations associated with the ‘activation’ of apoptoticmachinery and that PIs can lead to apoptosis hinderingvia a specific inhibitory effect on cell polarization andmaintenance of mitochondrial homeostasis. In consid-eration of the role of apoptosis occurring in bystandercells of HIV-infected patients and of its role in the onsetof immunodeficiency, our data seem to partiallyexplain the possible mechanisms underlying the benefi-cial effects of HAART. They support, in fact, theconcept that the immune reconstitution detected invivo after PI exposure could also be due to a protectiveactivity of these drugs against gp120-induced apoptosissensitization of bystander cells. More generally, theseresults seem also to provide further evidence for a reap-praisal of PIs in the clinical management of humanimmune deficiencies other than AIDS.

Data herein reported also indicate some importantnew findings regarding the target effects of these drugs.One is represented by the ability of PIs to act byimpairing reactive oxygen species formation detectableafter gp120 administration. Hence, in consideration ofthe key role played by the redox imbalance in apoptoticcell death program [22], these results allow us tohypothesize that the IDV-induced cell survival can bethe outcome of a sort of antioxidant activity exerted byPIs. It is in fact well known that mitochondria are themajor source of free radical species originated duringthe execution phases of apoptotic cell death. On thesebasis, we cannot rule out the possibility that PIs, byacting as ‘quenching’ agents, could contribute to main-taining the intracellular redox balance via their targetactivity on mitochondria, that is, via unexpectedantioxidant properties. These hypotheses seem to beconfirmed by the protective role of PIs towards apop-tosis in model systems alternative to gp120-inducedapoptosis sensitization. In fact, T cell treatment withnon-cytotoxic doses of IFN-α or STS, both considered

as ‘mitochondriotropic’ agents [23,36], lead to anincreased apoptotic proneness, which was significantlycounteracted by IDV. Hence, an immunoregulatorycytokine such as IFN-α as well as a drug, such as STS,directly acting on mitochondrial homeostasis, wereboth capable of sensitizing T cells to Fas-mediatedapoptosis. Thus, the target activity of PIs to mitochon-dria could be responsible for their protective effects inthe maintenance of mitochondrial homeostasis and, asa consequence, in the inhibition of T cell apoptosis. Inconsideration of the importance of IFNs in infectiousdiseases, these results also point to PIs as useful phar-macological modulators in a number of human innateand acquired immune diseases.

Some interesting considerations derive from theanalyses of the results obtained by low concentrationsof the protonophore uncoupler FCCP. High concentra-tions of this compound were demonstrated to induceapoptosis in tumour cell lines [37]. In contrast, verylow doses of FCCP could protect human T cells fromCD95-induced apoptosis [38]. Our results emphasizedthat PIs and FCCP show impressive similarities in theirmitochondrial effects. In fact, the results obtained inisolated mitochondria have shown the ability of bothdrugs to ‘stabilize’ MMP after t-Bid administration.The truncated form of the Bid molecule was in factconsidered as a pro-apoptotic signalling moleculereaching mitochondria after CD95/Fas stimulation. Apartial confirmation of the above hypothesis wasfurther offered by the PI-induced down-modulation ofUCP-2 mitochondrial protein. This can reinforce theidea that mitochondria represent specific targets of PIsand also favour the intriguing hypothesis that PIs, forexample, IDV, could exert a uncoupler-like activity,minimizing mitochondrial hyperpolarization occurringin the early phases of apoptosis. In fact, the mecha-nisms implicated in the maintenance of mitochondrialhomeostasis and redox balance involve the couplingactivity of the respiratory chain and are physiologicallyregulated by UCPs. The decreased UCP expression inthe presence of PIs could also represent indirectevidence for a peculiar role of PIs that, vicariating UCPactivity in activated lymphocytes, might sustain mito-chondrial homeostasis impairing mitochondrial hyper-polarization, reduce redox imbalance and, later, inhibit∆Ψ loss. In addition, UCPs seem to play an importantrole also in some pathophysiological states [39]including obesity, insulin resistance [40] and athero-sclerosis [41]. Finally, it is well known that UCPs alsoplay a pivotal role in regulating the energy metabolismalso in the adipose tissue, where UCPs have beenisolated for the first time [42,43]. Thus, on the basis ofthe well-known adverse effects associated withHAART, that is, lipodystrophy, atherosclerosis anddiabetes, the present results on the modulatory activity



exerted by PIs on UCP molecule expression would alsostimulate further studies on the pathogenetic mechanismunderlying HAART-associated disease contributing, inthe long run, to a refining of the therapeutic strategies.

Acknowledgements

The authors thank Professor Antonio Cassone for crit-ical reading of the manuscript. Supported by AIDSproject 30F1 to WM.

References1. Gougeon ML & Montagnier L. Programmed cell death as a

mechanism of CD4 and CD8 T cell deletion in AIDS.Molecular control and effect of highly active anti-retroviraltherapy. Annals of the New York Academy of Sciences1999; 887:199–212.

2. Roshal M, Zhu Y & Plannells V. Apoptosis in AIDS.Apoptosis 2001; 6:103–116.

3. Hengartner MO. The biochemistry of apoptosis. Nature2000; 407:770–776.

4. Schmitz I, Walczak H, Krammer PH & Peter ME.Differences between CD95 type I and type II cells detectedwith the CD95 ligand. Cell Death & Differentiation 1999;6:821–822.

5. Banki K, Hutters E, Gonchoroff NJ & Perl A. Molecularordering in HIV-induced apoptosis. Journal of BiologicalChemistry 1998; 273:11944–11953.

6. Petit F, Arnoult D, Lelievre JD, Moutouh-de Parseval L,Hance AJ, Schneider P, Corbeil J, Ameisen JC & EstaquierJ. Productive HIV-1 infection of primary CD4+ T cellsinduces mitochondrial membrane permeabilization leadingto a caspase-independent cell death. Journal of BiologicalChemistry 2002; 277:1477–1487.

7. Phenix BN, Angel JB, Mandy F, Kravcik S, Parato K,Chambers KA, Gallicano K, Hawley-Foss N, Cassol S,Cameron DW & Badley AD. Decreased HIV-associated Tcell apoptosis by HIV protease inhibitors. AIDS Research& Human Retroviruses 2000; 16:559–567.

8. Viora M, Di Genova G, Rivabene R, Malorni W &Fattorossi A. Interference with cell cycle progression andinduction of apoptosis by dideoxynucleoside analogs.International Journal of Immunopharmacology 1997;19:311–321.

9. Chavan SJ, Tamma SL, Kaplan M, Gersten M & PahwaSG. Reduction in T cell apoptosis in patients with HIVdisease following antiretroviral therapy. ClinicalImmunology 1999; 93:24–33.

10. Lu W & Andrieu JM. HIV protease inhibitors restoreimpaired T-cell proliferative response in vivo and in vitro: aviral-suppression-independent mechanism. Blood 2000;96:250–258.

11. Phenix BN, Lum JJ, Nie Z, Sanchez-Dardon J & BadleyAD. Antiapoptotic mechanism of HIV protease inhibitors:preventing mitochondrial transmembrane potential loss.Blood 2001; 98:1078–1085.

12. Estaquier J, Lelievre JD, Petit F, Brunner T, Moutouh-DeParseval L, Richman DD, Ameisen JC & Corbeil J. Effectsof antiretroviral drugs on human immunodeficiency virustype 1-induced CD4(+) T-cell death. Journal of Virology2002; 76:5966–5973.

13. Airò P, Torti C, Uccelli MC, Malacarne F, Palvarini L,Carosi G & Castelli F. Naive CD4+ T lymphocytes expresshigh levels of Bcl-2 after highly active antiretroviral therapyfor HIV infection. AIDS Research & Human Retroviruses2000; 16:1805–1807.

14. Conti L, Rainaldi G, Matarrese P, Varano B, Rivabene R,Columba S, Sato A, Belardelli F & Gessani S. The HIV-1

protein acts as a negative regulator of apoptosis in ahuman lymphoblastoid cell line: possible implications forthe pathogenesis of AIDS. Journal of ExperimentalMedicine 1998; 187:403–413.

15. Cossarizza A, Franceschi C, Monti D, Salvioli S, Bellesia E,Rivabene R, Biondo L, Rainaldi G, Tinari A & Malorni W.Protective effect of N-acetylcysteine in tumor necrosisfactor-alpha-induced apoptosis in U937 cells: the role ofmitochondria. Experimental Cell Research 1995;220:232–240.

16. Parlato S, Giammarioli AM, Logozzi M, Lozupone F,Matarrese P, Luciani F, Falchi M, Malorni W & Fais S.CD95 (APO-1/Fas) linkage to the actin cytoskeletonthrough ezrin in human T lymphocytes: a novel regulatorymechanism of the CD95 apoptotic pathway. EMBOJournal 2000; 19:5123–5134.

17. Zamzami N, Maisse C, Metivier D & Kroemer G.Measurement of membrane permeability and permeabilitytransition of mitochondria. Methods in Cell Biology 2001;65:147–158.

18. Matarrese P, Gambardella L, Cassone A, Vella S, Cauda R& Malorni W. Mitochondrial membrane hyperpolarizationhijacks activated T lymphocytes toward the apoptotic-prone phenotype: homeostatic mechanisms of HIV proteaseinhibitors. Journal of Immunology 2003; 170:6006–6015.

19. Luciani F, Matarrese P, Giammarioli AM, Lugini L,Lozupone F, Federici C, Iessi E, Malorni W & Fais S.CD95/phosphorylated ezrin association underlies HIV-1GP120/IL-2-induced susceptibility to CD95(APO-1/Fas)-mediated apoptosis of human resting CD4(+)Tlymphocytes. Cell & Death Differentiation 2004;11:574–582.

20. Matarrese P, Cauda R & Malorni W. Activation-associatedmitochondrial hyperpolarization hijacks T cells toward anapoptosis-sensitized phenotype. Cell & DeathDifferentiation 2003; 10:609–611.

21. Banki K, Hutter E, Gonchoroff NJ & Perl A. Elevation ofmitochondrial transmembrane potential and reactiveoxygen intermediate levels are early events and occur inde-pendently from activation of caspases in Fas signalling.Journal of Immunology 1999; 162:1466–1479.

22. Perl A, Gergely P Jr, Puskas F & Banki K. Metabolicswitches of T-cell activation and apoptosis. Antioxidants &Redox Signaling 2002; 4:427–443.

23. Perl A, Gergely P Jr, Nagy G, Koncz A & Banki K.Mitochondrial hyperpolarization: a checkpoint of T-celllife, death and autoimmunity. Trends in Immunology 2004;25:360–367.

24. Puskas F, Gergely P, Niland B, Banki K & Perl A.Differential regulation of hydrogen peroxide and Fas-dependent apoptosis pathways by dehydroascorbate, theoxidized form of vitamin C. Antioxidants & RedoxSignaling 2002; 4:357–369.

25. Sato T, Machida T, Takahashi S, Iyama S, Sato Y,Kuribayashi K, Takada K, Oku T, Kawano Y, Okamoto T,Takimoto R, Matsunaga T, Takayama T, Takahashi M,Kato J & Niitsu Y. Fas-mediated apoptosome formation isdependent on reactive oxygen species derived from mito-chondrial permeability transition in Jurkat cells. Journal ofImmunology 2004; 173:285–296.

26. Matarrese P, Di Biase L, Santodonato L, Straface E,Mecchia M, Ascione B, Parmiani G, Belardelli F, FerrantiniM & Malorni W. Type I interferon gene transfer sensitizesmelanoma cells to apoptosis via a target activity on mito-chondrial function. American Journal of Pathology 2002;160:1507–1520.

27. Wang GQ, Gastman BR, Wieckowski E, Goldstein LA,Rabinovitz A, Yin XM & Rabinowich H. Apoptosis-resistant mitochondria in T cells selected for resistance toFas signaling. Journal of Biological Chemistry 2001;276:3610–3619.

28. Wei MC, Zong WX, Cheng EH, Lindsten T, Panoutsakop-oulou V, Ross AJ, Roth KA, MacGregor GR, ThompsonCB & Korsmeyer SJ. Proapoptotic BAX and BAK: a requi-

P Matarrese et al.


site gateway to mitochondrial dysfunction and death.Science 2001; 292:727–730.

29. Giovannini C, Matarrese P, Scazzocchio B, Sanchez M,Masella R & Malorni W. Mitochondria hyperpolarizationis an early event in oxidized low-density lipoprotein-induced apoptosis in Caco-2 intestinal cells. FEBS Letters2002; 523:200–206.

30. Skulachev VP. Uncoupling: new approaches to an oldproblem of bioenergetics. Biochimica & Biophysica Acta1998; 1363:100–124.

31. Kagawa Y, Cha SH, Hasegawa K, Hamamoto T & EndoH. Regulation of energy metabolism in human cells inaging and diabetes: FoF(1), mtDNA, UCP, and ROS.Biochemical & Biophysical Research Communications1999; 266:662–676.

32. Roberts AI, Devadas S, Zhang X, Zhang L, Keegan A,Greeneltch K, Solomon J, Wei L, Das J, Sun E, Liu C, YuanZ, Zhou JN & Shi Y. The role of activation-induced celldeath in the differentiation of T-helper-cell subsets.Immunologic Research 2003; 28:285–293.

33. Matarrese P, Testa U, Cauda R, Vella S, Gambardella L &Malorni W. Expression of P-170 glycoprotein sensitizeslymphoblastoid CEM cells to mitochondria-mediated apop-tosis. Biochemical Journal 2001; 355:587–595.

34. Perl A, Nagy G, Gergely P, Puskas F, Qian Y & Banki K.Apoptosis and mitochondrial dysfunction in lymphocytesof patients with systemic lupus erythematosus. Methods inMolecular Medicine 2004; 102:87–114.

35. Matarrese P, Tinari A, Mormone E, Bianco GA, ToscanoMA, Ascione B, Rabinovich GA & Malorni W. Galectin-1sensitizes resting human T lymphocytes to Fas (CD95)-mediated cell death via mitochondrial hyperpolarization,budding and fission. Journal of Biological Chemistry 2004;280:6969–6985.

36. Carrozzo R, Rizza T, Stringaro A, Pierini R, Mormone E,Santorelli FM, Malorni W & Matarrese P. Maternally-inherited Leigh syndrome-related mutations bolstermitochondrial-mediated apoptosis. Journal ofNeurochemistry 2004; 90:490–501.

37. Aronis A, Melendez JA, Golan O, Shilo S, Dicter N &Tirosh O. Potentiation of Fas-mediated apoptosis by atten-uated production of mitochondria-derived reactive oxygenspecies. Cell Death & Differentiation 2003; 10:335–344.

38. Stoetzer OJ, Pogrebniak A, Pelka-Fleischer R, Hasmann M,Hiddemann W & Nuessler V. Modulation of apoptosis bymitochondrial uncouplers: apoptosis-delaying featuresdespite intrinsic cytotoxicity. Biochemical Pharmacology2002; 63:471–483.

39. Argiles JM, Busquets S & Lopez-Soriano FJ. The role ofuncoupling proteins in pathophysiological states.Biochemical & Biophysical Research Communications2002; 293:1145–1152.

40. Lameloise N, Muzzin P, Prentki M & Assimacopoulos-Jeannet F. Uncoupling protein 2: a possible link betweenfatty acid excess and impaired glucose-induced insulinsecretion? Diabetes 2001; 50:803–809.

41. Blanc J, Alves-Guerra MC, Esposito B, Rousset S, GourdyP, Ricquier D, Tedgui A, Miroux B & Mallat Z. Protectiverole of uncoupling protein 2 in atherosclerosis. Circulation2003; 107:388–390.

42. Garlid KD, Jaburek M, Jezek P & Varecha M. How douncoupling proteins uncouple? Biochimica & BiophysicaActa 2000; 459:383–389.

43. Garlid KD, Jaburek M & Jezek P. Mechanism of uncou-pling protein action. Biochemical Society Transactions2001; 29:803–806.



Received 10 January 2005, accepted 23 March 2005



Mechanisms of HIV and nucleoside reversetranscriptase inhibitor injury to mitochondriaGraeme Moyle

St Stephens HIV Research, Chelsea and Westminster Hospital, London, UK

Tel: 020 8746 8000; Fax: 020 8746 6188 E-mail: [email protected]

Mitochondria perform a range of biological functionsand carry a number of factors involved in cell apop-tosis. In particular, mitochondria are the key organellesin energy production in all human cells except erythro-cytes. Energy, in the form of ATP, is produced throughthe oxidative phosphorylation pathway. HIV and otherinfectious agents as well as some nucleoside/nucleotidereverse transcriptase inhibitors (NRTIs) are known toaffect mitochondrial (mt) function. A number ofimportant clinical events occurring in individuals withHIV infection and on antiretroviral therapy (ART)have been linked to mt injury and dysfunction.

In vitro studies have demonstrated that NRTIs maydiffer in their effects on mitochondria and may affectmitochondria in different cell lines in different ways.This is likely to influence the clinical syndromes asso-ciated with toxicity to these agents. Dideoxy-NRTIs(d-NRTIs) have the greatest affinity for mtDNA poly-merase-γ [1], the enzyme responsible for mtDNA repli-cation, whereas other nucleoside analogues mayinfluence mt function through other mechanisms. Thesedifferences may be important when choosing techniquesto evaluate the impact of antiretroviral agents on mito-chondria.

Clinical toxicities with a possible mt aetiology

A wide range of adverse events occurring in individualswith HIV infection, particularly those receiving NRTI-based therapy, have been suggested as relating todiminished mt function. The development programs ofzidovudine (AZT), didanosine, zalcitabine and stavu-dine have all required dose de-escalations due to toxic-ities thought to be related to drug impact onmitochondria. Due to limitations in measurement tech-nology, clinical studies of NRTIs, while collectingadverse event data, have not specifically evaluated mttoxicity in a systematic way.

Lactic acidosis is the event that establishes proofthat clinically important mt toxicity occurs in individ-uals receiving NRTIs, although causation is not neces-sarily established by this observation. For lacticacidosis to occur, the mt oxidative phosphorylationsystem, which normally removes H+ generated by thehydrolysis of ATP and the conversion of glucose-6-phosphate to pyruvate, must be dysfunctional (Figure1). Lactic acidosis in the critical care setting has a rangeof causes and these are not always reliably excluded inreports of individuals with HIV on ART who developlactic acidosis. Not surprising, lactic acidosis has alsobeen reported in individuals with HIV not currentlyreceiving ART [2].

Other NRTI-associated adverse events where theweight of evidence favours mt injury include peripheralneuropathy, myopathy and hepatic steatosis. However,multiple aetiologies for these adverse events exist andshould be routinely sought in individuals presentingwith these effects. Other adverse effects observedduring ART that may represent manifestations of, orbe contributed to by mt toxicity include hypogo-nadism, pancreatitis, diabetes mellitus, proximal renaltubular dysfunction, anaemia and neutropaenia, andperipheral fat atrophy [3].

Manifestations of NRTI-related mt toxicity in adultsdo not commonly involve the brain, the organ mostcommonly affected in inherited mt disorders. Thepossibility of CNS mt toxicity arising in infants after inutero exposure to NRTIs has been raised in reportsfrom France [4,5] but has not been found in a largeretrospective analysis in the USA [6]. Certainly, anextremely high incidence of hyperlactataemia in infantsafter in utero NRTI (mainly AZT plus lamivudine)exposure has been reported [7,8], suggesting mtdysfunction may be common in infants exposed tonucleoside analogues in utero, possibly due to differen-tial effects of NRTIs during ontogeny. Additionally,

Introduction

reports of a high rate of nuclear DNA (nDNA) muta-tion (genotoxicity) have been reported in childrenexposed to AZT in utero [9], underlining that DNAdamage may not be localized to the mitochondria.

Familial and drug-related mt disorders

Familial or inherited mt diseases are well-recognized inmedicine, particularly in paediatrics, neurology andhepatology [10–14]. Mutation in either mtDNA ornDNA may lead to disorders of mt function.

Drugs that may impact the mitochondria also tendto lead to adverse effects in the most metabolicallyactive tissues, with the brain (for example, valproate,lead, alcohol), other nerves (aminoglycosides, alcohol),heart (anthracyclines, amiodarone, alcohol) and liver(valproate, aspirin, alcohol) all involved, with lacticacidosis occasionally seen (phenformin, metformin,alcohol).

For clinical disease to be present in familial cases,depletion of functional mtDNA to <80% of normal isrequired [10–14]. This is usually assessed by evaluating

the proportion of mutant versus functional mtDNApresent. In the HIV setting, as with many other drugs,this assessment may not be appropriate as, while somedrugs (mainly the d-NRTIs) may predominately affectmtDNA content (by inhibition of DNA polymerase-γ),others (most notably AZT) may effect mt enzymes orother nuclear gene expression [15–19].

The impact of HIV infection on mitochondria

In patients with untreated HIV, samples from a rangeof tissues have been observed to have diminishedmtDNA relative to age-matched uninfected individuals[20–24]. Muscle and nerve biopsies from untreatedindividuals presenting with HIV-associated myopathy[22] or distal symmetrical peripheral neuropathy mayhave low mtDNA, abnormalities in mt ultrastructureor respiratory chain abnormalities [22]. These changesare similar to those reported with NRTI therapy invitro, animal and human nerves and muscle cells.Declines in mtDNA in adipose tissue of untreated indi-viduals have also been described [20,22–25]. Changesin the mtDNA:nDNA ratio in peripheral bloodmononuclear cells (PBMCs) (derived from buffy coat)were proportionally more pronounced when comparingHIV-negative controls to HIV-infected individuals (a44% reduction) relative to the addition of antiretrovi-rals (a further 24% decline) [20]. Thus, reductions inmtDNA can occur with HIV infection alone and thesechanges may precede the use of NRTI therapy or symp-toms. Indeed, mtDNA in PBMCs may rise following theinitiation of effective therapy [24], even when thattherapy includes agents known to inhibit DNA poly-merase-γ. Changes in mtDNA content or mitochondriaultrastructure in NRTI-treated individuals, with orwithout clinical disease, are generally greater than inuntreated individuals.

These data raise the possibility that HIV maydirectly (or via cytokines released in response to HIVinfection or immune reconstitution) injure mitochon-dria, potentially making them more vulnerable to theeffects of NRTIs.

Several HIV gene products, most notably tat andviral protein R (vpr), have been demonstrated todecrease or damage mitochondria and cause clinicaldisease in vitro or in animal models. For example,expression of TAT may lead to cardiomyopathy withmt destruction in mice [26]. The vpr directly affects themt permeability transition pore and may trigger cellapoptosis through a mt pathway independent ofcaspase [27]. The HIV-1 protease may also process pro-caspase to cause mt release of cytochrome c triggeringapoptosis [28].

As muscle, nerve or fat cells may not be infectable byHIV, cytokines may represent the key mediator of

G Moyle


Figure 1. (A) L-Lactic acid synthesis: lactic acid accumulatesif pyruvate or NADH accumulates. (B) DCA effects: DCAactivates PDH, favouring lactate oxidation

G6P, glucose-6-phosphate; DCA, dichloroacetate; LDH, lactate dehydrogenase;PDH, pyruvate dehydrogenase. From Luft FC. Lactic acidosis update for criticalcare clinicians. Journal of the American Society of Nephrology 2001;12:S15–S19.

Glycogen

G6P Glucose

Glucose

Protein

Amino acids

Urea

LDH NAD+

Lactate + H+ Pyruvate + H+

Pyruvate

Activated by DCA

Lactate Acetyl-CoA

O2, ADP

ATP

PDH

Fatty acids

+ +

NADH + H+

A

B

injury. Tumour necrosis factor (TNF)-α triggersapoptosis through targeting mitochondria [29] and mayreduce mtDNA number and quality [30]. It has beenimplicated in liver injury from alcohol [31], particularlycontributing to steatohepatitis, a condition reflective ofdiminished mt beta-oxidation of fatty acids [32,33].TNF-α and interferon (IFN)-γ also inhibit mt respira-tion in smooth muscle and other cells [34]. IFN-α is apro-apoptotic cytokine whose effects are mediatedthrough mt cytochrome c release and impaired mtDNAtranscription. TNF-α and IFN-α are elevated inuntreated HIV infection [35,36] but may decline withtherapy [37] although subsets of CD8 lymphocyteshighly productive of TNF-α may persist [38].

Several studies have suggested associations betweenelevations of TNF-α or soluble TNF-α receptor type IIand dyslipidaemia, insulin resistance and/or fat atrophy[39–42], a condition associated with some degree ofmtDNA reduction in fat cells [23,26]. IFN-α has alsobeen linked with lipoatrophy [43].

Thus, mt changes observed in a range of tissues fromindividuals with HIV infection may represent theconsequences of cytokines and HIV gene productsproduced during HIV infection, and indicate thatchanges in mt appearance and mtDNA content may tosome extent predate in the introduction of NRTItherapy. Therefore, individuals with HIV infection maybe at increased risk of mt toxicity once NRTIs areintroduced than may be expected from studies in vitro,in animals or in human volunteers.

Effects of NRTIs on mitochondria

The most prevalent theory regarding the effects ofNRTIs on mitochondria is that these agents act ascompetitive inhibitors of DNA polymerase-γ, theenzyme responsible for copying mtDNA. The d-NRTIs,zalcitabine (ddC), didanosine (ddI) and stavudine(d4T), have the greatest affinity for this enzyme [1].Inhibition of polymerase-γ is likely to lead to decline inquantity and, most likely, quality of mtDNA and even-tually trigger a cellular energy crisis.

With regards to peripheral neuropathy and the dose-limiting toxicity of the d-NRTIs, the weight of evidenceindicates that this is indeed a mt toxicity with mtDNAdecline. Using an in vitro model of nerve cells, ddC andddI have been shown to reduce mtDNA, leading todestruction of mitochondria and an increase in intra-cellular lactate levels [44]. Nerve biopsies from patientswith NRTI-associated neuropathy have showabnormal mitochondria with enlarged size, excessivevacuolization, electron-dense concentric inclusions anddegenerative myelin structures. Abnormal mitochon-dria represented the majority (55% vs 9% in controls)of nerve cell mitochondria in biopsies from individuals

with ddC-related neuropathy and mtDNA was reducedby as much as 80% compared with the controls [45].This degree of mtDNA depletion is consistent with lossof functional mtDNA observed in familial mt disor-ders and hence is consistent with causation.Mitochondrial changes are also found in nerves ofuntreated individuals presenting with HIV-relatedperipheral neuropathy [46], hence neuropathy in indi-viduals on therapy may in some cases represent anunmasking or exacerbation of a pre-existent mtneuropathy.

However, with myopathy, a probable mt toxicityassociated with AZT therapy, the effects on mtDNAmass are less evident. As with neuropathy, specificchanges in muscle mitochondria have been observed inclinical biopsy samples and in animal or in vitromodels. Effects have been demonstrated in bothskeletal and cardiac muscle [47]. Histological featuressuggested to be distinguishing include ragged-red fibresand abnormal mitochondria with paracrystalline inclu-sions [48,49], although similar mt abnormalities havealso been reported in therapy-naive individuals withHIV-related myopathy [22,50]. Tissue-specificitystudies with AZT have demonstrated that this drug hasgreater impact on muscle cells, compared with kidneyor liver cells, and may involve inhibition of succinatetransport or cytochrome oxidase activity, reduction incarnitine, oxidative damage to mitochondria anddestruction of myotubes rather than reduction inmtDNA [47,51–55]. Thus, myopathy (and presumablyother toxicity events) with AZT may relate to thisagent’s impact on mt enzyme systems rather than onDNA polymerase-γ. Other studies have found thatAZT may affect a range of mt functions includingstrongly inhibiting the ADP/ATP antiport in a compet-itive manner [17], and adenylate kinase [18].

These differences in mechanism of toxicity withAZT relative to d-NRTIs probably relates to the obser-vation that some of its cytological and mt toxicities aremediated through its intermediate metabolite AZT-monophosphate rather than the triphosphate metabo-lites responsible for the toxicity (and activity) of otherNRTIs [56]. This has important implications whenassessing ways in which drug impact on mitochondriais measured, as standard measures of mtDNA contentare likely to underestimate the effects of AZT on mtfunction.

More recently, a further mechanism by which AZTmay cause mt toxicity has been evidenced. In non-mitotic cells, AZT inhibits thymidine phosphorylationby thymidine kinase (TK) type 2, the TK expressed inmitochondria. TK2 is the only constitutively expressedTK in non-mitotic cells. The reduced supply of thenatural thymide triphosphate (TTP) leads to limitedmtDNA replication and subsequent mtDNA depletion


Mitochondria and NRTIs

[57]. As d4T is a much poorer substrate of TK2 thanAZT, but a more potent inhibitor of polymerase-γ, it isunlikely that this mechanism is critical to d4T toxicity[58]. In vitro studies indicate that lactic acid produc-tion begins in AZT-treated cells before the decline inmtDNA, whereas declines in mtDNA coincide withlactic acid production increases in d-NRTI-treated cells[59]. In vivo, the rate of mtDNA reductions over timeappear somewhat slower and may be less severe in TK-dependent cells (such as adipocytes) with AZT thanwith d4T [25,60,61], an issue that may be linked to thedifferent modes of toxicity.

Summary

Available evidence suggests that a number of importantclinical events in individuals with HIV infection arerelated to mt dysfunction. Several factors maycontribute to the development of these events and thetissue(s) in which the event occurs. Some individualsare likely to have important genetic predispositions formt disease, which may be unmasked by the presence ofHIV infection or the introduction of NRTI antiretrovi-rals. HIV infection per se is associated with reductionin mtDNA content and changes in mt morphology andfunction, which in some cases leads to clinical eventssuch as myopathy or peripheral neuropathy. NRTIantiretrovirals may impact mtDNA content and func-tion through a number of different mechanisms andhave been demonstrated to be causative of a number ofclinical toxicities. In in vitro and in clinical studies,newer nucleoside and nucleotides agents such aslamivudine, emtricitabine, abacavir and tenofovirappear to be much weaker inhibitors of mtDNA poly-merase-γ or other mt functions, and appear to be asso-ciated with a lower risk of events thought to be relatedto mt toxicity.

Simple, non-invasive tests for mt function are notavailable at present in the clinical routine, and assays ofmtDNA content in blood cells may miss key aspects ofmt function, require careful sample handling and maynot reflect events occurring in other tissues. Thereremains a need for the development of rapid, cheap andclinically applicable assays that would enable theprediction of increased likelihood of mt events.

References1. Martin JL, Brown CE, Matthews-Davis N & Reardon JE.

Effects of antiviral nucleoside analogs on human DNA poly-merases and mitochondrial DNA synthesis. AntimicrobialAgents & Chemotherapy 1994; 38:2743–2749.

2. John M, Moore CB, James IR, Nolan D, Upton RP,McKinnon EJ & Mallal SA. Chronic hyperlactatemia inHIV-infected patients taking antiretroviral therapy. AIDS2001; 15:717–723.

3. Brinkman K, Hofsted HJ, Burger DM, Smeitink JAM &Koopmans PP. Adverse effects of reverse transcriptase

inhibitors: mitochondrial toxicity as common pathway.AIDS 1998; 12:1735–1744.

4. Blanche S, Tardieu M, Rustin P, Slama A, Barret B, FirtionG, Ciraru-Vigneron N, Lacroix C, Rouzioux C,Mandelbrot L, Desguerre I, Rotig A, Mayaux MJ &Delfraissy JF. Persistent mitochondrial dysfunction andperinatal exposure to antiretroviral nucleoside analogues.Lancet 1999; 354:1084–1089.

5. Delfraissy JF, Blanche S, Tardieu M, Barret B, Rustin P &Mayaux MJ. Mitochondrial and mitochondrial-like symp-toms in children born to HIV-infected mothers. Exhaustiveevaluation in a large prospective cohort. 8th Conference onRetroviruses & Opportunistic Infections. 1–4 February2001, Chicago, IL, USA. Abstract 625B.

6. McIntosh K. Toxicity of perinatally administered zidovu-dine. 7th Conference on Retroviruses & OpportunisticInfections. 30 January–2 February 2000, San Francisco,CA, USA. Abstract S14.

7. Noguera A, Fortuny C, Munoz-Almagro C, Sanchez E,Vilaseca MA, Artuch R, Pou J & Jimenez R. Hyperlactatemiain human immunodeficiency virus-uninfected infants who areexposed to antiretrovirals. Pediatrics 2004; 114:e598–e603.

8. Giaquinto C, De Romeo A, Giacomet V, Rampon O, RugaE, Burlina A, De Rossi A, Sturkenboom M & D’Elia R.Lactic acid levels in children perinatally treated with anti-retroviral agents to prevent HIV transmission. AIDS 2001;15:1074–1075.

9. Poirier MC, Olivero OA, Walker DM & Walker VE.Perinatal genotoxicity and carcinogenicity of anti-retroviralnucleoside analog drugs. Toxicology & AppliedPharmacology 2004; 199:151–161.

10. Lombes A, Bonilla E & Dimauro S. Mitochondrialencephalomyopathies. Revista de Neurologia 1989;145:671–689.

11. Fromenty B & Pessayre D. Impaired mitochondrial func-tion in microvesicular steatosis. Journal of Hepatology1997; 26(Suppl 2):43–53.

12. Treem WR & Sokol RJ. Disorders of the mitochondria.Seminars in Liver Disease 1998; 18:237–253.

13. Taylor RW, Chinnery PF, Clark KM, Lightowlers RN &Turnbull DM. Treatment of mitochondrial disease. Journalof Bioenergetics & Biomembranes 1997; 29:195–205.

14. Chinnery PF, Howell N, Andrews RM & Turnbull DM.Clinical mitochondrial genetics. Journal of MedicalGenetics 1999; 36:425–436.

15. Mhiri C, Baudrimont M, Bonne G, Geny C, Degoul F,Marsac C, Roullet E & Gherardi R. Zidovudine myopathy:a distinctive disorder associated with mitochondrialdysfunction. Annals of Neurology 1991; 29:606–614.

16. Modica Napolitano JS. AZT causes tissue-specific inhibitionof mitochondrial bioenergetic function. Biochemical &Biophysical Research Communications 1993; 194:170–177.

17. Barile M, Valenti D, Hobbs GA, Abruzzese MF, KeilbaughSA, Passarella S, Quagliariello E & Simpson MV.Mechanisms of toxicity of 3′-azido-3′-deoxythymidine: itsinteraction with adenylate kinase. BiochemicalPharmacology 1994; 48:1405–1412.

18. Valenti D, Barile M & Passarella S. AZT inhibition of theADP/ATP antiport in isolated rat heart mitochondria.International Journal of Molecular Medicine 2000;6:93–96.

19. Pan Zhou XR, Cui L, Zhou XJ, Sommadossi JP & DarleyUsmar VM. Differential effects of antiretroviral nucleosideanalogs on mitochondrial function in HepG2 cells.Antimicrobial Agents & Chemotherapy 2000; 44:496–503.

20. Côté HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyMV & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV-infected patients. NewEngland Journal of Medicine 2002; 346:811–820.

21. McComsey G, Tan DJ, Lederman M, Wilson E & WongLJ. Analysis of mitochondrial DNA genome in the periph-eral blood leukocytes of HIV-infected patients with ofwithout lipoatrophy. AIDS 2002; 16:513–518.

G Moyle


22. Morgello S, Wolfe D, Gadfrey E, Feinstein R, Tagliati M &Simpson DM. Mitochondrial abnormalities in humanimmunodeficiency virus-associated myopathy. ActaNeuropathologica 1995; 90:366–374.

23. Shikuma CM, Hu N, Yost F, Waslien C, Shimizu S &Shiramizu B. Mitochondrial DNA decrease in subcutaneousadipose tissue of HIV-infected individuals with peripherallipoatrophy. AIDS 2001; 15:1801–1809.

24. Gallant J, Staszewski S, Pozniak A, Lu B, Miller MD,Coakley DF & Cheng A. Favorable lipid and mitochondrial(mt) DNA profile for tenofovir disoproxil fumarate (TDF)compared to stavudine (d4T) in combination with lamivu-dine (3TC) and efavirenz (EFV) in antiretroviral therapy(ART) naïve patients: a 48 week interim analysis. 42ndInterscience Conference on Antimicrobial Agents &Chemotherapy. 27–30 September 2002, San Diego, CA,USA. Abstract LB-2.


26. Raidel SM, Haase C, Jansen NR, Russ RB, Sutliff RL,Velsor LW, Day BJ, Hoit BD, Samarel AM & Lewis W.Targeted myocardial transgenic expression of HIV TATcauses cardiomyopathy and mitochondrial damage.American Journal of Physiology. Heart & CirculatoryPhysiology 2002; 282:H1672–H1678.

27. Jacotot E, Ravagnan L, Loeffler M, Ferri KF, Vieira HL,Zamzami N, Costantini P, Druillennec S, Hoebeke J, BriandJP, Irinopoulou T, Daugas E, Susin SA, Cointe D, Xie ZH,Reed JC, Roques BP & Kroemer G. The HIV-1 viral proteinR induces apoptosis via a direct effect on the mitochondrialpermeability transition pore. Journal of ExperimentalMedicine 2000; 19:33–46.

28. Roumier T, Vieira HL, Castedo M, Ferri KF, Boya P,Andreau K, Druillennec S, Joza N, Penninger JM, Roques B& Kroemer G. The C-terminal moiety of HIV-1 Vpr inducescell death via a caspase-independent mitochondrial pathway.Cell Death & Differentiation 2002; 9:1212–1219.

28. Nie Z, Phenix BN, Lum JJ, Alam A, Lynch DH, Beckett B,Krammer PH, Sekaly RP & Badley AD. HIV-1 proteaseprocesses procaspase 8 to cause mitochondrial release ofcytochrome C, caspase cleavage and nuclear fragmentation.Cell Death & Differentiation 2002; 9:1172–1184.

29. Polla BS, Kantengwa S, Francois D, Salvioli S, Franceschi C,Marsac C & Cossarizza A. Mitochondria are selectivetargets for the protective effects of heat shock against oxida-tive injury. Proceedings of the National Academy ofSciences, USA 1996; 93:6458–6463.

30. Li YY, Chen D, Watkins SC & Feldman AM. Mitochondrialabnormalities in tumor necrosis factor-alpha-induced heartfailure are associated with impaired DNA repair activity.Circulation 2001; 104:2492–2497.

31. Neuman MG, Shear NH, Bellentani S & Tiribelli C. Role ofcytokines in ethanol-induced cytotoxicity in vitro in HepG2cells. Gastroenterology 1998; 115:157–166.

32. Pessayre D, Mansouri A, Haouzi D & Fromenty B.Hepatotoxicity due to mitochondrial dysfunction. CellBiology & Toxicology 1999; 15:367–373.

33. Chitturi S & Farrell GC. Etiopathogenesis of nonalcoholicsteatohepatitis. Seminars in Liver Disease 2001; 21:27–41.

34. Geng Y, Hansson GK & Holme E. Interferon-gamma andtumor necrosis factor synergize to induce nitric oxideproduction and inhibit mitochondrial respiration in vascularsmooth muscle cells. Circulation Research 1992;71:1268–1276.

35. Cossarizza A, Mussini C, Mongiardo N, Borghi V, SabbatiniA, De Rienzo B & Franceschi C. Mitochondria alterationsand dramatic tendency to apoptosis in peripheral bloodlymphocytes during acute HIV syndrome. AIDS 1997;11:19–26.

36. Cossarizza A, Ortolani C, Mussini C, Borghi V, Guaraldi G,Mongiardo N, Bellesia E, Franceschini MG, De Rienzo B &Franceschi C. Massive activation of immune cells with an

intact T cell repertoire in acute HIV syndrome. Journal ofInfectious Diseases 1995; 172:105–112.

37. Franco JM, Rubio A, Rey C, Leal M, Macias J, Pineda JA,Sanchez B, Sanchez-Quijano A, Nunez-Roldan A & LissenE. Reduction of immune system activation in HIV-1-infectedpatients undergoing highly active antiretroviral therapy.European Journal of Clinical Microbiology & InfectiousDiseases 1999; 18:733–736.

38. Ledru E, Christeff N, Patey O, de Truchis P, Melchior JC &Gougeon ML. Alteration of tumor necrosis factor-alpha T-cell homeostasis following potent antiretroviral therapy:contribution to the development of humanimmunodeficiency virus-associated lipodystrophy syndrome.Blood 2000; 95:3191–3198.

39. Mynarcik DC, McNurlan MA, Steigbigel RT, Fuhrer J &Gelato MC. Association of severe insulin resistance withboth loss of limb fat and elevated serum tumor necrosisfactor receptor levels in HIV lipodystrophy. Journal of AIDS2000; 25:312–321.

40. Domingo P, Veloso S, Montero F, Sirvent J, Matias-Guiu X,Vialdes J, Gutierrez C, Sambeat MA, Aguilar C, Peraire J,Richart C & Richart C. Serum levels of soluble tumornecrosis factor (TNF) receptors correlate with the degree ofsubcutaneous adipocyte apoptosis in HIV-infected patientswith lipodystrophy. 14th AIDS International Conference.7–12 July 2002, Barcelona, Spain. Abstract WePeA5792.

41. Johnson JA, Albu JB, Engelson ES, Fried SK, Inada Y,Ionescu G & Kotler DP. Increased systemic and adiposetissue cytokines in patients with HIV-associated lipodys-trophy. American Journal of Physiology, Endocrinology &Metabolism 2004; 286:E261–E271.

42. Lagathu C, Bastard JP, Auclair M, Maachi M, KornprobstM, Capeau J & Caron M. Antiretroviral drugs with adverseeffects on adipocyte lipid metabolism and survival alter theexpression and secretion of proinflammatory cytokines andadiponectin in vitro. Antiviral Therapy 2004; 9:911–920.

43. Christeff N, Melchior JC, de Truchis P, Perronne C &Gougeon ML. Increased serum interferon alpha in HIV-1associated lipodystrophy syndrome. European Journal ofClinical Investigation 2002; 32:43–50.

44. Keilbaugh SA, Prusoff WH & Simpson VMV. The PC12 cellas a model for studies of mechanism of induction of periph-eral neuropathy by anti-HIV dideoxynucleoside analogs.Biochemical Pharmacology 1991; 42:R5–R8.


46. Simpson DM & Tagliati M. Nucleoside analogue-associatedperipheral neuropathy in human immunodeficiency virusinfection. Journal of Acquired Immune DeficiencySyndromes & Human Retrovirology 1995; 9:153–161.

47. McCurdy DTr & Kennedy JM. AZT decreases rat myocar-dial cytochrome oxidase activity and increase beta-myosinheavy chain content. Journal of Molecular & CellularCardiology 1998; 30:1979–1989.

48. Dalakas MC, Illa I, Pezeshkpour GH, Laukaitis JP, Cohen B& Griffin JL. Mitochondrial myopathy caused by long-termzidovudine therapy. New England Journal of Medicine1990; 322:1098–1105.

49. Pezeshkpour G, Illa I & Dalakas MC. Ultrastructural char-acteristics and DNA immunocytochemistry in humanimmunodeficiency virus and zidovudine-associatedmyopathies. Human Pathology 1991; 22:1281–1288.

50. Simpson DM, Citak KA, Godfrey E, Godbold J & WolfeDE. Myopathies associated with human immunodeficiencyvirus and zidovudine: can their effects be distinguished?Neurology 1993; 43:971–976.

51. Dalakas MC, Leon-Mozon ME, Bernardini I, Gahl WA &Jay CA. Zidovudine-induced mitochondrial myopathy isassociated with muscle carnitine deficiency and lipidstorage. Annals of Neurology 1994; 35:482–487.


Mitochondria and NRTIs

52. Semino-Mora MC, Leon-Monzon ME & Dalakas MC.Effect of L-carnitine on the zidovudine-induced destructionof human myotubes. Part I: L-carnitine prevents themyotoxicity of zidovudine in vitro. LaboratoryInvestigation 1994; 71:102–112.

53. Semino-Mora MC, Leon-Monzon ME & Dalakas MC.Effect of L-carnitine on the zidovudine-induced destructionof human myotubes. Part II: treatment with L-carnitineimproves AZT-induced changes and prevents furtherdestruction. Laboratory Investigation 1994; 71:773–781.

54. Pereira LF, Oliveira MB & Carnieri EG. Mitochondrialsensitivity to zidovudine. Cell Biochemistry & Function1998; 16:173–181.

55. de la Asuncion JG, del Olmo ML, Sastre J, Millan A, PellinA, Pallardo FV & Vina J. AZT treatment induces molecularand ultrastructural oxidative damage to muscle mitochon-dria. Prevention by antioxidant vitamins. Journal ofClinical Investigation 1998; 102:4–9.

56. Sales SD, Hoggard PG, Sunderland D, Khoo S, Hart CA &Back DJ. Zidovudine phosphorylation and mitochondrial

toxicity in vitro. Toxicology & Applied Pharmacology2001; 177:54–58.

57. McKee EE, Lynx MD, Susan-Resiga D, Bentley AT,D’Haenens JP, Cullen D & Ferguson M. Zidovudine inhibitsthymidine phosphorylation: a novel site of potential toxicityin non-mitotic cells. Antiviral Therapy 2004; 9:L9.

58. Rylova SN, Albertioni F, Flygh G & Eriksson S. Activityprofiles of deoxynucleoside kinases and 5′-nucleotidases incultured adipocytes and myoblastic cells: insights into mito-chondrial toxicity of nucleoside analogs. BiochemicalPharmacology 2005; 69:951–960.

59. Setzer B, Schlesier M, Thomas AK & Walker UA.Mitochondrial toxicity of nucleoside analogues in primaryhuman lymphocytes. Antiviral Therapy 2005; 10:327–334.


G Moyle


Received 7 January 2005, accepted 23 May 2005



Nucleoside analogues toxicities related to mitochon-drial dysfunction: focus on HIV-infected childrenAlessandra Viganò* and Vania Giacomet

Paediatrics, L Sacco Hospital, University of Milan, Italy


Survival in HIV-infected children has greatly improvedwith the introduction of highly active antiretroviraltherapy (HAART) [1]. Concomitantly, morbidity fromthe long-term effects of antiretroviral therapy (ART)has grown in importance. Children are more vulner-able than adults to the metabolic side effects of therapybecause of the potential impact on growth and the like-lihood of greater cumulative exposure. A number ofimportant clinical events have been described in HIV-infected adults receiving antiretroviral nucleosideanalogues that have been linked to mitochondrial (mt)injury and dysfunction. This review discusses thesecomplications individually in an attempt to summarizethe current understanding of their pathogenesis, with afocus on HIV-infected children.

Hyperlactataemia syndromes

Use of nucleoside analogue reverse transcriptaseinhibitors (NRTIs) by HIV-infected adult patients maybe complicated by hyperlactataemia with a frequencyranging from 8–18.3% in cohort studies [2–6]. Theprecise biochemical pathways involved in NRTI-related hyperlactataemia (NRH) are not yet completelyunderstood or defined. Nevertheless, a leading theorybased on several in vitro data is that NRH derives fromdirect inhibition of mtDNA polymerase-γ by NRTIsand, consequently, mt dysfunction [7–10]. Threedifferent hyperlactataemia syndromes have beendescribed in HIV-infected adults: lactic acidosissyndrome (LAS), symptomatic hyperlactataemia andsubclinical hyperlactataemia.

LAS is a rare, life-threatening disease characterizedby severe lactic acidosis (lactate levels usually>5.0 mmol/l), hepatic steatosis, occasional liver failureand sometimes by other NRTI-related toxicitiesbelieved to have a mt genesis, such as pancreatitis,sensory neuropathy and skeletal myopathy [10–14]. InHIV adult cohorts, LAS shows an incidence ranging

from 1.3–3.9 cases per 1000 person-years, a mortalityrate greater than 50% and is highly correlated withNRTI use [2,14].

