Copyright 0 1989 by the Genetics Society of America

The Maltose Permease Encoded by the MAL61 Gene of Saccharomyces cerevisiae Exhibits Both Sequence and Structural Homology to Other Sugar Transporters

Qi Cheng and Corinne A. Michels

Department of Biology, Queens College and the Graduate School of the City Uniwersity of New York, Flushing, New York 11367 Manuscript received November 2 1, 1988 Accepted for publication August 10, 1989

ABSTRACT The MAL61 gene of Saccharomyces cerewisiae encodes maltose permease, a protein required for the

transport of maltose across the plasma membrane. Here we report the nucleotide sequence of the cloned MAL61 gene. A single 1842 bp open reading frame is present within this region encoding the 6 14 residue putative MAL61 protein. Hydropathy analysis suggests that the secondary structure consists of two blocks of six transmembrane domains separated by an approximately 71 residue intracellular region. The N-terminal and C-terminal domains of 100 and 67 residues in length, respectively, also appear to be intracellular. Significant sequence and structural homology is seen between the MAL61 protein and the Saccharomyces high-affinity glucose transporter encoded by the SNF3 gene, the Kluyueromyces lactis lactose permease encoded by the LAC12 gene, the human HepG2 glucose transporter and the Escherichia coli xylose and arabinose transporters encoded by the xylE and araE genes, indicating that all are members of a family of sugar transporters and are related either functionally or evolutionarily. A mechanism for glucose-induced inactivation of maltose transport activity is discussed.

M ALTOSE fermentation in the Saccharomyces yeasts is initiated by the transport of the disac-

charide across the plasma membrane. This transport is carried out by maltose permease and the process is the rate limiting step in fermentation. An understand- ing of the mechanisms controlling maltose transport is therefore fundamental to an understanding of the factors regulating maltose fermentation.

The Saccharomyces maltose uptake system is an inducible active transport system (HARRIS and THOMPSON 196 1 ; OKADA and HALVORSON 1964; DE KROON and KONINGSBERGER 1970; SERRANO 1977). SERRANO (1977) reports that this transport is inde- pendent of intracellular ATP levels but is coupled to the electrochemical gradient of protons. That is, malt- ose transport occurs via a proton symport system. As has been seen in the glucose and galactose transport systems of Saccharomyces, the maltose transport sys- tem exists in both a high and a low affinity form (BISSON and FRAENKEL 1983a,b, 1984; RAMOS, SZKUTNICKA and CIRILLO 1989; BUSTURIA and LA- GUNAS 1985). The basis of the difference between the two forms of these sugar transporters is not under- stood.

Saccharomyces strains able to ferment maltose carry any one of five MAL loci: MALI, MAL2, MAL3, MAL4, and MAL6 (reviewed by BARNETT 1976). The first

of page charges. This article must therefore be hereby marked “advertisement” The publication costs of this article were partly defrayed by the payment

in accordance with 18 U.S.C. $1734 solely to indicate this fact.

Genetics 123: 477-484 (November, 1989)

indication that the gene encoding maltose permease mapped to any of the MAL loci came from the iden- tification of a MALI-linked temperature-sensitive maltose transport mutation (GOLDENTHAL, COHEN and MARMUR 1983). All of the MAL loci have been cloned and structurally and functionally compared (FEDEROFF et al. 1982; NEEDLEMAN and MICHELS 1983; CHARRON, DUBIN and MICHELS 1986; CHAR- RON and MICHELS 1987; CHARRON et al. 1989). The MAL loci are all highly sequence-homologous, exhib- iting only a few restriction site polymorphisms. Each locus is a complex locus containing three genes re- quired for maltose fermentation: GENEs 1, 2, and 3 (NEEDLEMAN et al. 1984). We have established a two digit numbering system in order to distinguish the GENE 1, 2 or 3 functions mapping to the different MAL loci. The first digit indicates the locus position and the second the GENE function (NEEDLEMAN et al. 1984; CHARRON and MICHELS 1987, 1988). Thus, the MAL61 gene is the GENE 1 function mapping to the MAL6 locus.

Transcription of GENEs 1 and 2 is induced by maltose and repressed by glucose (NEEDLEMAN et al. 1984). That GENE 2 encodes maltase is inferred from the identification of an allele of the MAL12 gene (that is, GENE 2 of the MALI locus) that encodes a tem- perature-sensitive maltase (DUBIN et al. 1985). GENE 1 encodes maltose permease. This conclusion is based on several lines of evidence reported by Y. S. CHANG,

478 Q. Cheng and C. A. Michels

R. A. DUBIN, E. PERKINS, C. A. MICHELS and R. B. NEEDLEMAN (unpublished results). Point mutations in the MAL61 gene as well as a deletion/disruption of the MAL61 gene completely abolish maltose transport activity. Transformation of these mutant strains with high copy plasmids carrying the MAL61 gene leads to up to a tenfold increase in maltose permease activity as compared to the single-copy parental strain. Most significantly, the integration of a fragment carrying the yeast URA3 gene into the coding region of MAL61 near the N-terminal end results in a low level consti- tutive transcription of MAL61 and in a low level constitutive synthesis of maltose permease. GENE 3 encodes the MAL activator and the product of this gene is a cysteine-zinc finger protein (CHANG et al. 1988; KIM and MICHELS 1988; SOLLITI and MARMUR 1988).

This report presents the sequence of the MAL61 gene. Analysis of the deduced amino acid sequence of the proposed MAL61 protein indicates that it is an integral membrane protein. Additionally, MAL61 protein shows significant homology to several other sugar transport proteins from yeast and other species. This homology is seen both on the level of the primary sequence and on the level of secondary structure.

MATERIALS AND METHODS

Sequencing: Figure 1 shows a restriction endonuclease map of the MAL61 gene. Sequencing was done according to the method of SANGER, NICKLEN and COULSON (1977). The region was divided into three fragments: the PstI-EcoRI fragment containing the MAL61 upstream sequences and the 5’-end of the gene; the 1.7-kb EcoRI-Sal1 fragment containing sequences internal to the MAL61 gene; and the SalI-Hind111 fragment containing the 3’-end of the gene. Each of these was then sequenced by a combination of methods. Nested deletions within the MAL61-insert frag- ments were constructed with the fragment cloned into the M 13 sequencing vector mpl8 using exonuclease 111 and these were sequenced using the universal primer (MESSING 1983; HENIKOFF 1984). Gaps were filled by using oligonu- cleotide primers identical to known sequences. Nested dele- tions were also constructed using Ba131 to degrade the MAL61-insert fragment cloned in the plasmid vector pBR325. For sequencing, these deletions were subcloned into the M 13 sequencing vectors. Sequencing of the second strand was carried out using the 3.6-kb BglII-Hind111 frag- ment containing the entire MAL61 gene cloned into the M13 vector mp19. This was sequenced with a series of oligonucleotide primers complementary to known MAL61 sequence.

Computer analysis: Sequence data were analyzed using the programs of IntelliGenetics, Inc. of Palo Alto, Califor- nia. Alignment of the MAL61 protein sequence with several other transport protein sequences was carried out using the GENALIGN program. GENALIGN is a copyrighted soft- ware product of IntelliGenetics, Inc.; the program was de- veloped by HUGO MARTINEZ of the University of California at San Francisco. The hydropathy plots shown in Figure 4 comparing MAL61 and SNF3 proteins are the gift ofJOHN CELENZA, LINDA MARSHALL-CARLSON and MARIAN CARL- SON of the Department of Genetics and Development, Co-

lumbia University College of Physicians and Surgeons, New York; the profiles were made using the algorithm developed by KYTE and DOOLITTLE (1 982) and utilized the values of EISENBERG (1 984) with a 2 1 -residue window.

RESULTS

Sequence of the MAL61 gene and the proposed secondary structure of the deduced protein: Figure 2 presents the sequence of the DNA fragment con- taining the MAL61 gene starting at the ScaI site shown in Figure 1 and extending to the right for 2000 basepairs. A single large open reading frame is ob- served with the AUG codon of the N-terminal methi- onine located 105 base pairs from the ScaI site. No other large open reading frames are observed in any of the five other reading frames. The orientation of this single 1842 basepair open reading frame is con- sistent with the size of the maltose inducible transcript of the MAL61 gene (2.0 kbp) and with the direction of transcription of the MAL61 gene as reported in NEEDLEMAN et al. (1984). Construction of a MAL61- lacz fusion at the EcoRI site near the N-terminal end of the coding region supports the conclusion that the AUG codon indicated as the translation initiation can function as such in Saccharomyces (J. LEVINE, L. TANOUYE and C. A. MICHELS, unpublished results). A consensus “TATA” sequence is located at position -89 to -94. The sequence of the open reading frame predicts a 67,174 dalton protein of 614 amino acid residues.

Figure 2 also depicts the positions of twelve postu- lated hydrophobic transmembrane domains. Each of the twelve postulated 2 1-residue transmembrane do- mains has an average hydrophobicity value of greater than 0.42. As in the SNF3 protein, no signal sequence is seen at the N-terminal end of the MAL61 protein and the first predicted transmembrane domain begins at residue 100, suggesting that the N-terminal 100 amino acid residues lie on the cytoplasmic face of the plasma membrane. The overall secondary structure of the MAL61 protein thus appears to consist of two blocks of six transmembrane domains separated by an approximately 7 1 residue intracellular region. Both the 100 N-terminal residues and the 67 C-terminal residues are predicted to lie on the cytoplasmic face of the plasma membrane. Although two potential N- linked glycosylation sites are found at Asn-15 and Asn-27, these may not be modified since they lie within the proposed cytoplasmic N-terminal region. This remains to be determined since it has been shown that tunicamycin inhibits the synthesis of the maltose transport system in Saccharomyces (LAGUNAS, DEJUAN and BENITO 1986). Work is now in progress in our laboratory to test the predicted membrane topology of the maltose permease.