In some cases, hyperlactataemia (<5.0 mmol/l) isassociated with clinical symptoms (nausea, emesis andvague abdominal pain), mild liver abnormalitieswithout hepatic failure and is not complicated by meta-bolic acidosis [2–6]. Symptomatic hyperlactataemia israre in HIV-infected adults (8–14.5 cases per 1000person-years) and is highly correlated with NRTI use,showing a mild clinical course usually with a goodprognosis, provided that NRTIs are promptly discon-tinued [2,12,15].

Most (>85%) of the 8–18.3% of HIV-infectedadults who test positive for hyperlactataemia aresymptom-free [2–6]. Subclinical hyperlactataemia ischaracterized by lactate levels ranging from2.1–5.0 mmol/l, is usually transient and has a poorpositive predictive value for identifying cases of futuresymptomatic lactic acidosis/hepatic steatosis [3–5].Moreover, in the largest published prospective cohortstudy, the detection of subclinical hyperlactataemia in2% of ART-naive patients indicated that this syndromemight be relatively non-specific for current NRTI use[5]. Finally, a recent prospective study showed thatchronic subclinical mild hyperlactataemia with alactate concentration of 1.5–3.5 mmol/l occurs in asignificant proportion of HIV-infected adults startedon NRTI-containing regimens. Initiation of HAARTcontaining either zidovudine (AZT) or stavudine (d4T)was associated with a mild increase in group meanlactate levels during the first 6–8 months of therapyand with a new serum lactate ‘steady state’ after 12months of therapy [3]. The cause(s) of subclinicalhyperlactataemia remain(s) unclear. Given its transi-tory pattern, however, sampling variability might playa major role. In addition, the superimposition ofsampling variability on an already increased serumlactate setpoint may also account for the higher

Introduction

frequency of this syndrome in patients on HAART thatcontains NRTIs as compared with untreated controls.

Lactic acidosis is an important cause of metabolicacidosis in children and may be divided into two cate-gories: type A, which is associated with tissue hypoper-fusion and hypoxaemia secondary to cardiopulmonaryarrest, septic, cardiac or hypovolaemic shock and typeB, which occurs without any clinical evidence of tissuehypoxia but is due to impairment of mt function causedby drugs, toxins and inherited metabolic disease. Thefirst group is relatively common in the paediatric inten-sive care unit; the second is uncommon [16].

During 1997–2003, three cases of type B lacticacidosis were identified in HIV-infected childrentreated with antiretroviral drugs. The first paediatriccase of lactic acidosis and hepatic steatosis wasdescribed by Miller et al. [17]. The author reported onfour patients, one of whom was an HIV-infectedadolescent who developed severe hepatic steatosis andlactic acidosis while receiving an antiretroviral regimencontaining d4T. The paediatric case was a 16-year-oldHIV-infected girl with a 3-day history of nausea,vomiting and abdominal pain. She had severe meta-bolic acidosis (arterial blood pH 7.33), an elevatedserum lactate level (9.9 mmol/l), hepatic steatosis [liverdensity, at computed tomography (CT), consistent withdiffuse fatty infiltration], elevated liver enzymes[alanine aminotransferase (ALT), 120 U/l; aspartateaminotransferase (AST), 166 U/l], pancreatitis (pancre-atic imaging, at CT, showing inflammation andnecrosis) with increased levels of amylase (561 U/l) andlipase (6150 U/l), and myopathy (increased fat dropletin myocytes, cytochrome oxidase-negative fibres,degenerating fibres at light and electron microscopyassessment of quadriceps biopsy specimen). Therapywith d4T, didanosine (ddI) and nelfinavir (NFV)(which the patient had been taking for 3 months) wasdiscontinued. After a complicated hospital course thatincluded a prolonged stay in the intensive care unit, thegirl started a new antiretroviral regimen with AZT,nevirapine and NFV and her illness did not recur.

Subsequently, Church et al. described an HIV-infected child treated with AZT, ddI and NFV whodeveloped near-fatal lactic acidosis and liver failure withmtDNA depletion [18]. At 23 months old the childshowed generalized developmental regression (shebecame unable to stand and physical examinationrevealed generalized areflexia and marked doughytexture of the musculature), signs of liver dysfunction,lactic acidosis (plasma lactic acid from 3.66–7.11 mmol/land serum CO2 of 10 mEq/l), and elevation in Krebscycle intermediate products on urine acid measurements.Examination of muscle biopsy revealed severe general-ized atrophy and variation in fibre size, loss ofmyofibril and poorly defined mitochondria with

disorganized cristae and dense irregular granules. Inaddition, spectrophotometric analysis of muscles mtenzymes showed 62–89% reductions relative to labo-ratory normal values in the activities of respiratorychain enzymes, and quantitative Southern blot analysisof muscle mtDNA demonstrated a depletion of 79% ascompared with the average mtDNA content of age-matched controls. Coenzyme Q, riboflavin and levo-carnitine were given as empirical therapy for mt failureand ART was transiently discontinued and subse-quently adjusted to a regimen free of nucleosideanalogues. Neurological, hepatic and metabolic abnor-malities improved after nucleoside analogues werediscontinued and progressively resolved during thefollow-up. In addition, a repeat muscle biopsy 6months after discontinuation of nucleoside analoguesdemonstrated structural, enzymatic and mtDNAnormalization.

Recently, Rey et al. described the first paediatric caseof fatal lactic acidosis [19]. The child was a 5-year-oldHIV-infected girl receiving ritonavir, d4T and ddI witha 10-day history of nausea and vomiting and a 12-hourhistory of abdominal pain with severe tachypnea andhypocapnia. Initial laboratory studies revealed a pH of7.27, bicarbonate of 2.8 mmol/l and a lactate level of13.6 mmol/l. Signs of liver dysfunction includedelevated bilirubin levels, very decreased fibrinogenlevels (37 mg/dl) with prolonged prothrombin time(21.5 sec) and partial thromboplastin time (40 sec),mild elevation of AST and ALT (57 and 67 U/l, respec-tively), and elevated lipase (3222 U/l) and amylaselevels (805 U/l). She was admitted to the paediatricintensive care unit, where ART was discontinued andhigh-dose intravenous bicarbonate, haemodiafiltrationand empirical therapy for mt failure with essentialcofactors (L-carnitine, riboflavin and thiamine) wasstarted. Serum lactate level initially decreased from21.2 to 12.4 mmol/l and serum bicarbonate rose from9.5 to 19.5 mmol/l; however, soon after this, lactateincreased and bicarbonate decreased again and thistendency persisted until the death of the child 36 hafter hospital admission.

The comparison between paediatric and adult casesof LAS seems to identify several overlapping featuresconcerning incidence, risk factors and clinical presenta-tion and, unique to paediatric cases, the more frequentconcomitant presence of other signs of NRTI-relatedtoxicities.

Thus, the above-mentioned paediatric cases of LASshare several features with those described in adultpatients: the duration of exposure to NRTIs was in theexpected range of 3–20 months, the most commoncomplaints were gastrointestinal (except in the infantwho could not be expected to be able to refer thesesymptoms), signs of liver dysfunction were present in

A Viganò & V Giacomet


all cases and lactate levels were always >10 mmol/l inthe fatal cases [20,2–6,11–14]. Unlike adult cases ofLAS, the concomitant presence of other NRTI-relatedtoxicities (pancreatitis and skeletal myopathy) seems tobe more frequent in the paediatric spectrum of thedisease. Use of d4T and ddI has been identified as a riskfactor in adult NRH, and the combination of d4T andddI may confer the highest risk [3,4,11–13,21–23]. It isnoteworthy that all paediatric LAS cases included oneof these two drugs in the antiretroviral regimen andthat in the fatal case both drugs were present. Theanecdotal nature of the paediatric observations doesnot allow correct estimation of the incidence of LAS inchildren taking NRTIs, however the report of onlythree cases in a time period of 5 years suggests quite alow incidence. The features of subclinical hyperlac-tataemia have been assessed in only two paediatricstudies. Noguera et al. conducted a prospective obser-vational study of venous lactate concentrations duringa 28-month period in 80 HIV-infected children, mostlyreceiving antiretroviral drugs [24]. Fasting venousblood samples were obtained after the patient hadrested for 15 min, avoiding tourniquets when possible.Pathological hyperlactataemia was considered only iflactate and alanine levels were concomitantly higherthan the reference range (1.77 mmol/l and 390 µmol/l,respectively). During follow-up, none of the childrendeveloped clinical signs or symptoms consistent withlactic acidosis and no revisions in ART were made forthis reason. Overall, 23/80 children (29%) showedelevated lactate values in one or more of the determi-nations throughout the study. Of them, only 14patients were identified with concomitant elevatedalanine concentration, giving a prevalence of hyperlac-tataemia of 17%. Peak lactate plasma concentrationsranged from 2.05–4.9 mmol/l and in 5/14 (45%) cases,lactate values spontaneously returned to normal values.The size of this cohort did not allow the establishmentof a possible relationship between hyperlactataemiaand type of NRTI used, however it is remarkable thatall children with hyperlactataemia were receiving atleast one NRTI and that d4T was used in 11/14 ofthese patients. In addition, the study identified youngerage at the beginning of ART as a significant risk factorfor hyperlactataemia.

Desay et al. reported 251 lactate levels obtainedfrom 127 children with HIV/AIDS; 104 on HAARTand 23 not on HAART [25]. Of the 104 HAART-treated children, 20 (19%) were on non-NRTIs(NNRTIs), 102 were on one or more NRTI (98%) and95 (91%) were on one or more protease inhibitor (PI).Lactate levels showed a mean value of 1.70 mmol/l(range 0.6–4.4 mmol/l). Of the 127 children, 41(32.3%) had at least one value higher than 2 mmol/l.Of the total 251 lactate readings, 56 (25.6%) were

above 2 mmol/l. Only one patient was symptomatic,with abdominal pain, nausea and vomiting, but thesesymptoms disappeared after a temporary discontinua-tion of ART. Elevated lactate levels were associatedwith therapy with NRTIs (P=0.01) or PIs (P=0.04)when considered as classes.

Further studies are obviously needed to fully evaluatethe incidence of subclinical hyperlactataemia and toassess the exact contributory role of factors other thanNRTIs in this syndrome in HIV-infected children.However, both the published studies deserve somecomment. Noguera et al. [24] showed a 17% prevalenceof subclinical hyperlactataemia; however, if the ninecases with transient hyperlactataemia are excluded, thefrequency would further decrease to 11%. In addition,younger age was a significant risk factor for hyperlac-tataemia. This observation needs further confirmation,namely, it may arise either from a greater susceptibilityof younger children to NRTI toxicity or from morefrequent difficulties in blood sampling in infants andtoddlers compared with older children.

Desay et al. [25] claim a 32% prevalence of subclin-ical hyperlactataemia; however, no detailed informa-tion on the blood sampling method is given or whetherhyperlactataemia was also detected in the 23 untreatedchildren included in the study. The study also raises thenovel possibility that therapy with PIs may contributeto elevated lactate levels. However, since almost allpatients (102/104) included in the analysis werereceiving at least one NRTI, it is unclear if the obser-vation came from a true evidence or from a bias in thestatistical analysis.

Cardiomyopathy

Several patterns of cardiovascular involvement havebeen reported in HIV-infected children [26–32]. Acontinuum from asymptomatic left ventricular (LV)dysfunction to dilated cardiomyopathy to congestiveheart failure (CHF) to hypotensive pump failure withcardiac associated mortality has been suggested [33].Abnormalities of LV hypertrophy have also beensuggested in which LV mass is excessive for bodysurface area but insufficient for LV dimension, resultingin a sustained elevation of LV peak wall stress, a medi-ator of mechanically induced hypertrophy [28,34].Other reported cardiac problems include haemody-namic abnormalities, conduction abnormalities,dysrhythmias and sudden death, as well as pericardialand vascular involvement [26–32]. Dilated cardiomy-opathy appears to be more common in HIV-infectedchildren than in seroreverted children and increases infrequency as HIV-infected children progress to AIDS[35]. CHF appears to occur chronically in some 10% ofHIV-infected children and transiently in another 10%


NRTI toxicity and mitochondrial dysfunction in children

[28]. Cardiomyopathy appears to reduce survival inHIV-infected children [27,29,30,36]. One study showeda relative risk of death of 2.76 in children withcardiomyopathy compared with children withoutcardiomyopathy [27]. Children were more likely to beshort-term survivors (<5 years) if cardiomyopathy waspresent [31]. Risk factors for more advanced cardiacinvolvement include HIV encephalopathy and a lowCD4 cell count [28,37,38].

The causes of these abnormalities are likely to bemultifactorial. Possible causes include HIV itself, otherviruses, immune-mediated cardiac muscle dysfunction,malnutrition and cardiotoxic drugs. A possible role ofAZT use has been questioned on the basis of somestudies done on animal models. Distinctive histopatho-logical changes in mitochondria of cardiac muscle havebeen noted in rats receiving high doses of AZT andthey were speculated to be due to drug-induced inhibi-tion of mtDNA replication [39]. In the Erytrocebuspatas monkey model of in utero exposure, investigatorsdemonstrated in full-term foetuses that transplacentalexposure to AZT, at around 86% of the human dailydose for the second half of gestation, resulted in struc-tural alterations in mitochondria of skeletal muscle(including disrupted cristae) and mtDNA depletion incardiac and skeletal muscle [40]. Studies in transgenicadult mice suggest that AZT is associated with diffusedestruction of cardiac mt ultrastructure and inhibitionof mtDNA replication [41].

An association between AZT and dilated cardiomy-opathy has been noted in some HIV-infected adultpatients; however, other studies showed oppositeresults [42]. Herskowitz et al. retrospectively studiedsix patients in whom congestive heart failure devel-oped, which was temporally associated with ART;three patients received AZT, two received ddI and onereceived 3 weeks of ddI therapy after 7 months of AZTtherapy. However, cardiac changes were not confirmedby heart biopsy [43]. Cardoso et al. did not showeffects of AZT on LV end-diastolic dimension, mass orfractional shortening [44]. The first paediatric case ofdilated cardiomyopathy was reported in 1986 in onevertically HIV-infected infant who had never receivedART [45]. Symptomatic dilated cardiomyopathy devel-oped at age 14 months, with cardiomegaly on a chestroentgenogram, an LV fractional shortening of 17%and clinical congestive heart failure. The infant showeda progressive course of cardiac disease, which necessi-tated increasingly intensive medical support until hisdeath almost 18 months later. Similar cases werereported by others a year later, also without theinvolvement of antiretroviral drugs, in which theprogressive cardiomyopathy was attributed to ‘thelonger survival providing more time for cardiac lesionof multifactorial etiopathogenesis to manifest’ [46].

The relationship between AZT use and the develop-ment of cardiomyopathy has been carefully examinedby Lipshultz et al. [47]. Serial echocardiograms wereperformed in 24 children with symptomatic HIV infec-tion before they started AZT and a mean of 1.32 yearssince therapy began, 27 age-matched children withsymptomatic HIV infection not treated with antiretro-virals and 191 healthy controls (HCs). As comparedwith HCs, children treated with AZT had progressiveLV dilatation and peak wall stress; dilatation and stresswere significantly elevated both before and during AZTtreatment. The ratio of ventricular thickness to internaldimension was below normal before ART began. AfterAZT treatment, overall LV mass as well as peak wallstress increased while LV fractional shorteningdecreased. No significant differences were detected atfollow-up in any of these measurements between HIV-infected children treated with AZT and those nottreated. These data show that a progressive LV dilata-tion with compensatory hypertrophy inadequate tomaintain normal peak systolic wall stress occurred inchildren with symptomatic HIV infection. AZT treat-ment did not appear to worsen or ameliorate thesecardiac changes.

In a P2C2 HIV Study Group trial, 196 children withsevere and mild symptomatic HIV infection and witha median age of 2.1 years were followed with a longi-tudinal 2-year echocardiographic assessment. Theresults confirmed that subclinical cardiovascularabnormalities were common in HIV-infected childrenand most remained throughout follow-up, with someprogression. Unfortunately, the study did not performa separate analysis for the 124 AZT-treated and the 72untreated children, and so the possible role of this drugcannot be inferred [48].

In another P2C2 HIV Study Group trial, infants bornto HIV-infected mothers were followed from birth tothe first 14 months of age [49]. Data on 382 infantswithout HIV infection (all exposed to AZT perinatallyand 36 postnatally, for a median of 42 days) and 58HIV-infected children (all exposed to AZT perinatallyand 12 postnatally during the first 12 months of age)were analysed. No association with acute or chronicabnormalities in LV structure or function was foundwith perinatal and postnatal exposure to this antiretro-viral drug. Domanski et al. retrospectively reviewedechocardiograms and clinical records (from January1987–December 1992) on 137 HIV-infected children(13 of whom had never received ART) with sympto-matic disease in the large majority. At the date of thefirst echocardiogram, the antiretrovirals administeredincluded AZT (52 patients), ddI (13 patients), bothdrugs (one patient) and no treatment (71 patients).Many of the 71 untreated patients were receiving theirechocardiograms as a part of pre-treatment evaluation.



Children treated with AZT had a lower average in LVfractional shortening than those untreated with AZT.The odds that a cardiomyopathy would develop were8.4 times greater in children who had previously usedAZT than in those who had never taken this drug. ddIwas not associated with the development of acardiomyopathy [50].

Overall, the great majority of the studies performedin the pre-HAART era suggest that cardiomyopathy isquite common in HIV-infected children with sympto-matic disease and that it is not associated with AZT use.The conflicting data obtained by Domanski et al. needto be interpreted with caution. The authors have mainlycompared serial echocardiographic measurements fromchildren with symptoms of HIV disease receiving AZTwith those from children receiving ddI. The echocardio-grams on 58/71 children, who were supposed to repre-sent a group who had received neither therapy, wereactually ‘baseline’ measurements before the start ofART with no follow-up studies without therapy. Only13 never-treated patients were included to represent theeffect of HIV alone and these were specified as having‘no symptoms’.

Finally a recent case report showed benefits of aHAART regimen including AZT in a child with severecardiomyopathy [51]. A dilated cardiomyopathy wasdiagnosed between 9–12 months and it severely deteri-orated in the ensuing 2 years. When the child was 3.5years old, AZT, lamivudine (3TC) and ritonavirtherapy was started. Six months after therapy, CD4count increased, viral load became undetectable and LVshortening fraction increased from 12 to 25%. Oneyear later, the heart size was still slightly large on chestX-ray, but echocardiography revealed normal cardiacfunction with an LV shortening fraction of 33%.

Distal symmetric polyneuropathy

Peripheral nerve disorders are frequent complicationsof HIV disease and distal symmetric polyneuropathy(DSP) is the most common form of neuropathy withreported estimates of 15–50% in HIV-infected adultpopulations [52]. While DSP is relatively uncommonearly in the course of HIV disease, its incidenceincreases as the degree of immunosuppressionprogresses [53]. The major presenting complaints ofDSP are paraesthesia, numbness and burning sensa-tions in the feet, usually in a symmetrical pattern.Unexpected peripheral neuropathies have beendescribed in Phase I/II dose-finding studies withzalcitabine (ddC), ddI and d4T. The percentage ofpatients who developed DSP during ddC therapyranged from 25–66% [54–56]. The occurrence of ddC-associated neuropathy as well as the severity andprogression of symptoms were clearly dose-dependent.

The incidence of DSP in patients treated with ddIvaried from 12–34% of the subjects [57]. The onsetand progression of neurological toxicity were bothrelated to the daily and cumulative doses of this drug[58]. The occurrence of DSP has been described in 6,15 and 31% of patients receiving d4T at a daily doseof 0.5, 1.0 and 2.0 mg/kg, respectively (Bristol-MyersSquibb, data on file). The temporal relationship ofonset and resolution of DSP with drug intake anddiscontinuation clearly indicates a toxic effect ofNRTIs. There are several theories for the mechanism ofthis neurotoxicity but most evidence focuses on mttoxicity. Using an in vitro model of nerve cells, ddC andddI have been shown to reduce mtDNA and cause mtdamage [59].

Nerve biopsies from patients with ddC-related DSP, ascompared with nerve biopsies from patients with AIDS-related neuropathy never treated with ddC, have showna majority of abnormal mitochondria (55 vs 9%) andmtDNA depletion as high as 80% [60]. However, mtchanges were also observed in nerves of untreated indi-viduals presenting with DSP [61]. In addition, depletedlevels of acetyl-L-carnitine have been noted in patientswith DSP receiving ddC, ddI or d4T therapy [62]. Thisdepletion may impair peripheral nerve regeneration anddisrupt mt metabolism providing a further mechanismfor NRTI neurotoxicity [63].

Children with HIV infection develop a variety ofneurological complications, but peripheral nervoussystem involvement is relatively infrequent comparedwith the frequent occurrence of peripheral neuropathydescribed in HIV-infected adults [64].

Neuropathy has never been observed or has beenrarely reported in paediatric populations treated withddC [65]. In 1991, a case of a 5-year-old boy withAIDS who developed an inflammatory demyelinatingpolyneuropathy was reported by Raphael et al. [66].

In 1997, Floeter et al. described the electrophysio-logical data of 50 HIV-infected children under 18 yearsof age referred for evaluation of suspected neuropathyto the EMG laboratory at the National Institutes ofHealth during 1989–1995 [67]. Most children hadmoderate to severe manifestations of HIV infection,with 31/50 classified as C3 – the clinical and immuno-logically most severe category of the disease. All butthree of the children had been treated with one or moreNRTIs (AZT, ddI, ddC, 3TC) before the developmentof symptoms of neuropathy and before referral fornerve conduction studies (NCSs). Overall, 12 childrenhad abnormal NCSs and a few common patterns ofabnormalities were detected: DSP in seven cases,median mononeuropathy in three cases and unusualpatterns in two cases (central and peripheral nervoussystem dysfunction in one and subacute lumbosacralpolyradiculopathy following a varicella zoster infection



in the other one). All children with DSP had fairlyadvanced HIV infection (five in CDC class C3 and twoin CDC class B2) and had received ART prior toexperiencing symptoms suggestive of neuropathy.Interestingly, a stepwise logistical regression of riskfactors (age, % CD4 count and number of NRTIsreceived) for the development of neuropathy found thatage alone was significantly associated with DSP.Children with DSP had a mean age of 14.4 yearscompared with a mean age of 8.2 years for childrenwithout DSP. Thus DSP in children, as in adults, seemsto be the most common pattern of peripheralneuropathy and it occurs in subjects with advancedHIV infection. The role of NRTIs, particularly ddI andddC, in causing distal neuropathy could not be clarifiedby this study. In this series, children with more severeHIV infection had received more antiretroviral drugsoverall, and all children with DSP received more thanone antiretroviral drug prior to developing symptoms.Although these data cannot truly untangle the role ofNRTIs in the development of neuropathy in these chil-dren, most children who received NRTIs did notdevelop peripheral neuropathy.

In 2000, a cross-sectional study on 39 children (agerange 5–14 years) was conducted by means of a struc-tured questionnaire (regarding symptoms of pain,paraesthesia or weakness) and a physical examination[68]. Thirteen (34%) cases had symptoms and signs ofDSP. Distal paraesthesia and/or pain plus diminishedankle jerks and/or diminished vibration sense were themost common clinical findings. Symptoms werechronic and fluctuating, but pain was, in general, notsevere. In eight of the 13 patients, the use of potentialneurotoxic drugs was absent before the beginning ofDSP, while in the remaining five patients, clinicalfeatures developed after having been on ddI therapy.

The paucity of reports on DSP in HIV-infected chil-dren does not allow a definitive assessment of its inci-dence and correlation with the use of neurotoxic drugsin this population. However, the prevalence reported inthe more recent study [68] is similar to that reported inHIV-infected adults. The lack of peripheral neuropathyin studies conducted at the beginning of the epidemiccould be explained by the early mortality of children atthat time. Dying before acquiring adequate languageskills would preclude symptoms such as paraesthesia orpain from being confirmed. In addition, symptoms inchildren seem less severe and they could not be referredspontaneously to the clinicians. An interesting ques-tion, which deserves further research, is the role of agein the development of DSP. In animals, age alone is arisk factor diminishing regenerative capacity of thegrowing peripheral nervous system [69]. In humans,peripheral nerves normally exhibit very rapid growthshortly after birth followed by slower growth over the

first few years, leading to adult nerve conduction veloc-ities by about the fourth year [70]. If regenerativecapacity in animals parallels that in humans, theperipheral nervous system may no longer be able to compensate for chronic low-level nerve injuries from HIV infection by the time the child reachesadolescence.

Peripheral lipoatrophy

Body fat abnormalities, summarized under the termlipodystrophy, are common in HIV-infected adultsreceiving potent ART, occurring in 30–50% or more ofindividuals in several large, prospective studies [71–73].These abnormalities include, singularly or in combina-tion, central fat accumulation evidenced by increasedabdominal girth, development of a dorsocervical fat padand breast enlargement, as well as loss of peripheralsubcutaneous fat (lipoatrophy). The latter designationincludes subcutaneous fat loss in the limbs, buttocksand face. There is no universally accepted definition oflipodystrophy, but most descriptions define thissyndrome on the basis of clinical features of fat redistri-bution, as assessed with physical examination, CT ormagnetic resonance imaging (MRI) scans, dual-energyX-ray absorptiometry (DXA) scans and anthropometry.

The clinical diagnosis of lipodystrophy in childrenis hampered by the lack of questionnaires appropriateto different paediatric ages and by the fact that alter-ations in body fat frequently escape clinical detection.The latter observation stems from studies which clearlyshowed that children without clinical signs of lipodys-trophy demonstrate a decrease in limbs fat and anincrease in trunk fat with DXA assessment [74,75].Lumbar single-slide CT or MRI scans have shown greataccuracy in quantifying visceral and subcutaneousadipose tissue in patients affected by body compositionabnormalities [76]. However, the use of these methodswithout sedation is only suitable in children older than4–5 years and there are no reference values in thepaediatric population. DXA quantifies the lean and fatcompartments precisely and it is presently consideredthe gold standard for in vivo body composition studiesin children; moreover, it allows a regional analysis ofthe fat distribution between limbs and trunk [77]. Onceagain, this technique is only suitable in children olderthan 4–5 years and the few available reference valuesare mainly derived from a population including over-weight children [78]. Skinfold thickness can measurethe subcutaneous fat layer, allowing a comparison withreference values at well-defined points at all paediatricages [79]. However, this method suffers from wideinter-/intraperson variability, requires considerabletraining for the results to be reproducible and may alsobe inappropriate in subjects with severe lipoatrophy.



Reference values are available for circumferences inchildren; waist circumference may be a useful para-meter to identify trunk adiposity although limb circum-ferences are not a useful marker of peripheral atrophy,being a measure of the sum of lean and fat mass. Inaddition, the lack of comparative studies betweensimple anthropometry (peripheral or central skinfoldsand circumferences) and gold standard techniques(DXA and MRI) in HIV-infected children currentlylimits its diagnostic power, especially in subtle, earlyforms of lipoatrophy.

Overall, the measurement of change in adiposity inchildren is challenging because of the effects of matura-tion and growth on lean muscle mass, fat mass andhydration status. This is particularly true in age periodswhen subcutaneous adipose tissue is minimal (pre-schooland school age) or when important inter-individualgender-related variabilities in fat compartment arecommon (infancy and puberty) [79]. Longitudinalbody composition analysis, possibly starting beforebeginning ART, may be required even more in childrenthan in adults to properly assess lipodystrophy and,consequently, to adopt therapeutic strategies in order toavoid this relevant clinical and metabolic complication.

Studies evaluating body composition by DXA, MRIand skinfold thickness have indicated that changes inbody fat content and distribution do occur in HIV-infected children. The prevalence of these changes variesfrom 18–33% and increases with longer duration ofexposure to ART [74,75,80–82]. Recently, a clinicalassessment of body fat abnormalities, according to anagreed protocol, was performed on 477 HIV-infectedchildren aged ≥3 years in 30 European paediatric HIVclinics [83]. Prevalence was 26.0% for any fat redistrib-ution, 8.81% for central lipohypertrophy, 7.55% forperipheral lipoatrophy and 9.64% for the combinedsubtype. Independent predictors of fat redistributionincluded advanced stage of HIV disease, female gender,ever used versus never used PIs and d4T. Increasing timesince initiation of ART was associated with increasedseverity of fat redistribution.

Considerable controversy exists concerning thepathophysiological mechanisms underlying the devel-opment of lipodystrophy. Although many studiessupport the view that this syndrome is mainly a drug-related side effect mediated from both the NRTI and PIclasses, some studies have demonstrated no evidence ofantiretroviral class-specific effects [84]. PIs wereinitially believed to be the most likely cause of thissyndrome, but more recently the use of NRTIs, d4T inparticular, has been linked specifically to the develop-ment of the lipoatrophic component of lipodystrophy[85,86]. Non-drug factors such as HIV itself, older age,Caucasian race, sex and genetics may also modulatethis syndrome.

It has been proposed that mt toxicity induced byNRTI-mediated inhibition of DNA γ polymerase playsa role in the development of the lipoatrophy compo-nent of the lipodystrophy syndrome. This theory wassuggested by the phenotypic similarity in fat maldistri-bution and metabolic abnormalities to what is seen insome patients with inherited mt enzyme deficiency.However, the precise mechanism by which NRTIscontribute to the syndrome is not yet completely under-stood [87]. Several data support mt toxicity as themechanism of lipoatrophy whilst other data refute thishypothesis [88]. Mitochondrial structural abnormali-ties and reduced mtDNA in subcutaneous fat biopsiestaken from adult patients with lipoatrophy have beenobserved [89,90]. Reduction of mtDNA content andrespiratory chain activity in adipocytes of patients onNRTI therapy has been demonstrated and these effectswere noted 6–12 months after the beginning of NRTItherapy [91]. Moreover, the ability to reverse periph-eral fat loss to some extent following the substitutionof d4T with abacavir or AZT, and the fact that suchimprovement is associated with decreased adipose cellapoptosis may further support the role of NRTI-induced mt toxicity in the development of lipoatrophy[92–94]. On the other hand, samples from subjectswith lipoatrophy have normal levels of mtDNA insome cases, while some of the samples from HCsshowed diminished mtDNA [89,90]. In addition,another study demonstrated a higher mtDNA contentin CD4 T cells from patient with lipodystrophy ascompared with patients without lipodystrophy andHCs [95].

The existence of possible association(s) between mttoxicity and the lipodystrophy syndrome has beenassessed in only one paediatric study so far [96].Mitochondrial functionality and apoptosis were studiedin peripheral blood lymphocytes (PBLs) in 18 HAART-treated (d4T, 3TC and one protease inhibitor), HIV-infected children, 12 with (LD+) and six without (LD–)lipodystrophy, and in 10 HCs. Using flow cytometry, mtmembrane potential, mt mass, intra-mt cardiolipindistribution, and early and late apoptosis in fresh PBLsor in PBLs cultured with different stimuli were assessed.MtDNA content in fresh PBLs was also evaluated bycompetitive quantitative PCR. PBLs from LD+ and LD–children and HCs were similar in mt functionality andtheir tendency to apoptosis. MtDNA content showed agreat variability among subjects but overall, there wereno relevant differences among the groups. Thus, theseresults seem to exclude HAART-induced mt damage inPBLs from children with LD. However, somehypotheses may partly explain our results. In HAART-treated children, PBLs are mainly generated in thethymus and it may be reasonable to assume that theperiod during which these cells were exposed to drugs



was too short to induce relevant damage. PBLs have alow metabolic rate with a consequent low replicationrate of mtDNA, which in turn provokes a low incorpo-ration rate of damaging drugs into mtDNA and a lowrequirement for γ polymerase. Lastly, adipocytes may bemore representative, as compared with PBLs, to assessthe role of NRTI-related mt damage in lipoatrophy.

Treatment of possible mitochondria-relatedevents

The manifestations of NRTI-related mitochondrial toxi-city are generally, at least partially, reversible upon with-drawal of the causative agent(s). However, choosingagents that appear to have a low risk of these toxicitiesand avoiding the use of combinations with overlappingmt toxicities may be the best approach for limiting theincidence of these problems. The severity of the toxicityand the degree of tissue damage may, at least in part,influence the extent of recovery from mt toxicities.Moreover, mt toxicity may recur following the reintro-duction of the same or similar agents.

As concerns hyperlactataemia, given the controver-sial role of serum lactate levels and mtDNA/nuclearDNA assessments as screening tools, maintaining a highlevel of vigilance remains key to the prevention anddiagnosis of this condition. Children (when appro-priate) on NRTIs (mainly d4T, ddI and AZT) and theirfamilies should be instructed on signs and symptoms tolook out for and strongly recommended to seek promptmedical evaluation. Physicians should regularly screenchildren taking these agents for symptoms (particularlyduring the first 12 months of therapy) such as unex-plained weight loss, gastrointestinal complaints,myalgia and paraesthesia, and they should pay partic-ular attention to unexplained tachypnea and neurolog-ical deterioration in infants and toddlers. A high indexof suspicion is specifically warranted during episodes ofinfection, as antecedent respiratory infection mayprecede symptomatic lactic acidosis. In all cases withsymptomatic hyperlactataemia and lactic acidosis, ARTshould be discontinued if no other causes are evident[97]; children who are more seriously ill may requiresupportive care in an intensive care unit, haemodialysisand mechanical ventilation.

Administration of essential cofactors such asthiamine, riboflavin, L-carnitine, coenzyme Q10 andantioxidants have been used as a therapy for congenitalmt diseases [98]. The beneficial effect of these agents insubjects with NRTI-related symptomatic hyperlac-tataemia is largely anecdotal and dosing schedules havenot yet been established. However, the low toxicitypotential of these agents make them a possible adjunctto standard measures. Even after the interruption ofART, normalization of lactate levels may take 3–6

months. Rechallenge after symptomatic hyperlac-tataemia should be performed with caution but carriesa low risk of recurrence as long as the culprit NRTI isreplaced by either a non-NRTI antiretroviral agent orone less frequently associated with hyperlactataemia,such as abacavir, 3TC or tenofovir [97]. The manage-ment of NRTI-related peripheral neuropathy mayinvolve discontinuation or dose reduction of thecausative agent, however the latter approach not onlylacks a proven beneficial effect but also cannot be recom-mended in HAART regimens. Even after drug with-drawal, symptoms may persist and require treatmentwith ibuprofen, acetaminophen, tricyclic antidepres-sants, topical lidocain, narcotics for refractory pain oracupuncture. The choice of which intervention needs tobe carefully tailored to the age of the paediatric patient.

Treatment of lipodystrophy is evolving, with no clearstandard of care. No proven treatment exists for HIVlipoatrophy and no studies have found that limb fatincreases spontaneously over time in patients withlipoatrophy. In vivo studies have suggested that thymi-dine analogues, especially d4T, are important in thelipoatrophy component of the lipodystrophy syndrome.The effect on fat loss of replacing d4T with abacavir orAZT has been recently assessed in HIV-infected adultswith lipoatrophy [92,93]. These studies showed that animprovement of lipoatrophy, albeit modest, occurs inthe short-term (24–48 weeks) and lipoatrophy ispartially reversed in the long-term follow-up (104weeks). NRTI switches could be an attractive option inHIV-infected children with lipoatrophy, however theycannot be formally suggested at the moment due to thelack of studies in this population.

Conclusions

HIV-infected children treated with potent ART canexhibit a large decrease in HIV-RNA levels and a subse-quent increase in CD4 cells. These changes have resultedin significant improvements in clinical outcome andquality of life, dramatically decreasing disease progressionand mortality. For many, HIV disease has been trans-formed from an acute life-threatening illness into amanageable chronic disease, allowing children, whowere once not expected to survive, to live well into adult-hood. Some clinical events related to NRTI-related mttoxicity have been reported in HIV-infected children butthe available studies are scanty as compared with thoseperformed in HIV-infected adults and further research isrequired to clarify the entity and the consequences ofNRTI-related mt toxicity in paediatric patients.Therefore, close monitoring of these syndromes is highlyadvisable due to the possible relevant damage to liver,muscle and nervous system, and the negative impact ongrowth related to a persistent subclinical mt toxicity.



Acknowledgements

This work was supported by Grant n. 30F.54, IstitutoSuperiore di Sanità – V Programma Nazionale diRicerca sull’AIDS – 2004.

References1. De Martino M, Tovo PA, Balducci M, Galli L, Gabiano C,

Rexxa G & Pezzotti P for the Italian Register for HIVInfection in Children and the Italian National AIDSRegistry. Reduction in mortality with availability of anti-retroviral therapy for children with perinatal HIV-1infection. Journal of the American Medical Association2000; 184:190–197.

2. Gerard Y, Maulin L, Yazdanpanah Y, De La Tribonnaire X,Amiel C, Maurage CA, Robin S, Sablonniere B, Dhennain C& Mouton Y. Symptomatic hyperlactataemia: an emergingcomplication of antiretroviral therapy. AIDS 2000;14:2723–2730.

3. John M, Moore CB, James IR, Nolan D, Upton RP,McKinnon EJ & Mallal SM. Chronic hyperlactataemia inHIV-infected patients taking antiretroviral therapy. AIDS2001; 15:717–723.

4. Boubaker K, Flepp M, Sudre P, Furrer H, Haensel A,Hirschel B, Boggian K, Chave JP, Bernasconi E, Egger M,Opravil M, Rickenbach M, Franciolo P & Telenti A.Hyperlactatemia and antiretroviral therapy: the Swiss HIVCohort Study. Clinical Infectious Diseases 2001;33:1931–1937.

5. Moyle GJ, Datta D, Mandalia S, Morlese J, Asboe D &Gazzard BG. Hyperlactatemia and lactic acidosis duringantiretroviral therapy: relevance, reproducibility andpossible risk factors. AIDS 2002; 14:1341–1349.

6. John M & Mallal S. Hyperlactactaemia syndromes inpeople with HIV infection. Current Opinion in InfectiousDiseases 2002; 15:23–29.

7. Konig H, Behr E, Lower J & Kurth R. Azidothymidinetriphosphate is an inhibitor of both humanimmunodeficiency virus type 1 reverse transcriptase andDNA polymerase gamma. Antimicrobial Agents &Chemotherapy 1989; 33:2109–2114.

8. Chen C, Vasquez-Padua M & Cheng Y. Effect of antihuman immunodefiency virus nucleoside analogues on mito-chondrial DNA and its implication for delayed toxicity.Molecular Pharmacology 1991; 39:625–628.

9. Brinkman K, ter Hofstede JM, Burger DM, Smeitink JAM& Koopmans PP. Adverse effects of reverse transcriptaseinhibitors: mitochondrial toxicity as common pathway.AIDS 1998; 12:1735–1744.

10. White AJ. Mitochondrial toxicity and HIV therapy. SexuallyTransmitted Infections 2001; 77:158–173.

11. Mokrzycki M, Harris C, May H, Laut J & Palmisano J.Lactic acidosis associated with stavudine administration: areport of five cases. Clinical Infectious Diseases 2000;30:198–200.

12. Lonergan JL, Behling C, Pfander H, Hassanein TT &Mathews WC. Hyperlactataemia and hepatic abnormalitiesin ten human immunodeficiency virus-infected patientsreceiving nucleoside analogue combination regimens.Clinical Infectious Diseases 2000; 31:162–166.

13. Coghlan ME, Sommadossi JP, Jhala NC, Many WJ, SaagMS & Johnson VA. Symptomatic lactic acidosis in hospital-ized antiretroviral-treated patients with humanimmunodeficiency virus infection: a report of 12 cases.Clinical Infectious Diseases 2001; 33:1911–1921.

14. Falco V, Rodriguez D, Ribera E, Martinez E, Mirò JM,Domingo P, Diazaraque R, Arribas JR, Gonzales-Garcia JJ,Montero F, Sanchez L & Pahissa A. Severe nucleoside-associated lactic acidosis in human immunodeficiencyvirus-infected patients: report of 12 cases and review of theliterature. Clinical Infectious Diseases 2002; 34:838–846.

15. Brinkman K. Management of hyperlactataemia: no need forroutine lactate measurements. AIDS 2001; 15:795–797.

16. Mizock BA & Falk JL. Lactic acidosis in critical illness.Critical Care Medicine 1992; 20:80–93.

17. Miller KD, Cameron M, Wood LV, Dalakas MC & KovacsJA. Lactic acidosis and hepatic steatosis associated with useof stavudine: report of four cases. Annals of InternalMedicine 2000; 133:192–196.

18. Church JA, Mitchell WG, Gonzalez-Gomez I, Christensen J,Vu TH, Dimauro S & Boles RG. Mitochondrial DNAdepletion, near-fatal metabolic acidosis and liver failure inan HIV-infected child treated with combination antiretro-viral therapy. Journal of Pediatrics 2001; 138:748–751.

19. Rey C, Prieto S, Medina A, Perez C, Concha A &Menendez S. Fatal lactic acidosis during antiretroviraltherapy. Pediatric Critical Care Medicine 2003; 4:485–487.

20. Bissuel F, Bruneel F, Habersetzer F, Chassard D, Cotte L,Chevallier M, Bernuau J, Lucet JC & Trepo C. Fulminanthepatitis with severe lactate acidosis in HIV-infected patientson didanosine therapy. Journal of Internal Medicine 1994;235:367–371.

21. Bleeker-Rovers CP, Kadir SW, van Leusen R & Richter C.Hepatic steatosis and lactic acidosis caused by stavudine inan HIV-infected patient. Netherlands Journal of Medicine2000; 57:190–193.

22. Fortgang IS, Belitsos PC, Chaisson RE & Moore RD.Hepatomegaly and steatosis in HIV-infected patientsreceiving nucleoside analogue antiretroviral therapy.American Journal of Gastroenterology 1995;90:1433–1436.

23. Hofstede HJM, de Marie S, Foudraine NA, Danner SA &Brinkman K. Clinical features and risk factors of lacticacidosis following long-term antiretroviral therapy: 4 fatalcases. International Journal of STD & AIDS 2000;11:611–616.

24. Noguera A, Fortuny C, Sanchez E, Arthuch R, VilasecaMA, Munoz-Almagro C, Pou J & Jimenez R.Hyperlactatemia in human immunodeficiency virus-infectedchildren receiving antiretroviral treatment. PediatricInfectious Disease Journal 2003; 22:778–782.

25. Desai N, Mathur M & Weedon J. Lactate levels in childrenwith HIV/AIDS on highly active antiretroviral therapy.AIDS 2003; 17:1565–1567.

26. Lipshultz SE, Chanock S, Sanders SP, Colan SD & McIntoshK. Cardiac manifestations of human immunodeficiencyinfection in infants and children. American Journal ofCardiology 1989; 63:1489–1497.

27. Tovo PA, de Martino M, Gabiano C, Cappello N, D’Elia R& Loy A. Prognostic factors and survival in children withperinatal HIV-1 infection. Lancet 1992; 339:1249–1253.

28. Luginbuhul LM, Orav EJ, McIntosh K & Lipshultz SE.Cardiac morbidity and related mortality in children withHIV infection. Journal of the American Medical Association1993; 269:2869–2875.

29. Turner BJ, Denison M, Eppes SC, Houchens R, Fanning T& Markson LE. Survival experience of 789 children withthe acquired immunodeficiency syndrome. PediatricInfectious Disease Journal 1993; 12:310–320.

30. Grenier MA, Karr SS, Rakusan TA & Martin GR. Cardiacdisease in children with HIV: relationship of cardiac diseaseto HIV symptomatology. Pediatric AIDS & HIV Infection1994; 5:174–179.

31. Italian Register for HIV Infection in Children. Features ofchildren perinatally infected with HIV-1 surviving longerthan 5 years. Lancet 1994; 343:191–195.

32. Lipshultz SE, Orav EJ, Sanders SP & Colan SD.Immunoglobulin and left ventricular struture and functionin paediatric HIV infection. Circulation 1995; 92:2220–2225.

33. Lipshultz SE, Bancroft EA & Boller A-M. Cardiovascularmanifestations of HIV infection in children. In The Scienceand Practice of Pediatric Cardiology. 1997 2nd edn. Editedby JT Bricker, A Garson Jr, DJ Fisher & SR Neish.Baltimore, MD: Williams-Wilkins.



34. Kearney DL for the P2C2 HIV Study Group. Postmortemcardiomegaly correlates with premortem measurements ofleft ventricular size in malnourished HIV-infected children.3rd Conference on Retroviruses & Opportunistic Infections.28 January–1 February 1996, Washington, DC, USA.Abstract 431.

35. Lindegren ML, Caldwell B & Oxtoby M. Paediatric HIVinfection in the USA. In A Guide to Pratical Management,1995; pp. 21–51. Edited by JYQ Mok & M-L Newell. NewYork: Cambridge University Press.

36. Lipshultz SE for the P2C2 HIV Study Group. Cardiacdysfunction predicts mortality in HIV-infected children: theprospective NHLBI P2C2 Study. 3rd Conference onRetroviruses & Opportunistic Infections. 28 January–1February 1996, Washington DC, USA. Abstract 415.

37. Lobato MN, Caldwell B, Ng P & Oxtoby MJ.Encephalopathy in children with perinatally acquiredhuman immunodeficiency virus infection. Journal ofPediatrics 1995; 126:710–715.

38. Lipshultz SE, Easley K, Kaplan S, Bricker JT, Starc T, Lai W,Moodie D & Colan SD for the P2C2 Study Group. The rela-tion between progressive immune dysfunction andventricular dysfunction: the prospective NHLBI P2C2 study.2nd National Conference on Human Retroviruses &Related Infections. 29 January–2 February 1995,Washington DC, USA. Abstract 193.

39. Lamperth T, Dalakas MC, Dagani F, Anderson J & FerrariR. Abnormal skeletal and cardiac muscle mitochondrial invitro and in an animal model. Laboratory Investigations1991; 6:742–751.

40. Gerschenson M, Erhart SW, Paik CY, Nagashima K, SkopelsB, Harbaugh SW, Harbaugh JW, Quan W & Poirier MC.Fetal mitochondrial heart and skeletal muscle damage inErytrocebus patas monkeys exposed in utero 3′-azido-3′-deoxythymidine. AIDS Research & Human Retroviruses2000; 16:635–644.

41. Lewis W, Grupp I, Grupp G, Hoit B, Morris R, SamarelAM, Bruggeman L & Klotman P. Cardiac dysfuction in theHIV-1 transgenic mouse treated with zidovudine.Laboratory Investigations 2000; 80:187–197.

42. Rerkpattanapipat P, Wongpraparut N, Jacobs LE & KotlerMN. Cardiac manifestations of acquired immunodeficiencysyndrome. Archives of Internal Medicine 2000;160:602–608.

43. Herskowitz A, Willoughby SB, Baughman KI, Schulman SP& Bartleit JD. Cardiomyopathy associated with antiretro-viral therapy in patients with HIV infection: a report of sixcases. Annals of Internal Medicine 1992, 18:1260–1265.

44. Cardoso JS, Moura B, Mota-Miranda A, Goncalves FR &Lecour H. Zidovudine therapy and left ventricular functionand mass in human immunodeficiency virus-infectedpatients. Cardiology 1997; 88:26–28.

45. Steinherz L, Broschstein JA & Robins J. Cardiac involve-ment in congenital acquired immunodeficiency syndrome.American Journal of Diseases of Children 1986;140:1241–1244.

46. Joshi VV, Gadol C, Connor E, Oleske JM, Mendelson J &Marin-Garcia J. Dilated cardiomyopathy in children withacquired immunodeficiency syndrome: a pathologic study offive cases. Human Pathology 1988; 19:69–73.

47. Lipshultz SE, Orav EJ, Sanders SP, Hale AR, McIntosh K &Colan SD. Cardiac structure and function in children withhuman immunodeficiency infection treated with zidovudine.New England Journal of Medicine 1992; 327:1260–1265.