Homology of MAL61 protein to other sugar trans- porters: Comparison of the deduced sequence of the

Sequence of Maltose Permease

I M U 61 I 479

Sc R N H 2 N A

Pv H 2 Ps S Pv R H 3

I 1 kb

i FIGURE I.-Restriction endonuclease map of the MAL61 gene of S. cereuiriae. The restriction endonuclease map of the 3.6-kb DNA

fragment containing the MAL61 gene and its flanking sequence is showvn. The abbreviations used are: A. Aval; Rg, Bglll; H2, Hindll; H3. Hindlll; N, Ncol; Ps. PslI; Pv, Pvull; R, EcoRI; Sc, Scal.

-105 AGTACTCAGCATATAAAGAGACACAATATACTCCATACTTGTTGTGAGTGGTTTTAGCGTATTCAGTATAACAATAAGAATTACATCCAAGACTATTAATTAACT

Met L y s G l y L e u S e r S e r L e u I l e Asn Arq Lys Lys Asp Arq Asn Asp ser His Leu ASP Glu I le Glu Asn Gly Val ASn Ala T h r G l u 3 0 1 ATG AAG GGA TTA TCC TCA TTA ATA AAC AGA AAA AAA GAC AGG AAC GAC TCA CAC TTA GAT GAG ATC GAG AAT GGC GTG AAC GCT ACC GAA

9 1 TTC AAC TCG ATA GAG ATG GAG GAG CAA GGT AAG AAA AGT GAT TTT GAT CTT TCC CAT CTT GAG TAC GGT CCA GGT TCA CTA ATA CCA AAC Phe Asn Se r Ile G l u Met Glu Glu G l n G l y L y s L y s S e r A s p P h e Asp l e u S e r His L e u G l u T y r G l y P r o G l y S e r L e u I l e P I 0 Asn 60

1 8 1 GAT AAT AAT GAA GAA GTC CCC GAC CTT CTC GAT GAA GCT ATG CAG GAC GCC AAA GAG GCA GAT GAA AGT GAG AGG GGA ATG CCA CTC ATG Asp Asn Asn Glu Glu Val P ro Asp Leu Leu Asp G l u Ala Met Gln Asp A la LYS G l u A l a ASP Glu S e r G l u A r q G l y Met P r o L e u Met 90

271 ACA GCT TTG AAG ACA TAT CCA AAA GCT GCT GCT TGG TCA CTA TTA GTT TCC ACA ACA TTG ATT CAA GAG GGT TAT GAC ACA GCC ATT CTA T h r Ala L e u L y s T h r T y r P r o L y s A l a 120 A l a A l a T r p S e r L e u L e u V a l S e r T h r T h r L e u I le G l n Glu G l y T y r A s p T h r A l a Ile Leu

361 GGA GCT TTC TAT GCC CTG CCT GTT TTT CAA AAA AAA TAT GGT TCT TTG AAT AGC AAT ACA GGA GAT TAT GAA ATT TCA GTT TCC TGG CAA Gly A l a P h e T y r Ala L e u P r o Val Phe G ln Lys Lys Tyr G ly Se r Leu Asn S e r Asn T h r G l y Asp T y r Glu Ile S e r Val S e r T r p G l n 1 5 0

541 CTG ATC ATG GCG TTG TTC TTT TTA GCG GCT TTC ATT TTC ATT CTG TAT TTT TGC AAG AGT TTG GGT ATG ATT GCC GTG GGA CAG GCA Tl'G Leu I l e Met A l a Leu Phe Phe Leu A la Ala Phe Ile Phe Ile L e u T y r P h e C y s L y s S e r L e u G l y Met Ile A l a V a l G l y G l n A l a Leu 210

631 TGT GGT ATG CCA TGG GGT TGT TTC CAA TGT TTG ACC GTT TCT TAT GCT TCT GAA ATT TGT CCT TTG GCC CTA AGA TAC TAT TTG ACG ACT C y s G l y Met P r o T r p G l y C y s P h e G l n C y s L e u T h r V a l S e r T y r A l a S e r G l u I le Cys P ro Leu Ala Leu Arq Tyr Tyr Leu Thr Thr 240

7 2 1 TAT TCT AAT TTA TGT TGG ACG TTC GGT CAA CTT TTC GCT GCT GGT ATT ATG AAA AAT TCC CAG AAC AAA TAT GCC AAC TCA GAA CTA GGA T y r S e r A s n L e u C y s T r p T h r P h e G l y G l n L e u P h e A l a Ala G l y Ile Met Lys Asn Se r G ln Asn Lys Tyr A la Asn Se r G lu Leu G ly 270

8 1 1 TAT AAG GAG TCT CCA TGG TGG CTG GTT CTA CCT TTT GCT TTG CAG TGG ATC TGG CCC CTT CCT TTG GCG GTA GGT ATT TTT TTG GCA CCA T y r L y s G l u S e r P r o T r p T r p L e u V a l 300 L e u P r o P h e A l a L e u G l n T r p I l e T r p P r o L e u P r o Leu A l a V a l G l y Ile Phe Leu A l a P r o

9 0 1 AAA AAA GGA AGG ATT GAT CAG GCG AGG AGA TCA CTT GAA AGA ATA TTA AGT GGT AAA GGA CCC GAG AAA GAA TTA CTA GTG AGT ATG GAA Lys Lys G ly Arq I l e A s p G l n A l a A r q A r q S e r L e u G l u A r q I l e L e u S e r G l y L y s Gly P r o Glu Lys Glu Leu Leu Val S e r Met Glu 330

9 9 1 CTC GAT AAA ATC AAA ACT ACT ATA GAA AAG GAG CAG AAA ATG TCT GAT GAA GGA ACT TAC TGG GAT TGT GTG AAA GAT GGT ATT AAC AGG Leu Asp Lys Ile L y s T h r T h r Ile Glu Lys G lu G ln Lys Met S e r A s p G l u G l y T h r T y r T r p A s p C y s V a l L y s A s p G l y I le Asn Arq 360

1 0 8 1 AGA AGA ACG AGA TAC TTT TAT GAA AAA ATA GCT TGT TTA TGT TGG ATC GGT CAA TGC TCC TGT GGT GCA TCA TTA ATT GGT TAT TCA ACT A r q A r q T h r A r q Tyr Phe Tyr G lu Lys 390 Ile A l a C y s L e u C y s T r p Ile G l y G l n C y s S e r Cys G l y A l a S e r L e u Ile G l y T y r S e r T h r

1 1 7 1 GCT GGT GTT AGC ACT GAT ACG GCT TTT ACT TTC AGT ATT ATC CAA TAT TGT CTT GGT ATT GCT GCA ACG TTT GTA TCC TGG TGG GCT TCA Ala G l y V a l S e r T h r A s p T h r Ala P h e T h r P h e S e r I l e Ile Gln T y r C y s Leu Gly Ile A l a A l a T h r P h e V a l S e r T r p T r p A l a S e r 4 2 0

1 2 6 1 AAA TAT TGT GGC AGA TTT GAC CTT TAT GCT TTT GGG CTG GCT TTT CAG GCT ATT ATG TTC TTC ATT ATC GGT GGT TTA GGA TGT TCA GAC L y s T y r C y s G l y A r q P h e A s p L e u Tyr A l a P h e G l y L e u A l a P h e G l n Ala Ile Met Phe Phe Ile Ile G l y G l y L e u G l y C y s S e r A s p 4 5 0

1 3 5 1 ACT CAT GGC GCT AAA ATG GGT AGT GGT GCT CTT CTA ATG GTT GTC GCG TTC TTT TAC AAC CTC GGT ATT GCA CCT GTT GTT TTT TGC TTA T h r His Gly Ala L y s Met G l y S e r G l y 480 Ala Leu Leu Met V a l V a l A l a P h e P h e Tyr Asn Leu Gly I le A l a P r o V a l V a l P h e C y s L e u

1 4 4 1 GTG TCT GAA ATG CCG TCT TCA AGG CTA AGA ACC AAA ACA

1531 -1CAA TTG AAC TCA GAG AAA TGG AAT TGG GGT GCT AAA[TCA GGC TTT TTC TGG GGA GGA TTT TGT CTG GCC ACT TTA GCT

ATT ATT TTG GCT CGT AAT GCT TAC AAT GTG ATC CAA GTT GTA GTT ACA GTT V a l S e r Glu Met P r o S e r Ser Arq Leu Arq Thr Lys Thr I l e Ile L e u A l a A r g A m A l a T y r A s n Val Ile G l n V a l Val Val T h r V a l 5 1 0

Leu Ile Met Tyr G l n L e u A s n S e r Glu L y s T r p A s n T r p G l y Ala L y s S e r G l y P h e P h e T r p G l y G l y P h e c y s L e u A l a T h r L e u A l a 5 4 0

1 6 2 1 TGG GCT GTI' GTC GAT TTA CCA GAA ACC GCT GGC AGG ACT TTT ATT GAG ATA AAT GAA TTG TTT AGA CTT GGT GTT CCA GCA AGA AAG TTC T r p A l a V a l V a l A s p L e u P r o G l u T h r Ala G l y A r q T h r P h e I l e G l u I l e Asn Glu Leu Phe Arq Leu Gly Val Pro Ala Arq Lys Phe 570