48. Lipshultz SE, Kirk A, Easley MS, Orav EJ, Kaplan S, StarcTJ, Bricker T, Lai WW, Moodie DS, McIntosh K, SchluchterMD & Colan SD. Left ventricular structure and function inchildren infected with human immunodeficiency virus: theprospective P2C2 HIV Multicenter Study. PediatricPulmonary and Cardiac Complications of VerticallyTransmitted HIV Infection (P2C2 HIV) Study Group.Circulation 1998; 97:1246–1256.

49. Lipshultz SE, Kirk A, Easley MS, Orav EJ, Kaplan S, StarcTJ, Bricker T, Lai WW, Moodie DS, McIntosh K, SchluchterMD & Colan SD. Absence of cardiac toxicity of zidovudine

in infants. Pediatric Pulmonary and Cardiac Complicationsof Vertically Transmitted HIV Infection Study Group. NewEngland Journal of Medicine 2000; 343:759–766.

50. Domanski MJ, Sloas MM, Follmann DA, Scalise PP, TuckerEE, Egan D & Pizzo PA. Effect of zidovudine and didano-sine on heart function in children infected with humanimmunodeficiency virus. Journal of Pediatrics 1995;127:137–146.

51. Saulsbury FT. Resolution of organ-specific complications ofimmunodeficiency virus infection in children with use ofhighly active antiretroviral therapy. Clinical InfectiousDiseases 2001; 32:464–468.

52. Cornblath DR & McArthur JC. Predominantly sensoryneuropathy in patients with AIDS and AIDS-relatedcomplex. Neurology 1998; 38:794–796.

53. Fuller GN, Jacobs JM & Guiloff RJ. Nature and incidenceof peripheral nerve syndromes in HIV infection. Journal ofNeurology, Neurosurgery & Psychiatry 1993; 56:372–381.

54. Yarchoan R, Perno CF, Thomas RV, Klecker RW, Allain JP,Wills RJ, McAtee N, Fischl MA, Dubinsky R, McNeelyMC, Mitauya H, Pluda JM, Lawley TJ, Luther M, Safai B,Collins JM, Myers CE & Broder S. Phase I studies of 2′,3′-dideoxycytidine in severe human immunodeficiency virusinfection as a single agent and alternating with zidovudine.Lancet 1988; 1:76–82.

55. Merigan TC, Skowron G, Bozzette SA, Richman D,Uttamchandani R, Fischi M, Schooley R, Hirsch M, Soo W& Pettinelli C. Circulating p24 antigen levels and responsesto dideoxycytidine in human immunodeficiency virus (HIV)infections. A phase I and II study. Annals of InternalMedicine 1989; 110:189–194.

56. Fischi MA, Olson RM, Follansbee SE, Lalezari JP, HenryDH, Frame PT, Remick SC, Salgo MP, Lin AH & Nauss-Karol C. Zalcitabine compared with zidovudine in patientswith advanced HIV-1 infection who received previouszidovudine therapy. Annals of Internal Medicine 1993;118:762–769.

57. Package Insert Videx (didanosine). October 1991. NewYork: Bristol-Meyer-Squibb.

58. Rozeneweig M, McLaren C, Beltangady M, Ritter J,Canetta R, Schacter L, Kelley S, Nicaise C, Smaldone L &Dunkle L. Overview of phase I trials of 2′,3′-dideoxyinosine(ddI) conducted on adult patients. Reviews of InfectiousDiseases 1990; 12:570–575.

59. Keilbaugh SA, Prusoff WH & Simpson VWV. The PC12 cellas a model for studies of mechanism of induction of periph-eral neuropathy by anti-HIV dideoxynucleoside analogs.Biochemical Pharmacology 1991; 42:R5–R8.

60. Dalakas MC, Semino-Mora C & Leon-Monzon M.Mitochondrial alterations with mitochondrial DNA deple-tion in the nerves of AIDS patients with peripheralneuropathy induced by 2′3′-dideoxycitidine (ddC).Laboratory Investigations 2001; 81:1537–1544.

61. Simpson DM & Tagliati M. Nucleoside analogue-associatedperipheral neuropathy in human immunodeficiency virusinfection. Journal of Acquired Immune DeficiencySyndromes & Human Retrovirology 1995; 9:153–161.

62. Famularo G, Moretti S, Marcellini S, Trinchieri V,Tzantzoglou S, Santini G, Longo A & De Simone C. Acetyl-carnitine deficiency in AIDS patients with neurotoxicity ontreatment with antiretroviral NRTI. AIDS 1997;11:185–190.

63. Forloni G, Angeretti N & Smiroldo S. Neuroprotectiveactivity of acetyl-L-carnitine: studies in vitro. Journal ofNeuroscience Research 1994; 37:92–96.

64. Civitello LA. Neurologic complications of HIV infection inchildren. Pediatric Neurosurgery 1991; 17:104–112.

65. Pizzo PA, Butler K, Balis F, Brouwers E, Hawkins M, EddyJ, Einloth M, Falloon J, Husson R & Jarosinski P.Dideoxycitidine alone and in an alternating schedule withzidovudine in children with symptomatic humanimmunodeficiency virus infection. Journal of Pediatrics1990; 117:799–808.



66. Raphael SA, Price ML, Lischner HW, Griffin JW, GroverWD & Bagarsa O. Inflammatory demyelinating polyneu-ropathy in a child with symptomatic humanimmunodeficiency virus infection. Journal of Pediatrics1991; 118:242–245.

67. Floeter MK, Civitell LA, Everett CR, Dambrosia J &Luciano CA. Peripheral neuropathy in children with HIVinfection. Neurology 1997; 49:207–212.

68. Prufer de QC Araujo A, Nascimento OJM & Garcia OS.Distal sensory polyneuropathy in a cohort of HIV-infectedchildren over five years of age. Pediatrics 2000; 106:E35.

69. Komiya Y. Axonal regeneration in bifurcating axons ofdorsal root ganglion cells. Experimental Neurology 1981;73:824–826.

70. Gamstorp I. Normal nerve conduction velocity of ulnar,median and peroneal nerves in infancy, childhood andadolescence. Acta Paediatrica 1963; 14(suppl 146):68–76.

71. Schambelan M, Benson CA, Carr A, Currier JS, Dube MP,Gerber JG, Grinspoon SK, Grunfeld C, Kotler DP, MulliganK, Powderly WG & Saag MS. Management of metaboliccomplication associated with antiretroviral therapy for HIV-1 infection: recommendation of an International AIDSSociety-USA panel. Journal of Acquired Immune DeficiencySyndromes 2002; 31:257–275.

72. Bernasconi E, Boubaker K, Junghans C, Flepp M, FurrerHJ, Haensel A, Hirschel B, Boggian K, Chave JP, OpravilM, Weber R, Rickenbach M & Telenti A. Abnormalities ofbody fat distribution in HIV-infected persons treated withantiretroviral drugs: the Swiss HIV Cohort Study. Journal ofAcquired Immune Deficiency Syndromes 2002; 31:50–55.

73. Health KV, Hogg RS, Singer J, Chan KJ, O’ShaughnessyMV & Montaner JS. Antiretroviral treatment patterns andincident HIV-associated morphologic and lipid abnormali-ties in a population-based cohort. Journal of AcquiredImmune Deficiency Syndromes 2002; 30:440–447.

74. Brambilla P, Bricalli D, Sala N, Renzetti F, Manzoni P,Vanzulli A, Chiumello G, di Natale B & Viganò A. Highlyactive antiretroviral-treated HIV-infected children show fatdistribution changes even in absence of lipodystrophy. AIDS2001; 15:2415–2422.

75. Arpadi SM, Cuff PA, Horlick M, Wang J & Kotler DP.Lipodystrophy in HIV-infected children is associated withhigh viral load and low CD4+-lymphocyte count and CD4+-lymphocyte percentage at baseline and use of proteaseinhibitors and stavudine. Journal of Acquired ImmuneDeficiency Syndromes 2001; 27:30–34.

76. Seidell JC, Bakker CJG & Van der Kooy K. Imaging tech-niques for measuring adipose tissue distribution. Acomparison between computed tomography and 1.5 Tmagnetic resonance. American Journal of Clinical Nutrition1990; 51:953–957.

77. Ellis KJ, Shypailo RJ, Pratt JA & Pond WG. Accuracy ofdual-energy X-ray absorptiometry for body-compositionmeasurements in children. American Journal of ClinicalNutrition 1994; 60:660–665.

78. He Q, Horlick M, Fedun B, Wang J, Pierson RN, Heshka S& Gallagher D. Trunk fat and blood pressure in childrenthrough puberty. Circulation 2002; 105:1093–1096.

79. Lohman TG, Roche F & Martorell R (Editors).Anthropometric standardization reference manual, 1988.Champaign, IL, USA: Human Kinetics Books.

80. Jaquet D, Levine M, Ortega-Rodriguez E, Faye A, Polak M,Vilmer E & Levy-Marchal C. Clinical and metabolic presen-tation of the lipodystrophic syndrome in HIV-infectedchildren. AIDS 2000; 14:2123–2128.

81. Amaya RA, Kozinetz CA, McMeans A, Schwarzwald H &Kline MW. Lipodystrophy syndrome in humanimmunodeficiency virus-infected children. PediatricInfectious Disease Journal 2002; 21:405–410.

82. Viganò A, Mora S, Testolin C, Beccio S, Schneider L,Bricalli D, Vanzulli A, Manzoni P & Brambilla P. Increasedlipodystrophy with increased exposure to highly active anti-retroviral therapy in HIV-infected children. Journal of

Acquired Immune Deficiency Syndromes 2003;32:482–489.

83. European Paediatric Lipodystrophy Group. Antiretroviraltherapy, fat redistribution and hyperlipidaemia in HIV-infected children in Europe. AIDS 2004; 18:1443–1451.

84. Lichtenstein KA, Delaney KM, Armon C, Ward DJ,Moorman AC, Wood KC & Holmberg SD. Incidence ofand risk factor for lipoatrophy (abnormal fat loss) in ambu-latory HIV-1-infected patients. Journal of Acquired ImmuneDeficiency Syndromes 2003; 32:48–56.

85. Carr A, Samaras K, Burton S, Law M, Freund J, ChisholmDJ & Cooper DA. A syndrome of peripheral lipodystrophy,hyperlipidaemia and insulin resistance in patients receivingHIV protease inhibitors. AIDS 1998; 12:F51–F58.

86. Mallal SA, John M, Moore CB, James IR & McKinnon EJ.Contribution of nucleoside analogue reverse transcriptaseinhibitors to subcutaneous fat wasting in patients with HIVinfection. AIDS 2000; 14:1309–1316.

87. Cossarizza A, Mussini C & Viganò A. Mitochondria in thepathogenesis of lipodystrophy induced by anti-HIV anti-retroviral drugs: actors or bystanders? BioEssays 2001;23:1070–1080.

88. Moyle G. Mitochondrial toxicity hypothesis for lipoat-rophy: a refutation. AIDS 2001; 15:413–414.


90. Shikuma CM, Hu N, Milne C, Yost F, Waslien C &Shiramizu B. Mitochondrial DNA decrease in subcutaneousadipose tissue of HIV-infected individuals with peripherallipoatrophy. AIDS 2001; 15:1801–1809.


92. Martin A, Smith DE, Carr A, Ringland C, Amin J, Emery S,Hoy J, Workman C, Doong N, Freund J & Cooper DA;Mitochondrial Toxicity Study Group. Reversibility of lipoat-rophy in HIV-infected patients 2 years after switching froma thymidine analogue to abacavir: the MITOX ExtensionStudy. AIDS 2004; 18:1029–1036.

93. McComsey GA, Ward DJ, Hessenthaler SM, Sension MG,Shalit P, Lonergan JT, Fisher RL, Williams VC & HernandezJE; Trial to Assess the Regression of Hyperlactatemia and toEvaluate the Regression of Established Lipodystrophy in HIV-1-Positive Subjects (TARHEEL; ESS40010) Study Team.Improvement in lipoatrophy associated with highly activeantiretroviral therapy in human immunodeficiency virus-infected patients switched from stavudine to abacavir orzidovudine: the results of the TARHEEL study. ClinicalInfectious Diseases 2004; 38:263–270.

94. McComsey GA, Paulsen DM, Lonergan JT, HessenthalerSM, Hoppel CL, Williams VC, Fisher RL, Cherry CL,White-Owen C, Thompson KA, Ross ST, Hernandez JE &Ross LL. Improvements in lipoatrophy, mitochondrial DNAlevels and fat apoptosis after replacing stavudine withabacavir or zidovudine. AIDS 2005; 19:15–23.


96. Cossarizza A, Pinti M, Moretti L, Bricalli D, Bianchi R,Troiano L, Fernandez MG, Balli F, Brambilla P, Mussini C& Viganò A. Mitochondrial functionality and mitochondrialDNA content in lymphocytes of vertically infected humanimmunodeficiency virus-positive children with highly activeantiretroviral therapy-related lipodystrophy. Journal ofInfectious Diseases 2002; 185:299–305.



97. Ogedegbe AE, Thomas DL & Diehi AM. Hyperlactatemiasyndromes associated with HIV therapy. Lancet InfectiousDiseases 2003; 3:329–337.

98. Chinnery PF & Bindoff LA; European neuromuscularcenter. 116th ENMC international workshop: the treatment

of mitochondrial disorders, 14th–16th March 2003,Naarden, The Netherlands. Neuromuscular Disorders 2003;13:757–764.



Received 29 December 2004, accepted 14 April 2005



Diagnosis of mitochondrial dysfunction in HIV-infected patients under highly active antiretroviraltherapy: possibilities beyond the standard proceduresJordi Casademont*, Eduard Sanjurjo, Gloria Garrabou and Òscar Miró

Laboratory of Mitochondrial Function, Department of Internal Medicine, Hospital Clínic, IDIBAPS, Medical School, University ofBarcelona, Barcelona, Catalonia, Spain

*Corresponding author: Tel/Fax: +34 9322 79365; E-mail: [email protected]

Mitochondrial (mt) disorders are a complex group ofdiseases due to malfunctions of the mitochondrialrespiratory chain (MRC). As mitochondria areubiquous within body cells, clinical manifestations ofmt diseases are very polymorphous; classically, theyhave been considered primary or secondary. Primarymt defects are considered to be those caused by muta-tions in genes encoding subunits of the MRC [1].Because mitochondria have a dual genetic control,these defects include mutations of mtDNA as well asnuclear DNA (nDNA) genes. Mitochondrial dysfunc-tions not related to mutations in genes encodingsubunits of the MRC are considered secondary mtdisorders [2,3]. They include defects of nuclear-encoded mt proteins responsible for the maintenanceof MRC subunits and mtDNA biogenesis, or thoseinvolved in many other mt biochemical pathways.They also include non-genetic defects that producederangements of mt homeostasis that have an impacton MRC function. This last situation is generally dueto exposure to an environmental toxin or drug, whichmay interfere with MRC either directly or through aseries of mechanisms including secondary geneticdefects, which may appear as a consequence of mtderangement.

Since the introduction of highly active antiretroviraltherapy (HAART) the prognosis of HIV infection haschanged dramatically, shifting the concept of HIVdisease from that of a highly mortal disease to that of achronic illness. However, the chronic use of HAARThas also been associated with an increase in adversedrug effects, such as hyperlactataemia, polyneuritis andlipodystrophy. It has been proposed that some of theseeffects could be mediated by mt toxicity and, actually, adecrease in mtDNA copy number and a MRC dysfunc-tion has been repeatedly described [4–12].

A frequent problem in clinical practice is that thediagnosis of mt dysfunction is not easy to establish. A

classic and relatively simple way to approach this issueis the measurement of ketone body ratios. An enzy-matic defect of MRC produces a modification of redoxpotential status due to the accumulation of reducedequivalents (NADH and FADH2). This accumulationpartially inhibits the Krebs cycle that, in turn, favoursthe production of β-hydroxybutyrate with respect toacetoacetate inside mitochondria, and lactate withrespect to pyruvate in cytoplasm. These ratios weremeasured some years ago in children with perinatalHIV infection treated with zidovudine without anysignificant result, possibly because its sensitivity is verylow [13]. To our knowledge, its measurement has notbeen reported in HIV infection since. A series of moresophisticated techniques have been used since then,including morphological, molecular genetic and enzy-matic studies. The most important findings using theseapproaches are the presence of ragged-red fibres onmuscle histochemical studies [4], a depletion ofmtDNA and a dysfunction of MRC in diverse tissues[5–12]. A problem with these techniques is that theyare usually not routine. Moreover, to establish a diag-nosis of mt dysfunction, a combination of these studiesis frequently required, and only a few medical centresin each country are equipped for thorough mt evalua-tion. The suspicion of a possible mt dysfunction in thecontext of HAART treatment is, consequently, difficultto prove and frequently only suspected. This may haveserious implications because the suspicion of mt toxi-city often induces a change in HAART regime with theconsequent discontinuation of useful antiretrovirals.

In this review, we analyse a series of techniquesthat may suggest the existence of a mt dysfunctionnot based on pathology, biochemical tissue or molec-ular genetic analyses. Several of these techniques havebeen used for the evaluation of classic mt diseasesand, with some modifications, could be applied to thediagnosis of HAART-associated mt dysfunction.

Introduction

Most have not been used for this purpose, their utilitybeing speculative.

Breath tests

Breath tests are simple, cost-effective and safe. Forthese reasons, they have been proposed for many‘dynamic’ evaluations, especially related to liver diseaseeither of genetic or acquired origin. The rationale fortheir use to assess mt function is that oxidative metab-olism of some substrates, such as methionine andketoisocaproic acid, need the integrity of the hepato-cyte electron transport chain and/or ATP synthesis fordecarboxylation [14,15]. Methionine is the best-studied carbon-labelled substrate; the isotope usuallyused is 13C, which is non-radioactive, although 14C canalso be used. The procedure consists of measuring theexhalation of 13CO2 after administration of 2 mg/kgbody weight of [methyl-13C]-labelled methionine.Breath 13CO2 is measured with a mass spectrometer atbaseline and every 15 min thereafter for 120 or 180min [15]. What the study reflects is hepatic mt func-tion, although to date there is still no general consensusas to its usefulness in the clinical setting.

In the absence of liver disease, the 13C-methioninebreath test has been used to assess mt function inpatients under HAART. Decreased intramitochondrialdecarboxylation capacity has been reported in HIV-infected patients with antiretroviral drug-related hyper-lactataemia compared with healthy controls [16,17].Drug discontinuation or regimen modification led to arecovery of this capacity (Figure 1).

The most important limitation in the evaluation ofHIV-infected patients is the high prevalence of coinfec-tion with hepatitis C and B viruses, as well as possiblealcohol abuse or hepatotoxicity from drugs, making itdifficult to completely exclude an undiagnosed hepaticdisease. Another minor problem in the use of breathtests is the need for mass spectrophotometry. However,this problem can be easily overcome with the develop-ment of a kit similar to those used to diagnoseHelicobacter pylori infection. This kit uses 13C-urea asa substrate and breath-exhaled samples are collectedinto bags and mailed to a reference laboratory [18].The general impression is that this is a young butpromising field and that further studies are needed toassess the suitable substrate or substrates required forthe evaluation of the complex mt metabolism.

Cardiopulmonary exercise tests

Cardiopulmonary exercise testing is an objectivemethod for evaluating exercise limitations either ofcardiac, pulmonary or metabolic origin, in whichsubjects exercise, preferably on a bicycle ergometer.

During exercise they breathe through a mouthpiecethat is a miniaturized pressure differential pneumo-tachygraph. The inspired and expired gas is continu-ously sampled and O2 uptake and CO2 elimination arecomputed [19]. Typical recordings also include cardiacoutput, dynamic flow volume loops and ventilation-perfusion measurements performed at rest and duringan incremental workload exercise test. Serum lactatecan also be measured. A series of derived parameterscan be obtained and correlated with workload,measured in watts. The respiratory exchange ratio(RER) is the quotient of the amount of CO2 producedto the amount of O2 consumed. Peak oxygen consump-tion (VO2max) in ml oxygen/kg body weight/mindenotes cardiovascular or ‘aerobic fitness’. The finalworkload (peak watts/kg) achieved by patients isconsidered their ‘peak work capacity’. The pointduring exercise at which anaerobic metabolism is usedto supplement aerobic metabolism as a source ofenergy is termed the ‘anaerobic threshold’. It normallyoccurs at >40% of VO2max [19,20].

In mt myopathies, exaggerated circulatory andventilatory responses to exercise are governed byskeletal muscle oxidative capacity, in which moreseverely impaired oxidative phosphorylation elicitsmore active systemic responses. Exercise capacityvaries widely, which is attributable to different levels ofoxidative impairment, but in general, the average peakwork capacity and VO2max are lower than in control

J Casademont et al.


Figure 1.13CO2 breath test exhalation curves of four patientswith drug-related hyperlactataemia during therapy and aftertherapy modification

12

10

8

6

4

2

0

Time from 13C-methionine adminstration, min

0 15 30 45 60 75 90 105 120Incr

ease

ove

r bas

elin

e CO

2 en

richm

ent

Same four patients after HAART modification

Eight healthy controls

Four patients on HAART

The second breath test was performed between 3 weeks and 2 months afterHAART modification. Results are compared with a series of eight healthycontrols (continuous line). Modified from Milazzo et al. [16]. HAART, highlyactive antiretroviral therapy.

subjects [21,22]. Low anaerobic threshold in a subjectwith unimpaired cardiovascular fitness provides addi-tional evidence of mt dysfunction [22].

In a group of HIV-positive patients on HAART,classified according to their level of venous lactatelevels, there were no significant differences with respectto peak work capacity, expired volume/min or VO2maxwhen compared with a group of controls. However,patients with abnormal venous lactate levels had ahigher RER at the peak of exercise and tended to havea lower anaerobic threshold [23]. In another group ofHIV-positive patients on HAART, lactate productionwas higher in patients with lipodystrophy than inpatients without lipodystrophy at the same level ofVO2max. In the same way, peak work capacity on thecycloergometer was reduced in the lipodystrophicgroup. The anaerobic threshold occurred earlier in thelipodystrophic group [24]. Finally, a group of HIV-infected patients with lipodystrophy and elevatedP-lactate levels had a significantly lower peak workcapacity and a trend towards reduced VO2 maxcompared with controls [25].

One problem in interpreting these results is that aseries of HIV-positive patients analysed in the late1980s before the introduction of HAART, also exer-cised to a significantly lower peak work capacitycompared with a group of non-infected patients. Theventilatory anaerobic threshold values and VO2maxwere also significantly lower [26]. There are actuallyseveral possible mechanisms to explain exercise limita-tions in HIV-positive patients aside from mt dysfunc-tion: cardiac, ventilatory, peripheral nerve or muscleabnormalities, anaemia, smoking, deconditioning,decreased motivation resulting from chronic disease ora combination of these factors [27]. The extreme diffi-culty in excluding all these circumstances in HIV-positive patients, together with the need forwell-trained personnel to interpret the results and therelatively sophisticated material used, makes cardiopul-monary exercise testing far from being an easy methodto implement in usual clinical practice.

Forearm exercise tests

Functional blood testsThe best known is the ischaemic forearm exercise testintroduced with the specific aim of screening for abnor-malities of muscle glycogen metabolism such asmyophosphorylase deficiency or McArdle’s disease[28,29]. Although not designed for the study of mtdefects, it has been suggested that the rate of lactateclearance in the post-exercise period may be signifi-cantly slower in patients with mt myopathies than inhealthy subjects [30,31]. To our knowledge, there areno systematic studies that sustain this hypothesis.

Furthermore, in a study not designed to study the rateof lactate clearance, the authors did not find any differ-ence between HIV-infected patients with lipodystrophyand elevated P-lactate levels and a group of controls[25]. This possibly indicates that the test is not usefulin the analysis of mitochondria in patients underHAART.

An aerobic forearm exercise test specifically developed forthe study of mt performance [32] seems more interestingfor the study of HAART-related mt dysfunction. Theprotocol consists of intermittent handgrip exercise (squeeze1 sec, rest 1 sec) for 3 min at 33% of intended maximalvoluntary contraction (MVC) force, which is determined30 min before initiation of data collection. Oxygen satura-tion is analysed in blood samples collected from the mediancubital vein of the exercised arm. Patients with a mtmyopathy do not develop a significant desaturation duringexercise compared with healthy subjects or patients withother muscular diseases [32]. We recently had the opportu-nity to study a patient with symptomatic hyperlactataemiadue to HAART [33]. During the acute phase of hyperlac-tataemia, O2 saturation did not decrease as expected inresponse to exercise. Antiretroviral therapy was initiallystopped and afterwards modified. The patient clinicallyrecovered and after 6 months, the aerobic forearm test wascompletely normal (Figure 2). Although promising andrelatively easy to implement in clinical practice, morestudies are required to determine the sensitivity and speci-ficity of this method.

M67

Diagnosis of mitochondrial dysfunction

Figure 2. Venous oxygen saturation before a forearm aerobicexercise test (minute 0), during aerobic exercise (minutes 1, 2and 3) and after resting (minute 4)

1101009080

6070

504030

Time, min

0 1 2 3 4

Veno

us o

xyge

n sa

tura

tion

(% re

spec

t to

bas

elin

e)

HIV+ on HAARTpatient with SHL

Healthy control

HIV+ on HAARTpatient after resolving SHL

HIV+ on HAARTcontrol without SHL

A patient on HAART who developed symptomatic hyperlactataemia did notpresent a normal venous desaturation during exercise as compared with healthysubjects and patients on HAART without hyperlactataemia. This is an indicationof poor O2 utilization during exercise. After 6 months and once the patient wasclinically recovered, the aerobic forearm test was normal. SHL, symptomatichyperlactataemia; HAART, highly active antiretroviral therapy.


Near-infrared spectroscopy (NIRS)NIRS is a non-invasive optical method for continuousmonitoring of oxygenation and haemodynamics intissue. It is based on the capacity of light in the near-infrared range to penetrate tissues to a depth of severalcentimetres and on absorption characteristics ofoxyhaemoglobin plus oxymyoglobin, compared withdeoxyhaemoglobin plus deoxymyoglobin, with differen-tial near-infrared light spectrometry. A series of opticalfibres are placed on top of the muscles of the exercisinglimb and the difference in the absorption at 760 and850 nm estimates the relative change in oxyhaemoblobinversus deoxyhaemoglobin. The sum of these spectraprovides an estimate of the blood volume. Thus, the net extraction of oxygen from oxyhaemoglobin relativeto oxygen delivery by blood circulation can be deter-mined over the area of the tissue sampled by the device,and the effect of exercise on muscle oxygenation can beassessed [34]. Since data can be collected continuously,this device provides unique information regarding thekinetics of oxygen utilisation relative to delivery in the transition from rest to exercise, during sustainedexercise and during recovery. This technique has beenused to assess patients with classic mt diseases. It seemsthat these patients present a decrease in O2 consumptioncompared with controls in both low-intensity exerciseand at rest [34,35]. To our knowledge, NIRS has notbeen used to assess the possible mt toxicity in HAART-treated patients. The advantages of the non-invasivenessof the procedure are possibly counterbalanced by thedifficulties in interpreting the results. It seems, nonethe-less, to be a technique with potential utility in thissetting.

Imaging techniques

Imaging studies have changed our approach to medicaldiagnosis in the last 20 years. Many modalities maycontribute toward the diagnosis of mt diseases. Table 1summarizes the most important methods [36]. Amongthem, magnetic resonance spectroscopy (MRS) seemsthe most promising for the diagnosis of mild mtdysfunction due to its ability to detect metabolicchanges. MRS can be used to monitor tissue bioener-getic changes in both the brain and the skeletal muscle.

Proton-MRS is useful in studying bioenergeticchanges in the brain. The main resonances observed inthe spectrum arise from N-acetylaspartate (a neuronalmarker), lactate, creatine and choline. Proton-MRS isless useful in the investigation of skeletal musclebecause of the large signal from the protons in thesubcutaneous fat, which can obscure other signals ofinterest [36]. For this reason, proton-MRS seems to beof low utility in the investigation of the effects ofHAART regimes.

The spectra of phosphorus-MRS (P-MRS) containseveral resonances: three arise from the γ, α and βphosphate groups of ATP, one from phosphocreatine(PCr) and one from inorganic phosphate (Pi) (Figure3); two additional smaller resonances can sometimes beobserved from phosphomonoesters and phosphodi-esters. The area under each resonance is proportionalto the amount of the corresponding metabolite. Thespectral distance between Pi and PCr provides infor-mation about intracellular pH.

In normal exercising muscle, there is a PCr decreaselinked to Pi accumulation, while the ATP signal remains

J Casademont et al.


Table 1. Clinical imaging techniques useful in the diagnosis of mitochondrial diseases

Imaging modality Contribution to diagnosis Comments

Magnetic resonance imaging (MRI) Structural changes No insight into tissue function

Computed tomography (CT) Structural changes No insight into tissue function

Diffusion weighted imaging Differentiation between ischemic Limited relevant studies to dateand MELAS stroke

Single-photon-emission computed tomography (SPECT) Changes in central blood flow Low spatial resolution

Positron emission tomography (PET) Detection of glucose/oxygen and Limited availabilityoxygen/blood flow ratios

Phosphorous and proton magnetic Metabolic changes Measurement of metaboliteresonance spectroscopy (MRS) concentrations at rest or under

exercise

MELAS, mitochondrial encephalopathy with lactic acidosis and stroke-like episodes. Modified from Parry & Matthews [35].

unchanged due to the continuous resynthesis of ATPthrough different metabolic pathways. After exercise,mt oxidative phosphorylation remains the main sourceof ATP, which continues for a while at an acceleratedrate to replenish the high-energy phosphates utilisedduring physical activity. Thus, during this period ofrecovery, PCr gradually increases, Pi and ADPdecrease, and pH returns to its resting level. The initialrate of PCr recovery provides a measure of maximaloxidative rate in the tissue and the recovery of ADP isnow considered as one of the most sensitive and reli-able indexes of mt dysfunction in vivo [37].

P-MRS of muscle is particularly interesting in theevaluation of patients with mt diseases, which present,at rest, an increase in Pi and, less often, a decrease inPCr resulting in a low PCr/Pi (Figure 3). Abnormalitiesin resting skeletal muscle and in brain can be detectedin patients even with relatively mild disease and normalserum lactate, or no clinical evidence of CNS involve-ment [38]. Muscle dynamic P-MRS studies during exer-cise can increase the specificity of the examination(Figure 4). Patients with mt myopathies display a rapidrate of PCr depletion. After stopping exercise, there isa prolonged rate of PCr recovery, which is a directconsequence of slower oxidative rephosphorylation ofADP to ATP, and faster than normal pH recovery [39].These changes do not seem to be specific for primarymt diseases. They have also been described to occursecondary to traumatic muscle injury or in inflamma-tory myopathies [40,41]. It is conceivable that P-MRSmay be a useful tool for the evaluation of HIV-infectedpatients on HAART, although no studies have beenreported to date.

Conclusions

There is currently a general belief that mt dysfunctionplays a pivotal role in some adverse effects observed in patients receiving HAART. The demonstration ofthis hypothetical dysfunction is complex and relies ona combination of pathological, biochemical and molec-ular genetic studies that are far from being consideredroutine in most general clinical settings. In the presentreview we have analysed some further diagnosticprocedures that may help in deciding whether mito-chondria are really affected in a given patient.Although some of these procedures are expensive andalso limited to a few high technology centres (forexample, MRS), others can be easily performed in moreconventional outpatient clinics (for example, func-tional forearm exercise tests). The major inconvenienceof all these methods is that they have either been intro-duced relatively recently or their use in diagnosing mtdysfunction is only a proposition. For these reasonstheir sensitivity, specificity and positive and negativepredictive values remain to be elucidated in the diag-nosis of HAART-related mt toxicity.

Acknowledgements

To Fundació La Marató de TV3 (01/1710 and02/0210), SGR 2001/00379 and V2003-REDG011-0.



Figure 4. Muscle dynamic P-MRS study. Scheme of the varia-tions of PCr during a rest-exercise-recovery protocol

40

30

20

10

0

Control

Rest Exercise Recovery

Mitochondrial patient

Time, min

5 10 15 20 25 300

Patients with a mitochondrial myopathy have a rapid rate of PCr depletion anda prolonged rate of PCr recovery, which is a direct consequence of sloweroxidative rephosphorylation of ADP to ATP. Modified from Mattei et al. [39].PCr, phosphocreatine; P-MRS, phosphorous magnetic resonance spectroscopy.

Figure 3. Representation of a muscle phosphorous magneticresonance spectra from two hypothetical subjects:(A) healthy individual and (B) patient with a mitochondrialmyopathy

10 0

ATPPi

PCr

PCr

γ α β

–10 ppm 10 0 –10 ppm

PiATP

γ α β

Spectra arise from the phosphate groups γ, α and β of ATP, PCr and Pi. Thespectrum from the patient with mitochondrial myopathy has a reduced PCrand an increased Pi concentration in comparison to the spectrum from thehealthy individual. ppm, parts per million; Pi, inorganic phosphate; PCr, phosphocreatine.

A B

[PC

r] m

M

References1. Wallace CD. Diseases of mitochondrial DNA. Annual

Review of Biochemistry 1992; 61:1175–1212.

2. Cardellach F, Casademont J & Urbano-Marquez A.Mitocondriopatías secundarias. Revista de Neurologia1998; 26(Suppl 1):S81–S86.

3. Schapira AH. Primary and secondary defects of the mito-chondrial respiratory chain. Journal of Inherited MetabolicDisease 2002; 25:207–214.

4. Casademont J, Barrientos A, Grau JM, Pedrol E, Estivill X,Urbano-Marquez A & Nunes V. The effect of zidovudineon skeletal muscle mtDNA in HIV-1 infected patients withmild or no muscle dysfunction. Brain 1996;119:1357–1364.

5. Zaera MG, Miro O, Pedrol E, Soler A, Picon M,Cardellach F, Casademont J & Nunes V. Mitochondrialinvolvement in antiretroviral therapy-related lipodystrophy.AIDS 2001; 15:1643–1651.

6. Cote HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR,O’Shaughnessy MV & Montaner JS. Changes in mitochon-drial DNA as a marker of nucleoside toxicity inHIV-infected patients. New England Journal of Medicine2002; 346:811–820.

7. Casademont J, Miró O & Cardellach F. MitochondrialDNA and nucleoside toxicity. New England Journal ofMedicine 2002; 347:217.


9. Miro O, Lopez S, Pedrol E, Rodriguez-Santiago B,Martinez E, Soler A, Milinkovic A, Casademont J, NunesV, Gatell JM & Cardellach F. Mitochondrial DNA deple-tion and respiratory chain enzyme deficiencies are presentin peripheral blood mononuclear cells of HIV-infectedpatients with HAART-related lipodystrophy. AntiviralTherapy 2003; 8:333–338.

10. Miro O, Lopez S, Martinez E, Rodriguez-Santiago B,Blanco JL, Milinkovic A, Miro JM, Nunes V, CasademontJ, Gatell JM & Cardellach F. Short communication:reversible mitochondrial respiratory chain impairmentduring symptomatic hyperlactatemia associated with anti-retroviral therapy. AIDS Research & Human Retroviruses2003; 19:1027–1032.


12. Lopez S, Miro O, Martinez E, Pedrol E, Rodriguez-Santiago B, Milinkovic A, Soler A, Garcia-Viejo MA,Nunes V, Casademont J, Gatell JM & Cardellach F.Mitochondrial effects of antiretroviral therapies in asymp-tomatic patients. Antiviral Therapy 2004; 9:47–55.

13. de Martino M, Zammarchi E, Filippi L, Donati MA,Mannelli F, Galli L & Vierucci A. Redox potential status inchildren with perinatal HIV-1 infection treated with zidovu-dine. AIDS 1995; 9:1381–1383.

14. Armuzzi A, Marcoccia S, Zocco MA, De Lorenzo A,Grieco A, Tondi P, Pola P, Gasbarrini G & Gasbarrini A.Non-invasive assessment of human hepatic mitochondrialfunction through the 13C-methionine breath test.Scandinavian Journal of Gastroenterology 2000;35:650–653.

15. Candelli M, Cazzato IA, Zocco MA, Nista EC, Fini L,Armuzzi A, Camise V, Santoro M, Miele L, Grieco A,Gasbarrini G & Gasbarrini A. 13C-breath tests in the studyof mitochondrial liver function. European Review forMedical & Pharmacological Sciences 2004; 8:23–31.

16. Milazzo L, Riva A, Sangaletti O, Piazza M, Antinori S &Moroni M. 13C-methionine breath test detects liver mito-

chondrial impairment in HIV-infected patients with anti-retroviral drug-related hyperlactatemia. Journal ofAcquired Immune Deficiency Syndromes 2004;35:429–432.

17. Banasch M, Goetze O, Hollborn I, Hochdorfer B,Brockmeyer N, Schmidt WE & Schmitz F. Non-invasiveassessment of hepatic mitochondrial toxicity in HIV-infectedpatients with normal serum lactate by 13C-methioninebreath test. Antiviral Therapy 2004; 9:L19.

18. Versalovic J. Helicobacter pylori. Pathology and diagnosticstrategies. American Journal of Clinical Pathology 2003;119:403–412.

19. ATS/ACCP. Statement on cardiopulmonary exercise testing.American Journal of Respiratory & Critical Care Medicine2003; 167:211–277.

20. Mayers JN. The physiology behind exercise testing.Primary Care 2001; 28:5–28.

21. Dandurand RJ, Matthews PM, Arnold DL & EidelmanDH. Mitochondrial disease. Pulmonary function, exerciseperformance, and blood lactate levels. Chest 1995;108:182–189.

22. Taivassalo T, Jensen TD, Kennaway N, DiMauro S, VissingJ & Haller RG. The spectrum of exercise tolerance in mito-chondrial myopathies: a study of 40 patients. Brain 2003;126:413–423.

23. Tesiorowski AM, Harris M, Chan KJ, Thompson CR &Montaner JS. Anaerobic threshold and random venouslactate levels among HIV-positive patients on antiretroviraltherapy. Journal of Acquired Immune DeficiencySyndromes 2002; 31:250–251.

24. Chapplain JM, Beillot J, Begue JM, Souala F, Bouvier C,Arvieux C, Tattevin P, Dupont M, Chapon F, DuvauferrierR, Hespel JP, Rochcongar P & Michelet C. Mitochondrialabnormalities in HIV-infected lipoatrophic patients treatedwith antiretroviral agents. Journal of Acquired ImmuneDeficiency Syndromes 2004; 37:1477–1488.

25. Roge BT, Calbet JA, Moller K, Ullum H, Hendel HW,Gerstoft J & Pedersen BK. Skeletal muscle mitochondrialfunction and exercise capacity in HIV-infected patients withlipodystrophy and elevated p-lactate levels. AIDS 2002;16:973–982.

26. Johnson JE, Anders GT, Blanton HM, Hawkes CE, BushBA, McAllister CK & Matthews JI. Exercise dysfunction inpatients seropositive for the human immunodeficiencyvirus. American Review of Respiratory Disease 1990;141:618–622.

27. Stringer WW. Mechanisms of exercise limitation in HIV+individuals. Medicine & Science in Sports & Exercise2000; 32(7 Suppl):S412–S421.

28. Munsat TL. A standardized forearm ischemic exercise test.Neurology 1970; 20:1171–1178.

29. Sanjurjo E, Laguno M, Bedini JL, Miro O & Grau JM.Forearm ischemic exercise test. Standardization and diag-nostic value in the identification of McArdle disease.Medicina Clinica 2004; 122:761–766.

30. Clark JB, Bates TE, Boakye P, Kuimov A & Land JM.Investigation mitochondrial defects in brain and skeletalmuscle. In A Practical Approach to the Investigation ofMetabolic Disease, 1996, pp.151–174. Edited by AJ Turner& HS Batchelard. Oxford: IRL Press, Oxford UniversityPress.

31. Dysgaard Jeppesen T, Olsen D & Vissing J. Cycle ergom-etry is not a sensitive diagnostic test for mitochondrialmyopathy. Journal of Neurology 2003; 250:293–299.

32. Jensen TD, Kazemi-Esfarjani P, Skomorowska E & VissingJ. A forearm exercise screening test for mitochondrialmyopathy. Neurology 2002; 58:1533–1538.

33. Garrabou G, López S, Sanjurjo E, Infante A, Riba J,Casademont J, Cardellach F & Miró Ò. Mitochondrialdysfunction of HAART-related hyperlactataemia is demon-strable by non-invasive studies. Antiviral Therapy 2004;9:L24.

J Casademont et al.


34. Abe K, Matsuo Y, Kadekawa J, Inoue S & Yanagihara T.Measurement of tissue oxygen consumption in patientswith mitochondrial myopathy by noninvasive tissueoximetry. Neurology 1997; 49:837–841.

35. Beekvelt M, Engelen B, Wevers R & Colier W. Quantitativenear-infrared spectroscopy discriminates between mito-chondrial myopathies and normal muscle. Annals ofNeurology 1999; 46:667–670.

36. Parry A & Matthews PM. Roles for imaging in under-standing the patophysiology, clinical evaluation, andmanagement of patients with mitochondrial disease.Journal of Neuroimaging 2003; 13:293–302.

37. Argov Z, De Stefano N & Arnold DL. ADP recovery aftera brief ischemic exercise in normal and diseased humanmuscle – a 31P MRS study. NMR in Biomedicine 1996;9:165–172.

38. Matthews PM, Allaire C, Shoubridge EA, Karpati G,Carpenter S & Arnold DL. In vivo muscle magnetic reso-nance spectroscopy in the clinical investigation ofmitochondrial disease. Neurology 1991; 41:114–120.

39. Mattei JP, Bendahan D & Cozzone P. P-31 magnetic reso-nance spectroscopy. A tool for diagnostic purposes andpathophysiological insights in muscle diseases. Reumatismo2004; 56:9–14.

40. Argov Z. Functional evaluation techniques in mitochon-drial disorders. European Neurology 1998; 39:65–71.

41. Cea G, Bendahan D, Manners D, Hilton-Jones D, Lodi R,Styles P & Taylor DJ. Reduced oxidative phosphorylationand proton efflux suggest reduced capillary blood supply inskeletal muscle of patients with dermatomyositis andpolymyositis: a quantitative 31P-magnetic resonance spec-troscopy and MRI study. Brain 2002; 125:1635–1645.






Chronic use of antiretrovirals (ARVs) to treat HIV infec-tion, along with more prolonged patient survival, hasbeen associated with an increase in adverse drug effectsin HIV-infected patients on treatment. It has beenproposed that some of these adverse effects (includingmyopathy, cardiomyopathy, anaemia, hyperlactataemia/lactic acidosis, pancreatitis, polyneuritis and lipodys-trophy) could be mediated by mitochondrial (mt) toxicity.From the experimental data, it has been proposed thatnucleoside analogue reverse transcriptase inhibitors(NRTIs) also inhibit γ-polymerase, the enzyme devoted toreplicate (and, to a lesser extent, repair) mtDNA. It is nowwidely accepted that the use of most NRTIs in HIV-infected patients is associated with mtDNA depletion.

Although cross-sectional studies suggest that certainARVs, especially stavudine, are more toxic to mitochon-dria, the differences among different highly active ARVtherapy (HAART) schedules detected in the analysis oflongitudinal studies are not so clear. These types of studyin previously untreated individuals suggest that thegreatest mtDNA loss appears at the beginning of thetreatment. Conversely, in ARV-experienced patients, thepotential beneficial effects of HAART changes in terms ofmtDNA content remain controversial and must be furtherinvestigated. Functional studies accompanying geneticinvestigations are needed for the correct pathogenicinterpretation of the mtDNA abnormalities.

Mitochondrial studies in HAART-related lipodystrophy:from experimental hypothesis to clinical findingsÒscar Miró*, Sònia López, Francesc Cardellach and Jordi Casademont

Mitochondrial Research Laboratory, Department of Internal Medicine, Hospital Clínic, IDIBAPS, Barcelona, Catalonia, Spain


The clinical use of antiretrovirals (ARVs) to treatHIV infection began in 1986 with the introduction ofzidovudine (AZT), an analogue of thymidine nucleo-side with proven capacity to inhibit HIV reversetranscriptase (RT). Since then, more than 20 ARVsthat act at different steps of the HIV life cycle havebeen approved. With this wide therapeutic arsenal,the current standard treatment for HIV infectionconsists of a combination of several ARVs in so-calledhighly active ARV therapy (HAART). As a conse-quence, HAART use has achieved a marked decreasein patient mortality and has shifted the concept ofHIV infection from a highly mortal disease to achronic illness.

However, chronic use of ARVs together withprolonged patient survival has also been associatedwith an increase in adverse drug effects. It has beenproposed that some of these adverse effects (includingmyopathy, cardiomyopathy, anaemia, hyperlac-tataemia/lactic acidosis, pancreatitis, polyneuritis andlipodystrophy) could be mediated by mitochondrial(mt) toxicity. Nonetheless, despite the large number ofbasic and clinical studies published on this hypothesisduring the last 10 years, a unifying theory that explains

the clinical manifestations of ARV mt damage is stilllacking. One of the main reasons for this is that mostof these studies have been performed in vitro and wereeither non-reproducible or have not been examined inthe setting of human studies. Consequently, it iscurrently unknown why certain patients developadverse effects in a particular tissue or why patientswith similar accumulated doses of ARVs expressdifferent patterns of adverse effects. It is possible thatARV-related factors (different rates of tissue incorpora-tion, transportation into mt compartment or intra-mtphosphorylation for each ARV), patient-related factors(mtDNA polymorphisms) or tissue-related factors[oxidative phosphorylation (OXPHOS) dependence]play a significant role in this heterogeneity. Therefore,while for some of these adverse effects (such as toxicmyopathy or lactic acidosis) a strong relationship withmt dysfunction has been proven [1–6], in others (espe-cially lipodystrophy) controversies remain. In thisreview, we cover the field from experimental hypoth-esis to clinical studies and analyse the level of evidencewith respect to the relationship between ARV adverseeffects and mt toxicity, with particular attention to mtparticipation in lipodystrophy.

Introduction

Molecular basis of ARV toxicity on mitochondria

In addition to inhibiting HIV-RT, in vitro studiessuggest that nucleoside analogue RT inhibitors(NRTIs) are also able to inhibit β and γ human DNApolymerases, although a current demonstration of suchdirect inhibition by NRTIs in humans is lacking. Froma pathogenic point of view, whereas the inhibition of β-polymerase (devoted to the repair nuclear of DNA)seems not to be of clinical relevance, the inhibition ofγ-polymerase (γ-pol, devoted to the replication and, toa lesser extent, the repair of mtDNA) has beenproposed to participate in most of the secondary effectsassociated with the clinical use of NRTIs [7]. Althoughγ-pol inhibition is considered a specific class effect ofthese drugs, the magnitude is not the same for allNRTIs, at least under experimental conditions. Basedon experimental laboratory data, different NRTIs havebeen classified from a higher potency to impair γ-polactivity to a lower potency as follows: zalcitabine(ddC) > didanosine (ddI) > stavudine (d4T) >>> AZT >lamivudine (3TC) > abacavir (ABV) = tenofovir (TDF)[8–10].

NRTIs inhibit γ-pol through four different mecha-nisms encompassing their effects as: i) mtDNA chainterminators (once incorporated into a growing strand,DNA replication is abruptly halted), ii) competitiveinhibitors (competing with natural nucleotides to beincorporated into growing DNA chains by γ-pol),iii) inductors of errors in the fidelity of mtDNA repli-cation (inhibiting the exonucleolytic proofreadingfunction of γ-pol) and iv) contributors to the decreaseof mtDNA reparatory exonuclease activity (resistingexonucleolytic removal by exonuclease activity of γ-polbecause of the lack of the group 3′OH in NRTIs) [11].As a final consequence, the efficiency of γ-pol isdecreased and the whole cellular content of mtDNA isreduced, while the percentage of point mutations [12]and deletions [13] in such genomes increases. SincemtDNA only codifies for functional proteins corre-sponding to mt respiratory chain complexes I, III, IV[cytochrome C oxidase (COX)] and V, the final andonly possible consequence of mtDNA damage (if themagnitude is great enough to surpass compensatorymechanisms) is to cause respiratory chain dysfunctionand low ATP synthesis. Other studies carried out ondifferent cell lines have also demonstrated decreasedsynthesis of some of these mt-encoded proteins [14,15].Furthermore, respiratory chain dysfunction can cause aloss of mt membrane potential and an increase in mt-driven apoptosis, a cascade of events that has beendemonstrated for AZT and d4T [16].