1 7 1 1 AAG TCG ACT AAA GTC GAC CCT TTT GCA GCT GCC AAA GCA GCA GCT GCA GAA ATT AAT GTT AAA GAT CCG AAG GAA GAT TTG GAA ACT TCT L y s Ser T h r L y s Val A s p P r o P h e A l a Ala Ala L y s Ala Ala A l a A l a G l u Ile Asn V a l L y s Asp P r o L y s G l u Asp L e u G l u T h r S e r 6 0 0

1801 GTG GTA GAT GAA GGG CGA AGC ACC CCA TCT GTT GTG AAC AAA TGATTTTTTTAGCCAGTAGGTAGATCGGCGTTATTTAATTTTATTTTATATAA V a l Val Asp G l u S l y A r q S e r T h r P r o S e r V a l Val Asn Lys *** *tt 614

FIGURE 2.-Nucleotide sequence of the MAL61 gene and predicted amino acid sequence of the gene product. The nucleotide sequence of the MAL61 gene is given starting at the upstream Scal site. Nucleotide numbers are on the left with the first base of the initiation codon a s nucleotide + I . The amino acid residue numbers are shown to the right. Asterisks indicate the termination codons. Putative 21 residue nlembl.alle-spanning regions are boxed and shaded. The location of these is based on the algorithm of KYTE and DOOLIITLE (1982) using the hydropathy parameters of EISENRERG (1 984).

MAL61 protein to that of the SNF3 protein reveals transporter of Saccharomyces or a component of this an approximate 24% sequence homology (Figure 3). transport system (CELENZA, MARSHALL-CARLSON and The SNF3 gene encodes the high affinity glucose CARLSON 1988). More impressive than the sequence

480 Q. Cheng and C. A. Michels

UAL6I HGT SNP3 :: I- s E - - - - P - P q u q s n u n s I c v c - v ~ - v ~ v c c ~ L - ~ c ~ D ~ c L - ~ n - - - s - t - ~ s n N y v ~ s n - - - - - - q D E S E R - C ~ P L ~ ~ A ~ - ~ T ~ P ~ - A A ~ U ~ L L ~ S I I L I ~ E G I D I A - - I - L ~ - A F ~ A L P V F ~ K K Y G S ~ N S N T G

LAC12 5: I a D A R E E v L L p c u O s i q y Y B L y c 1. c F I T y L c A T n a - 6 y 11 G ,\ L - - - u g s s -m- T E D A y L m y H a - - - - - n E - - - P - S S K - - K L T C R L ~ L ~ V - G C A ~ L G ~ L ~ ~ G ~ N T G - ~ I ~ A P ~ K ~ I E E F Y ~ - ~ T ~ ~ ~ - - - - - R

XYLE ARAE

I ””” n - - N O q u N s s O I F s I T L v - - - A T L c c L t . F G y n T - A v t s G T v - - E s I N - - T - v - - - - - F v I t - - - - - - I ~ T P R ~ L R D T R R ~ ~ ~ ~ ~ ~ ~ - - * I A I A G L L ? ~ L D - I ~ ~ ~ ~ ~ A G - - A L ~ F ~ - - - - - - - - En T D H F V

UAL6I 142 ~ Y ~ l ~ V S u ~ ~ c ~ c ~ c r ~ ~ c a ~ v c ~ q v ~ ~ ~ D Y ~ G N R Y T L I ~ A - L F - F L - - - - - - ~ - - - ~ SNF3 HCT 1 3 1 V A P N H D ~ ~ ~ ~ ~ ~ ~ ~ S I ~ V S F L S L G I F F G - A L ~ ~ I S D S Y G R K P T I l F S T l P l P - - - - - S - - l G - N S L

L A C I ~ 109 ~ - I N ~ S ~ G T - G L V F S I - - - F - S V C ~ I C G A P F Y P - L ~ ~ Y K C - R K P A I - - - - - - - I . I G C L G V ~ ~ C - ~ I ~ 52 Y C ~ ~ I L P T T L T T L ~ S L S ~ A I F ~ ~ G G ~ I G - ~ ~ ~ ~ G L F ~ ~ R F ~ R R ~ ~ ~ L ~ ~ ~ L L A F - - - ~ - ~ - ~ - ~ L ~ G F

XYLE ARAE 44 56 A P ~ N L S E S A A N S L L G F C V A S A L I G C ~ I G ~ G A L ~ Y C S S R F C R R D S I . ~ I ~ A V L F F I S G ~ ‘ G S - ~ \ U P E I . G F “” L - T s - - - R L ~ E u v v s s n ~ L G I I I G - * L I H G Y L S F R L c ~ ~ y s L n ~ c ~ ~ L F v L c s x c s - ~ - - - - ~ ~ o o w v - g HAL61 1 9 3 F IO? P C a L G W I - A V G - - - - - - - - SNF3 1 8 9 ~ V G A G - C I T L L I - - V C - - - R - - - - V I - S G l G l G A I S A V V P L I ~ ~ E A T l l K S L R G A I l S I ? ~ U A I T U G - L

LAC12 160 S S ~ T T T ~ - A L I ~ - G C ~ ~ - R - - - - - U F V A F F A ~ l A N A A A P T Y ~ A E V A P A l l l . R G K ~ ’ A ~ ~ L Y ~ L Y S \ ’ G - S XYLE l10 T S - I N P I ~ S T Y P V Y L A C Y V P E F V I Y R I I C I G V C L A S U ~ S P U Y I A E L A P A l l l R G K ~ V S F N ~ F A l l F G z oyl HGT q ~ ~ c ~ n ~ u ~ c ~ q c ~ ~ ~ ~ ~ ~ ~ ~ c ~ ~ ~ ~ ~ ~ ~ ~ ~ s ~ c u ~ ~ c

1 1 3 ~ S K L G K S F E ~ L I - L - C ~ - - ~ I ” - - T I - G I T C G L I T G Y Y P ~ Y ~ G E ~ ~ P T A F R G A ~ G ~ L H L G I V V C I L

ARAE t l o r s - - - - - v e u L ~ - ~ - A R v - - - v - - - - - ~ ~ ~ ~ v ~ ~ ~ s y ~ ~ p L ~ L s E u A s E N v n c u u x s n ~ q ~ u v ~ L G - -

UAL61 252 - F O G I n K N W - - m A - N S E L G Y K L P F SNF3 245 L V S S A V - - - S C T H A R N D a S - - Y R I P I HCT LAC12 ;iz - -a I A ~ ~ - - F - - - G L D S I ~ C R K D L ~ P L L L $ I ~ ~ I P A L L ~ ~ I ~ L P F ~ P ~ ~ P R F L L I ~ R ~ E E ~ R A K ~ ~ L - ~ ? v u s s F L * 1 c n F s L P r s p R y Y v L ~ L ~ u O - O - s m % QEXD o n

U ~ P ~ ~ I ~ A P E S P U W L V K K G R I D A R R S - L E m

I V A A F S T Y C - T ~ - - ~ N F P ~ ~ K A F K I ~ L Y L ~ X ~ P C L Y C I F G V ~ I P E ~ P R V L V G V G R E E E A R E ~ I I K Y

ARAE 161 - I ~ L A F L S D T A F S - - ~ S - C N - - - ~ R A ~ L ~ ~ L A L P A ~ L L I I L ~ ~ F L P ~ ~ P R ~ L A ~ K G R ~ I ~ A E E ~ - L - R XYLE 1 7 7 L - ~ ~ Y C V N Y F I A R S G ~ A S ~ L ~ T D ~ ~ R Y ~ F A ~ ~ ~ ~ P ~ ~ I . L F L ~ L L Y T ~ P E ~ P R ~ L ~ ~ R G K ~ E A E G I - L - R

UAL61 3 1 5 I L S G K C P E K ~ L ~ S U E L D K I K - T T I E K E Q O M S D E O T Y W D C V K S N F 3 306 F L R G - V ~ V H D S G L L E E L V E I K A T Y D Y E A S F C S S N F I N C F I S S K S R P K q - T L - R ~ F T G I A

o - - - - - ” G ~ N ~ R R ~ R ~ ~ ~ ~ ~ ~ q ~ ~ ;

HGT LACIZ 2 8 1 H L N C - D R T H - P L L D ~ E ~ A E I I E ~ F ~ G T D L ~ ~ P L E ~ L ~ - ~ R ~ - L F R T R ~ ~ R Y - ~ A ~ L ~ ~ L ~ A ~ - F ~ ~ F ~

230 K L R G - - - T A D - - ~ T H D L ~ E ~ K E E ~ R ~ ~ ~ R E ~ K ~ T I L E L F R ~ P A Y R - - ~ - P ~ - L - - - I A ~ ~ L ~ L ~ q ~ s