Experimental studies have also invoked other addi-tional mechanisms aside from γ-pol inhibition to

completely explain NRTI-associated mt toxicity. Forexample, AZT is able to i) inhibit the ATP/ADPtranslocator from rat liver and heart in vitro, therebylimiting the OXPHOS mt capacity [17,18], ii) reduceprotein glycosylation [19] and iii) to decrease proteinsynthesis [20].

The effects of ARV drug classes other than NRTIsagainst mitochondria have been less frequently studiedand evaluated. Although it seems that non-NRTIs(NNRTIs) have no toxic effects on mtDNA, they couldinterfere with apoptotic pathways and eventually leadto some secondary harmful effects against mitochon-dria. Recent data indicate that in laboratory assays,efavirenz (EFV) acts as an inductor of the caspasa-dependent apoptotic mt pathway [21]. Also, few andcontroversial data have been reported regarding mteffects of protease inhibitors (PIs). While some authorshave found that PIs can induce loss of mt membranepotential [22], others have suggested that PIs couldexert a beneficial role due to their anti-apoptotic prop-erties [23]. In a very recent review, Badley identified atleast five distinct mechanisms for the anti-apoptoticeffects of PIs: i) decreasing expression of apoptosis regulatory molecules, ii) caspase inhibition, iii) alteringproliferation, iv) inhibiting calpain and v) avoiding lossof mt transmembrane potential [24]. However, undercertain circumstances (particularly high doses of PIs) aparadoxical pro-apoptotic effect can be observed intransformed cell lines in vitro and implanted mousemodels [24]. Clearly, further studies are required withthis drug class to define the exact interactions with mito-chondria, especially with apoptotic pathways. Finally,there are no current reports evaluating the effects offusion inhibitors on mitochondria.

The bulk of data generated under experimental labo-ratory conditions, briefly mentioned above, have beenof crucial relevance in order to propose and, in somecases define, the exact mechanisms by which ARVcause mt side effects. However, results from in vitroexperimental studies on cultured cells or animalscannot always be directly extrapolated to what occursin vivo in HIV-infected individuals. Laboratory modelsusually consist of non-HIV infected cells or animalsand, nowadays, there are data consistently indicatingthat HIV itself causes some mt disarrangements,including mtDNA depletion [4,25–28] and respiratorychain dysfunction [25–29]. Thus, experimental studiesdo not take into consideration the role of HIV in facil-itating or magnifying ARV-related mt toxic effects anddo not include the beneficial effects of ARV in limitingHIV-related mt damage by controlling HIV infection.Additionally, ARV pharmacokinetics are not accountedfor in models based on cell cultures, and the effects ofthe long-term use of ARVs are probably not accuratelyevaluated either. Moreover, experimental studies are

Ò Miró et al.


mainly limited to ascertaining the effects of an isolatedARV and, in clinical practice, ARVs are managed ascombinations of three or four drugs that are concomi-tantly administered to patients. Finally, the exact path-ogenic significance of experimental findings to explaincertain adverse effects (such as lipodystrophy) whichappear during HAART, is not established by cellularmodels. Therefore, this review encompasses mt datafrom studies performed in HIV-infected patientsreceiving ARV who have developed lipodystrophy.

Cross-sectional studies in HIV-infected individuals developing lipodystrophy

The first direct data of mt involvement in lipodys-trophy was described in a case report of an HIV-infected woman suffering from lipodystrophy. Thepatient exhibited multiple mtDNA deletions in skeletalmuscle and subcutaneous fat along with a markedrespiratory chain dysfunction in skeletal muscle andperipheral blood mononuclear cells (PBMCs) [30].Soon after this, mtDNA depletion was found in subcu-taneous fat of eight patients developing lipodystrophy[31]. Since then, case series and cross-sectional studieshave both progressively appeared. Currently, mtabnormalities (and especially mtDNA depletion) havebeen identified in several tissues of HIV-infectedpatients with lipodystrophy on HAART, includingskeletal muscle [13,32,33], liver [32], adipose tissue[13,31,34,35], sperm [36] and PBMCs [12,37].However, some other authors have not found mtabnormalities [38–41]. Table 1 summarizes thepublished data from transversal studies of HIVpatients developing lipodystrophy. As one can see, theevaluated tissues are diverse and there is great hetero-geneity of the methodologies for studying mitochon-dria. For example, Southern blot methodology tomeasure mtDNA content has been replaced by real-time PCR technology, which renders greater sensi-tivity, accuracy and reliability than the former.Moreover, it is highly unusual for a single work toprovide morphological, genetic and functional data onmitochondria. These facts can explain, at least in part,the lack of current consensus regarding the exact roleof mt dysfunction in lipodystrophy. Additionally, sincethe majority of data comes from HIV lipodystrophicpatients who have been receiving ARV for many years,there are important limitations in interpreting theresults. For example, the prior drug exposure isdifferent in practically every patient and other uncon-trolled patient-related factors [such as age, smokinghabit, intake of drugs (other than ARV) which caninterfere with mt function] can act as confoundingfactors, which may severely limit the power of thecross-sectional studies.

In addition, mtDNA depletion has also beendescribed in patients not showing clinically relevantARV adverse effects [42–44]. Some cross-sectionalstudies have reported that, in asymptomatic individ-uals, mtDNA depletion is greater in patients receivingd4T as the backbone of HAART in comparison withother HAART regimens [43–45]. This is consistentwith the greater in vitro affinity of this drug for γ–polthan other currently used NRTIs. However, the findingof mtDNA depletion in asymptomatic individualslimits the pathogenic conclusions from the aforemen-tioned transversal studies of patients with lipodys-trophy, since mtDNA depletion could be interpreted asa class drug effect of NRTI that, if investigated, may bedemonstrable in most patients receiving such drugs,irrespective of the presence or absence of adverseeffects. In fact, it has been reported very recently thatmtDNA depletion is even present in asymptomaticHIV-uninfected infants born to HIV-infected womenreceiving ARV during pregnancy [46]. There are, there-fore, reasonable doubts regarding the real value ofabnormal findings in HIV-infected individuals withlipodystrophy. In this setting, data from longitudinalstudies evaluating the same mt parameters using thesame tissues from the same individuals should help tobetter understand the findings reported by cross-sectional studies.

Longitudinal studies in previously untreatedHIV-infected individuals

Sequential studies performed in naive patients startingARV are of special interest because they eliminate thehypothetical effects of ARV taken by patients prior tothe current ARV or HAART regimen that is being eval-uated. The main endpoint evaluated in such studies isusually the mtDNA content, since this is the directeffect of NRTIs. In a pioneering study, Reiss’ group[47] reported the effects on the mtDNA content ofPBMCs of starting ARV therapy with different ARVstrategies, prior to the HAART era. They observedthat, after 1 year of treatment, patients receiving AZTin monotherapy exhibited a 27% decrease of mtDNAwith respect to baseline and that, when AZT was asso-ciated with ddC or ddI, the decrease was 44% and49%, respectively. It is remarkable that the greatestpart of this molecular side effect was already present asearly as 4 weeks after starting the NRTIs. Morerecently, these investigators have also studied HIV-naive patients starting HAART and have found that,after 4 years on treatment, both d4T- and AZT-basedHAART are associated with a profound mtDNA deple-tion in PBMCs, with this decrease being greater in theformer HAART schedules (75% of decrease) than inthe latter (63% of decrease) [48]. Our laboratory has


Mitochondrial studies in HAART-related lipodystrophy

studied 11 patients naive for ARV, four of them startingwith d4T+ddI-based HAART and seven of themstarting with AZT+3TC-based HAART. As with previ-ously discussed studies, we have also found greaterharmful effects of d4T on PBMCs’ mtDNA abundance,with a 28% decline in mtDNA content 6 months afterstarting HAART containing d4T+ddI, a situation thatit is not observed in those who started HAARTcontaining AZT+3TC.

However, not all longitudinal studies have showngreater mtDNA depletion in HAART schemescontaining d4T. Petit et al. [45] also evaluated the effect

of starting four different HAART regimens on mtDNAcontent of PBMCs after a variable time on treatment(from 50–80 weeks). They found more modest negativeeffects on mtDNA abundance (ranging from 15–38% ofreduction) than those found by Reiss et al. and they didnot find clear differences between schemes containingd4T and those containing AZT. Interestingly, thesequential analysis of mtDNA content evolutiondemonstrates again that the greatest decay is achievedduring the first weeks of treatment. Nolan’s group hasbeen the only team to study the effects of the introduc-tion of HAART on mtDNA content in the subcutaneous

Ò Miró et al.


Table 1. Results of cross-sectional studies published until December 2004 in HIV-patients receiving ARV with lipodystrophy

Reference Year Tissue n Morphology mtDNA MRC function

Miro et al. [30] 2000 Skeletal muscle 1 Lipid+ M. deletions Abnormal (C3 def., C4 def., O2

COX–/SDH+ consumption def.)Fat 1 ? M. deletionsBlood cells 1 — Normal Abnormal (C3 def., C4 def., O2

consumption def.)

Shikuma et al. [31] 2001 Fat 8 ? Depletion ?

Zaera et al. [13] 2001 Skeletal muscle 7 Lipid+ M. deletions Abnormal (C3 def., C4 def., O2

consumption def.)Fat 2 ? M. deletions ?

White et al. [36] 2001 Sperm 3 ? M. deletions ?

Walker et al. [34] 2002 Fat 11 Lipid+ Depletion ?mt. inclusions

Cossarizza et al. [40] 2002 Blood cells 6 Normal Normal Normal

McComsey et al. [39] 2002 Blood cells 10 ? Normal ?

Roge et al. [41] 2002 Skeletal muscle 7 ? ? Normal

Vittecoq et al. [32] 2002 Skeletal muscle 19 COX-/SDH+/ M. deletions, Abnormal (C1 def., C3 def., C4 def.)COX-II def. depletion

Liver 5 ? Depletion Abnormal (C4 def.)(one out of three cases)

Blood cells 12 ? Normal Normal

Miro et al. [37] 2003 Blood cells 12 ? Depletion Abnormal (C3 def., C4 def.)

Cossarizza et al. [38] 2003 Blood cells 23 ? Increase ?

Martin et al. [12] 2003 Blood cells 5 ? Point mutations ?

Chapplain et al. [35] 2004 Skeletal muscle 10 COX– ? Abnormal (C3 def., C4 def.)

Christensen et al. [33] 2004 Fat 13 ? Depletion ?Blood cells 13 ? Normal ?

M, multiple; C1, C3 and C4, complexes I, III and IV of the mt respiratory chain, respectively; n, number of patients studied; ?, not performed; lipid+, lipid deposition;COX–, cytochrome c oxidase negative fibres; mt, mitochondrial; SDH+, succinate dehydrogenase hyper-reactive fibres; def., deficiency.

fat of naive patients [49] – the target tissue of thelipodystrophy syndrome. They found that whenHAART included AZT+3TC, patients developed a 78%decrease in mtDNA after 24 weeks of treatment,whereas when HAART included d4T+3TC, the magni-tude of the decrease was 58%. They have furtherreported that, in such patients, the decrease in mtDNAfat content is accompanied by COX deficiencies demon-strated through immunohistochemical reactions [50].

Taken as a whole (Figure 1), the aforementionedresults indicate that commencing HAART is uniformlyassociated with mtDNA depletion. As previouslydiscussed, the vast majority of cross-sectional studieshave found greater mt toxicity for d4T-based HAARTthan other HAART schedules. However, no clear conclu-sions regarding a greater capacity to induce mtDNAdepletion by a particular ARV or HAART scheme can bedepicted from the data reported in longitudinal analysisof previously untreated patients. Additionally, such adecline seems to mainly occur early after starting ARV.This observation is consistent with the cross-sectionalstudy performed in liver by Walker et al. [51]. Theyfound that mtDNA content declines during the initial 6months of treatment with dideoxynucleotides, with nofurther decline beyond this time. One possible explana-tion is that while HAART adverse effects on mtDNAkinetics due to γ-pol inhibition are clearly manifest atinitial stages of treatment, they are further counteracted

by the reduction of HIV viraemia achieved by HAART.Since it has been demonstrated that HIV infection per seis associated with a decrease in mtDNA content[4,25,28], the control of HIV infection may limit the mtside effects of HIV itself. As a result, the initial exponen-tial decline in mtDNA content may be followed by asteady-step phase (Figure 2).

Longitudinal studies of the effects of HAARTswitching in HIV-infected individuals

From a clinical point of view, it seems that once lipody-strophy appears, changes in HAART schedules do notlead to a rapid improvement of the syndrome. Onepossible explanation could be that adipocytes involved



100

80

60

40

20

0 0 25 50 75 100 125

AZT monotherapy (n=19) [47]AZT+ddC (n=14) [47]AZT+ddI (n=13) [47]AZT+ddC+RTV (n=10) [45]HAART with AZT+3TC (n=3) [49]HAART with AZT (n=8) [48]AZT+3TC+ddI (n=5) [45]

HAART with d4T (n=4) [49]d4T+ddI+RTV (n=12) [45]HAART with d4T (n=15) [48]d4T+3TC+IDV (n=6) [45]

Studies on PBMCsStudies on adipose tissue

150 175 200 225 Weeks after initiating ARV treatment

% o

f mtD

NA

(com

pare

d w

ith b

asel

ine)

Figure 1. Changes in mtDNA content in HIV-naive patientsstarting antiretrovirals

Longitudinal studies published up to December 2004. n, number of patientsstudied; ARV, antiretroviral; HAART, highly active antiretroviral therapy; mt,mitochondrial; PBMCs, peripheral bloodmononuclear cells; 3TC, lamivudine;ABV, abacavir; AZT, zidovudine; ddC, zalcitabine; ddI, didanosine; d4t, stavu-dine; IDV, indinavir; RTV, ritonavir.

100%

0%

Normality

HIVinfection

HAARTinitiation

Precipitating event(rebound of HIV viraemia, switch to a more

mitotoxic HAART regimen, introduction of other drugs that interact with

mitochondria (ribavirine, valproic acid), failure of up-regulatory mt mechanisms,

other ‘mitotoxic’ factors, individual unknown factors, etc)

Asymptomatic phase

Mixed HIV/HAART effects

Steady-stateExponentialdecrease

Symptomatic phase(that is, hyperlactataempolyneuropathy, lipodystrophy)

Pure HIVeffects

Elapsed time

Rela

tive

effe

cts

of H

IV

on m

tDN

A co

nten

t Re

lativ

e ef

fect

s of

HAA

RT

on m

tDN

A co

nten

t O

vera

ll m

tDN

A c

onte

nt

100%

0% Elapsedtime

100%

0% Elapsed time

Figure 2. Proposed model of action of HIV and ARVs onmtDNA content

ARV, antiretroviral; mt, mitochondrial; HAART, highly active antiretroviraltherapy.

in lipodystrophic changes are severely and, for the mostpart, inevitably damaged. Since patients with lipodys-trophy usually exhibit a mixed pattern of peripherallipoatrophy and central adiposity, it has been postu-lated that apoptotic activation could be responsible forlipoatrophy while decreased mt metabolism couldresult in lipid accumulation in visceral and centraladipocytes [49].

Based on experimental data regarding the affinity ofNRTIs for γ-pol, it has been proposed that switching toa HAART scheme that does not contain dideoxynu-cleotides could eventually improve lipodystrophy. Veryrecently, data from the MITOX study [52] have shownthat, in patients receiving HAART who have developedlipodystrophy, the substitution of d4T or AZT by ABV(one of the NRTIs with the weakest affinity for γ-pol),is associated with a significant increase in body fatcontent 2 years after ABV introduction. Unfortunately,no molecular studies of mtDNA content at 2 yearsaccompanied this report. The demonstration of thereversibility of mtDNA depletion associated withHAART changes occurring concurrently with theregression of lipodystrophy would strengthen the exis-tence of an mt role in the development of thissyndrome. This close relationship between clinicalmanifestations and laboratory findings has been betterapproached for HAART-related hyperlactataemia. Forexample, Montaner et al. [53] studied eight patientsreceiving d4T-based HAART who developed hyperlac-tataemia, and demonstrated that, after discontinuationor substitution of d4T, the disappearance of the clinicalsigns and symptoms correlated with an increase of over200% in the mtDNA content in PBMCs. Similarly, wehave reported that reversibility of mt abnormalitieswith HAART interruption is not limited to mtDNAdepletion in patients developing hyperlactataemia, butalso implicates the restoration of previously alteredrespiratory chain function [54].

Unfortunately, the data regarding the benefits interms of mtDNA content of switching a HAARTschedule are scarce and have often been obtained in avery limited number of patients with contradictoryresults [49,55–58] (Figure 3). On one hand, Carr’sgroup [57] reported the largest cohort in which sequen-tial mtDNA content has been determined and did notfind evidence of any significant mtDNA change afterswitching from HAART containing a thymidineanalogue to HAART containing ABV, at least after 24weeks of follow-up. Additionally, the behaviour of thesepatients was the same as that of a control group inwhich no HAART changes were introduced. Consistentwith Carr et al.’s results, we have found that the intro-duction of a nucleoside-sparing HAART (nevirapineplus lopinavir/ritonavir) to ARV-experienced patients isassociated only with a trend toward increasing mtDNA

without changes in respiratory chain function evaluatedthrough COX activity [58]. Indeed, this group ofpatients showed very similar changes as those inpatients who continued with the same NRTI-containingHAART scheme (Figure 4) [57]. It is noteworthy thatthese non-relevant effects of switching the HAARTregimen obtained by our group and Carr’s wereachieved using PBMCs of asymptomatic individuals.Although some doubts have been raised regarding thesensitivity of this biological sample to detect mt abnor-malities, we have demonstrated that changes inmtDNA are present in asymptomatic patients receivingARV, thereby demonstrating that PBMCs are reliable inthe investigation of mt disorders [44].

In a clash with these results, Nolan’s group [49]found a mean increase of 650% of mtDNA in subcuta-neous fat from three patients with lipodystrophy whowere switched from d4T-based HAART to a HAARTcombination consisting in AZT+3TC+ABV. Similarly,McComsey’s group [55] has reported that mtDNAincreased around 100% in the subcutaneous fat ofpatients with lipodystrophy in whom a d4T-basedHAART was replaced by an AZT- or ABV-basedHAART scheme. In a more recent and extensive paper,they studied mtDNA content in patients treated with

Ò Miró et al.


0 50

100 150 200 250 300 350 400 450 500 700 750

0 5 10 15 20 25

Switched from d4T-based to AZT- or ABV-based HAART, fat samples (n=11) [55]Switched from d4T-based HAART to AZT+3TC+ABV, fat samples (n=3) [49]Switched from d4T-based HAART to AZT or ABV-based HAART, skeletal muscle samples (n=12) [56]Switched from d4T-based HAART to AZT or ABV-based HAART, fat samples (n=13) [56]Switched from thymidine-based to ABV-based HAART, PBMCs (n=39) [57]Switched from NRTI-based HAART to NVP+LPV/rit, PBMCs (n=5) [58]Switched from d4T-based HAART to AZT- or ABV-based HAART, PBMCs (n=13) [56]

30 35 45 50 40 Weeks after switching

% o

f mtD

NA

(com

pare

d w

ith b

asel

ine)

Figure 3. Effects of HAART changes on mtDNA content

Longitudinal studies published until January 2005. n, number of patientsstudied; 3TC, lamivudine; ABV, abacavir; AZT, zidovudine; LPV/rit,lopinavir/ritonavir; NVP, nevirapine; HAART, highly active antiretroviral therapy;mt, mitochondrial; PBMCs, peripheral bloodmononuclear cells.

d4T-based HAART and lipodystrophy, and found thatthe replacement of d4T by AZT or ABV was accompa-nied by a rebound in mtDNA of 141% in skeletalmuscle, 146% in adipose tissue and 369% in PBMCsat week 48 [56]. Additionally, they also observed arestoration of mt respiratory chain complex I activity inskeletal muscle [56], as well as a decrease in apoptosisscores in adipose tissue after the switching. It is note-worthy that this study simultaneously investigates, forthe first time, sequential genetic and functional mtparameters along with clinical data from patients withlipodystrophy in whom HAART was switched, and itconstitutes the first evidence that the substitution ofABV or AZT for d4T improves the subcutaneous fatcontent as well as reverting abnormal mt indices andfat apoptosis. The demonstration of deficiencies in thediverse tissues evaluated, as well as a close correlationbetween mtDNA content in PBMCs and in fat, rein-forces the usefulness of PBMCs as subrogates of othermore appropriate, but more difficult to obtain, tissues.As the only caveat, the McComsey et al. study [55]

lacks a control cohort group to assess the exact effectsof pharmacological intervention.

Overall, it is important to note that investigations ofmtDNA content are not sufficient to correctly ascertainthe effects of ARV on mitochondria. The study of func-tional repercussions of the eventual genetic deficienciesappearing during HAART is probably a more phys-iopathological approach to knowing the real involvementof mitochondria in the development of lipodystrophy[59]. For example, we have recently reported the presenceof up-regulatory mechanisms that compensate formtDNA depletion developed by patients on treatmentwith ddI+d4T. Such mechanisms allow maintenance ofcorrect COXII expression (a protein codified bymtDNA, which was depleted in the patients studied), aswell as a normal COX activity [60]. Therefore, mtDNAstudies only cover one of the multiple aspects of mt func-tion and, consequently, can only offer partial explana-tions. On the other hand, lipodystrophy probably has amultifactorial mt aetiology where events other thanmtDNA depletion play a pivotal role. Among them,ARV modifications of mt-dependent apoptotic path-ways, as well as of overall biology of adipose tissue, arebeing intensively investigated [61]. Regardless of themechanism, the important question that remains to beanswered is how altered mt function leads to the massivemodifications observed in adipose tissue of patientsdeveloping HAART-related lipodystrophy.

Conclusions

Nowadays, it has been demonstrated that the use ofmost of NRTIs in HIV-infected patients is associatedwith mtDNA depletion. Although cross-sectionalstudies suggest that certain ARVs, especially d4T, aremore toxic to mitochondria, the differences amongdifferent HAART schedules detected in the analysis oflongitudinal studies are not so clear. This kind of studyin previously untreated individuals suggests that thegreatest mtDNA loss appears at the beginning of thetreatment. Conversely, in ARV-experienced patients, thepotential beneficial effects of HAART switches in termsof affecting mtDNA content remain controversial andmust be further investigated. Functional studies accom-panying genetic investigations are needed for the correctpathogenic interpretation of mtDNA abnormalities.

Grants

Fundación para la Investigación y la Prevención delSida en España (FIPSE 3102-00 and 3161/00A),Fundació La Marató de TV3 (020210), Redes deInvestigación en Mitocondrias (V2003-REDC06E-0) ySida (Rg-173) and Suport a Grups de Recerca2001/SGR/00379.



0 20 40 60 80

100 120 140 160 180

0 24

NVP group (n=5)NRTI group (n=5)

48 Time, weeks

% m

t DN

A ac

tivity

(com

pare

d w

ith b

asel

ine)

0

20

40

60

80

100

120

140

0 24

NVP group (n=5)NRTI group (n=5)

48Time, weeks

% C

ompl

ex IV

act

ivity

(com

pare

d w

ith b

asel

ine)

Figure 4. Longitudinal study comparing the effects of beingmaintained on a NRTI-containing HAART (NRTI group) orswitched to a NRTI-sparing HAART (NVP group) on (A) mtDNAcontent and (B) complex IV activity

n, number of patients studied; NVP, nevirapine; HAART, highly active antiretro-viral therapy; mt, mitochondrial; NRTI, nucleoside reverse transcriptaseinhibitor.

A

B

References1. Dalakas MC, Illa I, Pezeshkpour GH, Laukaitis JP, Cohen

B & Griffin JL. Mitochondrial myopathy caused by long-term zidovudine therapy. New England Journal of Medicine1990; 332:1098–1105.

2. Grau JM, Masanes F, Pedrol E, Casademont J, Fernandez-Sola J & Urbano-Marquez A. Human immunodeficiencyvirus type 1 infection and myopathy: clinical relevance ofzidovudine therapy. Annals of Neurology 1993; 34:206–211.

3. Masanes F, Barrientos A, Cebrian M, Pedrol E, Miró O,Casademont J & Grau JM. Clinical, histological and molec-ular reversibility of zidovudine myopathy. Journal of theNeurological Sciences 1998; 159:226–228.

4. Cote HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyMV & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV-infected patients. NewEngland Journal of Medicine 2002; 346:811–820.

5. Church JA, Mitchell WG, Gonzalez-Gomez I, Christensen J,Vu TH, Dimauro S & Boles RG. Mitochondrial DNA deple-tion, near-fatal metabolic acidosis, and liver failure in anHIV-infected child treated with combination antiretroviraltherapy. Journal of Pediatrics 2001; 138:748–751.

6. Miró O, Lopez S, Martinez E, Rodriguez-Santiago B, BlancoJL, Milinkovic A, Miro JM, Nunes V, Casademont J, GatellJM & Cardellach F. Short communication: reversible mito-chondrial respiratory chain impairment during symptomatichyperlactatemia associated with antiretroviral therapy. AIDSResearch & Human Retroviruses 2003; 19:1027–1032.


8. Lim SE & Copeland WC. Differential incorporation andremoval of antiviral deoxynucleotides by human DNA poly-merase gamma. Journal of Biological Chemistry 2001;276:23616–23623.


10. Nolan D & Mallal S. Complications associated with NRTItherapy: update on clinical features and possible pathogenicmechanisms. Antiviral Therapy 2004; 9:849–863.

11. Lewis W, Day BJ & Copeland WC. Mitochondrial toxicityof NRTI antiviral drugs: an integrated cellular perspective.Nature Reviews 2003; 2:812–822.

12. Martin AM, Hammond E, Nolan D, Pace C, Den Boer M,Taylor L, Moore H, Martinez OP, Christiansen FT & MallalS. Accumulation of mitochondrial DNA mutations in humanimmunodeficiency virus-infected patients treated with nucle-oside-analogue reverse transcriptase inhibitors. AmericanJournal of Human Genetics 2003; 72:549–560.

13. Zaera MG, Miró O, Pedrol E, Soler A, Picon M, CardellachF, Casademont J & Nunes V. Mitochondrial involvement inantiretroviral therapy-related lipodystrophy. AIDS 2001;15:1643–1651.

14. Pan-Zhou XR, Zhou XJ, Sommadossi JP & Darley-UsmarVM. Differential effects of antiretroviral nucleoside analogson mitochondrial function in HepG2 cells. AntimicrobialAgents & Chemotherapy 2000; 44:496–503.

15. Walker UA, Setzer B & Venhoff N. Increased long termmitochondrial toxicity in combinations of nucleosideanalogue reverse-transcriptase inhibitors. AIDS 2002;16:2165–2173.

16. Caron M, Auclair M, Lagathu C, Lombes A, Walker UA,Kornprobst M & Capeau J. The HIV-1 nucleoside reversetranscriptase inhibitors stavudine and zidovudine alteradipocyte functions in vitro. AIDS 2004; 18:2127–2136.

17. Barile M, Valenti D, Passarella S & Quagliarello E. 3′azido-3′deoxythimidine uptake into isolated rat liver mitochondriaand impairment of ADP/ATP translocator. BiochemicalPharmacology 1997; 53:913–920.

18. Valenti D, Barile M & Passarella S. AZT inhibition of theADP/ATP antiport in isolated rat heart mitochondria.International Journal of Molecular Medicine 2000; 6:93–96.

19. Hall ET, Yan JP, Melancon P & Kuchta RD. 3′azido-3′deoxythimidine potently inhibits protein glycosylation.Journal of Biological Chemistry 1994; 269:14355–14358.

20. Hoobs GA, Keilbaugh SA, Rief PM & Simpsom MV.Cellular targets of 3′azido-3′deoxythimidine: an early (non-delayed) effect on oxidative phosphorylation. BiochemicalPharmacology 1995; 50:381–390.

21. Pilon AA, Lum JJ, Sanchez-Dardon J, Phenix BN, Douglas R& Badley AD. Induction of apoptosis by a nonnucleosidehuman immunodeficiency virus type 1 reverse transcriptaseinhibitor. Antimicrobial Agents & Chemotherapy 2002;46:2687–2691.

22. Nerurkar PV, Pearson L, Frank JE, Yanagihara R &Nerurkar VR. Highly active antiretroviral therapy(HAART)-associated lactic acidosis: in vitro effects of combi-nation of nucleoside analogues and protease inhibitors onmitochondrial function and lactic acid production. Cellular& Molecular Biology 2003; 49:1205–1211.

23. Phenix BN, Lum JJ, Nie Z, Sanchez-Dardon J & Badley AD.Antiapoptotic mechanism of HIV protease inhibitors:preventing mitochondrial transmembrane potential loss.Blood 2001; 98:1078–1085.

24. Badley AD. In vitro and in vivo effects of HIV proteaseinhibitors on apoptosis. Cell Death & Differentiation 2005.In press.

25. Miró O, Lopez S, Martinez E, Pedrol E, Milinkovic A, DeigE, Garrabou G, Casademont J, Gatell JM & Cardellach F.Mitochondrial effects of HIV infection on the peripheralblood mononuclear cells of HIV-infected patients who werenever treated with antiretrovirals. Clinical InfectiousDiseases 2004; 39:710–716.

26. Miura T, Goto M, Hosoya N, Odawara T, Kitamura Y,Nakamura T & Iwamoto A. Depletion of mitochondrialDNA in HIV-1-infected patients and its amelioration by anti-retroviral therapy. Journal of Medical Virology 2003;70:497–505.

27. Cherry CL, Gahan ME, McArthur JC, Lewin SR, Hoy JF &Wesselingh SL. Exposure to dideoxynucleosides is reflectedin lowered mitochondrial DNA in subcutaneous fat. Journalof Acquired Immune Deficiency Syndromes 2002;30:271–277.

28. Chiappini F, Teicher E, Saffroy R, Pham P, Falissard B,Barrier A, Chevalier S, Debuire B, Vittecoq D & Lemoine A.Prospective evaluation of blood concentration of mitochon-drial DNA as a marker of toxicity in 157 consecutivelyrecruited untreated or HAART-treated HIV-positive patients.Laboratory Investigations 2004; 84:908–914.


30. Miró O, Gómez M, Pedrol E, Cardellach F, Nunes V &Casademont J. Respiratory chain dysfunction associated withmultiple mitochondrial DNA deletions in antiretroviraltherapy-related lipodystrophy. AIDS 2000; 14:1855–1857.

31. Shikuma CM, Hu N, Milne C, Yost F, Waslien C, Shimizu S& Shiramizu B. Mitochondrial DNA decrease in subcuta-neous adipose tissue of HIV-infected individuals withperipheral lipoatrophy. AIDS 2001; 15:1801–1809.

32. Vittecoq D, Jardel C, Barthelemy C, Escaut L, Cheminot N,Chapin S, Sternberg D, Maisonobe T & Lombes A.Mitochondrial damage associated with long-term antiretro-viral treatment: associated alteration or causal disorder?Journal of Acquired Immune Deficiency Syndromes 2002;31:299–308.

33. Christensen ER, Stegger M, Jensen-Fangel S, Laursen AL &Ostgergaard L. Mitochondrial DNA levels in fat and bloodcells from patients with lipodystrophy or peripheralneuropathy and the effect of 90 days of high-dose coenzymeQ treatment: a randomized, double blind, placebo-controlledpilot study. Clinical Infectious Diseases 2004;39:1371–1379.

34. Walker UA, Bickel M, Lutke Volksbeck SI, Ketelsen UP,Schofer H, Setzer B, Venhoff N, Rickerts V & Staszewski S.

Ò Miró et al.


Evidence of nucleoside analogue reverse transcriptaseinhibitor-associated genetic and structural defects of mito-chondria in adipose tissue of HIV-infected patients. Journalof Acquired Immune Deficiency Syndromes 2002;29:117–121.

35. Chapplain JM, Beillot J, Begue JM, Souala F, Bouvier C,Arvieux C, Tattevin P, Dupont M, Chapon F, DuvauferrierR, Hespel JP, Rochcongar P & Michelet C. Mitochondrialabnormalities in HIV-infected lipoatrophic patients treatedwith antiretroviral agents. Journal of Acquired ImmuneDeficiency Syndromes 2004; 37:1477–1488.

36. White DJ, Mital D, Taylor S & St John JC. Sperm mitochon-drial DNA deletions as a consequence of long term highlyactive antiretroviral therapy. AIDS 2001; 15:1061–1062.

37. Miró O, Lopez S, Pedrol E, Rodriguez-Santiago B, MartinezE, Soler A, Milinkovic A, Casademont J, Nunes V, Gatell JM& Cardellach F. Mitochondrial DNA depletion and respira-tory chain enzyme deficiencies are present in peripheralblood mononuclear cells of HIV-infected patients withHAART-related lipodystrophy. Antiviral Therapy 2003;8:333–338.

38. Cossarizza A, Riva A, Pinti M, Ammannato S, Fedeli P,Mussini C, Esposito R & Galli M. Increased mitochondrialDNA content in peripheral blood lymphocytes from HIV-infected patients with lipodystrophy. Antiviral Therapy 2003;8:315–321.

39. McComsey G, Tan DJ, Lederman M, Wilson E & Wong LJ.Analysis of the mitochondrial DNA genome in the peripheralblood leukocytes of HIV-infected patients with or withoutlipoatrophy. AIDS 2002; 16:513–518.

40. Cossarizza A, Pinti M, Moretti L, Bricalli D, Bianchi R,Troiano L, Fernandez MG, Balli F, Brambilla P, Mussini C &Vigano A. Mitochondrial functionality and mitochondrialDNA content in lymphocytes of vertically infected humanimmunodeficiency virus-positive children with highly activeantiretroviral therapy-related lipodystrophy. Journal ofInfectious Diseases 2002; 185:299–305.

41. Roge BT, Calbet JA, Moller K, Ullum H, Hendel HW,Gerstoft J & Pedersen BK. Skeletal muscle mitochondrialfunction and exercise capacity in HIV-infected patients withlipodystrophy and elevated p-lactate levels. AIDS 2002;16:973–982.

42. Pace CS, Martin AM, Hammond EL, Mamotte CD, NolanDA & Mallal SA. Mitochondrial proliferation, DNA deple-tion and adipocyte differentation in subcutaneous adiposetissue of HIV-positive HAART recipients. Antiviral Therapy2003; 8:323–331.

43. de Mendoza C, de Ronde A, Smolders K, Blanco F, Garcia-Benayas T, de Baar M, Fernandez-Casas P, Gonzalez-Lahoz J& Soriano V. Changes in mitochondrial DNA copy numberin blood cells from HIV-infected patients undergoing anti-retroviral therapy. AIDS Research & Human Retroviruses2004; 20:271–273.

44. Lopez S, Miró O, Martinez E, Pedrol E, Rodriguez-SantiagoB, Milinkovic A, Soler A, Garcia-Viejo MA, Nunes V,Casademont J, Gatell JM & Cardellach F. Mitochondrialeffects of antiretroviral therapies in asymptomatic patients.Antiviral Therapy 2004; 9:47–55.

45. Petit C, Mathez D, Barthelemy C, Leste-Lasserre T, NaviauxRK, Sonigo P & Leibowitch J. Quantitation of bloodlymphocyte mitochondrial DNA for the monitoring of anti-retroviral drug-induced mitochondrial DNA depletion.Journal of Acquired Immune Deficiency Syndromes 2003;33:461–469.

46. Divi RL, Walker VE, Wade NA, Nagashima K, Seilkop SK,Adams ME, Nesel CJ, O’Neill JP, Abrams EJ & Poirier MC.Mitochondrial damage and DNA depletion in cord bloodand umbilical cord from infants exposed in utero tocombivir. AIDS 2004; 18:1013–1021.

47. Reiss P, Casula M, de Ronde A, Weverling GJ, Goudsmit J& Lange JM. Greater and more rapid depletion of mito-chondrial DNA in blood of patients treated with dual(zidovudine+didanosine or zidovudine+zalcitabine) vs single(zidovudine) nucleoside reverse transcriptase inhibitors. HIVMedicine 2004; 5:11–14.

48. van der Valk M, Casula M, Weverlingz GJ, van Kuijk K, vanEck-Smit B, Hulsebosch HJ, Nieuwkerk P, van Eeden A,Brinkman K, Lange J, de Ronde A & Reiss P. Prevalence oflipoatrophy and mitochondrial DNA content of blood andsubcutaneous fat in HIV-1-infected patients randomly allo-cated to zidovudine- or stavudine-based therapy. AntiviralTherapy 2004; 9:385–393.


50. Hammond E, Nolan D, James I, Metcalf C & Mallal S.Reduction of mitochondrial DNA and respiratory chainactivity occurs in adipocytes within 6–12 months ofcommencing nucleoside reverse transcriptase inhibitortherapy. AIDS 2004; 18:815–817.

51. van der Valk M, Casula M, Weverlingz GJ, van Kuijk K, vanEck-Smit B, Hulsebosch HJ, Nieuwkerk P, van Eeden A,Brinkman K, Lange J, de Ronde A & Reiss P. Depletion ofmitochondrial DNA in liver under antiretroviral therapywith didanosine, stavudine or zalcitabine. Hepatology 2004;39:311–317.

52. Martin A, Smith DE, Carr A, Ringland C, Amin J, Emery S,Hoy J, Workman C, Doong N, Freund J & Cooper DA;Mitochondrial Toxicity Study Group. Reversibility of lipoat-rophy in HIV-infected patients 2 years after switching from athymidine analogue to abacavir: the MITOX ExtensionStudy. AIDS 2004; 18:1029–1036.

53. Montaner JS, Cote HC, Harris M, Hogg RS, Yip B,Harrigan PR & O’Shaughnessy MV. Nucleoside-relatedmitochondrial toxicity among HIV-infected patients receivingantiretroviral therapy: insights from the evaluation of venouslactic acid and peripheral blood mitochondrial DNA.Clinical Infectious Diseases 2004; 38:S73–S79.

54. Miró O, Lopez S, Martinez E, Rodriguez-Santiago B, BlancoJL, Milinkovic A, Miro JM, Nunes V, Casademont J, GatellJM & Cardellach F. Short communication: reversible mito-chondrial respiratory chain impairment during symptomatichyperlactatemia associated with antiretroviral therapy. AIDSResearch & Human Retroviruses 2003; 19:1027–1032.

55. McComsey G & Lonergan JT. Mitochondrial dysfunction:patient monitoring and toxicity management. Journal ofAcquired Immune Deficiency Syndromes 2004; 37:S30–S35.

56. McComsey GA, Paulsen DM, Lonergan JT, HessenthalerSM, Hoppel CL, Williams VC, Fisher RL, Cherry CL,White-Owen C, Thompson KA, Ross ST, Hernandez JE &Ross LL. Improvements in lipoatrophy, mitochondrial DNAlevels and fat apoptosis after replacing stavudine withabacavir or zidovudine. AIDS 2005; 19:15–23.

57. Hoy JF, Gahan ME, Carr A, Smith D, Lewin SR, WesselinghS & Cooper DA. Changes in mitochondrial DNA in periph-eral blood mononuclear cells from HIV-infected patientswith lipoatrophy randomized to receive abacavir. Journal ofInfectious Diseases 2004; 190:688–692.

58. Negredo E, Molto J, Burger D, Cote H, Miró O, Ribalta J,Martinez E, Puig J, Ruiz L, Salazar J, Lopez S, Montaner J,Rey-Joly C & Clotet B. Lopinavir/ritonavir plus nevirapineas a nucleoside-sparing approach in antiretroviral-experi-enced patients (NEKA Study). Journal of Acquired ImmuneDeficiency Syndromes 2005; 38:47–52.

59. Casademont J, Miró O & Cardellach F. Mitochondrial DNAand nucleoside toxicity. New England Journal of Medicine2002; 347:216–218.

60. Miró O, Lopez S, Rodriguez de la Concepcion M, MartinezE, Pedrol E, Garrabou G, Giralt M, Cardellach F, Gatell JM,Vilarroya F & Casademont J. Upregulatory mechanismscompensate for mitochondrial DNA depletion in asympto-matic individuals receiving stavudine plus didanosine.Journal of Acquired Immune Deficiency Syndromes 2004;37:1550–1555.

61. Villaroya F, Domingo P & Giralt M. Lipodystrophy associ-ated with highly active anti-retroviral therapy for HIVinfection: adipocyte as a target of anti-retroviral-inducedmitochondrial toxicity. Trends in Pharmacological Sciences2005; 26:88–93.




Mitochondrial dysfunction has been demonstrated insubcutaneous adipose tissue from lipoatrophic HIV-1-infected patients treated with nucleoside reversetranscriptase inhibitors (NRTIs). To further assess mito-chondrial toxicity, mitochondrial DNA (mtDNA)copies/cell were measured in subcutaneous fat fromvarious sites. Peripheral adipose tissues were obtainedfrom the abdominal wall near the umbilicus, anteriorlateral thigh, and dorsal cervical region of the neck ofindividuals from four cohorts: 1) seven lipoatrophic HIV-1-infected patients receiving a regimen with nucleosidereverse transcriptase inhibitors (NRTIs) as part of highlyactive antiretroviral therapy (HAART) for >6 months; 2)seven non-lipoatrophic HIV-1-infected patients receivingNRTIs-containing HAART; 3) five HIV-1-infected patientson antiretroviral therapy <2 weeks (naive); 4) and fiveHIV-1-negative participants. Along with the adiposetissue samples, peripheral blood mononuclear cells

(PBMC) were also obtained from each patient for mtDNAdepletion examination. Total DNA was isolated andmtDNA copies/cell quantitated by competitive and real-time PCR. MtDNA copies/cell in abdomen, thigh, and neckfat were depleted in lipoatrophic HIV-1 seropositivecompared to the seropositive naive and seronegativecohorts. MtDNA copies/cell in thigh and neck fat werealso decreased in non-lipoatrophic subjects exposed toNRTIs compared with NRTI-naive and HIV seronegativecontrols. PBMC values did not differ among the cohortsand there was no correlation with lipoatrophy state orHIV-1 serostatus. Additionally, differences in mtDNAcopies/cell were observed in the fat depots from seroneg-ative subjects. Thigh fat mtDNA levels were 45–55%lower than abdomen and neck. These studies helpdemonstrate that mtDNA levels can vary in differentsubcutaneous adipose depots suggesting possible meta-bolic differences.

Mitochondrial DNA levels of peripheral bloodmononuclear cells and subcutaneous adipose tissuefrom thigh, fat and abdomen of HIV-1 seropositiveand negative individualsMariana Gerschenson*, Bruce Shiramizu, Daniel E LiButti & Cecilia M Shikuma

Hawaii AIDS Clinical Research Program, Department of Medicine, John A Burns School of Medicine, University of Hawaii, Honolulu, HI,USA

*Corresponding author: Tel: +1 808 737 2751; Fax: +1 808 735 7047; Email: [email protected]


HIV-1 lipodystrophy is a syndrome characterized byalterations in the normal distribution of fat tissueresulting in subcutaneous lipoatrophy of the face, armsand legs as well as increases in visceral fat of theabdomen and back of the neck. Metabolic findings ofhyperlipidaemia and insulin resistance often accom-pany these distressing body morphology changes [1,2].Epidemiological data suggests a strong associationbetween the use of NRTIs and the development oflipoatrophy [3–7]. Mitochondrial involvement in thepathogenesis of HIV-1 lipoatrophy has been hypothe-sized via their role in regulating energy metabolism inadipose tissue [8] and to their known sensitivity toNRTIs [9]. Mitochondria contain their own DNAconsisting of a circular, double stranded DNA moleculeof 16 kb. Although NRTIs preferentially inhibit HIV-1

reverse transcriptase, NRTIs can also inhibit cellularDNA polymerases, most notably mitochondrial DNA(mtDNA) polymerase γ. DNA polymerase γ is a keyregulatory enzyme of mtDNA replication. It has beenhypothesized that inhibition of this enzyme by NRTIsresults in mtDNA depletion and/or impairment in theproduction of mitochondrial enzymes within theadipocyte [10,11]. It is hypothesized that tissue toxici-ties due to NRTIs will occur if mtDNA falls below acritical level, so that the production of mtDNA-encoded protein subunits of the mitochondrial respira-tory chain and RNAs are insufficient to meet cellularenergy requirements.

Recently several studies have shown decreases inmtDNA levels in subcutaneous adipose tissue in lipoa-trophic patients taking NRTIs [12–15]. This has led

Introduction


investigators to query whether mitochondrial parame-ters could be monitored in a non-invasive manner, forexample in peripheral blood mononuclear cells(PBMCs), as in some genetically inherited mitochon-drial diseases [16]. In this study, we measure mtDNAcopies/cell by quantitative PCR in subcutaneous adiposetissues from the abdominal wall near the umbilicus,anterior lateral thigh and dorsal cervical region of theneck, and PBMCs from HIV-1 seropositive lipoatrophicpatients, HIV-1 seropositive non-lipoatrophic, HIV-1seropositive naïve, and seronegative patients.


Patients and specimensAs per guidelines established by the University ofHawaii Institutional Review Board, specimens for thisstudy were obtained without personal identifiers froma previously described cross-sectional 4-cohort study[12] and 5 additional HIV seronegative age and gendermatched controls for the PBMC measurements. Thecohorts consisted of: 1) HIV-1 (+) individuals on NRTI(zidovudine, stavudine and/or didanosine)-containingHAART for more than six months with self-reportedchanges in lipodystrophy which included peripherallipoatrophy following initiation of such therapy (n=3were taking stavudine); 2) HIV-1 (+) individuals onsimilar NRTI-containing HAART without self-reported changes of lipodystrophy (n=4 were takingstavudine) (Table 1); 3) HIV-1 (+) individuals with lessthan two weeks total exposure to antiretroviral therapy(naïve); and 4) individuals seronegative for antibodiesto HIV-1 by ELISA.

Subcutaneous adipose tissue specimens were previ-ously obtained by core needle technique from theabdominal wall near the umbilicus, anterior lateralthigh, and dorsal cervical region of the neck. Thetissues were flash frozen and were stored at –70˚C.Available sample numbers from the four cohorts of thecross-sectional study varied from n=3–10. PBMCs wereisolated by Ficoll gradient and stored viably at –70˚C.Total DNA was isolated using QIAamp DNA BloodMini kit and DNeasy Tissue kit; both are from Qiagen(Qiagen Inc, Valencia, CA, USA). DNA integrity wasexamined by agarose gel electrophoresis. Intact DNAwas assayed for mtDNA copies/cell by real-time PCR.

Quantitative competitive PCR (QC-PCR) mtDNAanalysisA competitive PCR assay to semi-quantitate mtDNAcopy per cell was set up as previously described [17]and used to assay the abdominal tissue. A plasmidcontaining the human mitochondrial gene encoding thesubunit VI of the F0F1 ATPase region and a gDNAinsert from the human FasL gene, spanning the first

exon, was used as a standard. The competitor plasmidwith the embedded mtDNA and gDNA is smaller thanthe target DNA from the specimens, which allows fordifferentiation when size-fractionated on an agarosegel. In order to determine the number of mitochondrialDNA copies per cell, it was necessary to perform twoQC-PCR, one to detect mitochondrial primers, and onewith genomic primers. Serial dilutions of thecompetitor (108–100) were set up with the sameamounts of DNA from the patient sample. The mito-chondrial primers, mt192R (GCTCTAGAAAGA-GATCAGGTTCGTCCTTTAGTG) and mt27D (AAAATGAACGAAAATCTGTTCGCT) amplified a 180 bpfragment of the gene encoding for the subunit VI ofFOF1 ATPase. 276R (GGGGATCCGGT GGCAGCG-GTAGTGGAG) and 60D (GGGAATTCTGAGAA-GAAGTAAAACC GTTTGCTG), the genomic primers,amplified a 259 bp fragment of the Fas Ligand.