XYLE 242 K I ~ C - - - - - N T L A T ~ A V ~ E I K - H S L D H G R - ~ T G ~ R L - - - - - - - L ~ F G V C V I \ ~ - - I ~ \ ~ ~ I S I F ~ ~ ~ F \ ’ ARAE 220 n O - - - R D T s O u A R E E L N E - I - n E s L - - - - - O I I - - L K q c c u A L F K x N R N v - n ~ A v F L c n L ~ q A n q q!! XYLE 292 G I N V V L Y Y A P E V F K T L C ~ - - S T D I ~ L L ~ T ~ V G V I S L T F V L A I ~ T ~ D K F C R K P ~ ~ I I G A ~ - G ~ A - - - *RAE 273 c n m I ~ n ~ Y A P R I F K n A C - F T ~ ~ ~ q q n ~ ~ ~ L v v c L ~ p n ~ ~ x ~ v ~ ~ v D u ~ c n u p A L K ~ c p s v - n ~ - - - n O F MAL61 4 4 1 F l l G G ~ C s D ~ - 8 G A ~ - U G S G A L L H V V A P P Y N L ~ P ~ V ~ C L V S E ~ P S S R L R ~ - ~ - - I I L A - - - R N HGT s w 3 429 I ~ ~ n F x v ~ x - - v C c s L - u T ~ ~ u v n ~ ~ F x ~ ~ F s ~ I u c c v v u v ~ s A E L ~ p L c \ ~ n s K c ~ A ~ c ~ ~ ~

346 - G C A I ~ U T I A L A - - L L E Q L P U Y S Y L S I V I P G P V A F F E ~ G P G P I P U ? I V A E L F S q G P R P A A l A V A G F S LAC12 4 0 8 L T C L S l - - - C O A R Y E O T K K K S A S N G A L \ , ~ l Y L F G G l F S F A ~ T P S q S ~ Y S T E V S ~ N L ~ R S K - - A - - q L L A F - - Y T Q A P C I V A L L S U ~ - V A ~ ~ S U ~ P V C U V L L S E I F P S A I R G K A L A I A V ~ A ~ I] XYLE 3 5 4 I C U F S U T - - - A R A E 336 L ~ T L ~ L G ~ ~ L ~ ~ F D N ~ T A ~ ~ G L ~ ~ L ~ ~ G ~ T ~ ~ ~ I A G Y A ~ ~ A A P ~ ~ ~ I L ~ ~ E I ~ P L ~ ~ R D F G I T ~ ~ T I T

MAL61 500 A Y ~ V I ~ ~ - V ~ , V L I ~ I ~ L N S E K U ~ W G A K S G P F U G G ~ C L ~ I L A U A V V D L P E T A G R T F I E I N E L F R L G V P

HGT SNF3 494 4 1 1 R Y L ~ N F I C A L I T P I I V D T G ~ H T S S L C A K l P P l U G S L ~ A ~ C V l V V ? L I V Y E T K G ~ T L E E l D ~ - - Y t K S N ~ T S W F I V G ~ C P ~ Y - ~ - - - - - ~ ~ L C C P I I P I I P T V L L I L P ~ I F T ~ ~ K ~ ~ E T K G R T F D E I - - - A ~ G F R ~ LAC12 469 N - F ~ V S G V A - ~ F V N ~ F A T P K A U K ~ I K Y U F Y \ ~ ~ Y V F ~ D I F E F I \ ~ I Y F F F \ ’ E T K G R S L E E L - E V V F E A P S

A R A E 404 ~ U V S N ~ l I C A ~ P - - - - L T L L D S l G A A G I F - U L Y T A L ~ I ~ F V G l I F U L I ~ E T K S V T L E l l t - E - - - - - - - b m

og $3 gn- [I 0

F!% MAL61 SNP3 ;E ~: : : : . : : : ~ f ‘ , ; : r r~ :8 : : ; r : : f~~E : : : :~ :~4E: ’ : : : : : ~ ’ r l : : ~ : : :~ : :~~ : . : :~ ;~ I~ : : : : p LAC12 3 4 3 G N N V C S Y Y - L P T U L R ~ V C U K S V S L N V L ~ S l : \ ~ Y S l ~ ‘ T U l S S l ~ ~ ~ A F F l D K l G R R E ~ : F L - G S l S G - A A L A HCT 286 C I N A V F 1 Y S T S I F - - E K A C V - - ~ q P V I A T I G S G I V N T ~ F ~ V ~ L F V V E R A C R R T ~ H L I G - ~ G U A - - - W

8 R W

CP P m

XYLE 4 1 7 ~ L A I Y F V S ~ T F P ~ ~ D K N S ~ L V A H F H S G F ~ ~ ~ I Y ~ C ~ G V L A A L F ~ ~ K F V ~ E T K G K T L E E L - E - - - - - - -

MAL61 SNF3 HGT LAC1 2 XYLE ARAE

567 5 6 0

4 7 6 5 3 4

4 5 9

470

~ F K S T ~ P F F A ~ K A A A A E I ~ V K . . . C G A S q S D K T P E E L F H P L G A D S P V S T C V V S - - P K F U K D I R E R A - L K F Q . . . & ? - - - L U E P E T K K T q q T A T L P R K - A S - ~ q A P L O q V R A T L V q R U . . 0 . 0 - R K - - - L U A - G E K L R N I - - G I