PCR preparation and cycling was identical for bothsets of competitive PCRs. Each reaction tube wasprepared in a final volume of 25 µl and contained 1×PCR Buffer, 0.2 mmol/l of each dNTP, 0.2 µmol/l ofeach primer, 1 unit of Amplitaq (Applied Biosystems,Foster City, CA, USA), 1 µl of a known pMITO dilu-tion (ranging from 108 copies per µl to 100 copies perµL) and approximately 100 ng of patient DNA.Cycling conditions were as follows: 94˚C for 5 min, 50cycles of 94˚C for 30 sec, 55˚C for 30 sec and 72˚C for30 sec, with a final hold at 72˚C for 7 min. PCR prod-ucts were visualized on an ethidium bromide stained1% agarose/1.5% low molecular weight agarose geland quantitated using a Biorad imaging densitometer(Bio-Rad Laboratories, CA, USA). In order to deter-mine the copies of mtDNA per cell, the sample valuedetermined with mitochondrial primers was divided bythe value established by the genomic primers and thisratio was multiplied by two, due to there being twocopies of the nuclear-encoded genes in each cell.

Analysis of mtDNA copies/cell by real-time PCRAll fat tissues and PBMCs were assayed using real-timePCR as previously described [18]. Standardization ofreal-time PCR was performed using iQ SYBR greensupermix with the BioRad iCycler real-time instrument(Bio-Rad Laboratories, CA, USA). The mitochondrialprimers, mtDIR (CAC AGA AGC TGC CAT CAAGTA) and mtREV (CCG GAG AGT ATA TTG TTGAAG AG), amplify a region of mtDNA (90 bp) whichencodes for NADH dehydrogenase subunit 2 (90 bp).The genomic primers, GenDIR (GGC TCT GTG AGGGAT ATA AAG ACA) and GenREV (CAA ACC ACCCGA GCA ACT AAT CT) were specific for the regionof the genome encoding the Fas Ligand (98 bp) [18].The PCR products were cloned into plasmid, whichwere used as standard in serial dilutions. Each sample

M Gerschenson et al.



MtDNA levels in PBMCs and fat in HIV lipoatrophic patients

Table 1. Cohort characteristics of lipoatrophic and non-lipoatrophic cohorts

Prior additive exposureCase, n ART at time of biopsy time on ART Age Gender

Non-lipoatrophic (n=7)

1006 11 months 2 months ZDV 51 Md4T/3TC/EFV 3 months ABC

2014 60 months None 50 MZDV/3TC

3015 9 months 12 months ZDV/3TC 33 Md4T/ddI/IDV 24 months ABC

9 months IDV/EFV

4016 60 months d4T/NFV 12 months ZDV 42 M48 months ddI

5022 10 months 108 months ZDV 42 Md4T/ABC/EFV 42 months 3TC

9 months EFV

6027 1 month 24 months ZDV 41 Fd4T/ZDV/NFV 12 months 3TC/NFV

7031 24 month None 35 MZDV/3TC/IDV

Lipoatrophic (n=7)

1002 102 months ZDV 24 months d4T 40 M18 months NFV

2003 144 months ZDV None 47 F60 months 3TC48 months IDV

3004 96 months ZDV 25 months NFV 45 M18 months 3TC1 month ABC

4009 36 months 24 months d4T/3TC 36 MZDV/ddC/NFV

5017 42 months d4T 84 months ZDV 4248 months 3TC/IDV 30 months ddI M

6018 72 months ZDV/IDV None 55 M

7020 24 months 36 months ZDV/3TC 59 Fd4T/ddI/NFV

ABC, abacavir; ART, antiretroviral therapy; ddI, didanosine; d4T, stavudine; EFV, efavirenz; IDV, indinavir; NFV, nelfinavir; RTV, ritonavir; 3TC, lamivudine; ZDV,zidovudine

and standard was run in triplicate (50 µl reactionvolume) containing: 2X SYBR Green SuperMix,0.5 µM of each primer, and 10 ng sample of DNA.PCR cycling conditions were: denaturation for 1 cycle95˚C for 14:30 min, amplification for 40 cycles 95˚Cfor 30 sec, 58˚C for 1 min, and 72˚C for 30 sec, finalextension for 1 cycle at 72˚C for 6:30 min, melt for 80cycle at 55˚C for 30 sec, cool 1 cycle at 4˚C for infinity.The results were then analysed with version 3.0 iCyclersoftware (Bio-Rad Laboratories).

Statistical analysisStatistical analysis was done using the Mann–Whitneyrank sum test for non-parametric data with thethreshold for significance set at P=0.05. The assayswere compared by linear regression analyses usingSigma Stat 3.0 (SPSS Inc, IL, Chicago, USA).

Results

Competitive PCR of abdominal subcutaneous fat was quantitated measuring mtDNA and gDNA titra-tion curves of pMito (Figure 1A). The mean mtDNA content and standard deviation were1057 ±737 copies/cell in the HIV seronegative group(n=7), 280 ±110 copies/cell in the antiretroviral naivecohort (n=5), 219 ±355 copies/cell in the non-lipoat-rophic cohort (n=7) and 59 ±64 copies/cell in the lipoa-trophic cohort (n=10). Examples of low and highmtDNA copies/cell are demonstrated in Figure 1B andC, respectively. A statistically significant 94% decreasein mtDNA was found in the HIV-1 seropositive lipoat-rophic cohort compared to the seronegative cohort(P=0.001).

Similarly, real-time PCR comparisons were alsocomparable (Table 2) in the abdomen (although, thetwo assays were not comparable by linear regressionanalyses). MtDNA copies/cell in abdomen, thigh, andneck fat were decreased in the HIV-1 seropositivelipoatrophic cohort compared to the HIV-1 seroposi-tive naïve and seronegative cohorts (P≤0.05) by real-time PCR. Also, thigh and neck HIV-1 seropositivenon-lipoatrophic mtDNA copies/cell were decreasedcompared to HIV-1 seropositive naive and the seroneg-ative controls (P≤0.05). These mtDNA decreases variedin the HIV-1 seropositive lipoatrophics from 40% inthe thigh, 70% abdomen and 80% neck compared tothe seronegative controls. There were no statisticallysignificant differences in mtDNA copies/cell in the fatdepots between the lipoatrophic and non-lipoatrophicseropositive patients or the seronegative and naivecohorts. NRTI exposure time between the lipoatrophiccohort (90 ±39) and non-lipoatrophic (60 ±50) was notstatistically different [12]. Additive NRTI exposuretime between the lipoatrophic cohort (101 ±40) and

non-lipoatrophic (51 ±50) was not statisticallydifferent [12] (Table 1). Another interesting findingwas variation in mtDNA copies/cell in the thigh,abdomen, and neck fat in the HIV-1 seronegative



mtDNA 180 bp

108 107 106 105 104 103 102 101 100 N

gDNA 259 bp

108PT 107 106 105 104103 102 101 100 N+

mtDNA

gDNA

mtDNA

gDNA

108PT 107 106 105 104 103 102 101 100 N

Figure 1. Ethidium-stained gel of PCR products from pMITOplasmid using mtDNA and gDNA primers.

(A) Gel of standard PCR products from pMITO plasmid using mtDNA and gDNAprimers. Dilution of the pMITO ranged from 108 to 100 copies and includednegative (N) control with no plasmid. (B) Example of low copy (1 mtDNAcopy/cell). Gel of competitive PCR products from pMITO plasmid diluted 108 to100 copies competing with an equal amount of unknown DNA (Pt) usingmtDNA and gDNA primers. Positive control (+, pMITO) and negative (N) controlwith no plasmid are included. ⇓: Denotes the equivalence point:(5×107/108)×2=1 mtDNA copy/cell. (C) Example of high copy (400 mtDNAcopies/cell). Gel of competitive PCR products from pMITO plasmid diluted 108

to 100 copies competing with an equal amount of unknown DNA (Pt) usingmtDNA and gDNA primers. Positive control (+, pMITO) and negative (N) controlwith no plasmid are included. ⇓: Denotes the equivalence point:(108/5×105)×2=400 mtDNA copies/cell. mtDNA, mitochondrial DNA; gDNA,genomic DNA

A

B

C

cohort. The thigh fat had 45–55% less mtDNAcopies/cell than the abdomen and neck. Additionally,mtDNA copies/cell were evaluated in PBMCs fromthese cohorts and ranged from 105–263 copies/cell. Nostatistically significant differences in PBMC valueswere observed among the cohorts and there was nocorrelation with lipoatrophy state or HIV-1 serostatus(data not shown).

Conclusion

This study was designed to measure quantitativelymtDNA copies/cell from PBMCs and different subcuta-neous fat depots in a previously described cohort [12].Our previous study measured mtDNA copies/cell in thefat tissue using semi-quantitative PCR by amplifyingthree different mtDNA fragments and analysing themby visual interpretation of ethidium-stained gels. Theconclusion of that study showed a decrease in mtDNAcontent in HAART treated HIV-1 infected patientswith peripheral fat wasting in comparison with subjectsin the control cohorts. The findings in this currentprotocol confirm our previous study and show thatsignificant mtDNA depletion is evident regardless ofwhich PCR method was used. We observed significantdifferences by real-time PCR in mtDNA copies/cell inthe subcutaneous adipose tissue from thigh, abdomen,and neck of seronegative subjects. Additionally,

mtDNA depletion was observed in thigh and neck fatfrom both lipoatrophic and non-lipoatrophic cohortson NRTIs compared with NRTI naive controls. Incontrast, we found that Ficoll-isolated PBMC mtDNAcopies/cell did not vary significantly among thecohorts. This lack of differences may be due to thesmall number of samples available particularly in theHIV (+) naive group, n=3. Thus in our study, PBMCmtDNA copies/cell did not correspond with HIVstatus, current NRTI exposure, or the presence of self-reported lipoatrophy.

Consistent with our findings, other investigatorshave found a substantial decrease in mtDNA content infat tissue in association with HIV-1 lipoatrophy[13,15,19]. This mtDNA depletion has been observedin vitro with different NRTIs affecting DNA poly-merase γ [9] and is more profound in subjects on stavu-dine compared to zidovudine [15,19,20]. Morerecently, the partial reversal of lipoatrophy following‘switch’ substitution of thymidine analogue NRTIs to a‘more mitochondrial friendly’ non-thymidine analogueNRTI regimen or to a completely NRTI-sparingregimen also supports the hypothesis that NRTIs andthymidine analogues in particular have a role in thedevelopment of lipoatrophy [15,21]. In our study, boththe non-lipoatrophic (five of the seven patients) andlipoatrophic (four of the seven patients) cohorts hadbeen treated with stavudine and mtDNA depletion was



Table 2. MtDNA copies/cell in subcutaneous fat and PBMCs

HIV(-) HIV (+) naive HIV (+) no lipoatrophy HIV (+) lipoatrophy

Thigh

435 ±63† 489 ±100 267 ±136* 255 ±124*n=4† n=5 n=6* n=6*

Abdomen

790 ±292 545 ±190 335 ±158* 244 ±148*n=5 n=5 n=6* n=7*

Neck

976 ±292 676 ±271 396 ±249* 205 ±78*n=5 n=5 n=6* n=7*

PBMC

201 ±62 105 ±48 157 ±49 148 ±53n=10 n=3 n=7 n=7

All values are representative as mtDNA copies/cell (× ±SD) and statistical significance are described. *Statistical significance between HIV (-) compared to eitherHIV(+) no lipoatrophy or lipoatrophy. Thigh HIV (+) no lipoatrophy and lipoatrophy were compared to HIV (-), P=0.05 and P=0.04 respectively. Thigh HIV (+) no lipoa-trophy and lipoatrophy were compared to HIV (+) naive, P=0.01 and P=0.008. Abdomen HIV (+) no lipoatrophy and lipoatrophy were compared to HIV (-), P=0.003and P=0.001 respectively. Abdomen HIV (+) no lipoatrophy was significant compared to HIV (-), P=0.02. Neck HIV (+) no lipoatrophy and lipoatrophy are compared toHIV (-), P=0.001 and P=0.002 respectively. Thigh HIV (+) no lipoatrophy and lipoatrophy are compared to HIV (+) naive, P=0.001 and P=0.002. †Statistical significancebetween the HIV (-) thigh in comparison to abdomen (P=0.05) or neck (P=0.05).

observed in both cohorts, adipose tissues, but we didnot observe mtDNA depletion in PBMCs. Otherstudies with HIV-1 lipoatrophic cohorts haveconfirmed these findings [22].

One of the most interesting findings from this studyis the difference in mtDNA copies/cell in the HIV (-)thigh, neck, and abdomen, with mtDNA copies/cellbeing lowest in the thigh. These results suggest theremay be mitochondrial metabolic differences in differentfat depots. Studies comparing visceral and subcuta-neous fat in humans have shown gene expression andbiochemical differences. Gene expression profiles ofsubcutaneous and visceral adipose tissue from 10 non-diabetic, normolipidemic obese men showed increasedexpression in subcutaneous fat of genes in the Wntsignalling pathway, CEPBA, HOX, lipolytic stimuli,and cytokine secretion [23]. Furthermore, uncouplingprotein 2 mRNA expression has been shown to beincreased in the omentum vs subcutaneous adipocytesfrom patients undergoing elective intra-abdominalsurgery [24]. Tumour necrosis alpha levels have beenshown to be lower in visceral fat in women comparedto subcutaneous adipose tissue in patients undergoingelective intra-abdominal surgery [25]. All these path-ways, genes, and proteins affect mitochondrial func-tion. For instance, uncoupling proteins aremitochondrial carrier proteins that catalyze a regulatedproton leak across the inner mitochondrial membrane,diverting free energy from ATP synthesis by the mito-chondrial F0F1-ATP synthase to the production of heat[26]. Therefore, further investigations are warranted inunderstanding the differences in subcutaneous fatdepots and their roles in HIV lipodystrophy.

Acknowledgements

We would like to thank Duy Tran and ElizabethWestgard for their technical assistance, Dr ChristopherJ O’Callaghan, Queen’s University, Kingston, Ontario,Canada for his statistical analyses and Drs AndreaCossarizza and Marcello Pinti, University of Modenaand Reggio Emilia School of Medicine, Modena, Italyfor the plasmids and methodologies for quantitatingmtDNA. Funding for this research was provided by theNational Institutes of Health, USA, grant numbers:AI34853 and MD000173.

References1. Shevitz A, Wanke CA, Falutz J & Kotler DP. Clinical

perspectives on HIV-associated lipodystrophy syndrome: anupdate. AIDS 2001; 15:1917–1930.

2. Schambelan M, Benson CA, Carr A, Currier JS, Dube MP,Gerber JG, Grinspoon SK, Grunfeld C, Kotler DP, MulliganK, Powderly WG & Saag MS; International AIDS Society-USA. Management of metabolic complications associatedwith antiretroviral therapy for HIV-1 infection: recommen-

dations of an International AIDS Society-USA panel.Journal of Acquired Immune Deficiency Syndromes 2002;31:257–275.

3. Saint-Marc T, Partisani M, Poizot-Martin I, Bruno F,Rouviere O, Lang JM, Gastaut JA & Touraine JL. Asyndrome of peripheral fat wasting (lipodystrophy) inpatients receiving long-term nucleoside analogue therapy.AIDS 1999; 13:1659–1667.


5. Heath KV, Hogg RS, Chan KJ, Harris M, Montessori V,O'Shaughnessy MV & Montanera JS. Lipodystrophy-asso-ciated morphological, cholesterol and triglycerideabnormalities in a population-based HIV/AIDS treatmentdatabase. AIDS 2001; 15:231–239.

6. Lichtenstein KA, Ward DJ, Moorman AC, Delaney KM,Young B, Palella FJ Jr, Rhodes PH, Wood KC & HolmbergSD; HIV Outpatient Study Investigators. Clinical assess-ment of HIV-associated lipodystrophy in an ambulatorypopulation. AIDS 2001; 15:1389–1398.

7. Galli M, Ridolfo AL, Adorni F, Gervasoni C, Ravasio L,Corsico L, Gianelli E, Piazza M, Vaccarezza M, d’ArminioMonforte A & Moroni M. Body habitus changes and meta-bolic alterations in protease inhibitor-naive HIV-1-infectedpatients treated with two nucleoside reverse transcriptaseinhibitors. Journal of Acquired Immune DeficiencySyndromes 2002; 29:21–31.

8. Kopecky J, Rossmeisl M, Flachs P, Bardova K & Brauner P.Mitochondrial uncoupling and lipid metabolism inadipocytes. Biochemical Society Transactions 2001;29:791–797.

9. Dagan T, Sable C, Bray J & Gerschenson M.Mitochondrial dysfunction and antiretroviral nucleosideanalog toxicities: what is the evidence. Mitochondrion2002; 1:397–412.

10. Lewis W, Day BJ & Copeland WC. Mitochondrial toxicityof NRTI antiviral drugs: an integrated cellular perspective.Nature Reviews. Drug Discovery 2003; 2:812–822.

11. Gerschenson M & Brinkman K. MitochondrialDysfunction in AIDS and its treatment. Mitochondrion2004; 4:763–767.


13. Walker UA, Bickel M, Lutke Volksbeck SI, Ketelsen UP,Schofer H, Setzer B, Venhoff N, Rickerts V & Staszewski S.Evidence of nucleoside analogue reverse transcriptaseinhibitor – associated genetic and structural defects ofmitochondria in adipose tissue of HIV-infected patients.Journal of Acquired Immune Deficiency Syndromes 2002;29:117–121.

14. Cherry CL, McArthur JC, Hoy JF & Wesselingh SL.Nucleoside analogues and neuropathy in the era ofHAART. Journal of Clinical Virology 2003; 26:195–207.


16. Shoffner JM. Oxidative phosphorylation disease diagnosis.Seminars in Neurology 1999; 19:341–351.

17. Pinti M, Pedrazzi J, Benatti F, Sorrentino V, Nuzzo C,Cavazzuti V, Biswas P, Petrusca DN, Mussini C, De RienzoB & Cossarizza A. Differential down-regulation of CD95or CD95L in chronically HIV-infected cells of monocytic orlymphocytic origin: cellular studies and molecular analysisby quantitative competitive RT-PCR. FEBS Letters 1999;458:209–214.

18. Shiramizu B, Shikuma KM, Kamemoto L, Gerschenson M,Erdem G, Pinti M, Cossarizza A & Shikuma C. Brief report:





placenta and cord blood mitochondrial DNA toxicity inHIV-infected women receiving nucleoside reverse transcrip-tase inhibitors during pregnancy. Journal of AcquiredImmune Deficiency Syndromes 2003; 32:370–374.


20. Pace CS, Martin AM, Hammond EL, Mamotte CD, NolanDA & Mallal SA. Mitochondrial proliferation, DNA deple-tion and adipocyte differentiation in subcutaneous adiposetissue of HIV+, HAART recipients. Antiviral Therapy2003; 8:323–331.

21. Carr A, Workman C, Smith DE, Hoy J, Hudson J, DoongN, Martin A, Amin J, Freund J, Law M & Cooper DA;Mitochondrial Toxicity (MITOX) Study Group. Abacavirsubstitution for nucleoside analogs in patients with HIVlipoatrophy: a randomized trial. Journal of the AmericanMedical Association 2002; 288:207–215.

22. Miura T, Goto M, Hosoya N, Odawara T, Kitamura Y,Nakamura T & Iwamoto A. Depletion of mitochondrial

DNA in HIV-1-infected patients and its amelioration byantiretroviral therapy. Journal of Medical Virology 2003;70:497–505.

23. Vohl MC, Sladek R, Robitaille J, Gurd S, Marceau P,Richard D, Hudson TJ & Tchernof A. A survey of genesdifferentially expressed in subcutaneous and visceraladipose tissue in men. Obesity Research 2004;12:1217–1222.

24. Digby JE, Crowley VE, Sewter CP, Whitehead JP, Prins JB& O’Rahilly S. Depot-related and thiazolidinedione-respon-sive expression of uncoupling protein 2 (UCP2) in humanadipocytes. International Journal of Obesity & RelatedMetabolic Disorders 2000; 24:585–592.

25. Orel M, Lichnovska R, Gwozdziewiczova S, Zlamalova N,Klementa I, Merkunova A & Hrebicek J. Gender differ-ences in tumor necrosis factor alpha and leptin secretionfrom subcutaneous and visceral fat tissue. PhysiologicalResearch 2004; 53:501–505.

26. Lowell BB & Spiegelman BM. Towards a molecular under-standing of adaptive thermogenesis. Nature 2000;404:652–660.

Received 21 January 2005, accepted 27 June 2005

Background: Damage to mitochondria (mt) is a majorside effect of highly active antiretroviral therapy (HAART)that includes a nucleoside reverse transcriptase inhibitor(NRTI). Such damage is associated with the onset oflipodystrophy in HAART-treated HIV+ patients. To furtherinvestigate mt changes during this syndrome, weanalysed the expression of mtRNA in adipocytes fromlipodystrophic HIV+ patients taking NRTI-containingHAART and compared it with similar cells from healthyindividuals.Materials and methods: Total RNA was extracted fromadipocytes collected from different anatomical locationsof 11 HIV+ lipodystrophic patients and seven healthy

control individuals. RNA was reverse transcribed andTaqman-based real-time PCR was used to quantify threedifferent mt transcripts (ND1, CYTB and ND6 gene prod-ucts). mtRNA content was normalized versus thehousekeeping transcript L13.Results: ND1, CYTB and ND6 expression was significantlyreduced in HIV+ lipodystrophic patients. HIV+ men andwomen did not differ in a statistically significant wayregarding the levels of ND1 and ND6, whereas the oppo-site occurred for CYTB.Conclusions: Lipodystrophy following treatment withNRTI-containing HAART is associated with a decrease inadipose tissue mtRNAs.

Altered mitochondrial RNA production in adipocytesfrom HIV-infected individuals with lipodystrophyLorenzo Galluzzi1, Marcello Pinti1, Giovanni Guaraldi 2, Cristina Mussini 2, Leonarda Troiano1, Erika Roat1,Chiara Giovenzana1, Elisa Nemes1, Milena Nasi1, Gabriella Orlando2 , Paolo Salomoni3 and AndreaCossarizza1*

1Chair of Immunology, Department of Biomedical Sciences, University of Modena and Reggio Emilia, Modena, Italy2Clinic of Infectious Diseases, University of Modena and Reggio Emilia and Azienda Policlinico, Modena, Italy3Laboratory of Genetic Instability II, MRC Toxicology Unit, University of Leicester, Leicester, UK


L Galluzzi and M Pinti contributed equally to this work.


Introduction


It has been proved that lipodystrophy (central obesityand peripheral lipoatrophy), together with hyperlipi-daemia and insulin resistance, is associated with highlyactive antiretroviral therapy (HAART) [1,2]. Althoughthe first studies focused on the role of proteaseinhibitors (PIs), subsequent analyses revealed thatnucleoside analogue reverse transcriptase inhibitors(NRTIs) are equally, if not more, involved [3–5].Indeed, it has been suggested that NRTI-induced mito-chondrial (mt) toxicity may be one cause of HAART-associated lipodystrophy. In particular, as evidenced byseveral clinical studies, these drugs are the main causeof the onset of lipoatrophic forms: a strong associationexists between NRTI-containing therapeutic regimensand either lipoatrophy or markers of mt toxicity suchas lactic acidaemia, hepatic impairment and changes inmtDNA content ([6–12]; reviewed in [13]).Mitochondrial activity could theoretically be impairedeven in the absence of systemic abnormalities that giveclinical signs, or when the mtDNA content of cells isstill unaffected, at least in the case of cell lines in vitro

exposed to NRTIs [14]. Thus, it could be of interest tolook for other markers of mt damage, such as theexpression of mtRNAs.

mtRNAs are synthesized, completely processed andtranslated within the organelle by a dedicatedmachinery made both of nuclear-encoded components(for example, mtRNA polymerase) and of mt-encodedones (tRNAs) [15,16]. Human mtDNA is a double-stranded, circular molecule of 16 571 base pairsencoding 13 proteins, 22 tRNAs and two rRNAs. It istranscribed as two large polycistronic units from bothtemplate DNA strands (H or heavy and L or light); anendonuclease processes these large molecules and givesorigin to all functional mtRNA species [17–19].

To conveniently analyse the transcription of thewhole mt genome, we chose to quantify three differentmt transcripts: ND1, encoding for subunit 1 of theNADH-dehydrogenase complex and lying at the 5′ endof the H strand; CYTB, encoding for cytochrome Band lying at 3′ end of the H strand; and ND6, encodingfor subunit 6 of the NADH-dehydrogenase complex,

and being the only mRNA encoded by the L strand (5′end). This study was designed to assess mtRNA contentin the adipocytes from seropositive individuals whohave developed lipodystrophy following NRTI-containing HAART and to compare the results withthose from seronegative subjects.


Studied subjectsThe present study was performed on samples amongHIV+ patients with lipodystrophy selected from thepatients of the Metabolic Clinic of the ‘AziendaPoliclinico di Modena’ Hospital and from healthycontrols undergoing minor plastic surgery. The HIV+subjects, who gave informed consent for the analysisreported in the present study, underwent surgicalprocedures for the amelioration of the physical changescaused by lipodystrophy. Fat samples were obtainedfrom different subcutaneous body areas (buffalo hump,back, breast and abdomen) by mechanical liposuction,performed in some cases to obtain a fat graft for autol-ogous fat transplant (in the case of HIV+ patients, tocorrect facial lipoatrophy) or for aesthetic purposes(healthy controls).

The lipodystrophic HIV+ group was formed by sixmen (mean age ±SD: 46.3 ±8.9 years) and five women(mean age 41.4 ±10.0). All these patients had a longhistory of exposure to NRTIs, including D-drugs[stavudine (d4T) and didanosine (ddI)], and werecurrently taking HAART including one or more NRTI.The control HIV– group was composed of one man(aged 63) and six women (mean age 52.3 ±9.8).

RNA extraction and reverse transcriptionTotal RNA was extracted from adipocytes of studysubjects by means of RNeasy Lipid Tissue Mini Kitfrom Qiagen (Hilden, Germany). Frozen biopticsamples of subcutaneous adipose tissue from differentanatomical locations were the source of adipocytesfrom both HIV-infected patients and healthy controlindividuals. Represented locations included breast,abdomen, buffalo hump (from HIV-infected patientsonly) and lower limbs. Subsequently, 1 µg of theextracted RNA was subjected to a standard random-primed reverse transcription reaction [20,21].

Construction of the standard plasmid for mtRNAquantificationThe amplicons of interest (L13, ND1, ND6 andCYTB, whose sequences are reported in Table 1) werecloned together in a plasmid in order to prepare asingle, reference DNA molecule that could be used asthe standard in real-time PCR quantification of allfour transcripts (patent PCT/NL03/00545). The use of

a single, cleaved plasmid was preferred to guaranteethe ratio among amplicons to be fixed at the value of1:1:1:1. As described below, the plasmid wasconstructed using classical molecular biology tech-niques [20], and its sequence checked by an automaticDNA sequencer (Abi Prism 310 Genetic Analyzer;Applied Biosystems, Foster City, CA, USA). A humancDNA sample, obtained from the random-primedreverse transcription of total RNA from peripheralblood mononuclear cells, was used as a template toamplify the four amplicons of interest by PCR(primers are reported in Table 1). Each primer wasdesigned to contain convenient linker regions usefulfor the subsequent cloning steps. Tails to be added toprimers in order to produce linkers were selected fromthe genome of an evolutionarily distant organism(Cryptococcus neoformans) and blasted against thehuman genome to check for absence of homology.This was necessary to avoid unspecific annealingbetween the tailed primers and human cDNAs, whichwould have lead to unspecific PCR products.

All primers, as well as probes used in the quantifica-tion reactions, were purchased from Qiagen Operon(Hilden, Germany). Primers SP1/SP2 created L13amplicon (72 bp) with a PstI restriction site immedi-ately upstream and a linker (L1, 20 bp) immediatelydownstream; primers SP7/SP8 lead to ND6 amplicon(109 bp) with a different linker (L2, 21 bp) immedi-ately upstream and a HindIII restriction site immedi-ately downstream. Primers SP3/SP4 were used toamplify CYTB amplicon (107 bp) with L1 immediatelyupstream and a ‘false linker’ introducing a SacI restric-tion site immediately downstream. This ‘false linker’contains the SacI restriction site and part of thesequence of ND1 amplicon (78 bp), which in turn wasobtained with primers SP5/SP6, and serves onlyconstruction purposes. ND1 amplicon had L2 immedi-ately downstream and a SacI restriction site immedi-ately upstream, in the context of the false linker (in thiscase part of CYTB amplicon).

These four PCR products were used together astemplates in a single PCR reaction to obtain the fullinsert of interest. A small amount of each amplicon wasused in a multitemplate reaction (based upon an orig-inal strategy) as follows. The starting reaction mixtureincluded <0.5 µl of the products of each describedsingle reaction (templates); Mg2+-free buffer 1×(Promega, Madison, WI, USA); MgCl2 1.5 mM, Taqpolymerase 2 U (Promega), dNTPs mix 0.2 mM(Fermentas, Vilnius, Lithuania) and water up to 49.4 µl(total starting volume). No primers were present at thisstage. The mixture then underwent the followingthermal protocol, to fill in the gaps between templatespartially annealed because of the complementary tails:starting denaturation (95°C, 5 min), two main cycles

L Galluzzi et al.



mtRNA in adipose tissue

Tabl

e 1.

Prim

ers,

prob

es a

nd a

mpl

icon

s

Nam

e5′

–3′S

eque

nce/

labe

lsLe

ngth

, bp

Sour

ce

Ampl

icon

s

A1–L

135′

-GCT

GG

AAG

TACC

AGG

CAG

TGAC

AGCC

ACCC

TGG

AGG

AGAA

GAG

GAA

AGAG

AAAG

CCAA

GAT

CCAC

TACC

GG

T-3′

72[2

1]A2

–ND

15′

-CCT

TCG

CTG

ACG

CCAT

AAAA

CTCT

TCAC

CAAA

GAG

CCCC

TAAA

ACCC

GCC

ACAT

CTAC

CATC

ACCC

TCTA

CATC

ACCG

-3′

78Pr

esen

t w

ork

A3–C

YTB

5′-A

GTC

CCAC

CCTC

ACAC

GAT

TCTT

TACC

TTTC

ACTT

CATC

TTAC

CCTT

CATT

ATTG

CAG

CCCT

AGCA

GCA

CTCC

ACCT

CCTA

TTCT

TGCA

CGAA

ACG

GG

ATCA

AACA

A-3′

107

Pres

ent

wor

kA4

–ND

65′

-AAC

CCTG

ACCC

CTCT

CCTT

CATA

AATT

ATTC

AGCT

TCCT

ACAC

TATT

AAAG

TTTA

CCAC

AACC

ACCA

CCCC

ATCA

TACT

CTTT

CACC

CACA

GCA

CCAA

TCCT

ACCT

CCA-

3′10

9Pr

esen

t w

ork

Stan

dard

pla

smid

con

stru

ctio

n pr

imer

s –

taile

d pr

imer

s* (Q

iage

n O

pero

n)

SP1–

L13

dir/

PstI

5′-A

AACT

GCA

GG

CTG

GAA

GTA

CCAG

GCA

GTG

A-3′

30Pr

esen

t w

ork

SP2–

L13

rev/

L15′

-TCC

AGAC

ACCC

AACA

ACG

TCAC

CGG

TAG

TGG

ATCT

TGG

CTT-

3′41

Pres

ent

wor

kSP

3–CY

TB d

ir/L1

c5′

-GAC

GTT

GTT

GG

GTG

TCTG

GAA

GTC

CCAC

CCTC

ACAC

GAT

T-3′

40Pr

esen

t w

ork

SP4–

CYTB

rev

/Sac

I5′

-GG

CGTC

AGCG

AAG

GG

AGCT

CTTG

TTTG

ATCC

CGTT

TCG

TG-3

′40

Pres

ent

wor

kSP

5–N

D1

dir/

SacI

5′-A

CGG

GAT

CAAA

CAAG

AGCT

CCCT

TCG

CTG

ACG

CCAT

AAA-

3′39

Pres

ent

wor

kSP

6–D

1 re

v/L2

5′-G

ACAA

CACT

CCTC

GG

CACC

TTCG

GTG

ATG

TAG

AGG

GTG

ATG

-3′

41Pr

esen

t w

ork

SP7–

ND

6 di

r/L2

c5′

-AAG

GTG

CCG

AGG

AGTG

TTG

TCAA

CCCT

GAC

CCCT

CTCC

TTC-

3′41

Pres

ent

wor

kSP

8–N

D6

rev/

Hin

dIII

5′-C

CAAG

CTTT

GG

AGG

TAG

GAT

TGG

TGCT

G-3

′28

Pres

ent

wor

k

Real

-tim

e PC

R pr

imer

s (Q

iage

n O

pero

n)

P1–L

13 d

ir5′

-GCT

GG

AAG

TACC

AGG

CAG

TGA-

3′21

[21]

P2–L

13 r

ev5′

-ACC

GG

TAG

TGG

ATCT

TGG

CTT-

3′21

[21]

P3–N

D1

dir

5′-C

CTTC

GCT

GAC

GCC

ATAA

A-3′

19Pr

esen

t w

ork

P4–N

D1

rev

5′-C

GG

TGAT

GTA

GAG

GG

TGAT

G-3

′20

Pres

ent

wor

kP5

–CYT

B di

r5′

-AG

TCCC

ACCC

TCAC

ACG

ATT-

3′20

Pres

ent

wor

kP6

–CYT

B re

v5′

-TTG

TTTG

ATCC

CGTT

TCG

TG-3

′20

Pres

ent

wor

kP7

–ND

6 di

r5′

-AAC

CCTG

ACCC

CTCT

CCTT

C-3′

20Pr

esen

t w

ork

P8–N

D6

rev

5′-T

GG

AGG

TAG

GAT

TGG

TGCT

G-3

′20

Pres

ent

wor

k

Prob

es (Q

iage

n O

pero

n)

S1–L

135′

-TCT

TTCC

TCTT

CTCC

TCCA

GG

GTG

GCT

-3′ T

exas

Red

– B

HQ

127

[21]

S2–N

D1

5′-C

CAAA

GAG

CCCC

TAAA

ACCC

GCC

-3′ F

AM49

0 –

BHQ

123

Pres

ent

wor

kS3

–CYT

B5′

-CAG

CCCT

AGCA

GCA

CTCC

ACCT

C-3′

Tex

as R

ed –

BH

Q1

27Pr

esen

t w

ork

S4–N

D6

5′-C

CACC

ACCC

CATC

ATAC

TCTT

TCAC

CC-3

′ FAM

490

– BH

Q1

23Pr

esen

t w

ork

*Tai

l nuc

leot

ides

are

rep

orte

d in

ital

ics

and

inse

rted

res

tric

tion

sit

es a

re u

nder

lined

. Gen

e ba

nk a

cces

sion

num

bers

: NM

_012

423

for

L13,

AAO

8854

0 fo

r N

D1,

AY3

3947

4 (r

egio

n: 1

4747

–158

87) f

or C

YTB;

AAO

8883

7 fo

r N

D6.

dir,

dire

ct;

rev,

rev

erse

.

(94°C, 15 sec; 63°C, 30 sec; 72°C, 30 sec) and twoadditional main cycles (94°C, 15 sec; 72°C, 1 min).After this, one additional unit of Taq polymerase andprimers SP1 and SP8 were added up to a final concen-tration of 0.4 µM (final volume 50 µl). The thermalprotocol was then continued as follows: two maincycles (94°C, 15 sec; 64°C, 30 sec; 72°C, 30 sec),35 additional main cycles (94°C, 15 sec; 70°C, 30 sec;72°C, 30 sec) and final elongation (72°C, 7 min).Electrophoresis on 3% agarose gel of the productsconfirmed the amplification of a single fragment of430 bp (see Figure 1, which also shows the localizationof the genes we studied on the mtDNA molecule).

The 430 bp insert was then cloned as a PstI-HindIIIfragment into the vector pQE-81L (Qiagen). Thederiving plasmid (pQE-81L-mtRNA), extracted fromrecipient Escherichia coli JM109 cells with QIAprepSpin Miniprep Kit (Qiagen), was digested with SacI to

obtain the final standard mixture, composed of twoequimolar linear fragments of 4937 and 227 bp,respectively. The digestion pattern is due to the pres-ence of two SacI restriction sites: the first one withinthe insert and the second one as part of the polylinkerof the parental vector pQE-81L. The products werethen quantified by comparing their intensity after 1%agarose gel electrophoresis with a molecular weightmarker of known concentration. The softwareQuantity One (Bio-Rad, Hercules, CA, USA) was usedfor this analysis. The digested plasmid was used in 10-fold dilutions for the construction of the standard curvefor the real time PCR quantification.

Real-time PCREach different transcript was quantified in a separatereaction to avoid non-specific amplifications and toensure the maximal reliability of the study. Each reac-tion entailed the following reagents: 1 µl of cDNA solu-tion (sample); PCR Mg2+-free buffer 1× (Promega);MgCl2 1.5 mM; Taq polymerase 2 U (Promega);dNTPs mix 0.2 mM (Fermentas), direct and reverseprimers 0.4 µM for mt transcripts, 0.2 µM for L13(primers vary according to the measured RNA, seeTable 1); Taqman probe 0.2 µM (probes varyaccording to the measured RNA, see Table 1); andwater up to 50 µl.

Reactions were performed in PCR multiwell plates(Bioplastics, North Ridgeville, OH, USA). iCycler (Bio-Rad) was the real-time thermal cycler of choice andwas set as follows: starting denaturation (95°C, 5 min)followed by 45 cycles (94°C, 15 sec; 60°C, 30 sec;fluorescence reading). The reading wavelengthdepended on the probe in use: FAM490-labelled probesare detected at 520 nm, while those labelled with TexasRed are detected at 615 nm. Baseline cycles, thresholdand threshold cycles (Ct) are calculated automaticallyby selecting the maximum correlation coefficientapproach in the cycler software.

Data handling and statistical analysisEach real-time PCR quantification reaction, includingthose run on the standard mixture at different dilu-tions, was performed in triplicate. The iCycler soft-ware, at the end of the run, automatically compares themean Ct values with the created standard curve andgives results in terms of absolute copies and standarddeviation for each group of triplicate samples.Nevertheless, absolute cDNA copies are not a suitableparameter for analysis. Indeed, to have interpretabledata, it is recommended that the mtRNA content ofeach sample is normalized to its content of a house-keeping transcript. We chose L13, which encodes aprotein belonging to the large ribosomal subunit and iswidely considered as a housekeeping gene [22], whose

L Galluzzi et al.


Figure 1. mtDNA map and insert for mtRNA standard plasmid

D-loop12S rRNA

16S rRNA

ND1

ND1

ND2

COX1

COX2

COX3

ND3ND4LND4

ND5

ND6

ND6

CYTB

CYTB

L13

SP1

PstISacl

HindIIISP3 SP5 SP7

SP8SP6SP4SP2

ATP8ATP6

(A) Map of mtDNA that evidences the position of the genes chosen for theanalysis of mtRNA production (in grey) and the sense of their transcription.Black lines indicate genes for tRNAs. Note that ND1 and CYTB genes areencoded by the H strand (clockwise arrows), while ND6 gene by the L strand(anticlockwise arrow). (B) Grey boxes represent the four amplicons involved inthe quantification reactions. Arrows depict the annealing positions of theprimers (indicated as SP) used for the construction of the molecule. Black linesshow relevant restriction sites (enzymes used are in italics).

A

B

transcription is, in practice, constant in all functionalmoments of the cell. The normalization to a house-keeping RNA avoids further mathematical analysesthat would otherwise be necessary to consider thedifferent efficiency of RNA isolation and reverse tran-scription in different samples. Thus, in this study theresults are shown as copies of each mt transcript percopy of L13.

Studied subjects were grouped into two main cate-gories according to their HIV seropositivity. Infectedindividuals were subsequently divided according to sex.This was not done for healthy controls because of thelarge preponderance of women. Groups werecompared for the expression of mtRNAs in thefollowing ways: HIV+ patients versus HIV– controls,HIV+ men versus HIV+ women and HIV+ womenversus HIV– women (for CYTB only). Statistical signif-icance was determined by using two-tailed non-parametric test (Mann–Whitney test), with confidenceintervals of 95%.

Results

Mitochondrial transcription in healthy adipocytesFirstly we analysed the adipocyte mtRNAs fromhealthy subjects and found that the transcription levelsof the three genes under investigation are different.Indeed, ND1 is expressed at much lower levels(130.5 copies/ L13 copies, mean value) than the othertwo transcripts (573.1 and 1043.0 copies/L13 copies,mean values for ND6 and CYTB, respectively). Nosignificant differences were present among fat samplescollected in different sites.

mtRNA depletion in HIV+ patientsThe quantification of mtRNAs in samples obtainedfrom HIV+ individuals revealed a dramatic decrease oftheir expression. This decrease was similar in samplescollected from different sites. In cells from HIV+ men,ND1 had a concentration of 65.6 copies/L13 copies,corresponding to a 50% reduction with respect to thecontrols. We also demonstrated a similar fall for HIV+women (52.5 copies/L13 copies corresponding to a60% reduction). The comparison between the controlgroup and all HIV+ patients was statistically significant(P=0.0185), but HIV+ men and women did not signif-icantly differ (P=0.4762). The data for ND1 aresummarized in Figure 2.

In the adipose tissue of HIV+ men, ND6 was presentat the concentration of 183.5 copies/L13 copies (68%reduction from the controls). In samples from HIV+women the expression of ND6 was even lower (107.8copies/L13 copies – an 81% reduction). Again, theMann–Whitney test witnessed a statistically significantdifference between the control group and HIV+

patients (P=0.0021), whereas HIV+ men and womendid not differ (P=0.3290) (Figure 3).

The concentration of CYTB transcripts in adipocytesfrom HIV+ men was 359.0 copies/L13 copies (66%reduction vs controls). mtRNA levels in adipose tissuefrom HIV+ women were much lower (63.9 copies/L13copies, which corresponds to a 94% reduction vscontrols). As a consequence, statistical analysis revealeda significant difference not only between the controlgroup and all HIV+ patients (P=0.0104, similar to ND1and ND6), but also between HIV+ men and women(P=0.0303). Finally, we compared CYTB expression inHIV+ and HIV– women (who were represented by sixindividuals, aged 52.3 ±9.8), and found a statisticallysignificant difference (P=0.0079) (Figure 4).



Figure 2. ND1 expression in studied subjects

200

100

0

p < 0.05

Controls HIV+ HIV+Men

HIV+Women

p = ns

Results are reported as ND1 copies/L13 copies in terms of mean value andstandard error. Statistical significance is indicated by P value.

Figure 3. ND6 expression in studied subjects

750

500

250

0

p < 0.01


HIV+Women

ND6

cop

ies/

L13

cop

ies

p = ns

Results are reported as ND6 copies/L13 copies in terms of mean value andstandard error. Statistical significance is indicated by P value.

Discussion

Considerable attention has been paid to the role ofmitochondria in the pathogenesis of lipodystrophy, andseveral authors have demonstrated a significant,dramatic depletion of mtDNA content in adipose tissueof lipodystrophic HIV+ patients compared withcontrols [23–26]. The determinant role of D-drugs,especially d4T, in causing lipoatrophy has been welldefined by several sets of clinical data. The functionalconsequences of mtDNA depletion are complex. It isknown from classic studies on genetic disordersaffecting the mt genome that an mtDNA decrease ofthe order of 80% is necessary to evidence functionalalterations. However, in treated HIV+ patients, evensmaller decreases in mtDNA content are significantlyassociated with relevant alterations in the distributionof fat tissue [3,11,27,28]. Depletion of adipocytemtDNA positively correlates with evidence of tissue,cell and mt toxicity, including decreased expression ofmt proteins, increased adipocyte pleiomorphism, infil-tration of macrophages and non-adipocyte inflamma-tory cells, and increased apoptosis [29]. Mitochondrialdamages are not irreversible, since improvements inlipoatrophy, mtDNA content and fat tissue apoptosiscan be obtained after replacing a constituent drug witha less toxic one [30–32]; damage can also be reducedby regimen alternations [33].

At the functional level, studies on frozen adipocytebiopsies from HIV+ individuals demonstrated thatNRTI-induced mtDNA depletion can result in adecreased enzymatic activity of the respiratory chaincomplex IV [34]. It is not known, at least in fat cells,

what relationship exists between changes in mtDNAcontent and changes in the number of mitochondria.Nevertheless, it has been shown that mtDNA depletionis associated with an increased organelle mass,suggesting that this may represent a compensatoryresponse to decreased mtDNA [25].

The mechanisms that regulate the replication ofmtDNA and the relationship among mtDNA levels,mtRNA levels and the levels of the encoded proteins arenot completely clear. On one hand, it could be hypoth-esized that the reduction in mtDNA leads to a paralleldecrease in its transcription and translation; on theother hand, in cell cultures, mitochondria couldcompensate mtDNA loss with a concomitant increase inits transcriptional rate [35]. Clinical data showed thatthe treatment with d4T plus ddI was associated withdecreased mt mass and mtDNA content, but that theexpression and activity of mtDNA-codified enzymessuch as COXII remained unaltered [36]. This suggeststhat up-regulatory transcriptional or post-transcriptional mechanisms could compensate formtDNA depletion before profound mtDNA depletionoccurs.

In cultured mouse muscle cells treated with zidovu-dine (AZT), the disruption of mt cristae occurred after4 weeks of treatment and was not accompanied bychanges in mtDNA content [37]. Cytochrome b andcytochrome c oxidase I mRNA significantly increased(64% and 31%, respectively), while no changes werepresent as far as mtDNA was concerned. This suggeststhat AZT can provoke complex alterations in theproduction of nucleic acids, that can affect alsomtRNA transcription. In patients, it was reported thatdual NRTI therapy decreases mtRNA production after2 weeks of therapy, before changes in fat mass orchanges in metabolic parameters [38]. There are veryfew data, in addition to ours, about the quantificationof mtRNAs in human cells [35,38–40]. The analysis ofmtRNA levels, besides those on mtDNA, probablyprovides additional information on the consequencesof mtDNA depletion. This approach could also help toclarify if and how this depletion effectively leads to adecline in terms of functionality of the mt machinery.

The real-time PCR technique that we describe in thispaper measures the concentration of three mt tran-scripts encoded at different positions in the mt genome.We selected these mtRNAs in order to convenientlyrepresent the whole transcriptional process from themtDNA molecule. It is indeed known that the mtgenome is transcribed from both mtDNA strands intotwo large polycistronic units, which are cleaved byspecific endonucleases to produce the mature mtRNAs[18,19]. According to this model, an equal amount ofND1 and CYTB mtRNAs should be found, since theyare encoded on the same template strand. This is not

L Galluzzi et al.


Figure 4. CYTB expression in studied subjects

1500

1000

500

0

p < 0.05


HIV+Women

CYTB

cop

ies/

L13

cop

ies

CYTB

cop

ies/

L13

cop

ies

p = 0.05

1500

500

0

p < 0.01

ControlsWomen

HIV+Women

Results are reported as CYTB copies/L13 copies in terms of mean value andstandard error. Statistical significance is indicated by P value. The insert repre-sents the comparison between control women and HIV+ women.

the case, probably because the amount of each mtRNAis determined not only by its transcription (presumablyoccurring at the same rate for ND1 and CYTB genes)but also by its degradation, which probably occurs atdifferent rates, according to the intrinsic stability ofeach transcript and the cellular functional microenvi-ronment. Our analysis allows the quantification ofmtRNAs using nuclear RNA as a reference. Even ifquite unlikely, because the nuclear gene we chose asreporter is quite stable [22], it cannot be excluded thatmodifications in nuclear transcription could influencethe data we obtained.

We have found different expression of CYTB inHIV+ male and females. Since CYTB is the last genetranscribed in the heavy chain and since no main differ-ences were observed among fat samples collected indifferent sites, one could speculate that the efficiency ofthe transcription is lower in women, or that they aremore prone to mt toxicity. Since the number of patientswe have studied is relatively low, further data arerequired to investigate this aspect.

We have previously shown that the relative ratiosamong these three mtRNAs is different in variousexperimental models [14]. This suggests that it cannotbe exclusively due to different transcription rates, but isprobably the result of a dynamic process involving rateof mtRNA synthesis, editing, stability and degradation,which all vary between different cells [14]. What weobserved in ex vivo (lymphocytes) and in vitro models(U937, CEM and HUT-78 cell lines) clearly indicatesthat the relative ratio among ND1, ND6 and CYTB ishighly variable, but is usually kept constant in a partic-ular type of cell.

The data we report in this paper reveal the presenceof an association between NRTI-induced lipodystrophyin HIV+ patients and significantly reduced levels ofND1, ND6 and CYTB mtRNAs. However, we are wellaware that the analysis of HIV+ patients withoutlipodystrophy is urgently needed to ascertain which isthe role of the viral infection per se in provokingmtRNA alterations, as observed for mtDNA [41]. Forthis reason, we are in the process of selecting naiveHIV+ patients whose adipocytes will be studied.

When chronically exposed to NRTI drugs, adiposetissue from HIV+ patients with lipodystrophy shows ageneral, dramatic decrease in the mtRNA levels for allof the three messengers analysed. However, even inthese cells, the ratio between the mtRNAs was roughlymaintained, suggesting that NRTIs act by provoking ageneral drop in the efficiency of the transcriptionalapparatus of mitochondria. Since the decrease inmtRNA levels does not affect one single transcript, weare tempted to assume that NRTIs interfere with theoverall transcriptional process rather than affecting thestability of mature molecules. It will be interesting to

know whether this decrease is an indirect consequenceof mtDNA depletion in these cells (a well-knownphenomenon described by several authors in adiposetissue), or if it is due to a direct action of NRTIs on thetranscriptional machinery.

In a previous work, we demonstrated that mtRNAlevels can decrease in cell lines treated with NRTIs evenwhen mtDNA content is still preserved [14]. This addi-tionally stresses the importance of mtRNA quantifica-tion, which is able to reveal mt impairment before aconsiderable decrease in mtDNA content can bemeasured. Direct studies on mtDNA transcription inthe presence or absense of different drugs/drug combi-nations, as well as sequential studies in patients whostart NRTI-based therapy, could clarify the causes ofthis phenomenon and help in a better identification ofthe molecular target(s) of their toxic action.

Acknowledgements

This paper was supported by ISS, Rome (ProgrammaNazionale di Ricerca sull’AIDS, grant No. 30F.15 toAC). GeneMoRe Italy srl and GeneMoRe Holding SAare gratefully acknowledged.

References1. Carr A, Samaras K, Burton S, Law M, Freund J, Chisholm

DJ & Cooper DA. A syndrome of peripheral lipodystrophy,hyperlipidaemia and insulin resistance in patients receivingHIV protease inhibitors. AIDS 1998; 12:F51–F58.

2. Carr A. HIV lipodystrophy: risk factors, pathogenesis,diagnosis and management. AIDS 2003; 17(Suppl1):S141–S148.

3. Brinkman K, Smeitink JA, Romijn JA & Reiss P.Mitochondrial toxicity induced by nucleoside-analoguereverse-transcriptase inhibitors is a key factor in the patho-genesis of antiretroviral-therapy-related lipodystrophy.Lancet 1999; 354:1112–1115.

4. Carr A, Samaras K, Thorisdottir A, Kaufmann GR,Chisholm DJ & Cooper DA. Diagnosis, prediction, andnatural course of HIV-1 protease-inhibitor-associatedlipodystrophy, hyperlipidaemia, and diabetes mellitus: acohort study. Lancet 1999; 353:2093–2099.

5. Carr A, Miller J, Law M & Cooper DA. A syndrome oflipoatrophy, lactic acidaemia and liver dysfunction associ-ated with HIV nucleoside analogue therapy: contribution toprotease inhibitor-related lipodystrophy syndrome. AIDS2000; 14:F25–F32.

6. Côté HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyMV & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV-infected patients. NewEngland Journal of Medicine 2002; 346:811–820.

7. Cossarizza A, Troiano L & Mussini C. Mitochondria andHIV infection: the first decade. Journal of BiologicalRegulators & Homeostatic Agents 2002; 16:18–24.

8. Cossarizza A, Pinti M, Moretti L, Bricalli D, Bianchi R,Troiano L, Fernandez MG, Balli F, Brambilla P, Mussini C& Viganò A. Mitochondrial functionality and mitochon-drial DNA content in lymphocytes of vertically infectedhuman immunodeficiency virus-positive children withhighly active antiretroviral therapy-related lipodystrophy.Journal of Infectious Diseases 2002; 185:299–305.








14. Galluzzi L, Pinti M, Troiano L, Prada N, Nasi M, FerraresiR, Salomoni P, Mussini C & Cossarizza A. Changes inmitochondrial RNA production in cells treated with nucle-oside analogues. Antiviral Therapy 2005; 10:191–195.

15. Anderson S, Bankier AT, Barrell BG, de Bruijn MH,Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA,Sanger F, Schreier PH, Smith AJ, Staden R & Young IG.Sequence and organization of the human mitochondrialgenome. Nature 1981; 290:457–465.

16. Bonen L. The mitochondrial genome: so simple yet socomplex. Current Opinion in Genetics & Development1991; 1:515–522.

17. Shuey DJ & Attardi G. Characterization of an RNA poly-merase activity from HeLa cell mitochondria, whichinitiates transcription at the heavy strand rRNA promoterand the light strand promoter in human mitochondrial DNA.Journal of Biological Chemistry 1985; 260:1952–1958.

18. Clayton DA. Transcription of the mammalian mitochon-drial genome. Annual Reviews of Biochemistry 1984;53:573–594.

19. Clayton DA. Transcription and replication of mitochondrialDNA. Human Reproduction 2000; 15(Suppl 2):11–17.

20. Sambrook J & Russell DW. Molecular Cloning: aLaboratory Manual. 3rd edn 2001. New York: Cold SpringHarbor Laboratory Press.

21. Pinti M, Troiano L, Nasi M, Monterastelli E, Moretti L,Bellodi C, Mazzacani A, Mussi C, Salvioli G & CossarizzaA. Development of real time PCR assays for the quantifica-tion of Fas and FasL mRNA levels in lymphocytes: studieson centenarians. Mechanisms of Ageing & Development2003; 124:511–516.

22. Fu X, Menke JG, Chen Y, Zhou G, MacNaul KL, WrightSD, Sparrow CP & Lund EG. 27-hydroxycholesterol is anendogenous ligand for liver X receptor in cholesterol-loaded cells. Journal of Biological Chemistry 2001;276:38378–38387.

23. Cherry CL, Gahan ME, McArthur JC, Lewin SR, Hoy JF& Wesselingh SL. Exposure to dideoxynucleosides isreflected in lowered mitochondrial DNA in subcutaneousfat. Journal of Acquired Immune Deficiency Syndromes2002; 30:271–277.

24. Walker UA, Bickel M, Lutke Volksbeck SI, Ketelsen UP,Schofer H, Setzer B, Venhoff N, Rickerts V & Staszewski S.Evidence of nucleoside analogue reverse transcriptaseinhibitor – associated genetic and structural defects ofmitochondria in adipose tissue of HIV-infected patients.Journal of Acquired Immune Deficiency Syndromes 2002;29:117–121.

25. Nolan D, Hammond E, Martin A, Taylor L, Herrmann S,McKinnon E, Metcalf C, Latham B & Mallal S.

Mitochondrial DNA depletion and morphologic changes inadipocytes associated with nucleoside reverse transcriptaseinhibitor therapy. AIDS 2003; 17:1329–1338.



28. Zaera MG, Mirò O, Pedrol E, Soler A, Picon M,Cardellach F, Casademont J & Nunes V. Mitochondrialinvolvement in antiretroviral therapy-related lipodystrophy.AIDS 2001; 15:1643–1651.

29. Pace CS, Martin AM, Hammond EL, Mamotte CD, NolanDA & Mallal SA. Mitochondrial proliferation, DNA deple-tion and adipocyte differentiation in subcutaneous adiposetissue of HIV-positive HAART recipients. Antiviral Therapy2003; 8:323–331.

30. Carr A, Workman C, Smith DE, Hoy J, Hudson J, DoongN, Martin A, Amin J, Freund J, Law M & Cooper DA; forthe Mitochondrial Toxicity (MITOX) Study Group.Abacavir substitution for nucleoside analogs in patientswith HIV lipoatrophy: a randomized trial. Journal of theAmerican Medical Association 2002; 288:207–215.

31. Martin A, Smith DE, Carr A, Ringland C, Amin J, EmeryS, Hoy J, Workman C, Doong N, Freund J & Cooper DA;for the Mitochondrial Toxicity (MITOX) Study Group.Reversibility of lipoatrophy in HIV-infected patients 2 yearsafter switching from a thymidine analogue to abacavir: theMITOX Extension Study. AIDS 2004; 18:1029–1036.


33. Negredo E, Paredes R, Peraire J, Pedrol E, Côté H, Gel S,Fumoz CR, Ruiz L, Abril V, Rodriguez de Castro E, OchoaC, Martinez-Picado J, Montaner J, Rey-Joly C & Clotet B(Swatch Study Team). Alternation of antiretroviral drugregimens for HIV infection. Efficacy, safety and tolerabilityat week 96 of the Swatch Study. Antiviral Therapy 2004;9:889–893.


35. Seidel-Rogol BL & Shadel GS. Modulation of mitochon-drial transcription in response to mtDNA depletion andrepletion in HeLa cells. Nucleic Acids Research 2002;30:1929–1934.

36. Mirò O, Lopez S, Rodriguez de la Concepcion M, MartinezE, Pedrol E, Garrabou G, Giralt M, Cardellach F, GatellJM, Vilarroya F & Casademont J. Upregulatory mecha-nisms compensate for mitochondrial DNA depletion inasymptomatic individuals receiving stavudine plus didano-sine. Journal of Acquired Immune Deficiency Syndromes2004; 37:1550–1555.

37. d’Amati G & Lewis W. Zidovudine causes early increasesin mitochondrial ribonucleic acid abundance and inducesultrastructural changes in cultured mouse muscle cells.Laboratory Investigations 1994; 71:879–884.

38. Mallon P, Unemori P, Bowen M, Miller J, WinterbothamM, Kelleher A, Williams K, Cooper D & Carr A. Nucleo-side reverse transcriptase inhibitors decrease mitochondrialand PPARgamma gene expression in adipose tissue afteronly 2 weeks in HIV-uninfected healthy adults. 11thConference on Retroviruses & Opportunistic Infections.11–14 February 2004, San Francisco, CA, USA. Abstract76.

L Galluzzi et al.


39. Suomalainen A, Majander A, Pihko H, Peltonen L &Syvanen AC. Quantification of tRNA3243(Leu) pointmutation of mitochondrial DNA in MELAS patients and itseffects on mitochondrial transcription. Human MolecularGenetics 1993; 2:525–534.

40. Bonod-Bidaud C, Giraud S, Mandon G, Mousson B &Stepien G. Quantification of OXPHOS gene transcriptsduring muscle cell differentiation in patients with

mitochondrial myopathies. Experimental Cell Research1999; 246:91–97.

41. Lopez S, Mirò O, Martinez E, Pedrol E, Rodriguez-Santiago B, Milinkovic A, Soler A, Garcia-Viejo MA,Nunes V, Casademont J, Gatell JM & Cardellach F.Mitochondrial effects of antiretroviral therapies in asymp-tomatic patients. Antiviral Therapy 2004; 9:47–55.



Received 20 December 2004, accepted 29 March 2005



In the majority of cases, HIV-associated lipodystrophy,lipoatrophy in particular, becomes clinically apparent onlyafter months or years of continuous exposure to antiretro-viral medications and, once developed, is difficult toreverse. Many lipid-related side effects of antiretroviralmedications result from drug-induced changes in geneexpression. As our understanding of the pathogenic mech-anisms underlying HIV-associated lipodystrophy improves,it is important to be able to explore changes at a molec-ular level in order to fully elucidate the mechanismswhereby antiretroviral drugs exert their toxicities.

Monitoring changes in gene expression in vivo may enablephysicians to identify, predict or prevent drug toxicitiesearly, before irreversible changes in body compositionoccur. However, monitoring changes in gene expression ata population level presents many methodological chal-lenges that need to be addressed, over and above theconsiderable intra- and inter-individual variabilityinherent in the cellular expression of any gene. Carefulcollection and processing of adequate biological samples,robust laboratory processes and assays, and appropriatestudy design can help overcome many of these difficulties.

Methodological considerations in human studies ofgene expression in HIV-associated lipodystrophyPatrick WG Mallon1,2,3*, Rebecca Sedwell1,3, Patrick Unemori1,3, Anthony Kelleher1,2,3, David A Cooper1,2,3

and Andrew Carr2,3

1National Centre in HIV Epidemiology and Clinical Research, University of New South Wales, Sydney, Australia2HIV, Immunology and Infectious Diseases Clinical Services Unit, St Vincent’s Hospital, Sydney, Australia3HIV Immunovirology Research Laboratory, Centre for Immunology, St Vincent’s Research Campus, Sydney, Australia


HIV-associated lipodystrophy (HIVLD) is a complexsyndrome of multifactorial aetiology and, althoughprevention strategies have yielded some encouragingresults [1], no effective treatment exists. Lipoatrophytakes months to develop [2,3] and, even when thecausal agents are substituted, undergoes only a slowand incomplete reversal [4]. In vitro, protease inhibitors(PIs) disrupt the action of sterol regulatory elementbinding protein 1 (SREBP1), a transcriptional activatorthat mediates expression of peroxisome proliferator-activated receptor gamma (PPARγ) [5,6]. The thymi-dine analogue nucleoside reverse transcriptaseinhibitors (NRTIs) zidovudine and stavudine decreaseexpression of mitochondrial genes and PPARγ in humanadipose tissue [7] and have been linked with mitochon-drial dysfunction [8,9] and depletion [10,11]. As thereis no effective way to predict or monitor the onset ofHIVLD before it becomes clinically apparent, a fullerunderstanding of drug-induced molecular changes invivo is important if the joint goals of effective preven-tion and treatment of HIVLD are to be realized.

In contrast to laboratory experiments using celllines, where conditions and interventions can be tightlyregulated, studies of gene expression in vivo arecomplicated by numerous potential confounding

factors that can complicate the detection or interpreta-tion of changes in gene expression. In the case oflipodystrophy, the incidence and severity of thesyndrome can be significantly influenced by factorssuch as age, gender, presence of coinfection, and pre-treatment weight and immune status [12]. Many ofthese factors may influence the molecular effects ofantiretrovirals and complicate gene expression studiesin this clinical setting.

With any target tissue under investigation, such assubcutaneous adipose tissue, appropriate samplecollection and processing is of the utmost importance.This is because the amount of tissue required isdictated by the number of planned investigations andthe RNA yield from the target tissue, which variesconsiderably between tissues and, in the case of humansubcutaneous adipose tissue, is relatively low[7,13,14]. In addition, certain genes of interest, such astranscription factors, are expressed at very low levelswithin tissues [7] making it more difficult to detectsubtle but potentially clinically important changes intheir expression. Biological and pharmacologicalconfounders, such as ongoing opportunistic infectionsor use of polypharmacy, which can affect overallcellular gene expression in a target tissue, may make

Introduction

identifying an appropriate housekeeping gene difficult.Despite these obstacles, with careful attention to studydesign and sample processing, it is possible to limit theimpact of these factors.

Sample collection and processing

RNA yields from adipose tissue are lower per weight oftissue than other tissues such as liver and muscle. Incontrast to muscle and liver, which are expected toyield 100–600 µg of RNA per 100 mg tissue [15],adipose tissue yields are only in the region of 2–3 µgper 100 mg tissue [7,11,13,14]. Given the rapid degra-dation of RNA, in particular messenger RNA (mRNA),careful sample collection and rapid processing, such asimmediate fixing and snap-freezing of biopsied samplesin liquid nitrogen, can limit degradation and maintainoptimal RNA yields (Figure 1).

Careful consideration also needs to be applied to thequality of tissue biopsied. Collection techniques such asneedle biopsies [11,13] or liposuction [14], are often

well tolerated and easy to perform, but the overallyields of tissue can be low. In addition, the blindednature of the sampling increases the risk of contamina-tion of biopsied fat with unwanted tissues such asconnective tissue and muscle, especially in subjects withlow subcutaneous fat volumes, such as those seen inpatients with lipoatrophy. Open biopsy techniques[7,10] (Figure 2) have the potential advantage ofyielding larger amounts of tissue, with operators beingable to carefully biopsy adipose tissue, thus limitingcontamination. However, these procedures arearguably more invasive and complicated than needle-based procedures.

RNA extraction

Although isolation reagents based on phenol andguanidine isothiocyanate, such as TRIzol reagent(Invitrogen Life Technologies, Carlsbad, CA, USA), arecommonly used to fix tissues, avoiding RNA degrada-tion and maintaining RNA expression as close as

PWG Mallon et al.


Adipose tissue

Low expression = fail (discard aliquots)

Good expression = pool aliquots

4 X RNA(200 ng)

4 X RT (oligo dT)

4 X cDNA(20 µl)

cDNA pool(80 µl)

PCR (duplicates)

Gene of interest

Results =gene of interest

Check PCR(β-actin)

Fix in TRlzol,snap freeze andstore at –70°C

Homogenize(100 mg tissueper ml TRlzol)

Extract RNA, DNase treatment, purify and store in 200 ng aliquots

β-actin

β-actin

2 µl

Figure 1. Processing of adipose tissue for use in gene expression experiments

RT, reverse transcriptase.

possible to that seen in vivo at the time of samplecollection, high lipid levels within the target tissue(such as seen in adipose tissue) can inhibit the chloro-form/ethanol extraction process and reduce the yield ofRNA obtained using this method. In the case of humanadipose tissue using the TRIzol extraction protocol,RNA yields tend not to increase if more than 400 mgadipose tissue is fixed per ml of TRIzol (Figure 3),presumably because of the inhibitory effects of higherlipid concentrations on the reagent and subsequentprecipitation process.

Problems with RNA yield are not limited to adiposetissue. We have evaluated monocytes as a potentialperipheral blood surrogate for mitochondrial toxicity[7]. As monocytes make up only a fraction of the totalcell population in whole blood, we found the RNAyield from extracted monocytes also to be relativelylow – in the region of 2 µg per monocyte sample. Inmonocytes, the RNA yield from extracted samplessignificantly correlated with the number of monocytesisolated from the original whole blood sample (Figure4). It is therefore important to ensure that the volumeof blood collected is enough to ensure an adequatenumber of monocytes to give an appropriate RNAyield. In the majority of cases, more than 3 millionmonocytes [extracted from 18 ml blood in acid citratedextrose (ACD) buffer] provide in excess of 2 µg totalRNA, enough to examine the expression of more than10 genes of interest.

RNA and cDNA preparation

For real-time quantitative PCR, it is important that thestarting RNA is of the highest purity. As a minimum,RNA samples should undergo DNase treatment and

column purification. Contamination with genomicDNA can give false positive results, especially for genesthat are expressed at very low levels, whilst contamina-tion with ethanol-based buffers used in RNA extrac-tion can inhibit subsequent PCR reactions [16]. AfterRNA extraction, it is usual to store RNA at –70°C foruse in future PCR reactions or gene arrays. As RNA is


Molecular studies in HIV-associated lipodystrophy

Figure 2. Open subcutaneous adipose tissue biopsy

The biopsy is taken from the lateral aspect of the buttock. The procedure isperformed in an ambulatory setting under local anaesthetic.

30

25

15

20

10

5

0

Mass of adipose tissue, mg/ml TRlzol

0 200 400 600 800

RNA

yiel

d, µ

g

Figure 3. RNA yields from adipose tissue using TRIzol extraction protocol

RNA yields begin to plateau if RNA is extracted from more than 400 mgadipose tissue per 1 ml TRIzol. This is probably due to inhibition of the reagentdue to high lipid levels within the sample. RNA was extracted from bothvisceral and subcutaneous adipose tissue samples.

7

6

4

5

3

2

1

0

RNA yield, µg

0 2 4 6 8 10

Rho=0.61P=0.001

12

Cell

coun

t (x

106 c

ells

)

Figure 4. Relationship between RNA yield and monocyte cellcount

RNA yields rise proportionally to the number of monocytes in the startingsample. Starting with at least 3 million cells (extracted from 18 ml ACD blood)will give a yield >2 µg RNA in more than 90% cases. ACD, acid citrate dextrose(buffer).

unstable and tends to degrade easily with everyfreeze–thaw episode, adequate storage of RNA isimportant. Storing RNA at pre-determined concentra-tions (either ng or µg aliquots, depending on whetherthe planned investigations include PCR or gene array)avoids multiple freeze–thaws. Ideally, laboratory proto-cols should be developed to limit the number offreeze–thaw events between RNA extraction andcDNA preparation to only one.

Various methods are used to quantify extractedRNA, the commonest of which are absorbance assays[17] and fluorescent nucleic acid stains [7,13].Spectrophotometers measure the ability of RNA toabsorb ultraviolet light. Maximum absorption occursat 260 nm and the absorption can be used to calculatethe concentration of RNA within a sample. Due to thepotential for contaminants such as protein and DNA toaffect absorbance, this method is relatively insensitive,especially when measuring low concentrations of RNA,such as those extracted from adipose tissue (forexample, an A260 of only 0.1 represents 4 µg/ml RNA).Fluorescent nucleic acid stains, such as SYBR® Green(Applied Biosystems, Foster City, CA, USA) [7] andRiboGreen® (Molecular Probes, Eugene, OR, USA)[13], rely on the use of standard curves constructedfrom serial dilutions of RNA of a known quantity. Thismethod is more specific for RNA and is accurate atmeasuring even small quantities.

First strand complementary DNA (cDNA), used inreal-time PCR experiments, can be prepared from RNAusing oligo dT [7,13] or random hexamer primers [17]and the reverse transcriptase (RT) enzyme. The reac-tion involves the RT enzyme elongating single strandsof DNA from a site where the primer anneals to theRNA, using the RNA as a template. As their namesuggests, random hexamer primers comprise shortlengths of random nucleic acids capable of annealing toall types of RNA, while oligo dT primers are designedto specifically anneal to the poly-A tails of mRNA. Forthis reason, there are differences in the cDNA resultingfrom the use of these two primers. RT using oligo dTshould result in transcription to cDNA of only tran-scribed genes (mRNA) and some ribosomal RNA(rRNA), whilst use of random hexamers results in theadditional transcription to cDNA of non-coding RNA,transfer RNA (tRNA) and most rRNA. The presence ofcDNA transcribed from non-messenger RNA intro-duces the risk of interference by these molecules in anysubsequent PCR reaction, increasing non-specificannealing of PCR primers and the potential for falsepositive results.

Regardless of the primers used, the efficiency of theRT reaction can vary considerably, both betweensamples and between reactions. If equal amounts of thesame RNA sample undergo RT, the yield of cDNA, as

measured by β-actin expression, can vary by more than60% (Figure 5A). The variability introduced by the RTstep can significantly affect results when RT iscombined with PCR in a single-step RT-PCR reaction[16]. If efficiency of a particular RT reaction is low, itmay be difficult to measure the expression of a gene ofinterest, such as a transcription factor, that is normallyexpressed at much lower levels than β-actin; sometimesgreater than 100-fold lower for genes such as thoseencoding PPARγ co-activator 1 or the uncouplingproteins UCP1 and 2 [7,13]. Separating the RT stepfrom the PCR reaction, performing multiple RT reac-tions on an individual sample, testing the efficiency ofthe RT by examining the expression of a gene knownto be ubiquitously expressed in the target tissue (suchas β-actin) and pooling the multiple cDNAs to establisha ‘pool’ of adequately transcribed cDNA can help over-come much of this type of variability (Figure 5B). Inthis way, a large amount of cDNA of adequate qualitycan be made from which expression of multiple genesof interest can be determined (Figure 1).

Analysis

Given the variability introduced by, among otherthings, RNA extraction and RT techniques, carefulinterpretation of results is required. Although variouscorrections can be made along the way to attempt toadjust for within-sample variation, such as quantifica-tion of and correction for starting RNA or cDNAconcentrations, these analyses are relatively insensitivewhen using nanogram quantities for real-time PCRassays. As such, it is important to perform a finalcorrection prior to presentation of data – the correctionfor the housekeeping gene.

The principal is simple. Find a gene that is ubiqui-tously expressed in the tissue of interest and which isn’taffected by the intervention under investigation, andpresent any changes in a gene of interest relative tochanges in the housekeeping gene. By doing so, aninvestigator can say with some confidence that theintervention under investigation is the cause of thechange in expression of the gene of interest, rather thanother potential confounders such as insensitive quan-tification of RNA, failed reverse transcription or inter-ference in cellular gene expression introduced byenvironmental or laboratory factors.

This argument for use of a housekeeping gene carriesspecial significance in cross-sectional human studies thatmeasure changes in gene expression in disease states. Forexample, in studies in HIV-positive populations,confounders such as age, weight, cortisol and insulinresponsiveness and the effects of HIV, antiretroviraltherapy and changes in body composition all have thepotential to individually alter cellular gene expression

PWG Mallon et al.




100 000

Inter-RT, intra-sample cv=0.61

10 000

100

1000

10

1R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R S S S S S S S S S S S S S S S1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 4 4 4 4 4 5 5 6 7 8 9 1 1 1 1 1 1 1 2 3 4 5 6 7 8 9

0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 4 9 0 2 6 7 0 3 0 1 2 3 4 6

Sample ID

β ac

tin e

xpre

ssio

n (x

10 8 n

g/µl

)-

Figure 5. (A) Intra-sample variation in reverse transcriptase and (B) post-pooling gene expression

(A) shows the considerable inter-RT variability (measured by expression of β-actin in the cDNA) when equal amounts of starting RNA from the same sample undergoRT. The lower limit of this assay is 1x108 ng/µl. Therefore, if the ‘check RT’ result falls below 1x106 ng/µl (dotted line) then the sample would be unsuitable formeasuring expression of genes such as transcription factors, that are expressed at much lower quantities than β-actin and should be considered to have ‘failed’ theRT. (B) shows duplicate results for β-actin expression after discarding the failed samples and pooling the remaining cDNA. Much of the intra-sample variability isremoved and a large amount of good quality cDNA remains from which expression of multiple genes of interest can be measured. cv, coefficient of variation;ID, identification; RT, reverse transcriptase.

100 000

10 000

100

1000

10

1R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R S S S S S S S S S S S S S S1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 3 3 3 3 3 4 4 4 4 5 5 5 5 6 7 8

R9 1 1 1 1 1 1 2 3 4 5 6 7 8 9

0 1 2 3 4 5 6 7 8 9 0 1 2 4 6 7 8 9 0 2

R31 3 8 6 7 8 0 1 3

R54 0 1 2 3 4

Sample ID

β ac

tin e

xpre

ssio

n (x

10 8 n

g/µl

)-

A

B

[18–21]. Even exercise can significantly alter theexpression of some commonly used housekeepinggenes [22]. As a result, some authors recommend that,due to inherent changes in gene expression betweensystems, use of two [23] or even multiple [24] house-keeping genes should be employed in any analysis ofsuch studies. In such diverse populations as those seenin studies of lipodystrophy, identification of a truehousekeeping gene can be difficult and any resultspresented without correcting for expression of a house-keeping gene need to be interpreted with caution.

Various housekeeping genes have been used inhuman studies of gene expression. These include genesencoding β-actin, glyceraldehyde-3-phosphate dehy-drogenase (GAPDH), β2-microglobulin and 18S ribo-somal RNA [7,13,14,17]. An in-depth knowledge ofthe molecular characteristics of the tissue under inves-tigation, including the likely effect of any interventionon the expression of a housekeeping gene and the labo-ratory processes used, helps in the choice of an appro-priate housekeeping gene. For example, RT using oligodT primers, although more specific in transcribingmRNA, may not transcribe rRNA as efficiently. As aresult, most studies using 18S rRNA as a control userandom hexamers to prepare cDNA. In addition, asHIVLD arises as a result of disturbances in adiposetissue lipid metabolism, use of genes encoding compo-nents of the glycolytic pathway, such as GAPDH, maybe inappropriate as it is likely that their expression willbe affected by disturbances in lipid metabolism.

To illustrate these difficulties, we performed a cross-sectional study examining the expression of the tran-scription factor SREBP1 in monocytes extracted fromwhole blood, as previously described [7]. We examinedmonocyte gene expression using real-time PCR(Lightcycler, Roche Applied Science, Mannheim,Germany) from samples of pooled cDNA synthesizedfrom individual starting quantities of 20 ng RNA usingoligo dT primers. Samples from a total of 53 subjectswere analysed: 39 HIV-infected subjects with lipodys-trophy and 14 HIV-negative healthy controls. Initial,uncontrolled analysis showed a significant decrease inSREBP1 expression in those subjects with HIVLD(Figure 6A), which would support a drug-induceddown-regulation of SREBP1 in monocytes similar tothat observed in fat. However, β-actin expression wasalso significantly down-regulated in those with HIVLDcompared with healthy controls (Figure 6B). When theSREBP1 results were reanalysed correcting for β-actinexpression, no significant difference in SREBP1 expres-sion was detected between the two groups (Figure 6C).Similar results were found when GAPDH was used asan alternative housekeeping gene (data not shown). Assuch, these results tell us very little about the relation-ship between HIVLD and gene expression in monocytes

PWG Mallon et al.


100

75

50

25

P=0.005

0SREBP1

Gen

e ex

pres

sion

(x10

-8 n

g/µl

)

20 000

15 000

10 000

5000

P=0.007

0β-actin

Gen

e ex

pres

sion

(x10

-8 n

g/µl

)

0.005

0.003

0.004

0.002

0.001

P=0.8

0SREBP1/ β–actin

SREB

P1/β

-act

in

HIV-negative control(n=14)

HIV-positive patient with HIVLD(n=39)

Figure 6. SREBP1 expression in monocytes before and aftercorrection for β-actin expression

HIVLD, HIV-associated lipodystrophy; SREBP1, sterol-regulatory elementbinding protein 1.

A

B

C

as it is not possible to control for the inherent differ-ences in gene expression between the two diverse popu-lations studied using these housekeeping genes. This is alimitation seen in many cross-sectional studies andunderlies the need for appropriate study design whenexamining tissue gene expression in human disease.

Population selection and study design

Cross-sectional human studies of gene expression inlipodystrophy, especially those involving smallnumbers of subjects, are prone to significant bias intro-duced by the many potential confounding factorsdescribed above. To overcome these difficulties in across-sectional setting, studies need to be carefully andadequately powered for expression of each gene ofinterest before comments relating to the clinical orbiological relevance of negative results can be made.

The target tissue under examination can also differsignificantly in structure and cellular content betweencross-sectional groups. In the case of subcutaneousadipose tissue, tissue biopsies from patients affected byHIVLD have been shown to differ at a microscopiclevel from HIV-negative control subjects, with smalleradipocytes and infiltrates of inflammatory cellsobserved in some diseased adipose tissue [10,14].Although, as previously described, adequate samplingcan help reduce contamination by unwanted tissue, thepotential influence of tissue infiltration by cells otherthan adipocytes on gene expression within adiposetissue needs to be carefully considered when inter-preting the results of cross-sectional studies.

Prospective studies using well-defined populationscan overcome many of these difficulties. As many anti-retroviral drug (ARV) toxicities originate at the molec-ular level, changes in expression of biologically relevantgenes would be expected to occur early after exposureto ARVs. By examining changes in gene expressioninduced by ARVs in a prospective randomized setting,environmental and disease-related factors may haveless of an impact on the overall results, as any potentialerror introduced by these confounders would bepresent in both baseline and post-intervention samples,provided that the interval between sampling is rela-tively close. At present, the number of such studies isrelatively small, but is increasing.

Limitations

Molecular studies on human tissue offer the ability todemonstrate clinically relevant changes in gene expres-sion due to ARVs. However, this approach has severalimportant limitations. As previously mentioned, manymolecular pathways involved in HIVLD are undercomplex regulatory control and, given the many variables

HIV introduces, it can be difficult to determine definitecause and effect relationships between exposure to ARVsand subsequent effects on gene expression in vivo. Inaddition, when expression of multiple genes changes inresponse to ARV exposure [7,13,14,25], it is almostimpossible to elicit an exact sequence of events, that is,which changes arise directly from antiretroviral drugeffects and which arise as a result of dysregulationinduced by changes in other genes, without very detailedand sample-intensive time-course studies. Human studiesinvolving multiple biopsies, although ideal in principle,would be both difficult to recruit to and ethically chal-lenging. For these reasons, in vitro experiments remain avital resource for robustly testing the many hypothesesthat the limited in vivo gene expression studies generate.

Summary

Molecular studies of lipodystrophy in populations ofHIV-infected subjects have the potential to revealaspects of the syndrome that may help prevent thesyndrome occurring and aid in the development of new,safer therapies. Effective research in this field requiresan effective communication between clinical and labo-ratory researchers to enable them to design and imple-ment clinical trials and laboratory assays capable ofovercoming the many pitfalls inherent in this type ofresearch. Further research is vital, particularly usingnewer technologies such as microarray that are able tocharacterize genomewide responses to exposure toARVs, if the goal of safe, lifelong ARV therapy for HIVis to be realized.

References1. Gallant JE, Staszewski S, Pozniak AL, DeJesus E, Suleiman

JM, Miller MD, Coakley DF, Lu B, Toole JJ & Cheng AK;903 Study Group. Efficacy and safety of tenofovir DF vsstavudine in combination therapy in antiretroviral-naivepatients: a 3-year randomized trial. Journal of theAmerican Medical Association 2004; 292:191–201.

2. Carr A, Samaras K, Burton S, Law M, Freund J, ChisholmDJ & Cooper DA. A syndrome of peripheral lipodystrophy,hyperlipidaemia and insulin resistance in patients receivingHIV protease inhibitors. AIDS 1998; 12:F51–F58.

3. Mallon PWG, Miller J, Cooper D & Carr A. Prospectiveevaluation of the effects of antiretroviral therapy on bodycomposition in HIV-1 infected men starting therapy. AIDS2003; 17:971–979.

4. Martin A, Smith DE, Carr A, Ringland C, Amin J, EmeryS, Hoy J, Workman C, Doong N, Freund J & Cooper DA;Mitochondrial Toxicity Study Group. Reversibility of lipoa-trophy in HIV-infected patients 2 years after switchingfrom a thymidine analogue to abacavir: the MITOXExtension Study. AIDS 2004; 18:1029–1036.

5. Liang J-S, Distler O, Cooper DA, Jamil H, Deckelbaum RJ,Ginsberg HN & Sturley SL. HIV protease inhibitorsprotect apolipoprotein B from degradation by the protea-some: a potential mechanism for protease inhibitor-inducedhyperlipidaemia. Nature Medicine 2001; 7:1–5.

6. Caron M, Auclair M, Vigouroux C, Glorian M, Forest C& Capeau J. The HIV protease inhibitor indinavir impairs



sterol regulatory element-binding protein-1 intranuclearlocalisation, inhibits preadipocyte differentiation, andinduces insulin resistance. Diabetes 2001; 50:1378–1388.

7. Mallon PW, Unemori P, Sedwell R, Morey A, Rafferty M,Williams K, Chisholm D, Samaras K, Emery S, Kelleher A,Cooper DA & Carr A; SAMA Investigators. In vivo, nucle-oside reverse-transcriptase inhibitors alter expression ofboth mitochondrial and lipid metabolism genes in theabsence of depletion of mitochondrial DNA. Journal ofInfectious Diseases 2005; 191:1686–1696.

8. Brinkman K, Smeitink JA, Romijn HA & Reiss P.Mitochondrial toxicity induced by nucleoside-analoguereverse-transcriptase inhibitors is a key factor in the patho-genesis of antiretroviral-related lipodystrophy. Lancet1999; 354:1112–1115.



11. Shikuma CM, Hu N, Milne C, Yost F, Waslien C, ShimizuS & Shiramizu B. Mitochondrial DNA decrease in subcuta-neous adipose tissue of HIV infected individuals withperipheral lipoatrophy. AIDS 2001; 15:1801–1809.

12. Mallon PWG, Cooper DA & Carr A. HIV-associatedlipodystrophy. HIV Medicine 2001; 2:166–173.

13. Kannisto K, Sutinen J, Korsheninnikova E, Fisher RM,Ehrenborg E, Gertow K, Virkamaki A, Nyman T, Vidal H,Hamsten A & Yki-Jarvinen H. Expression of adipogenictranscription factors, peroxisome proliferator-activatedreceptor gamma co-activator 1, IL-6 and CD45 in subcuta-neous adipose tissue in lipodystrophy associated withhighly active antiretroviral therapy. AIDS 2003;17:1753–1762.

14. Bastard JP, Caron M, Vidal H, Jan V, Auclair M,Vigouroux C, Luboinski J, Laville M, Maachi M, GirardPM, Rozenbaum W, Levan P & Capeau J. Associationbetween altered expression of adipogenic factor SREBP1 inlipoatrophic adipose tissue from HIV-1-infected patientsand abnormal adipocyte differentiation and insulin resis-tance. Lancet 2002; 359:1026–1031.

15. TRIzol reagent Product Information. Invitrogen LifeTechnologies, Carlsbad, CA, USA.

16. Bustin SA & Nolan T. Pitfalls of quantitative real-timereverse-transcription polymerase chain reaction. Journal ofBiomolecular Techniques 2004; 15:155–166.

17. Liu YM, Lacorte JM, Viguerie N, Poitou C, Pelloux V,Guy-Grand B, Coussieu C, Langin D, Basdevant A &Clement K. Adiponectin gene expression in subcutaneousadipose tissue of obese women in response to short-termvery low calorie diet and refeeding. Journal of ClinicalEndocrinology & Metabolism 2003; 88:5881–5886.

18. Tomlinson JW, Moore JS, Clark PM, Holder G,Shakespeare L & Stewart PM. Weight loss increases11beta-hydroxysteroid dehydrogenase type 1 expression inhuman adipose tissue. Journal of Clinical Endocrinology &Metabolism 2004; 89:2711–2716.

19. Tiikkainen M, Hakkinen AM, Korsheninnikova E, NymanT, Makimattila S & Yki-Jarvinen H. Effects of rosiglitazoneand metformin on liver fat content, hepatic insulin resis-tance, insulin clearance, and gene expression in adiposetissue in patients with type 2 diabetes. Diabetes 2004;53:2169–2176.

20. Marchlewska A, Stenvinkel P, Lindholm B, Danielsson A,Pecoits-Filho R, Lonnqvist F, Schalling M, Heimburger O& Nordfors L. Reduced gene expression of adiponectin infat tissue from patients with end-stage renal disease. KidneyInternational 2004; 66:46–50.

21. Otake K, Omoto S, Yamamoto T, Okuyama H, Okada H,Okada N, Kawai M, Saksena NK & Fujii YR. HIV-1 Nefprotein in the nucleus influences adipogenesis as well asviral transcription through the peroxisome proliferator-activated receptors. AIDS 2004; 18:189–198.

22. Mahoney DJ, Carey K, Fu MH, Snow R, Cameron-SmithD, Parise G & Tarnopolsky MA. Real-time RT-PCRanalysis of housekeeping genes in human skeletal musclefollowing acute exercise. Physiological Genomics 2004;18:226–231.

23. Tricarico C, Pinzani P, Bianchi S, Paglierani M, Distante V,Pazzagli M, Bustin SA & Orlando C. Quantitative real-time reverse transcription polymerase chain reaction:normalization to rRNA or single housekeeping genes isinappropriate for human tissue biopsies. AnalyticalBiochemistry 2002; 309:293–300.

24. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van RoyN, De Paepe A & Speleman F. Accurate normalization ofreal-time quantitative RT-PCR data by geometric averagingof multiple internal control genes. Genome Biology 2002;3:research0034.1–0034.11.

25. Sutinen J, Kannisto K, Korsheninnikova E, Fisher RM,Ehrenborg E, Nyman T, Virkamaki A, Funahashi T,Matsuzawa Y, Vidal H, Hamsten A & Yki-Jarvinen H.Effects of rosiglitazone on gene expression in subcutaneousadipose tissue in highly active antiretroviral therapy-associated lipodystrophy. American Journal of Physiology,Endocrinology & Metabolism 2004; 286:E941–E949.

PWG Mallon et al.


Received 23 January 2005, accepted 3 June 2005



Oxidative stress accompanying hepatitis C virus (HCV)infection seems to result in mitochondrial (mt) dysfunction.In HIV/HCV-coinfected individuals, HCV-related mt damagecould be further enhanced and clinical manifestations ofmt damage may appear, particularly following exposure tosome antiretroviral drugs. Furthermore, when HCV medica-tions are used together with certain antiretrovirals, the risk

of developing mt adverse events may be particularlyfrequent, such as development of pancreatitis whenribavirin and didanosine are coadministered. The manage-ment of HIV/HCV-coinfected individuals needs to considerthe high risk of mitochondria-associated toxicities in thispopulation, which may significantly influence treatmentdecisions and therapeutic modalities.

The role of hepatitis C virus (HCV) in mitochondrialDNA damage in HIV/HCV-coinfected individualsCarmen de Mendoza and Vincent Soriano*

Department of Infectious Diseases, Hospital Carlos III, Madrid, Spain


Around 200 million people are infected with hepatitis Cvirus (HCV) worldwide. The prevalence of HCV infec-tion among HIV-positive individuals varies widely andmainly depends on the risk category. In regions such assouthern Europe, the east coast of North America andSouth East Asia, where intravenous drug users repre-sent a large proportion of HIV-infected individuals, therate of HIV/HCV coinfection is extremely high [1–3].

The involvement of antiretroviral therapy (ART)drugs in mitochondrial (mt) damage, especially nucleo-side analogues, has been highlighted in recent years[4–6]. This is clear even when taking into considerationthat HIV infection itself may cause mtDNA depletion inat least some cell compartments such as peripheral bloodmononuclear cells (PBMCs) [7–9]. On the other hand,some co-morbidities may be particularly prone to mtdamage in this population. There is no doubt that ART-related complications such as lipoatrophy and hyper-lactataemia are more frequent among individualscoinfected with HCV [10,11].

In this review, we have tried to summarize the infor-mation available regarding the role of HCV in mtdamage, especially in the setting of HIV infection. Theinvolvement of HCV drugs and their interactions withantiretrovirals leading to further mt dysfunction inHIV/HCV-coinfected patients will be discussed further.

HCV and mt dysfunction — aetiological andpathophysiological aspects

Despite recent advances in the pathogenesis of HCV-related liver disease, many questions remain unanswered.

There are many challenges to reproducing in vitroHCV results due to difficulties in producing HCV inviral cultures. For this reason, is still unclear how HCVpersists and replicates in hepatocytes or how itproduces cellular injury. Ultrastructural studies haveshown that mt abnormalities are common in liver biop-sies from HCV-infected patients [12]. Mitochondrialalterations due to enhanced oxidative stress caused byHCV infection are associated with a depletion of thetissue glutathione store, which is a key cellular antiox-idant [13], and with a reduction in the mtDNA/nuclearDNA ratio.

In the light of various findings, Rust & Gores [14]have suggested that HCV could induce mt dysfunctionby the following mechanisms: 1) direct effect of viralproteins on mitochondria; 2) inducing a persistentintracellular oxidative stress, which may lead tosecondary mt dysfunction; 3) immune-mediated activa-tion of the cell death pathways, such as the Fas system;and 4) stimulation of inflammatory cells that couldtarget mitochondria through further oxidative stress(see Figure 1).

Oxidative injury may occur as a direct result of theHCV core protein expression both in vitro and in vivo[15] and may involve a direct effect of the HCV coreprotein on mitochondria. HCV replication might alsolead to an increase in intracellular oxidant production,damaging the mitochondria of infected cells.Accordingly, reactive oxygen species have been associ-ated with disease activity in chronic hepatitis C [16].

In relation to the apoptotic pathways, similar asser-tions have been made to explain why mtDNA depletion

Introduction

is seen in drug-naive, HIV-infected individuals andsubjects with chronic HCV infection alone [7–9].Briefly, mtDNA depletion in drug-naive, HIV-infectedindividuals seems to be related to cell apoptosis[17,18]. HIV-1 infection may cause apoptosis throughdifferent mechanisms, some of which rely on the intri-cate virus–host cell interaction while others involveactivation of the host’s inflammatory and immuneresponses. Soluble HIV-1 products, such as the accessoryproteins Tat, Vpr and gp120, directly promote cell deaththrough interactions with CD4, CXCR4 and otheruncharacterized receptors [19] or by induction of thecaspase cascade [20]. By similar mechanisms, immune-mediated apoptotic pathways are activated in chronicHCV infection. Expression of the death receptor Fas is significantly higher in HCV core antigen-positive

hepatocytes compared with uninfected cells [21]. Fasexpression promotes the formation of a death complex,which activates the caspase-8 cascade, which eventu-ally leads to apoptotic cell death [22]. Likewise, arecent study has shown that expression of the HCVNS3 protein, or the NS2/NS3 precursor protein, resultsin induction of apoptosis and activation of the caspase-8 cascade [23].

Chronic HCV infection is characterized by inflam-matory liver damage and is associated with a signifi-cant risk of liver cirrhosis and hepatocellularcarcinoma in the long term. There is increasingevidence suggesting that liver cell damage in chronichepatitis C is mediated by the induction of apoptosis[24]. Indeed, a marked increase in caspase activity isnoticed in the sera of HCV-infected patients [25].

C de Mendoza & V Soriano


CTL

O2T-cell receptor Fas/Fas ligand

Apoptosis

OxidativestressViral particles

and NS3 proteins

NS3

Cas-8 Bid

tBid

Monocyte 43

12

HCV

–

Figure 1. Four possible mechanisms of HCV-mediated mt dysfunction. Modified from Rust & Gores [14]

CTL, cytotoxic T lymphocyte; mt, mitochondrial.

Although one quarter of individuals with chronicHCV infection may show persistently normal serumalanine aminotransferase (ALT) levels, inflammatoryand fibrotic lesions in the liver may appear in morethan half of these patients, which in turn exhibitelevated serum caspase activity. Moreover, 30% ofpatients with normal ALT levels but elevated caspaseactivity show a significant fibrosis (F2–F4) in the liverbiopsy. This is why some authors have claimed thatmeasurement of caspase activity in serum might be auseful indirect tool for assessing liver damage inchronic hepatitis C, particularly in patients withnormal ALT levels [25,26].

Although the association between HCV and mtdamage seems to be clear, it remains unclear how HCVcould cause mt dysfunction. An increased production offree radicals by virus-related inflammation is most prob-ably the main cause of HCV-associated mt damage [27].

Clinical manifestations of mt damage inHIV/HCV coinfection

The first mention of mt dysfunction in HIV infectionappeared in the early 1990s, when several reportslinked zidovudine (AZT)-associated myopathy with mtdamage [28–30]. Since Brinkman proposed his theoryin 1998 [31], mt damage in HIV infection has beendirectly related to nucleoside reverse transcriptaseinhibitor (NRTI) use. However, there is evidencesuggesting that HIV infection itself may depletemtDNA in some cell compartments [7,8], causing clin-ical symptoms in the absence of any ART [32].

Mitochondrial dysfunction in HIV-infected individ-uals may be enhanced by the presence of HCV coinfec-tion. Lipoatrophy, pancreatitis, peripheral neuropathy,myopathy, hyperlactataemia and lactic acidosis are themost important adverse events of ART due to mtdamage [33]. HCV infection seems to increase the inci-dence of some of these events. In a transverse studyconducted at our institution, coinfection with HCVand/or hepatitis B virus (HBV) was associated with ahigher decrease in the mtDNA content of PBMCs thanin patients infected with HIV alone [8]. A moredetailed investigation showed that HCV infection itselfled to a significant depletion of mtDNA in PBMCs,which was more pronounced in patients who under-went treatment with pegylated interferon plus ribavirin(RBV) for chronic hepatitis C [34] (Figure 2).

Lipoatrophy

In a cohort of 226 HIV-infected patients, HCV infec-tion was significantly more frequent in lipoatrophicpatients (46%) than in subjects with adiposity or themixed syndrome (15%). It was also more prevalent

than in patients without lipodystrophy (20%) [11].Thus, HCV infection may be associated with theatrophic form of lipodystrophy in HIV-infectedpatients, especially after extended periods of exposureto nucleoside analogues.

Hyperlactataemia and lactic acidosis

Mitochondrial toxicity causing lactic acidosis is a rarebut fatal complication, which has been described insome HIV-infected patients exposed to nucleosideanalogues. It has been reported in individuals receivingboth single and dual nucleoside combinations,including AZT or stavudine (d4T) with didanosine(ddI), zalcitabine (ddC) or lamivudine. The overallprevalence is in the range of five per 1000 patients ontherapy per year [35]. The risk of lactic acidosis issomewhat more common in women, the obese andthose with viral hepatitis coinfections [30]. Analysingthe drugs in use, the combination of d4T plus ddI isassociated with the highest risk [8,35–37]. In a retro-spective study performed in France, nine cases of severelactic acidosis were identified [38]. The incidence was0.9/1000 patient-years of exposure to nucleosideanalogues. Six patients were coinfected by HCV and/orHBV. More recently, a case of lactic acidosis in an HIV-infected patient receiving ART after liver transplanta-tion for HCV-induced liver disease has been reported[39]. All these observations support HCV increasingthe incidence of mitochondria-related complications inthe setting of HIV infection.


Mitochondrial damage due to HCV in HIV infection

1400

800

1000

1200

600

400

200

0

Groups of infection

n = 11HIV–

56HIV+

18HCV+

107HIV/HCV

coinfection

mtD

NA

copy

num

ber

Figure 2. Comparison of mtDNA copy numbers in PBMCsfrom different groups. Effect of HCV infection alone andHIV/HCV coinfection on the depletion of mtDNA [34]

mt, mitochondrial; PBMCs, peripheral blood mononuclear cells.

Liver-related mt damage

Grade 3 or 4 liver enzyme elevations occur on averagein 5–10% of patients who initiate triple ART [40]. Therate is significantly higher in HIV-infected individualswith underlying chronic hepatitis C [41–45].

Four main mechanisms of drug-related liver toxicityhave been recognized in HIV-infected individualsexposed to ART: i) direct drug toxicity, ii) immunereconstitution following initiation of highly active anti-retroviral therapy (HAART) in the presence of HCVand/or HBV coinfections, iii) mt toxicity and iv) hyper-sensitivity reactions with liver involvement. Chronichepatitis C is known to increase the toxic effects ofdrugs in the liver, most probably by impairing themechanisms of cytoprotection in liver cells [46]. This iswhy exposure to drugs like ritonavir at full doses(600 mg twice daily) is associated with a high risk ofhepatotoxicity [43].

Immune reconstitution may explain some episodes ofliver enzyme elevations following the initiation ofHAART, particularly in severely immunosuppressedpatients with chronic hepatitis B or C [47–49]. Therationale behind this phenomenon is that the inhibitionof HIV replication with HAART leads to rapid immunerecovery and, consequently, to an immune responseagainst HBV and/or HCV antigens exposed in thesurface of hepatocytes, which are destroyed [50].Mitochondrial toxicity of some nucleoside analogues isa well-known cause of liver damage [51]. As we havediscussed previously, exposure to HIV nucleosideinhibitors (particularly ddI and/or d4T), female sex andobesity are some of the predisposing factors, and under-lying chronic HCV infection may increase the chance ofthis complication [46,52–55]. Finally, hypersensitivityreactions to drugs such as nevirapine, abacavir oramprenavir may involve multiple organs including theliver. In this situation, liver enzyme elevations occurwithin the first days or weeks following the initiation ofHAART and tend to resolve upon drug discontinuation.As expected, allergic reactions may be more frequent inpatients with high CD4 counts and do not seem to befavoured by the presence of HCV coinfection [56].

HCV may induce mt alterations in the liver ofpatients with hepatocellular carcinoma [57,58]. Similarultrastructural liver mt abnormalities were observed ina group of 30 HIV/HCV-coinfected patients underHAART [59]. The main ultrastructural abnormalitiesof mitochondria were reduction or loss of cristae,decrease in matrix density and glycogen accumulation.

There is evidence of mtDNA depletion in the liver ofcoinfected individuals in association with the use ofnucleoside analogues. For instance, the liver mtDNAcontent was decreased by 47% in HIV/HCV-coinfectedindividuals taking d4T, ddI or ddC compared with

subjects never exposed to these NRTIs [60]. However,the authors of this study did not observe a clear associ-ation between increases in serum lactate levels and theextent of liver mtDNA depletion. Lactate elevationsmay occur only in the presence of significant reductionsin the hepatic mtDNA content.

Finally, a higher risk of metabolic abnormalities,including insulin resistance and changes in bodycomposition, have been reported in HIV/HCV-coinfected individuals receiving ART, compared withHIV-monoinfected individuals exposed to the samemedications [10,61–64].

Interactions between HCV medications andantiretroviral drugs

The combination of pegylated interferon plus RBV, aguanosine nucleoside analogue, is the current recom-mended therapy for chronic hepatitis C in HIV/HCV-coinfected individuals [65]. Sustained virologicalresponse to this combination is around 50% in HCV-monoinfected individuals [60] but much lower inHIV/HCV-coinfected subjects [67,68]. Besides anintrinsically lower efficacy of HCV medication in theHIV setting, the co-administration of HCV medicationand antiretroviral drugs has resulted in a substantialnumber of side effects that often lead to prematuredrug discontinuation, precluding the achievement ofresponse to HCV therapy. Among the most importantdrug interactions are those of RBV with ddI and d4T,whose pathogenic mechanism relies on an enhance-ment of mt toxicity (Figure 3).

HIV nucleoside analogues require intracellular phos-phorylation to become active. The deoxyribonucleo-side kinases are located in the cell cytosol as well aswithin the mitochondrion. The mechanism of inhibi-tion of phosphorylated nucleoside analogues is byinhibitory competition with the natural nucleoside for



mt DNA synthesis lactate

AZT

anaemia

d4T

weight loss

hepatic decompensation

pancreatitis & lactic acidosis

ddI

Figure 3. Interactions between RBV and nucleoside analogues

AZT, zidovudine; ddI, didanosine; d4T, stavudine; RBV, ribavirin.

binding to the HIV reverse transcriptase, ultimatelyleading to premature DNA chain termination.Nucleoside analogues are also substrates of DNA poly-merase γ, the enzyme responsible for mtDNA replica-tion. This affinity explains the depletion and/ormutation of genes encoded by mtDNA in subjectsexposed to these drugs [31,69]. The final consequenceof mt dysfunction is a reduction in ATP production andthe release of reactive oxygen radicals, which ulti-mately affect the mitochondrion structure. Of note,RBV is also a nucleoside analogue and might cause mtdamage by the same mechanism as the HIV inhibitors,although their affinity for polymerase γ has not yetbeen determined.

The concomitant use of ddI and RBV is particularlyrisky as it favours the development of pancreatitis[61,62,70]. RBV inhibits inosine monophosphate(IMP) dehydrogenase, promoting the phosphorylationof ddI [71]. This effect leads to an increase in intracel-lular and also mt concentrations of ddATP, whichinhibits DNA polymerase γ (Figure 4) [72]. Regardinga different mechanism, a recent report has highlighteda potential synergistic interaction between d4T andRBV, leading to a rapid and severe weight loss in HIV-infected patients receiving both d4T and/or ddI alongwith HCV medications [10]. Interestingly, morepronounced weight loss, and lactate and amylase eleva-tions were found in patients taking d4T or ddIcompared with those taking other nucleoside analoguesalong with RBV.

Summary

HCV infection seems to be associated with mt alter-ations either causing it directly or in the context of indi-rect induction of cell death mediated by oxidativestress. In HIV/HCV coinfection, mt damage could befurther enhanced and clinical manifestations maybecome more apparent when using certain antiretro-viral drugs and when HCV medication is used withthese antiretrovirals. The management of HIV/HCV-coinfected individuals needs to consider the high risk ofmitochondria-related toxicities in this population,which may influence treatment decisions and thera-peutic modalities significantly. Given the deleteriousinfluence of HCV on HIV, efforts to eradicate hepatitisC with specific therapy will be of great value in thecoinfected population.

Acknowledgements

This work was supported in part by grants fromFundación Investigación y Educación en SIDA (IES),Red de Investigación en SIDA (RIS project 173), Redde Investigación en Hepatitis (RTIC G03/015) and theVIRGIL Network.

References1. Saillour F, Dabis F, Dupon M, Lacoste D, Trimoulet P,

Rispal P, Monlun E, Ragnaud JM, Morlat P, Pellegrin JL,Fleury H & Couzigou P. Prevalence and determinants ofantibodies to hepatitis C virus and markers for hepatitis Bvirus infection in patients with HIV infection in Aquitaine.Groupe d’Epidemiologie Clinique du SIDA in Aquitaine.British Medical Journal 1996; 313:461–464.

2. Martin J, Castilla J, López M, Arranz R, Gonzalez-Lahoz J& Soriano V. Impact of chronic hepatitis C in HIV diseaseprogression. HIV Clinical Trials 2004; 5:125–131.

3. Sherman K, Rouster D, Chung R & Rajicic N. Hepatitis Cvirus prevalence among patients infected with HIV: a cross-sectional analysis of the US adult AIDS Clinical TrialsGroup. Clinical Infectious Diseases 2002; 34:381–387.

4. Gerard Y, Maulin L, Yazdanpanah Y, De La Tribonniere X,Amiel C, Maurage CA, Robin S, Sablonniere B, DhennainC & Mouton Y. Symptomatic hyperlactatemia: anemerging complication of antiretroviral therapy. AIDS2000; 14:2723–2730.

5. Walker U, Setzer B & Venhoff N. Increased long-termmitochondrial toxicity in combinations of nucleosideanalogues reverse transcriptase inhibitors. AIDS 2002;16:2165–2173.

6. Dagan T, Sable C, Bray J & Gerschenson M.Mitochondrial dysfunction and antiretroviral nucleosideanalogues toxicities: what is the evidence? Mitochondrion2002; 1:397–412.

7. Cote HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyM & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV infected patients.New England Journal of Medicine 2002; 346:811–820.

8. De Mendoza C, de Ronde A, Smolders K & Soriano V.Changes in mitochondrial DNA copy number in blood cellsfrom HIV-infected patients undergoing antiretroviraltherapy. AIDS Research & Human Retroviruses 2004;20:271–273.



RBV

RBV-MP

IMP dehydrogenase

Physiologicalnucleosides

IMPddI

ddIMP

ddAMP

ddADP

ddATP

Inositol

HIV-RT

–

––

Figure 4. Metabolic pathways involved in the potentiation ofddI by RBV. The increased concentrations of ddATP due to theinhibition of the IMP dehydrogenase by RBV inhibits the DNApolymerase γ

ddI, didanosine; -MP, -monophosphate; HIV-RT, HIV reverse transcriptase; IMP,inosine monophosphate; RBV, ribavirin

9. Miura T, Goto M, Hosoya N, Odawara T, Kitamura Y,Nakamura T & Iwamoto A. Depletion of mitochondrialDNA in HIV-1 infected patients and its amelioration byantiretroviral therapy. Journal of Medical Virology 2003;70:497–505.

10. Garcia-Benayas T, Blanco F & Soriano V. Weight loss inHIV-infected patients. New England Journal of Medicine2002; 347:1287–1288.

11. Zylberberg H, Nalpas B, Pol S, Brechot C & Viard JP. Isthere a relationship between hepatitis C virus infection andantiretroviral-associated lipoatrophy? AIDS 2000; 14:2055.

12. Barbaro G, Di Lorenzo G, Asti A, Ribersani M, Belloni G,Grisorio B, Filice G & Barbarini G. Hepatocellular mito-chondrial alterations in patients with chronic hepatitis C:ultrastructural and biochemical findings. American Journalof Gastroenterology 1999; 94:2198–2205.

13. De Leve L & Kaplowitz N. Importance and regulation ofhepatic glutathione. Seminars in Liver Disease 1990;10:251–266.

14. Rust C & Gores G. Does hepatitis C cause liver injury bypathways associated with mitochondrial dysfunction?American Journal of Gastroenterology 1999;94:2003–2005.

15. Okuda M, Li K, Beard MR, Showalter LA, Scholle F,Lemon SM & Weinman SA. Mitochondrial injury, oxidativestress, and antioxidant gene expression are induced byhepatitis C virus core protein. Gastroenterology 2002;122:366–375.

16. De Maria N, Colantoni A, Fagiuoli S, Liu GJ, Rogers BK,Farinati F, Van Thiel DH & Floyd RA. Association betweenreactive oxygen species and disease activity in chronichepatitis C. Free Radical Biology & Medicine 1996;21:291–295.

17. Arnoult D, Petit F, Lelievre J & Estaquier J. Mitochondriain HIV-1 induced apoptosis. Biochemical & BiophysicalResearch Communications 2003; 304:561–574.

18. Badley A, Roumier T, Lum J & Kroemer G. Mitochondrionmediated apoptosis in HIV-1 infection. Trends inPharmacological Sciences 2003; 24:298–305.

19. Twu C. Cardiomyocytes undergo apoptosis in HIVcardiomyopathy through mitochondrion and death receptorcontrolled pathways. Proceedings of the National Academyof Sciences, USA 2002; 14:386–391.

20. Nie Z. HIV protease processes pro-caspase 8 to cause mito-chondrial relase of cytochrome C, caspase cleavage andnuclear fragmentation. Cell Death & Differentiation 2002;9:1172–1184.

21. Hayashi N & Mita E. Fas system and apoptosis in viralhepatits. Journal of Gastroenterology & Hepatology 1997;12:223–226.

22. Cohen G. Caspases: the executioners of apoptosis.Biochemical Journal 1997; 326:1–16.

23. Prikhod’ko EA, Prikhod’ko GG, Siegel RM, Thompson P,Major ME & Cohen JI. The NS3 protein of hepatitis Cvirus induces caspase-8-mediated apoptosis independent ofits protease or helicase activities. Virology 2004; 329:53–67.

24. Bantel H & Schulze-Osthoff K. Apoptosis in hepatitis Cvirus infection. Cell Death & Differentiation 2003;10:48–58.

25. Bantel H, Lugering A, Heidemann J, Volkmann X, PorembaC, Strassburg CP, Manns MP & Schulze-Osthoff K.Detection of apoptotic caspase activation in sera frompatients with chronic HCV infection is associated withfibrotic liver injury. Hepatology 2004; 40:1078–1087.

26. Feldstein A & Gores G. An apoptotic biomarker goes to theHCV clinic. Hepatology 2004; 40:1044–1046.

27. Korenaga M, Okuda M, Otani K, Wang T, Li Y &Weinman S. Mitochondrial dysfunction in hepatitis C.Journal of Clinical Gastroenterology 2005; 39:S162–S166.

28. Dalakas MC, Illa I, Pezeshkpour GH, Laukaitis JP, Cohen B& Griffin JL. Mitochondrial myopathy caused by long termzidovudine toxicity. New England Journal of Medicine1990; 322:1098–1105.

29. Arnaudo E, Dalakas M, Shanske S, Moraes CT, DiMauro S& Schon EA. Depletion of muscle mitochondrial DNA inAIDS patient with zidovudine-induced myopathy. Lancet1991; 337:508–510.

30. Peters BS, Winer J, Landon DN, Stotter A & Pinching AJ.Mitochondrial myopathy associated with chronic zidovu-dine therapy in AIDS. Quarterly Journal of Medicine 1993;86:5–15.

31. Brinkman K, ter Hofstede HJ, Burger DM, Smeitink JA &Koopmans PP. Adverse effects of reverse transcriptaseinhibitors: mitochondrial toxicity as a common pathway.AIDS 1998; 12:1735–1744.

32. Miro O, López S, Martinez E, Pedrol E, Milinkovic A, DeigE, Garrabou G, Casademont J, Gatell J & Cardellach F.Mitochondrial effects of HIV infection on the peripheralblood mononuclear cells of HIV-infected patients who werenever treated with antiretrovirals. Clinical InfectiousDiseases 2005; 39:710–716.


34. De Mendoza C, Sanchez-Conde M, Timmermans E &Soriano V. Mitochondrial DNA depletion in HIV-infectedpatients is enhanced with chronic hepatitis C and treatmentwith pegylated interferon plus ribavirin. 15th InternationalAIDS Conference. 11–16 July 2004, Bangkok, Thailand.Abstract MoPeB3313.

35. Moyle G, Datta D, Mandalia S, Morlese J, Asboe D &Gazzard B. Hyperlactatemia and lactic acidosis during anti-retroviral therapy: relevance, reproducibility and possiblerisk factors. AIDS 2002; 16:1341–1349.

36. Brinkman K & ter Hofstede H. Mitochondrial toxicity ofnucleoside analogue reverse transcriptase inhibitors: lacticacidosis, risk factors and therapeutic options. AIDSReviews 1999; 1:141–148.

37. Boubaker K, Flepp M, Sudre P, Furrer H, Hansel A &Hirschel B. Hyperlactatemia and antiretroviral therapy: theSwiss HIV Cohort study. Clinical Infectious Diseases 2001;33:1931–1937.

38. Bonnet F, Bonarek M, Abridj A, Mercie P, Dupon M,Gemain MC, Malvy D, Bernard N, Pellegrin JL, Morlat P& Beylot J. [Severe lactic acidosis in HIV-infected patientstreated with nucleoside reverse transcriptase analogues: areport of 9 cases]. Revue de Medecine Interne 2003;24:11–16. French.

39. Antoniades C, Macdonald C, Knisely A, Taylor C &Norris S. Mitochondrial toxicity associated with HAARTfollowing liver transplantation in an HIV-infected recipient.Liver Transplantation 2004; 10:699–702.

40. Bonnet F, Lawson-Ayayi S, Thiebaut R, RamanampamonjyR, Lacoste D, Bernard N, Malvy D, Bonarek M, Djossou F,Beylot J, Dabis F & Morlat P; French Aquitaine Cohort.Groupe d’Epidemiologie Clinique du SIDA en Aquitaine(GECSA). A cohort study of nevirapine tolerance in clinicalpractice: French Aquitaine Cohort, 1997–1999. ClinicalInfectious Diseases 2002; 35:1231–1237.

41. Rodriguez-Rosado R, Garcia-Samaniego J & Soriano V.Hepatotoxicity after introduction of highly active antiretro-viral therapy. AIDS 1998; 12:1256.

42. Saves M, Vandentorren S, Daucourt V, Marimoutou C,Dupon M, Couzigou P, Bernard N, Mercie P & Dabis F.Severe hepatic cytolysis: incidence and risk factors inpatients treated by antiretroviral combinations. AquitaineCohort, France, 1996–1998. Groupe d’EpidemiologieClinique de Sida en Aquitaine (GECSA). AIDS 1999;13:F115–F121.

43. Sulkowski M, Thomas D, Chaisson R & Moore R.Hepatotoxicity associated with antiretroviral therapy inadults infected with HIV and the role of hepatitis C or Bvirus infection. Journal of the American MedicalAssociation 2000; 283:74–80.

44. Nuñez M, Lana R, Mendoza JL & Soriano V. Risk factorsfor severe liver toxicity following the introduction ofHAART. Journal of Acquired Immune DeficiencySyndromes 2001; 27:426–431.





45. Aceti A, Pasquazzi C, Zechini B & De Bac C; LIVER-HAART Group. Hepatotoxicity development duringantiretroviral therapy containing protease inhibitors inpatients with HIV. The role of hepatitis B and C virus infec-tion. Journal of Acquired Immune Deficiency Syndromes2002; 29:41–48.

46. Bissell D, Gores G, Laskin D & Hoofnagle J. Drug-inducedliver injury: mechanisms and test systems. Hepatology 2001;33:1009–1013.

47. John M, Flexman J & French A. Hepatitis C virus-associatedhepatitis following treatment of HIV-infected patients withHIV protease inhibitors: an immune restoration disease?AIDS 1998; 12:2289–2293.

48. Vento S, Garofano T, Renzini C, Casali F, Ferraro T &Concia E. Enhancement of hepatitis C virus replication andliver damage in HIV-coinfected patients on antiretroviralcombination therapy. AIDS 1998; 12:116–117.

49. Gavazzi G, Bouchard O, Leclercq P, Morel-Baccard C,Bosseray A, Dutertre N, Micoud M & Morand P. Change intransaminases in hepatitis C virus- and HIV-coinfectedpatients after highly active antiretroviral therapy: differencesbetween complete and partial virologic responders? AIDSResearch & Human Retroviruses 2000; 16:1021–1023.

50. Stone S, Lee S, Keane N, Price P & French M. Associationof increased hepatitis C virus (HCV)-specific IgG andsoluble CD26 dipeptidyl peptidase IV enzyme activity withhepatotoxicity after highly active antiretroviral therapy inHIV-HCV-coinfected patients. Journal of Infectious Diseases2002; 186:1498–1502.

51. McKenzie R, Fried M, Sallie R, Conjeevaram H, DiBisceglie A & Park Y. Hepatic failure and lactic acidosis dueto fialuridine (FIAU), an investigational nucleoside analoguefor chronic hepatitis B. New England Journal of Medicine1995; 333:1099–1105.

52. Lonergan J, Behling C, Pfander H, Hassanein T & MathewsW. Hyperlactatemia and hepatic abnormalities in 10 HIV-infected patients receiving nucleoside analogue combinationregimens. Clinical Infectious Diseases 2000; 31:162–166.

53. Coghlan M, Sommadossi J, Jhala N, Many W, Saag M &Johnson V. Symptomatic lactic acidosis in hospitalized anti-retroviral-treated patients with HIV infection: a report of 12cases. Clinical Infectious Diseases 2001; 33:1914–1921.

54. Barbaro G, Di Lorenzo G, Asti A, Ribersani M, Belloni G& Grisorio B. Hepatocellular mitochondrial alterations inpatients with chronic hepatitis C: ultrastructural andbiochemical findings. American Journal of Gastroenterology1999; 94:2198–2205.

55. De Mendoza C, Sánchez-Conde M, Rivera E, Domingo P &Soriano V. Could mitochondrial DNA quantitation be asurrogate marker for drug mitochondrial toxicity? AIDSReviews 2004; 6:169–180.

56. Gonzalez de Requena D, Nuñez M, Jimenez-Nacher I &Soriano V. Liver toxicity caused by nevirapine. AIDS 2002;16:290–291.

57. Moriya K, Nakagawa K, Santa T, Shintani Y, Fujie H,Miyoshi H, Tsutsumi T, Miyazawa T, Ishibashi K, Horie T,Imai K, Todoroki T, Kimura S & Koike K. Oxidative stressin the absence of inflammation in a mouse model forhepatitis C virus associated hepatocarcinogenesis. CancerResearch 2001; 61:4365–4370.

58. Shao JY, Gao HY, Li YH, Zhang Y, Lu YY & Zeng YX.Quantitative detection of common deletion of mitochondrialDNA in hepatocellular carcinoma and hepatocellularnodular hyperplasia.World Journal of Gastroenterology2004; 10:1560–1564.

59. Verucchi G, Calza L, Biagetti C, Attard L, Costigliola P,Manfredi R, Pasquinelli G & Chiodo F. Ultrastructural liver

mitochondrial abnormalities in HIV/HCV coinfectedpatients receiving antiretroviral therapy. Journal ofAcquired Immune Deficiency Syndromes 2004;35:326–328.


61. Lafeuillade A, Hittinger G & Chadapaud S. Increasedmitochondrial toxicity with ribavirin in HIV/HCV coinfec-tion. Lancet 2001; 357:280–281.

62. Salmon-Ceron D, Chauvelot-Moachon L, Abad S,Silbermann B & Sogni P. Mitochondrial toxic effects andribavirin. Lancet 2001; 357:1803.

63. Duong M, Petit JM, Piroth L, Grappin M, Buisson M,Chavanet P, Hillon P & Portier H. Association betweeninsulin resistance and hepatitis C virus chronic infection inHIV-hepatitis C virus coinfected patients undergoing anti-retroviral therapy. Journal of Acquired Immune DeficiencySyndromes 2001; 27:245–250.

64. Lonardo A, Adinolfi LE, Loria P, Carulli N, Ruggiero G &Day CP. Steatosis and hepatitis C virus: mechanisms andsignificance for hepatic and extrahepatic disease.Gastroenterology 2004; 126:586–597.

65. Soriano V, Puoti M, Sulkowski M, Cargnel A, Dietrich D& Rockstroh J. Care of patients with hepatitis C and HIVco-infection. Updated recommendations from the HIV-HCV International Panel. AIDS 2004; 18:1–12.

66. Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G,Goncales FL Jr, Haussinger D, Diago M, Carosi G,Dhumeaux D, Craxi A, Lin A, Hoffman J & Yu J.Peginterferon alfa-2a plus ribavirin for chronic hepatitis Cvirus infection. New England Journal of Medicine 2002;347:975–982.

67. Torriani FJ, Rodriguez-Torres M, Rockstroh JK, Lissen E,Gonzalez-Garcia J, Lazzarin A, Carosi G, Sasadeusz J,Katlama C, Montaner J, Sette H Jr, Passe S, De Pamphilis J,Duff F, Schrenk UM & Dieterich DT; APRICOT StudyGroup. Peginterferon alfa 2a plus ribavirin for chronichepatitis C virus infection in HIV-infected patients. NewEngland Journal of Medicine 2004; 351:438–450.

68. Carrat F, Bani-Sadr F, Pol S, Rosenthal E, Lunel-Fabiani F,Benzekri A, Morand P, Goujard C, Pialoux G, Piroth L,Salmon-Ceron D, Degott C, Cacoub P & Perronne C;ANRS HCO2 RIBAVIC Study Team. Pegylated interferonalfa-2b vs standard interferon alfa-2b, plus ribavirin, forchronic hepatitis C in HIV-infected patients: a randomizedcontrolled trial. Journal of the American MedicalAssociation 2004; 292:2839–2848.

69. Lim S, Ponamerev M, Longley M & Copeland W.Structural determinants in human DNA polymerase γaccount for mitochondrial toxicity from nucleosideanalogs. Journal of Molecular Biology 2003: 329:45–57.

70. Moreno A, Quereda C, Moreno L, Perez-Elias MJ, MurielA, Casado JL, Antela A, Dronda F, Navas E, Barcena R &Moreno S. High rate of didanosine-related mitochondrialtoxicity in HIV/HCV coinfected patients receiving ribavirin.Antiviral Therapy 2004; 9:133–138.

71. Balzarini J, Lee C, Herdewijn P & De Clercq E.Mechanism of the potentiating effect of ribavirin on theactivity of 2′,3′-dideoxyinosine against HIV. Journal ofBiological Chemistry 1991; 266:21509–21514.

72. Soriano V, Sulkowski M, Bergin C, Katlama C, Dietrich D,Poynard T & Rockstroh J. Care of patients with chronichepatitis C and HIV co-infection: recommendations fromthe HIV-HCV international panel. AIDS 2002;16:813–828.




Long-term side effects of antiretroviral therapy are attrib-uted to the mitochondrial (mt) toxicity of nucleosideanalogue reverse transcriptase inhibitors (NRTIs) and theirability to deplete mtDNA. Studies in hepatocytes suggestthat uridine is able to prevent and treat mtDNA depletionby pyrimidine NRTIs [zalcitabine (ddC) and stavudine(d4T)] and to fully abrogate hepatocyte death, elevatedlactate production and intracellular steatosis. Uridine wasalso found to improve the liver and haematopoietic toxic-ities of zidovudine (AZT), which are unrelated to mtDNAdepletion, and to prevent neuronal cell death induced byddC. Most recently, uridine was found to prevent the onsetof a lipoatrophic phenotype (reduced intracellular lipids,increased apoptosis, mtDNA depletion and mt depolariza-tion) in adipocytes incubated long-term with d4T and AZT.Various steps of mt nucleoside utilization may be involved

in the protective effect, but competition of uridinemetabolites with NRTIs at polymerase γ or other enzymesis a plausible explanation. Pharmacokinetic studiessuggest that uridine serum levels can be safely increasedin humans to achieve concentrations which are protectivein vitro (50–200 µM). Uridine was not found to interferewith the antiretroviral activity of NRTIs. Mitocnol, a sugarcane extract which effectively increases uridine in humanserum, was beneficial in individual HIV patients with mttoxicity and is now being tested in placebo-controlledrandomized trials. Until these data become available, therisk–benefit calculation of using uridine should be indi-vidualized. The current safety data justify the closelymonitored use of uridine in individuals who suffer frommt toxicity but who cannot be switched to less toxicNRTIs.

Uridine in the prevention and treatment of NRTI-related mitochondrial toxicityUlrich A Walker* and Nils Venhoff

Department of Rheumatology and Clinical Immunology, Medizinische Universitätsklinik, Freiburg, Germany


More than 8 years after the widespread introduction ofhighly active antiretroviral therapy (HAART), it hasbecome clear that antiretroviral drugs have long-termeffects on organs and body metabolism. Nucleosidereverse transcriptase inhibitors (NRTIs) within theantiretroviral cocktail are associated with hyperlac-tataemia and organ toxicities such as damage to theliver, peripheral nerves and skeletal muscle. The choiceof NRTI also determines an individual’s risk of devel-oping lipoatrophy, a clinically irreversible loss ofsubcutaneous tissue. The main mechanism of theseNRTI-related side effects has been identified as mito-chondrial (mt) toxicity [1–7].

Pathogenesis of NRTI-related mt toxicity

NRTIs are activated by triphosphorylation and thenthey inhibit polymerase γ, the enzyme which replicatesmtDNA [3,8]. Polymerase γ inhibition is a result ofseveral distinct steps [3]. The first step involves compe-tition of NRTI triphosphates with the natural nucleo-side triphosphates. If this competition is successful, theNRTIs are incorporated into the nascent mtDNA

strand. This second step causes chain termination. As aresult of polymerase γ impairment, mtDNA depletion(a quantitative reduction of the mtDNA copy number)ensues. The relative potency of activated nucleosidetriphosphates to inhibit polymerase γ is not the sameamong all NRTIs. In vitro data indicate a relativelystrong inhibitory effect of the ‘d-drugs’, that is,zalcitabine (ddC), didanosine (ddI) and stavudine(d4T), whereas abacavir, emtricitabine, lamivudine andtenofovir do not impair mtDNA replication in clini-cally relevant concentrations [3,8,9].

Zidovudine (AZT) is a special case because thisNRTI is a mt toxin despite the fact that AZT triphos-phate only has a low potency to affect polymerase γand mtDNA content in clinically relevant and cyto-toxic concentrations, at least in proliferating cells[8–11]. On one hand, the mt toxicity of AZT may, inpart, involve binding to adenylate kinase (an enzymeinvolved in ATP formation) and inhibition of the mtADP/ATP translocator [12–14]. These mechanismsmay explain why some toxicities have been observedrelatively early after AZT exposure [9,13]. On theother hand, mtDNA depletion has indeed been

Introduction

observed with AZT in vivo [6,15–17]. Two observa-tions may explain why mtDNA depletion may alsooccur in the absence of direct polymerase γ inhibition.Firstly, it has been shown in vivo that some of theadministered AZT can be non-enzymatically convertedinto d4T, and thus a stronger polymerase γ inhibitor[18]. Secondly, mtDNA depletion may result from aanother mechanism, namely from AZT-mediated inhi-bition of thymidine kinase (TK) type 2 [19]. This TK isexpressed in mitochondria and responsible for theintramitochondrial phosphorylation of pyrimidinenucleosides (deoxythymidine, deoxycytidine anddeoxyuridine). In non-replicating cells, the cytosolicTK type 1 (TK1) is down-regulated, making the pyrim-idine supply for mtDNA synthesis dependent on theactivity of TK2. Such reduced supply of the normaldeoxypyrimidine phosphates limits mtDNA replica-tion, especially in skeletal muscle, as evidenced by a mtmyopathy in subjects carrying TK2 mutations [20].

As mtDNA encodes for subunits of the mt respira-tory chain, mtDNA depletion therefore results in respi-ratory chain dysfunction.

Any respiratory chain dysfunction may promoteelectron leakage in the mt matrix and thus the genera-tion of reactive oxygen species (ROS). Such increasedROS formation may then in turn damage the lipidarchitecture of the mt membrane, attack respiratorychain proteins or damage polymerase γ and mtDNAitself, thereby closing several vicious circles thatpromote even more ROS formation [21,22]. There isalso evidence for additional mechanisms of ROSformation [1]. Markers of oxidative damage andheteroplasmic mtDNA point mutations have indeedbeen shown to increase in patients treated with NRTIs[23,24].

Respiratory chain dysfunction also leads to thesecondary impairment of several metabolic pathways.Firstly, ATP can no longer be synthesized efficientlythrough oxidative phosphorylation and glycolysis hasto be relied upon. Secondly, the block of NADH utiliza-tion in the respiratory chain increases the intracellularNADH/NAD+ ratio. This alteration of the redox statuspromotes the conversion of pyruvate to lactate andinhibits key enzymes of beta oxidation, resulting in theintracellular accumulation of triglycerides [25].

The mt respiration also has a third important task:an efficient electron-flux through the respiratory chainis essential for the activity of dihydroorotate-dehydrogenase (DHODH; E.C. 1.3.99.11), an enzymelocated in the inner mt membrane and necessary for thede novo synthesis of all (intramitochondrial andintracytoplasmic) pyrimidines [26]. This is becauseDHODH catalyses the oxidation of dihydroorotate toorotate from which uridine monophosphate (UMP) andintracellular pyrimidines are synthesized (Figure 1).

A defect in the respiratory chain therefore results inpyrimidine depletion. The indirect inhibition ofDHODH by NRTI-related mt toxicity is likely to besimilar to those caused by direct DHODH inhibitors[27]. Research into leflunomide [27,28], a directDHODH inhibitor and a licensed immunosuppressivedrug has taught us about the in vitro and in vivo conse-quences of DHODH inhibition (Figure 2). The deple-tion of UMP and derived intracellular pyrimidinesactivates p53 and its immediate transcriptional targetp21 [27,29]. p53 also regulates the activation of Rbprotein and thus of cyclins via phosphorylation [30].Through this mechanism, the pyrimidine depletioninhibits the transition to the S-phase of the cell cycleand leads to a mitotic arrest in the G1 phase. p53 canalso activate the transcription of Bax [31] and promoteapoptosis. These molecular mechanisms may explainwhy cells with mtDNA depletion stop dividing andthen die.

The importance of the intracellular pyrimidine poolsfor the survival of cells without a functional respiratorychain is supported by the fact that cells without a singlemolecule of mtDNA (rho0-cells) are rescued from cell

UA Walker & N Venhoff


Carbamoylphosphate

Dihydroorotic acid

Orotic acid

DHODHmt toxicityleflunomide Beta-

alanine

Uridine UracilUMP

UTP

RNAUDP sugars

dTTP

DNA

dCTP

DNA

CTP

RNACDP lipids

Figure 1. Simplified scheme of pyrimidine metabolism

The biosynthetic pathway starts with the formation of carbamoyl phosphate.DHODH (an enzyme which is inhibited by respiratory chain dysfunction in mttoxicity of NRTIs and by leflunomide) then catalyses the synthesis of orotate.Orotate is then anabolized to UMP, which can be used to produce RNA, DNA,glycosylation products or membrane constituents. Uridine can be salvaged intoUMP by uridine kinase or degraded into beta-alanine, which enters the tricar-boxylic acid cycle. Dashed arrows signify pathways involving intermediatemetabolites. mt, mitochondrial; CDP, cytidine diphosphate; DHODH, dihy-droorotate dehydrogenase; dCTP, dideoxycytidine triphosphate; dTTP,dideoxythymidine triphosphate; UDP, uridine diphosphate; UMP, uridinemonophosphate; UTP, uridine triphosphate.

death and grow virtually normally if the intracellularpyrimidine pools are replenished by substances that canbe salvaged into pyrimidines by being converted intoUMP distal to DHODH. One such substance that canbypass the block in the de novo synthesis of pyrim-idines is uridine [32].

Uridine abrogates mt toxicity in vitro

The relationship between respiratory chain dysfunctionand pyrimidine metabolism makes uridine an attractivecandidate to alleviate symptoms of NRTI-related mttoxicity. Early work has demonstrated that neuronalcells exposed to ddC are rescued from death andimprove in proliferation and neurite outgrowth if themedium was supplemented with uridine (50 µM) [33].Uridine in concentrations of 50 µM also completelyreversed the haematopoietic toxicity of AZT (5 µM) onnormal human granulocyte–macrophage progenitor cells[34]. Similar strategies in mouse models of AZT-inducedbone marrow suppression reversed anaemia,leucopoenia, increased peripheral reticulocytes andincreased bone marrow cellularity [35]. The mecha-nism for the beneficial action of uridine on AZT is stillunclear. As discussed above, AZT has many effects oncell metabolism [8,19]. It is conceivable that uridine orits derived pyrimidines may compete with AZT for oneor several of these metabolic steps or, alternatively, forkinases or transporters responsible for the intramito-chondrial presence of triphosphorylated AZT [8,34].

Investigations into a model of d-drug-related hepa-totoxicity made the surprising discovery that uridinewas not only able to prevent cell death (an expectedfinding), but also to prevent the onset of a severemtDNA depletion and thereby normalize the synthesisof mtDNA-encoded respiratory chain subunits. Thisalso normalized the rate of lactate production and theintracellular triglyeride content [36]. Importantly,uridine was only able to improve the mtDNA depletion

caused by pyrimidine NRTIs, not that caused by purineanalogues such as ddI.

The ability of uridine to antagonize the polymerase γinhibition by pyrimidine d-drugs may be explained byits ability to disrupt the following vicious circle (Figure3): as discussed above, polymerase γ inhibition involvescompetition of NRTIs with the natural nucleotides as afirst step. mtDNA depletion, respiratory dysfunction,DHODH inhibition and pyrimidine depletion ensue.The decrease in intracellular pyrimidines most prob-ably allows for a more efficient competition of theexogenous nucleoside analogue at polymerase γ. Thus,a vicious circle is closed and drives the cell into furthermtDNA depletion. We hypothesize that this circle isdisrupted by supplying uridine as an exogenous sourceof intracellular pyrimidines. The data also suggest thatthe ability of uridine to abrogate mt toxicities wasproportional to the concentration of uridine [33,34,36],underlining the hypothesis of a competitive process.Alternatively, uridine may compete with antiretroviralsat steps of intracellular NRTI transport and phospho-rylation.

Most recently, long-term exposure of adipocytes tod4T (10 µM), ddC (0.2 µM) or AZT (1 µM) wasshown to induce a lipoatrophic phenotype consisting ofapoptosis, loss of lipids, mtDNA depletion, loss ofmtDNA-encoded respiratory chain subunits anddisruption of the mt membrane potential [37]. Theaddition of uridine (200 µM) completely abrogated allthese effects on adipocytes.


Uridine in mitochondrial toxicity

UMPdepletion

p63 + p21activation

Baxtranscription

pRbnot

activated

cyclinsnot

activated

mitoticarrest

apoptosis

Figure 2. Molecular and functional consequences ofdiminished intracellular pyrimidine supply

UMP, uridine monophosphate.

Inhibition ofγ-polymerase

by NRTIs

Relative excess of NRTIsover natural pyrimidine

mtDNAdepletion

Respiratory chaindysfunction

Uridine

Inhibition of DHODH

Inhibition ofuridine synthesis

Pyrimidinepool

Figure 3. Vicious cycle which is hypothesized to contribute tothe mt toxicity of antiretroviral pyrimidine d-drugs andwhich may be abrogated by uridine supplementation

mt, mitochondrial; DHODH, dihydroorotate dehydrogenase; NRTI, nucleosidereverse transcriptase inhibitor.

Notably, uridine was not only able to prevent theonset of mt toxicity but also to treat toxicities that werealready established [35,36]. Interestingly, in theabsence of uridine it took considerably longer formtDNA depletion to develop (weeks), than it took foruridine to revert such mt toxicity (days) [36]. This rela-tively quick therapeutic effect of uridine relative to themore prolonged development of mt toxicities mayallow for intermittent uridine dosing in order to ‘resetthe mitochondrial clock’.

Metabolism, pharmacokinetics and safety ofuridine in humans

Normal uridine concentrations range from 3–8 µM inhuman blood plasma, bone marrow and cerebrospinalfluid [38]. Although uridine is part of our everydayfood, diet is not an important source of uridine [39,40].Clinical studies and animal models suggest that uridineis mostly produced in the liver and that erythrocytesserve as carriers for distributing the uridine throughoutthe body [38]. Exogenous uridine rapidly disappearsfrom plasma (t1/2=2 min), reflecting a concentrativeand, under physiological conditions, unsaturated entryinto tissue cells, as well as catabolism by the liver [41].Subsequently, the tissue uridine pools turn over withhalf-lives of 13 to 18 h [41]. The physiological range ofuridine in the human plasma was shown not tocompletely satisfy the pyrimidine requirements ofdividing cells, making some de novo synthesis necessaryfor optimal proliferation [42]. Circulating uridine maynevertheless be of physiological importance by allowingdividing cells to utilize their salvage pathway [42].

Uridine has several metabolic fates in the cell (Figure1). Exogenous uridine is rapidly incorporated intonucleotides in nucleated cells [43]. Uridine can beconverted to dTTP and dCTP, which are used toproduce DNA. UTP is used for the synthesis of RNA.UTP can also be converted into CTP, which uponconjugation of lipids forms cellular membraneconstituents such as CDP ethanolamine. In the form ofUDP sugars, uridine may help in the production ofglycogen and in protein glycosylation. Uridine isdegraded into beta-alanine, which can enter the tricar-boxilic acid cycle (See Figure 1 for abbreviations) [38].

Pharmacokinetic and safety data for uridine werecollected in several human Phase 1 and 2 trials. Parentaladministration of uridine as a 1 h infusion (8 g/m2)resulted in plasma levels in the millimolar range, farabove those required to abrogate NRTI-related mt toxi-city [44]. Half-life, volume of distribution (634 ml/kg)and total clearance (4.98 ml/kg/min) of uridine appearto be independent of dose, whereas Cmax and AUCincrease with dose in a linear fashion [44]. In subjectsgiven uridine at doses of 2–12 g/m2 as a single 1 h

infusion, about a fourth of the administered dose wasexcreted in the urine [44]. Uracil, a uridine catabolite,accounted for 3% of the uridine dose [44]. These intra-venous doses were tolerated without side effects.However, transient fever, lasting for 15 min, occurredwith higher doses [44,45]. Intermittent infusion sched-ules with 3 g/m2/h for 3 h, alternating with a 3-h treat-ment-free interval, resulted in plasma levels of138–335 µM during the treatment-free period and weretolerable over the 72-h study period [45]. Parenteraluridine necessitates central venous administration dueto the onset of phlebitis if given through a peripheralvein [45]. Uridine can also be administered orally and isgenerally tolerated without any side effects. However,excessive oral dosing (12 g/m2) is limited by mild andreversible osmotic diarrhoea due to the relatively poorbioavailability of uridine (7%) [46]. Using other pyrim-idine precursors, for example, triacetyluridine[34,47,48] or inhibitors of uridine catabolism or excre-tion may also be envisaged [35,49,50].

Human uridine serum levels can now be effectivelyincreased with mitocnol, a sugar cane extract with ahigh content (17%) of nucleosides [51]. 24-hour phar-macokinetic data indicate that consuming 36 g of apowder that contains mitocnol increases humanuridine serum levels from baseline values (5.6 µM) tomean uridine serum concentrations (Cmax) of 152.0 µM[51]. Adverse events were not observed. It is recom-mended that three sachets of mitocnol are taken onthree consecutive days per month, taking into accountthe relatively quick improvement of mt toxicity from invitro studies.

In summary, the current data indicate that uridineconcentrations that are protective in vitro can be safelyachieved with oral and parenteral dosing. Oral uridinesupplementation (150 mg/kg/d) is also recommendedand has been safely used long-term in patients withhereditary orotic aciduria, an inborn error of pyrimi-dine de novo synthesis, in which uridine reverses mega-loblastic anaemia and other symptoms [52].

Interaction of uridine with antiretroviralnucleotides

If uridine or its metabolites are able to compete withNRTIs at the level of polymerase γ, they may also do soat the level of HIV reverse transcriptase (RT). Thisposes a theoretical risk for the antiretroviral efficacy ofnucleoside analogues. The efficiency of RT inhibition isdependent on the ratio between the normal deoxynu-cleoside triphosphates and the NRTI triphosphates atthe enzyme. For example, mycophenolate mofetil, aninhibitor of purine synthesis, depletes intracellulardeoxyguanosine triphosphate and decreases plasmaHIV-1 RNA in patients treated with the guanosine



analogue abacavir [53,54]. Uridine may thus theoreti-cally have an opposite effect on RT by increasing thenormal deoxypyrimidine triphosphates.

Such an effect of uridine on the antiretroviralactivity of pyrimidine analogues was first analysed withregard to AZT [34]. Phenotypic HIV resistance assaysdemonstrated that uridine did not interfere with viralsuppression [34]. Importantly, uridine did not impairthe antiretroviral activity even in a 10000-fold molarexcess, whereas the maximal therapeutic effects ofuridine were already achieved with a 10-fold molarsurplus. Investigations in mice also came to the sameconclusion [35].

The potential interference of uridine with the anti-retroviral activity of NRTIs was also extensively exam-ined in phenotypic HIV resistance assays usingnucleoside analogues alone and in combinations [55].Both X-4 tropic and R-5 tropic HIV isolates weretested and three different detection systems includingprimary human peripheral blood mononuclear cellswere used. Uridine was added in concentrations up to615 µM. Additionally, in these investigations no effectof uridine on NRTI-mediated viral suppression wasdetected. Enhancement of the normal intracellularpyrimidine stores therefore does not seem to have acrucial effect on HIV replication.

Taken together, the data suggest that the interactionbetween uridine and NRTIs in the prevention of mtdamage does not necessarily imply a reduced antiretro-viral efficacy. Explanations for this selectivity include aseparate regulation of mt and cytoplasmic dNTP pools,either at the level of mt transport [56] or by the pres-ence of disparate kinases in both compartments [57].The differential action of uridine on the mt and anti-retroviral replication enzymes may also be caused bydifferences between the polymerases in selecting thenatural nucleotide over the activated NRTI.

Uridine in HIV-infected patients

The selective effect of exogenous uridine on NRTI-inhibited mtDNA replication, but not on NRTI anti-retroviral action, implies that HIV-infected patientsunder treatment with pyrimidine NRTIs and sufferingfrom mt toxicity may benefit from strategies aimed atincreasing uridine. Mitocnol was used in an HIVpatient with progressive hyperlactataemia, mt steato-hepatitis and symptomatic elevation of creatine kinase(CK) under long-term antiretroviral treatment withd4T [58]. The patient was started on mitocnol (threesachets/day for four consecutive days). After 2 weeks,at his next visit, liver and muscle enzymes, as well asthe myalgias had improved rapidly, despite unchangedmedication. Lactate had normalized after 7 weeks andHIV replication remained below the limit of detection.

d4T was then switched to tenofovir with no subsequentclinical or laboratory abnormalities.

Mitocnol is now widely used in Germany. Severaland in-part randomized and placebo-controlled clinicaltrials are currently being conducted to formally analysewhether mitocnol is able to prevent and treat mt toxic-ities such as lipoatrophy, polyneuropathy, hepaticsteatosis and myopathy. Virological failure has notbeen reported (UA Walker, personal communication).

Perspective

The issues discussed above have several further impli-cations. Uridine supplementation may be used toenhance the therapeutic index of pyrimidine NRTIsand thus allow higher dosing to overcome multidrugresistance in salvage therapy. The available data alsosuggest the possibility of mtDNA depletion in blood[17,59,60]. If the detected mtDNA depletion in bloodsecondary to pyrimidine NRTIs indeed also reflectsreduced mtDNA copy numbers in lymphocytes and if itexceeded a certain threshold, it would have effectssimilar to those of the direct DHODH inhibitorleflunomide and of inherited defects in pyrimidinesynthesis. From the clinical experience with lefluno-mide as a licensed immunosuppressive antirheumaticdrug, it could then be predicted that the mt toxicity inlymphocytes impairs the proliferation of lymphocytesin response to mitotic stimuli, interferes with CD4recovery and thus is immunosuppressive. Impaired cell-mediated immune responses and reduced CD4 andCD8 lymphocyte subsets were also observed in severalpatients with an inherited defect in the de novosynthesis of pyrimidines; their immunodeficiencyimproved upon uridine therapy [52,61]. It was alsoshown that uridine antagonized the inhibition oflymphocytes by leflunomide [62,63]. Most recent invitro and in vivo observations in HIV patients alsosupport the view of mt toxicity as being immunosup-pressive [11,64,65]. This also offers the potential foruridine to enhance the CD4 cell recovery of patientsunder antiretroviral treatment.

Strategies aimed at increasing uridine also improvedsymptoms in patients harbouring a qualitative defect inmtDNA by carrying inherited mtDNA mutations [66].In patients with such mtDNA mutations, however,uridine would be predicted to ameliorate only oneaspect of respiratory chain dysfunction, namely theconsequences of DHODH inhibition and, in contrastwith antiretroviral-treated HIV patients, not toimprove the underlying mtDNA pathology. Therefore,patients with mtDNA mutations are likely to have acontinued defect in ATP synthesis and hyperlac-tataemia under uridine. Further clinical data on thisgroup of patients are eagerly awaited.



Many aspects of uridine are still poorly understood.For example, an oral dose of 300 mg three times dailyfor 6 months also improved diabetic neuropathy in awell-conducted trial [67]. Therapeutic uses of uridinewere also proposed in cardiovascular disease, hyper-tension, liver disease and infertility, among others [38].

Until the data from formal clinical studies are avail-able, the risk–benefit calculation of using uridine inHIV-infected patients should be individualized. Thecurrent safety data justify the current use of uridine inindividuals suffering from mt toxicity who are closelymonitored and who cannot be switched to an anti-retroviral regimen with a lower potential of mt toxicity.

References1. Lewis W & Dalakas MC. Mitochondrial toxicity of

antiviral drugs. Nature Medicine 1995; 1:417–422.2. Brinkman K, ter Hofstede HJ, Burger DM, Smeitink JA &

Koopmans PP. Adverse effects of reverse transcriptaseinhibitors: mitochondrial toxicity as common pathway.AIDS 1998; 12:1735–1744.

3. Lewis W, Day BJ & Copeland WC. Mitochondrial toxicityof NRTI antiviral drugs: an integrated cellular perspective.Nature Reviews Drug Discovery 2003; 2:812–822.

4. Walker UA, Bäuerle J, Laguno M, Murillas J, Mauss S,Schmutz G, Setzer B, Miquel R, Gatell JM & Mallolas J.Depletion of mitochondrial DNA in liver under antiretro-viral therapy with didanosine, stavudine, or zalcitabine.Hepatology 2004; 39:311–317.



7. Walker UA, Bickel M, Lütke Volksbeck SI, Ketelsen UP,Schöfer H, Setzer B, Venhoff N, Rickerts V & Staszewski S.Evidence of nucleoside analogue reverse transcriptaseinhibitor-associated genetic and structural defects of mito-chondria in adipose tissue of HIV-infected patients. Journalof Acquired Immune Deficiency Syndromes 2002;29:117–121.



10. Chen CH, Vazquez-Padua M & Cheng YC. Effect of anti-human immunodeficiency virus nucleoside analogs onmitochondrial DNA and its implication for delayed toxicity.Molecular Pharmacology 1991; 39:625–628.

11. Setzer B, Schlesier M, Thomas AK & Walker UA.Mitochondrial toxicity of nucleoside analogues in primaryhuman lymphocytes. Antiviral Therapy 2005; 10:327–334.

12. Barile M, Valenti D, Passarella S & Quagliariello E. 3′-Azido-3′-deoxythmidine uptake into isolated rat livermitochondria and impairment of ADP/ATP translocator.Biochemical Pharmacology 1997; 53:913–920.

13. Hobbs GA, Keilbaugh SA, Rief PM & Simpson MV.Cellular targets of 3′-azido-3′-deoxythymidine: an early(non-delayed) effect on oxidative phosphorylation.Biochemical Pharmacology 1995; 50:381–390.

14. Barile M, Valenti D, Hobbs GA, Abruzzese MF, KeilbaughSA, Passarella S, Quagliariello E & Simpson MV.

Mechanisms of toxicity of 3′-azido-3′-deoxythymidine. Itsinteraction with adenylate kinase. BiochemicalPharmacology 1994; 48:1405–1412.

15. Chariot P, Drogou I, de Lacroix-Szmania I, Eliezer-VanerotMC, Chazaud B, Lombes A, Schaeffer A & Zafrani ES.Zidovudine-induced mitochondrial disorder with massiveliver steatosis, myopathy, lactic acidosis, and mitochondrialDNA depletion. Journal of Hepatology 1999; 30:156–160.

16. Gerschenson M & Poirier MC. Fetal patas monkeys sustainmitochondrial toxicity as a result of in utero zidovudineexposure. Annals of the New York Academy of Sciences2000; 918:269–281.

17. Shiramizu B, Shikuma KM, Kamemoto L, Gerschenson M,Erdem G, Pinti M, Cossarizza A & Shikuma C. Placentaand cord blood mitochondrial DNA toxicity in HIV-infectedwomen receiving nucleoside reverse transcriptase inhibitorsduring pregnancy. Journal of Acquired Immune DeficiencySyndromes 2003; 32:370–374.

18. Becher F, Pruvost AG, Schlemmer DD, Creminon CA,Goujard CM, Delfraissy JF, Benech HC & Grassi JJ.Significant levels of intracellular stavudine triphosphate arefound in HIV-infected zidovudine-treated patients. AIDS2003; 17:555–561.

19. McKee EE, Lynx MD, Susan-Resiga D, Bentley AT,D’Haenens JP, Cullen D & Ferguson M. Zidovudine inhibitsthymidine phosphorylation: a novel site of potential toxicityin non-mitotic cells. Antiviral Therapy 2005; 9:L9.

20. Saada A, Shaag A, Mandel H, Nevo Y, Eriksson S & ElpelegO. Mutant mitochondrial thymidine kinase in mitochondrialDNA depletion myopathy. Nature Genetics 2001; 29:342–344.

21. Graziewicz MA, Day BJ & Copeland WC. The mitochon-drial DNA polymerase as a target of oxidative damage.Nucleic Acids Research 2002; 30:2817–2824.

22. Corral-Debrinski M, Stepien G, Shoffner JM, Lott MT,Kanter K & Wallace DC. Hypoxemia is associated withmitochondrial DNA damage and gene induction.Implications for cardiac disease. Journal of the AmericanMedical Association 1991; 266:1812–1816.

23. de la Asuncion JG, del Olmo ML, Sastre J, Millan A, PellinA, Pallardo FV & Vina J. AZT treatment induces molecularand ultrastructural oxidative damage to muscle mitochon-dria. Prevention by antioxidant vitamins. Journal of ClinicalInvestigation 1998; 102:4–9.

24. Martin AM, Hammond E, Nolan D, Pace C, Den Boer M,Taylor L, Moore H, Martinez OP, Christiansen FT &Mallal S. Accumulation of mitochondrial DNA mutations inhuman immunodeficiency virus-infected patients treatedwith nucleoside-analogue reverse-transcriptase inhibitors.American Journal of Human Genetics 2003; 72:549–560.

25. Fromenty B & Pessayre D. Inhibition of mitochondrial beta-oxidation as a mechanism of hepatotoxicity. Pharmacology& Therapeutics 1995; 67:101–154.

26. Löffler M, Jöckel J, Schuster G & Becker C. Dihydroorotat-ubiquinone oxidoreductase links mitochondria in thebiosynthesis of pyrimidine nucleotides. Molecular & CellularBiochemistry 1997; 174:125–129.

27. Fox RI. Mechanism of action of leflunomide in rheumatoidarthritis. Journal of Rheumatology 1998; 53(Suppl 1):20–26.

28. Cherwinski HM, Cohn RG, Cheung P, Webster DJ, Xu YZ,Caulfield JP, Young JM, Nakano G & Ransom JT. Theimmunosuppressant leflunomide inhibits lymphocyte prolif-eration by inhibiting pyrimidine biosynthesis. Journal ofPharmacology & Experimental Therapeutics 1995;275:1043–1049.

29. Oren M. Regulation of the p53 tumor suppressor protein.Journal of Biological Chemistry 1999; 274:36031–36034.

30. Laliberte J, Yee A, Xiong Y & Mitchell BS. Effects ofguanine nucleotide depletion on cell cycle progression inhuman T lymphocytes. Blood 1998; 91:2896–2904.

31. Schuler M & Green DR. Mechanisms of p53-dependentapoptosis. Biochemical Society Transactions 2001;29:684–688.

32. Bodnar AG, Cooper JM, Leonard JV & Schapira AH.Respiratory-deficient human fibroblasts exhibiting defectivemitochondrial DNA replication. Biochemical Journal 1995;305:817–822.



33. Keilbaugh SA, Hobbs GA & Simpson MV. Anti-humanimmunodeficiency virus type 1 therapy and peripheralneuropathy: prevention of 2′,3′-dideoxycytidine toxicity inPC12 cells, a neuronal model, by uridine and pyruvate.Molecular Pharmacology 1993; 44:702–706.

34. Sommadossi JP, Carlisle R, Schinazi RF & Zhou Z. Uridinereverses the toxicity of 3′-azido-3′-deoxythymidine in normalhuman granulocyte-macrophage progenitor cells in vitrowithout impairment of antiretroviral activity. AntimicrobialAgents & Chemotherapy 1988; 32:997–1001.

35. Calabresi P, Falcone A, St Clair MH, Wiemann MC, ChuSH & Darnowski JW. Benzylacyclouridine reversesazidothymidine-induced marrow suppression withoutimpairment of anti-human immunodeficiency virus activity.Blood 1990; 76:2210–2215.

36. Walker UA, Venhoff N, Koch E, Olschweski M, Schneider J& Setzer B. Uridine abrogates mitochondrial toxicity relatedto nucleoside analogue reverse transcriptase inhibitors inHepG2 cells. Antiviral Therapy 2003; 8:463–470.

37. Walker UA, Auclair M, Lebrecht D, Kornprobst M, CapeauJ & Caron M. Uridine abrogates the adverse effects ofstavudine and zalcitabine on adipose cell functions.Antiviral Therapy 2004; 9:L21–L22.

38. Connolly GP & Duley JA. Uridine and its nucleotides:biological actions, therapeutic potentials. Trends inPharmacological Science 1999; 20:218–225.

39. Becroft DM, Phillips LI & Simmonds A. Hereditary oroticaciduria: long-term therapy with uridine and a trial ofuracil. Journal of Pediatrics 1969; 75:885–891.

40. Yamamoto T, Moriwaki Y, Takahashi S, Tsutsumi Z, Ka T,Fukuchi M & Hada T. Effect of beer on the plasma concen-trations of uridine and purine bases. Metabolism 2004;51:1317–1323.

41. Darnowski JW & Handschumacher RE. Tissue uridinepools: evidence in vivo of a concentrative mechanism foruridine uptake. Cancer Research 1986; 46:3490–3494.

42. Karle JM, Anderson LW & Cysyk RL. Effect of plasmaconcentrations of uridine on pyrimidine biosynthesis incultured L1210 cells. Journal of Biological Chemistry 1984;259:67–72.

43. Hoogenraad NJ & Lee DC. Effect of uridine on de novopyrimidine biosynthesis in rat hepatoma cells in culture.Journal of Biological Chemistry 1974; 249:2763–2768.

44. Leyva A, van Groeningen CJ, Kraal I, Gall H, Peters GJ,Lankelma J & Pinedo HM. Phase I and pharmacokineticstudies of high-dose uridine intended for rescue from 5-fluo-rouracil toxicity. Cancer Research 1984; 44:5928–5933.

45. van Groeningen CJ, Leyva A, Kraal I, Peters GJ & PinedoHM. Clinical and pharmacokinetic studies of prolongedadministration of high-dose uridine intended for rescue from5-FU toxicity. Cancer Treatment Reports 1986; 70:745–750.

46. van Groeningen C, Peters G, Nadal J, Leyva A, Gall H &Pinedo H. Phase I clinical and pharmacokinetics study oforally administered uridine. Proceedings of the AmericanAssociation of Cancer Research 1987; 28:195.

47. Bhalla KN, Li GR, Grant S, Cole JT, MacLaughlin WW &Volsky DJ. The effect in vitro of 2′-deoxycytidine on themetabolism and cytotoxicity of 2′,3′-dideoxycytidine. AIDS1990; 4:427–431.

48. Bhalla K, Birkhofer M, Li GR, Grant S, MacLaughlin W,Cole J, Graham G & Volsky DJ. 2′-deoxycytidine protectsnormal human bone marrow progenitor cells in vitroagainst the cytotoxicity of 3′-azido-3′-deoxythymidine withpreservation of antiretroviral activity. Blood 1989;74:1923–1928.

49. Falcone A, Darnowski JW, Ruprecht RM, Chu SH, BrunettiI & Calabresi P. Different effect of benzylacyclouridine onthe toxic and therapeutic effects of azidothymidine in mice.Blood 1990; 76:2216–2221.

50. de Miranda P, Good SS, Yarchoan R, Thomas RV, BlumMR, Myers CE & Broder S. Alteration of zidovudine phar-macokinetics by probenecid in patients with AIDS orAIDS-related complex. Clinical Pharmacology &Therapeutics 1989; 46:494–500.

51. Venhoff N, Zilly M, Lebrecht D, Schirmer D, Klinker H,Thoden J, Langmann P & Walker UA. Uridine pharmacoki-netics of mitocnol, a sugar cane extract. AIDS 2005;19:739–745.

52. Girot R, Hamet M, Perignon JL, Guesnu M, Fox RM,Cartier P, Durandy A & Griscelli C. Cellular immune defi-ciency in two siblings with hereditary orotic aciduria. NewEngland Journal of Medicine 1983; 308:700–704.

53. Margolis DM, Kewn S, Coull JJ, Ylisastigui L, Turner D,Wise H, Hossain MM, Lanier ER, Shaw LM & Back D.The addition of mycophenolate mofetil to antiretroviraltherapy including abacavir is associated with depletion ofintracellular deoxyguanosine triphosphate and a decrease inplasma HIV-1 RNA. Journal of Acquired ImmuneDeficiency Syndromes 2002; 31:45–49.

54. Hossain MM, Coull JJ, Drusano GL & Margolis DM. Doseproportional inhibition of HIV-1 replication by mycophe-nolic acid and synergistic inhibition in combination withabacavir, didanosine, and tenofovir. Antiviral Research2002; 55:41–52.

55. Koch EC, Schneider J, Weiss R, Penning B & Walker UA.Uridine excess does not interfere with the antiretroviral effi-cacy of nucleoside analogue reverse transcriptase inhibitors.Antiviral Therapy 2003; 8:485–487.

56. Rossi L, Serafini S, Schiavano GF, Casabianca A, Vallanti G,Chiarantini L & Magnani M. Metabolism, mitochondrialuptake and toxicity of 2′,3′-dideoxycytidine. BiochemicalJournal 1999; 344:915–920.

57. Gallinaro L, Crovatto K, Rampazzo C, Pontarin G, FerraroP, Milanesi E, Reichard P & Bianchi V. Human mitochon-drial 5′-deoxyribonucleotidase. Overproduction in culturedcells and functional aspects. Journal of Biological Chemistry2002; 277:35080–35087.

58. Walker UA, Langmann P, Miehle N, Zilly M, Klinker H &Petschner F. Beneficial effects of oral uridine in mitochon-drial toxicity. AIDS 2004; 18:1085–1086.

59. Coté HC, Brumme ZL, Craib KJ, Alexander CS, WynhovenB, Ting L, Wong H, Harris M, Harrigan PR, O’ShaughnessyMV & Montaner JS. Changes in mitochondrial DNA as amarker of nucleoside toxicity in HIV-infected patients. NewEngland Journal of Medicine 2002; 346:811–820.

60. Cossarizza A. Tests for mitochondrial function and DNA:potentials and pitfalls. Current Opinion in InfectiousDiseases 2003; 16:5–10.

61. Yazaki M, Okajima K, Suchi M, Morishita H & Wada Y.Increase of protein synthesis by uridine supplement in lectin-stimulated peripheral blood lymphocytes and EB virus-trans-formed B cell line of hereditary orotic aciduria type I. TohokuJournal of Experimental Medicine 1987; 153:189–195.

62. Greene S, Watanabe K, Braatz-Trulson J & Lou L.Inhibition of dihydroorotate dehydrogenase by the immuno-suppressive agent leflunomide. Biochemical Pharmacology1995; 50:861–867.

63. Silva HT, Cao W, Shorthouse R & Morris RE. Mechanismof action of leflunomide: in vivo uridine administrationreverses its inhibition of lymphocyte proliferation.Transplantation Proceedings 1996; 28:3082–3084.

64. Setzer B, Schlesier M & Walker UA. Functional impairmentof NRTI-related mitochondrial DNA-depletion in primaryhuman T-lymphocytes. Journal of Infectious Diseases 2005;191:848–855.


66. Naviaux RK, McGowan K, Barshop BA, Nyhan WL &Haas RH. Correction of renal tubular acidosis (RTA) inmitochondrial disease patients treated with triacetyluridine(PN401). Mitochondrion 2001; 1:107.

67. Gallai V, Mazzotta G, Montesi S, Sarchielli P & Del GattoF. Effects of uridine in the treatment of diabetic neuropathy:an electrophysiological study. Acta NeurologicaScandinavica 1992; 86:3–7.



Received 14 December 2004, accepted 25 April 2005

HIV-associated antiretroviral toxic neuropathy (ATN):a review of recent advances in pathophysiology andtreatmentMike Youle

Royal Free Centre for HIV Medicine, Royal Free Hospital, London



Nucleoside analogue reverse transcriptase inhibitors(NRTIs) disrupt neuronal mitochondrial DNAsynthesis, impairing energy metabolism and resultingin a distal symmetrical polyneuropathy (DSP), cate-gorised as an antiretroviral toxic neuropathy (ATN)that causes significant morbidity in HIV disease [1].

Drugs used to treat many HIV-related conditions,such as isoniazid, vincristine, lithium carbonate,dapsone, pyridoxine (vitamin B6) and thalidomide, andopportunistic illnesses, for example, cytomegalovirusinfection and syphilis, may also cause neuropathy.Other possible causes of these symptoms includealcohol and some recreational drugs such as heroin,cocaine, or amphetamines.

It seems that these different causes of neuropathycan interact. People with mild neuropathy symptomsoften find that they intensify after they start takingtreatments such as didanosine (ddI) or stavudine (d4T).Neuropathy has been associated with a deficiency ofthe B vitamins, especially vitamin B12. Factors associ-ated with the development of peripheral neuropathy ina large cohort of HIV-infected patients include olderage, diabetes and white race.

Pathophysiology

Antiretroviral toxic neuropathy (ATN) is thecommonest HIV-associated DSP [1] causing significantmorbidity in 10–35% of HIV positive patients [2–4],and occurring in 11–66% of patients [1,5] on NRTIdrug therapy. Dideoxynucleotide analogue agents suchas zalcitabine (ddC), d4T and ddI are implicated in itspathogenesis [1,4,6] and changes in the prescribingpattern of these drugs, including dose reduction, haveled to incidence reduction in antiretroviral toxicneuropathy (ATN) [4]. A feature of HIV-associatedneuropathy is development of dysaesthetic pain [4]

whose severity is associated with elevated plasma HIV-1 RNA [7] levels, and which may be unresponsive toanalgesia, even in combination with anticonvulsants[1], tricyclic antidepressants [3], mexiletine [3], orgabapentin [8]. Withdrawal of certain NRTIs oftenbecomes necessary [1,4] since there are no licensedeffective therapies, although lamotrigine [9] andrecombinant nerve growth factor (rhNGF) [10] haveshown some benefit. Ideally a pathogenesis-basedtreatment for ATN would allow patients to continueNRTI therapy, still the keystone of current highlyactive antiretroviral therapy regimes [11].

ATN is thought to result from disrupted mitochon-drial oxidative metabolism [6,12] secondary to reduc-tion in neuronal mitochondrial DNA content[6,13,14]. Consequently, neurons are unable to meetthe metabolic requirements of their long peripheralaxons which undergo die-back, resulting in the gloveand stocking distribution of ATN [1]. In keeping withthis die-back hypothesis, epidermal innervation isreduced in ATN [15,16].

Symptomatic treatment

If the neuropathy is caused by a drug, symptomsusually occur after a few weeks. Depending on severityof the neuropathy and other treatments available, thepatient may be advised to stop or to reduce the dosageof the offending drug. The main purpose of treatingneuropathy is to relieve symptoms. In mild cases,where the symptoms are not affecting daily life, stan-dard painkillers such as ibuprofen may be all that isnecessary.

If the symptoms start to be disruptive, tricyclic anti-depressants such as amitriptyline may help. Thesedrugs can take a couple of weeks to show any effects,and may cause side-effects of a dry mouth, difficulty

Introduction


urinating, high blood pressure and drowsiness. Peoplewith severe symptoms may require stronger pain killerssuch as fentanyl or other opiates. The anti-convulsants,phenytoin and carbamazepine, can be useful.

La Spina and co-workers assessed the efficacy andsafety of gabapentin as a sole analgesic in patients withHIV-related painful neuropathy [8]. Nineteen patientswith HIV-related painful neuropathy were adminis-tered gabapentin. Efficacy was evaluated with two100 mm visual analogue scales (VAS) (0: no symptom;100: worst symptom), rating pain and interference ofpain with sleep, performed at baseline and monthlyintervals. Mean pain VAS score decreased from a base-line of 55.7 ±19.1 mm to a final 14.7 ±18.6 mm(P<0.0001) and mean sleep interference VAS scoredecreased from a baseline of 60.4 ±31.9 mm to a final15.5 ±27.7 mm (P<0.0001).

Hahn [17] carried out a multicentre, prospective,randomised, double-blind placebo-controlled study ofgabapentin in 26 patients with HIV sensory neuropathy.Fifteen patients received gabapentin at 400 mg per daybefore being increased to 1200 mg per day over 2 weeks.This dose was maintained or increased to 2400 mg perday if not beneficial. There was a significant decrease inpain score in the gabapentin group (-44%) but not theplacebo group (n=11; -30%). Sleep interference scoredecreased in the gabapentin group (-49%) but not theplacebo group (-12%). Somnolence was reported in80% of the gabapentin group.

Capsaicin has been found to be effective in relievingpain associated with other neuropathic pain syndromes,and is mentioned as a possible topical adjuvant anal-gesic for the relief of DSP [18]. This multicentre,controlled, randomized, double-masked clinical trialstudied patients with HIV-associated DSP andcompared measures of pain intensity, pain relief,sensory perception, quality of life, mood and functionfor patients who received topical capsaicin to the corre-sponding measures for patients who received the vehicleonly. Twenty-six subjects were enrolled in the study. Atthe end of 1 week, subjects receiving capsaicin tended toreport higher current pain scores than did subjectsreceiving the vehicle (P=0.042). The dropout rate washigher for the capsaicin group (67%) than for thevehicle group (18%) (P=0.014). A further study showeda 40% reduction in pain in capsaicin treated individuals[19].

Pathophysiologic treatments

Vitamin B12 deficiency is a cause of neuropathy andsome individuals with HIV have such a deficiency,which may cause symptoms such as fatigue, poormemory and low levels of red blood cells. A vitamin Bcomplex supplement may be taken to relieve vitamin

B12 deficiency although overdosing of vitamin B6 mayexacerbate nerve damage. Recombinant human (rh)nerve growth factor (NGF) has been used to treat HIV-related and diabetic peripheral neuropathy.

One study in HIV-associated neuropathy found thatNGF reduced pain and improved sensitivity [20]. Atotal of 270 patients with HIV-associated sensoryneuropathy (SN) were randomized to receive placebo,0.1 µg/kg rhNGF, or 0.3 µg/kg rhNGF by double-blinded subcutaneous injection twice weekly for 18weeks. The primary outcome was a change in self-reported neuropathic pain intensity (Gracely pain scale).In a subset, epidermal nerve fibre densities were deter-mined in punch skin biopsies. Both doses of NGFproduced significant improvements in average andmaximum daily pain compared with placebo. Positivetreatment effects were also observed for global painassessments (P=0.001) and for pin sensitivity (P=0.019).No treatment differences were found with respect tomood, analgesic use or epidermal nerve fiber densities.Injection site pain was the most frequent adverse event,and resulted in un-blinding in 39% of subjects. Schifitto[21] reported that symptoms of pain improved in 200people with HIV-associated distal symmetrical polyneu-ropathy (DSP) who were treated with neurotrophin(NGF) for 48 weeks in an open-label study. However,there was no improvement as measured by neurologicexamination, quantitative sensory testing, andepidermal nerve fibre density. Following disappointingresults in treating diabetic neuropathy, Genentech haveceased development of NGF [22].

Research into diabetic neuropathy has suggestedthat supplements of γ-linolenic acid (GLA), α-lipoicacid, magnesium and chromium may help relieve paindue to neuropathy, although none of these supplementshave been tested among people with HIV-relatedneuropathy.

A proposed therapeutic agent for DSP is acetyl-L-carnitine (ALCAR), the acetyl ester of L-carnitine.ALCAR is vital for normal mitochondrial function,being a transport molecule for free fatty acids, and animportant acetyl-group donor in high energy metabo-lism and free fatty acid β-oxidation [23]. Also, ALCARpotentiates NGF actions [24], promotes peripheralnerve regeneration [25], is neuroprotective in vitro[26], in vivo [27] and in animal models of diabeticneuropathy [28]. ALCAR has analgesic properties,possibly mediated by increasing ACTH and β-endor-phin levels [29], whilst its non-acetylated form, L-carnitine, also has favourable immunological benefits[30] in HIV infection. ALCAR has shown improvementin pain scores and electrophysiologic parameters in aplacebo controlled study in diabetics with DSP [31].Short term ALCAR treatment [32] has shown sympto-matic benefits in ATN, and further studies are

M Youle


underway to define whether this effect is long-lasting,due to neuronal regeneration, or merely to a result ofanalgesia.

Hart and co-workers reported on 21 patients withNRTI-associated DSP treated with 1500 mg ALCARtwice daily for up to 18 months [33]. Median baselineCD4 cell count was 286 cells/mm3 and 40% had HIVRNA <400 copies/ml. Eight started the study withgrade 1 neuropathy, 10 with grade 2 and three withgrade 3. Skin biopsies were taken from the leg at base-line and at months 6 and 12 and stained with anti-bodies for nerve fibres. The innervation of theepidermis increased by 34% and by 101% after 6 and12 months. In the dermis, it increased by 65% andaround the sweat glands by 75% after 6 months(Figure 1). Nerve fibre density approached normallevels after 6 months. The greatest increase was insmall sensory nerve fibres, with 100% increase in theepidermis (P=0.006) and 133% in the dermis(P<0.001). Neuropathic pain improved in 76% ofpatients. No side-effects of ALCAR were experienced.

Discussion

Quantification of cutaneous innervation has previouslybeen found to correlate with clinical tests of sensoryfunction in leprosy [34] and diabetic neuropathy [32],where during disease progression, immunohistochem-ical changes precede those of sensory testing [31]. Themorphology of cutaneous innervation in DSP has previ-ously been described qualitatively, and the density ofepidermal fibres shown to be reduced along a prox-imal-distal gradient in the limb in DSP [14] and ATN[15]. Epidermal nerve fibre density has recently beendescribed as a therapeutic outcome measure in HIV[16], however fibre counts do not assess the health ofsurviving fibres, whose atrophy or regeneration can bedetermined by immunostaining area quantification, asused in this study.

In established ATN, the symptoms reflect a cuta-neous innervation reduction of the lower leg, withepidermal innervation being most affected, consistentwith the dieback hypothesis of sensory neuropathy [4].There is also marked atrophy of dermal and sweatgland plexi. This cutaneous denervation may explainwhy neuropathic symptoms frequently do not begin toresolve for some weeks after starting ALCAR treat-ment, and may then continue to improve for manymonths, since this timeframe matches the slow rate atwhich peripheral nerves regenerate.

As expected from the ATN dysaesthetic algesicsymptomatology, small sensory (C, Aδ) fibres are mostaffected, and it has been demonstrated that these fibresshow the greatest reduction in immunostaining areawhen compared to controls [33]. Furthermore, the

proportion of small sensory and structural fibres wasmarkedly reduced in neuropathic patients’ epidermis(ATN 4%; control 36%), implying loss of epidermalfibres and reduced function of the surviving sensoryfibres. Six months of oral ALCAR treatment resulted insignificant increases in the innervation in epidermis,


Pathophysiology and treatment of ATN

Figure 1. Plots of the mean of all treated individuals meanfractional immunostaining for protein gene product 9.5 ineach area of cutaneous innervation at each time point up to18 months

All observations defined as occurring at 6 months occurred in the windowfrom 3–9 months after starting ALCAR. Similar windows were created for 12(9–15) and 18 (15–24) months. All averages are non-parametric (medians andranges).

Patients on ALCARControl median valuesControl lower rangeControl upper range

PGP epidermis 0.80.70.60.50.40.30.20.1

00 3 6 9 12 15 18

PGP dermis 1.2

1

0.8

0.4

0.6

0.2

00 3 6 9 12 15 18

PGP sweat gland 876

43

5

12

00 3 6 9 12 15 18

Time since commencement of ALCAR (months)



Frac

tiona

l im

mun

osta

inin

g(x

10-2

)Fr

actio

nal i

mm

unos

tain

ing

(x10

-2)

Frac

tiona

l im

mun

osta

inin

g(x

10-2

)

dermis and sweat glands, an improvement maintainedthroughout the treatment for all patients. The resultsdemonstrate that dermal PGP-immunostaining nervefibres regenerated sufficiently to reach the range foundin normal skin. Intra-epidermal fibres also regenerated,although more gradually, suggesting a temporal rela-tionship with improvement.

ALCAR treatment may counteract dideoxyribonu-cleotide NRTI toxicity (ATN) by several mechanisms.Firstly, it may reduce mitochondrial DNA damage bydirect antioxidant effect [34,35]. Secondly, bypromoting glucose utilization and high-energysubstrate oxidative metabolism, ALCAR improvesneuronal metabolic capacity [36]. In addition ALCARmay facilitate distal neurotrophic support, particularlyof myelinated (Aδ) and unmyelinated (C) fibres.Furthermore, ALCAR promotes peripheral nerveregeneration [31,37] independently of NRTI toxicityand function [38–41]. Patients with NRTI-associatedperipheral neuropathy also have reduced serumALCAR levels, contrary to asymptomatic HIV positivecontrols [42]. Although nucleoside analogue antiretro-viral agents have been partly superceded by otheragents such as protease inhibitors, they remain funda-mental for combination therapy [4,11] and are likely toremain important components in HIV management forthe foreseeable future [4]. Peripheral neuropathy hasbeen the principal complication limiting the use ofthese agents [1,4] and pathogenesis-based therapiessuch as ALCAR may be promising effective manage-ment approaches, allowing patients to remain on NRTItherapy.

References1. Simpson DM & Tagliati M. Nucleoside analogue-associ-

ated peripheral neuropathy in human immunodeficiencyvirus infection. Journal of Acquired Immune DeficiencySyndromes & Human Retrovirology 1995; 9:153–161.

2. Hall CD, Snyder CR, Messenheimer JA, Wilkins JW,Robertson WT, Whaley RA & Robertson KR. Peripheralneuropathy in a cohort of human immunodeficiency virus-infected patients. Incidence and relationship to othernervous system dysfunction. Archives of Neurology 1991;48:1273–1274.

3. Kieburtz K, Simpson D, Yiannoutsos C, Max MB, HallCD, Ellis RJ, Marra CM, McKendall R, Singer E, Dal PanGJ, Clifford DB, Tucker T & Cohen B. A randomized trialof amitriptyline and mexiletine for painful neuropathy inHIV infection. AIDS Clinical Trial Group 242 ProtocolTeam. Neurology 1998; 51:1682–1688.

4. Moyle GJ & Sadler M. Peripheral neuropathy with nucleo-side antiretrovirals: risk factors, incidence andmanagement. Drug Safety 1998; 19:481–94.

5. Moore RD, Wong WM, Keruly JC & McArthur JC.Incidence of neuropathy in HIV-infected patients onmonotherapy versus those on combination therapy withdidanosine, stavudine and hydroxyurea. AIDS 2000;14:273–278.

6. Brinkman K, ter Hofstede HJ, Burger DM, Smeitink JA &Koopmans PP. Adverse effects of reverse transcriptase

inhibitors: mitochondrial toxicity as common pathway.AIDS 1998; 12:1735–1744.

7. Simpson DM, Haidich AB, Schifitto G, Yiannoutsos CT,Geraci AP, McArthur JC & Katzenstein DA. Severity ofHIV-associated neuropathy is associated with plasma HIV-1RNA levels. AIDS 2002; 16:407–412.

8. La Spina I, Porazzi D, Maggiolo F, Bottura P & Suter F.Gabapentin in painful HIV-related neuropathy: a report of19 patients, preliminary observations. European Journal ofNeurology 2001; 8:71–75.

9. Simpson DM, McArthur JC, Olney R, Clifford D, So Y,Baird BJ, Barrett P & Hammer AE. Lamotrigine for HIV-associated painful peripheral sensory neuropathies: aplacebo controlled trial. Neurology 2003; 60:1508–1514.

10. McArthur JC, Yiannoutsos C, Simpson DM, Adornato BT,Singer EJ, Hollander H, Marra C, Rubin M, Cohen BA,Tucker T, Navia BA, Schifitto G, Katzenstein D, Rask C,Zaborski L, Smith ME, Shriver S, Millar L, Clifford DB &Karalnik IJ. A phase II trial of nerve growth factor forsensory neuropathy associated with HIV infection. AIDSClinical Trials Group Team 291. Neurology 2000;54:1080–1088.

11. Pozniak A, Gazzard B, Anderson J, Babiker A, Churchill D,Collins S, Fisher M, Johnson M, Khoo S, Leen C, LovedayC, Moyle G, Nelson M, Peters B, Phillips A, Pillay D,Wilkins E, Williams I & Youle M. British HIV Association(BHIVA) guidelines for the treatment of HIV-infected adultswith antiretroviral therapy: BHIVA Writing Committee –on behalf of the BHIVA Executive Committee. July 2003[cited June 2005]. Available from:http://www.bhiva.org/guidelines/2003/hiv/index.html

12. Chen CH, Vazquez-Padua M & Cheng YC. Effect of anti-human immunodeficiency virus nucleoside analogs onmitochondrial DNA and its implication for delayed toxi-city. Molecular Pharmacology 1991; 39:625–628.

13. Keilbaugh SA, Prusoff WH & Simpson MV. The PC12 cellas a model for studies of the mechanism of induction ofperipheral neuropathy by anti-HIV-1 dideoxynucleosideanalogs. Biochemical Pharmacology 1991; 42:R5–R8.


15. McCarthy BG, Hsieh ST, Stocks A, Hauer P, Macko C,Cornblath DR, Griffin JW & McArthur JC. Cutaneousinnervation in sensory neuropathies: evaluation by skinbiopsy. Neurology 1995; 45:1848–1855.

16. Polydefkis M, Yiannoutsos CT, Cohen BA, Hollander H,Schifitto G, Clifford DB, Simpson DM, Katzenstein D,Shriver S, Hauer P, Brown A, Haidich AB, Moo L &McArthur JC. Reduced intraepidermal nerve fiber densityin HIV-associated sensory neuropathy. Neurology 2002;58:115–119.

17. Hahn K, Arendt G, Braun JS, von Giesen HJ, Husstedt IW,Maschke M, Straube ME & Schielke E; German Neuro-AIDS Working Group. A placebo-controlled trial ofgabapentin for painful HIV-associated sensoryneuropathies. Journal of Neurology 2004; 251:1260–1266.

18. Paice JA, Ferrans CE, Lashley FR, Shott S, Vizgirda V &Pitrak D. Topical capsaicin in the management of HIV-associated peripheral neuropathy. Journal of Pain &Symptom Management 2000; 19:45–52.

19. Simpson D, Brown S, Sampson J, Estanislao L, Vilahu C,Ramanathan S, Jermano J & von Stein T. Novel high-concentration capsaicin patch for the treatment of painfulHIV – an associated distal symmetrical polyneuropathy:results of an open label trial. 11th Conference onRetroviruses & Opportunistic Infections. 8–11 February2004, San Francisco, CA, USA. Abstract 490.

20. McArthur JC, Yiannoutsos C, Simpson DM, Adornato BT,Singer EJ, Hollander H, Marra C, Rubin M, Cohen BA,Tucker T, Navia BA, Schifitto G, Katzenstein D, Rask C,Zaborski L, Smith ME, Shriver S, Millar L, Clifford DB &Karalnik IJ. A phase II trial of nerve growth factor forsensory neuropathy associated with HIV infection. AIDSClinical Trials Group Team 291. Neurology 2000;54:1080–1088.

M Youle


21. Schifitto G, Yiannoutsos C, Simpson DM, Adornato BT,Singer EJ, Hollander H, Marra CM, Rubin M, Cohen BA,Tucker T, Koralnik IJ, Katzenstein D, Haidich B, SmithME, Shriver S, Millar L, Clifford DB & McArthur JC;AIDS Clinical Trials Group Team 291. Long-term treat-ment with recombinant nerve growth factor forHIV-associated sensory neuropathy. Neurology 2001;57:1313–1316.

22. Apfel SC. Nerve growth factor for the treatment of diabeticneuropathy: what went wrong, what went right, and whatdoes the future hold? International Review ofNeurobiology 2002; 50:393–413.

23. Bremer J. The role of carnitine in intracellular metabolism.Journal of Clinical Chemistry & Clinical Biochemistry1990; 28:297–301.

24. Manfridi A, Forloni GL, Arrigoni-Martelli E & Mancia M.Culture of dorsal root ganglion neurons from aged rats:effects of acetyl-L-carnitine and NGF. International Journalof Developmental Neuroscience 1992; 10:321–329.

25. Hart AM, Wiberg M & Terenghi G. Pharmacologicalenhancement of peripheral nerve regeneration in the rat bysystemic acetyl-L-carnitine treatment. Neuroscience Letters2002; 334:181–185.

26. Virmani MA, Biselli R, Spadoni A, Rossi S, Corsico N,Calvani M, Fattorossi A, De Simone C & Arrigoni-MartelliE. Protective actions of L-carnitine and acetyl-L-carnitineon the neurotoxicity evoked by mitochondrial uncouplingor inhibitors. Pharmacological Research 1995; 32:383–389.

27. Hart AM, Wiberg M, Youle M & Terenghi G. Systemicacetyl-L-carnitine eliminates sensory neuronal loss afterperipheral axotomy: a new clinical approach in themanagement of peripheral nerve trauma. ExperimentalBrain Research 2002; 145:182–189.

28. Sima AA, Ristic H, Merry A, Kamijo M, Lattimer SA,Stevens MJ & Greene DA. Primary preventive andsecondary interventionary effects of acetyl-L-carnitine ondiabetic neuropathy in the bio-breeding worcester rat.Journal of Clinical Investigation 1996; 97:1900–1907.

29. Onofrj M, Fulgente T, Melchionda D, Marchionni A,Tomasello F, Salpietro FM, Alafaci C, De Sanctis E, PennisiG, Bella R, Ventura F & Morganti A. L-acetylcarnitine as anew therapeutic approach for peripheral neuropathies withpain. International Journal of Clinical PharmacologyResearch 1995; 15:9–15.

30. Famularo G, De Simone C & Cifone G. Carnitine standson its own in HIV infection treatment. Archives of InternalMedicine 1999; 159:1143–1144.

31. De Grandis D & Minardi C. Acetyl-L-carnitine (levacar-nine) in the treatment of diabetic neuropathy. A long-term

randomized, double-blind, placebo controlled study. Drugsin R&D 2002; 3:223–231.

32. Scarpini E, Sacilotto G, Baron P, Cusini M & Scarlato G.Effect of acetyl-L-carnitine in the treatment of painfulperipheral neuropathies in HIV+ patients. Journal of thePeripheral Nervous System 1997; 2:250–252.

33. Hart AM, Wilson AD, Montovani C, Smith C, Johnson M,Terenghi G & Youle M. Acetyl-L-carnitine: a pathogenesisbased treatment for HIV-associated antiretroviral toxicneuropathy. AIDS 2004; 18:1549–1560.

34. Calvani M & Arrigoni-Martelli E. Attenuation by acetyl-L-carnitine of neurological damage and biochemicalderangement following brain ischemia and reperfusion.International Journal of Tissue Reactions 1999; 21:1–6.

35. Tesco G, Latorraca S, Piersanti P, Piacentini S, Amaducci L& Sorbi S. Protection from oxygen radical damage inhuman diploid fibroblasts by acetyl-L-carnitine. Dementia1992; 3:58–60.

36. Peluso G, Benatti P, Nicolai R, Reda E & Calvani M(1998) Carnitine system and insulin resistance. In InsulinResistance, Metabolic Disease & Diabetic Complications;pp. 259–274. Edited by Crepaldi G, Tiengo A & Del PratoS. Elsevier.

37. Fernandez E, Pallini R, Gangitano C, Del Fa A,Sangiacomo CO, Sbriccoli A, Ricoy JR & Rossi GF. Effectsof L-carnitine, L-acetylcarnitine and gangliosides on theregeneration of the transected sciatic nerve in rats.Neurological Research 1989; 11:57–62.

38. Kano M, Kawakami T, Hori H, Hashimoto Y, Tao Y,Ishikawa Y & Takenaka T. Effects of ALCAR on the fastaxoplasmic transport in cultured sensory neurons of strep-tozotocin-induced diabetic rats. Neuroscience Research1999; 33:207–213.

39. Stevens MJ, Lattimer SA, Feldman EL, Helton ED,Millington DS, Sima AA & Greene DA. Acetyl-L-carnitinedeficiency as a cause of altered nerve myo-inositol content,Na,K-ATPase activity and motor conduction velocity in thestreptozotocin-diabetic rat. Metabolism 1996; 45:865–872.

40. De Grandis D, Santoro L & Di Benedetto P. L-acetylcarnitinein the treatment of patients with peripheral neuropathies.Clinical Drug Investigation 1995; 10:317–322.

41. Giammusso B, Morgia G, Spampinto A & Motta M.Improved pallesthetic sensitivity of pudendal nerve in impo-tent diabetic patients treated with acetyl-L-carnitine.Archivio Italiano di Urologia 1996; 10:185–187.

42. Famularo G, Moretti S, Marcellini S, Trinchieri V,Tzantzoglou S, Santini G, Longo A & De Simone C.Acetyl-carnitine deficiency in AIDS patients with neurotoxi-city on treatment with antiretroviral nucleoside analogues.AIDS 1997; 11:185–190.


Pathophysiology and treatment of ATN

Received 29 March 2005, accepted 14 June 2005

M1311st Meeting on Mitochondrial Toxicity & HIV Infection: Understanding the Pathogenesis for a Therapeutic Approach

SPEAKER ORGANISATIONAiuti, Fernando Division of Allergy and Clinical Immunology, University of

Rome "La Sapienza", Rome, Italy

Blanche, Stephane Unite d'Immunologie-Hematologie Pediatrique, Hopital Necker Enfants Malades, Paris, France

Brinkman, Kees Department of Internal Medicine, Onze Lieve Vrouwe Gasthuis, Amsterdam, The Netherlands

Casademont, Jordi Hospital Clínic, Department of Internal Medicine, University of Barcelona Medical School, Barcelona, Spain

Cauda, Roberto Infectious Diseases Clinics, Catholic University, Rome, Italy

Cossarizza, Andrea Department of Biomedical Sciences, Section of General Pathology, University of Modena and Reggio Emilia,Modena, Italy

Côté, Hélène Department of Pathology & Laboratory Medicine, University of British Columbia, Vancouver, B.C., Canada

Esposito, Roberto Infectious Diseases Clinics, University of Modena and Reggio Emilia, Modena, Italy

Galli, Massimo Infectious Diseases Clinics, L. Sacco HospitalUniversity of Milan, Milan, Italy

Gerschenson, Mariana Director of Molecular Medicine and Infectious Diseases, Hawaii AIDS Clinical Research Program, John A. Burns School of Medicine, University of Hawaii at Manoa, Honolulu, Hawaii

Guaraldi, Giovanni Infectious Diseases Clinics, University of Modena and Reggio Emilia, Modena, Italy

Lazzarin, Adriano Vita Salute San Raffaele University, Clinic of Infectious Diseases, Milano, Italy

Lewis, William Director of Cardiovascular Pathology, Emory University School of Medicine, Robert W. Woodruff Health Sci. Ctr., Atlanta, Georgia

Mallal, Simon Center for Clinical Immunology and Biomedical Statistics, Royal Perth Hospital, Wellington St, Perth, Western Australia

Mallon, Patrick W. National Centre in HIV Epidemiology and Clinical Research, University of New South Wales, Sydney, Australia

Malorni, Walter Dipartimento del Farmaco, Istituto Superiore di Sanitàviale Regina Elena, Roma, Italy

Milinkovic, Ana Clinical Institute of Infections and Immunology, Institu d'Investigacions Biomediques August Pi i Sunyer, Hospital Clinic, Barcelona, Spain

Mirò, Oscar Mitochondrial Research Laboratory, Department of Internal Medicine, Hospital Clinic, Barcelona, Spain

Moroni, Mauro Infectious Diseases Clinics, L. Sacco Hospital, University of Milan, Milan, Italy

Mussini, Cristina Infectious Diseases Clinics, University of Modena and Reggio Emilia, Modena, Italy

Di Perri, Gianni Department of Clinical Infectious Diseases, University of Torino, Torino, Italy

Reiss, Peter Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Skulachev, Vladimir Belozersky Institute of Physico-Chemical Biology,Moscow State University, Moscow, Russia

Soriano, Vincent Department of Infectious Diseases, Hospital Carlos III, Madrid, Spain


SPEAKER (continued) ORGANISATIONViganò, Alessandra Pediatrics Clinics, L. Sacco Hospital, Milan, Italy

Walker, Ulrich A. Medizinische Universitätsklinik, Department of Rheumatology and Clinical Immunology, Freiburg, Germany

Youle, Mike Director HIV Clinical Research, Royal Free Hospital, London, UK

toxicidad mitocondrial

Documents

Transcript of toxicidad mitocondrial