FIGURE 3.-Sequence and structural homology among MAL61 protein and other sugar transporters. Amino acid sequences of the MAL61 protein, the high affinity glucose transporter of Saccharomyces encoded by SNF3 gene (CELENZA, MARSHALL-CARLSON and CARLSON 1988). the lactose permease of K. lactis encoded by the LAC12 gene (CHANG and DICKSON 1988). human HepG2 glucose transporter (MUECKLER et al. 1985) and the Escherichia coli xylose and arabinose transporter (MAIDEN et al. 1987) are shown using standard single-letter amino acid symbols. The proteins are aligned so as to maximize identity to the MAL61 protein sequence. Gaps (indicated by dashes) are introduced to optimize the alignment. Identities with the MAL61 protein are boxed. Shaded regions indicate the putative transmembrane regions in the MAL6I. SNFS (CELENZA, MARSHALL-CARLSON and CARLSON 1988), human HepG2 (MUECKLER et al. 1985), and AraE (MAIDEN et al. 1987) protein sequences. Amino acids are numbered on the left.

homology is the structural homology between these two proteins. Figure 4 depicts the hydropathy plots of both MAL6 1 and SNFS proteins. One clearly sees the twelve proposed transmembrane domains organized into two blocks of six each. The spatial distribution of these domains is so similar that the plots are nearly perfectly superimposable. Both proteins contain an hydrophilic N-terminal domain of similar size. While the MAL61 protein, like the SNFS protein, contains an hydrophilic C-terminal domain, this domain is sig- nificantly smaller in the MAL61 protein.

Equivalent sequence and structural homology is seen to other sugar transport proteins from other species. Figure 3 aligns the amino acid sequence of the MAL61 protein with those of the SNFS protein, the human HepG2 glucose transporter, the Kluyvero- myces lactis lactose permease encoded by the LAC12 gene, and the Escherichia coli xylose and arabinose transporters (MUECKLER et al . 1985; MAIDEN et al .

1987; CELENZA, MARSHALL-CARLSON and CARLSON 1988; CHANC and DICKSON 1988). Homologous se- quences are seen in both hydrophobic membrane spanning domains as well as in hydrophilic regions. The proposed secondary structure of these sugar transporters is also remarkably similar and this is illustrated in Figure 3. Comparison of the MAL61 protein to the E. coli lactose permease and to the yeast plasma membrane ATPase (encoded by the PMAl gene) reveals little, if any, sequence homology even though all are proton transporters (SERRANO 1977; KABACK 1983; SERRANO, KIELLAND-BRANDT and FINK 1986).

DISCUSSION

The results presented here offer additional strong evidence that the MAL61 gene encodes the maltose permease. Transcription of the MAL61 gene is malt- ose induced and glucose repressed (NEEDLEMAN et al .

Sequence of Maltose Permease 48 1

1 .oo

0.75

0.50

0.25

0.00

-0.25

-0.50 c, -4 U -0.75

-rl A

a 0 k 0.75 a h

2 1.00

0.50

0.25

0 .oo

-0.25

-0 .50 .

-0.75.

-1.00,

I I I I I 1 I I 100 200 300 400 500 600 700 800

SN F3

I I I I I I I I 100 200 300 400 500 600 700 800

Residue number FIGURE 4,"IIydrophobicity profile of the predicted MAL61 protein and SNF3 proteins. The profiles were determined as described in

MATERIALS AND METHODS and in Figure 2.

1984). Genetic evidence indicates that MAL61 is re- quired for maltose transport in MAL6 strains (Y. S. CHANG, R. A. DUBIN, E. PERKINS, C. A. MICHELS and R. B. NEEDLEMAN, unpublished results). Our results clearly demonstrate that the MAL61 protein is ho- mologous both in sequence and in secondary structure to other sugar transporters, particularly the Saccha- romyces high affinity glucose transporter encoded by the SNF3 gene. While the results presented here do not demonstrate that the MAL61 protein is a plasma membrane protein, they support this conclusion. The primary sequence of the MAL61 protein exhibits twelve highly hydrophobic regions approximately 2 1-

residues in length and such structure is consistent with that of an integral membrane protein (KYTE and DOOLITTLE 1982; EISENBERC 1984). In another study (to be reported elsewhere), analysis of a series of MAL61-PhoA fusions selected in E. coli by transposition of a Tn5-derivative carrying a truncated copy of the E. coli phoA gene into a plasmid carrying the MAL61 gene also supports the localization of the MAL61 protein to the plasma membrane (MANOIL, BOYD and BECKWITH 1988; C. A. MICHELS and L. SEECCOOMER, unpublished results). E. coli strains carrying these fu- sion plasmids express alkaline phosphatase activity in whole cells and preliminary mapping localizes the

482 Q. Cheng and C. A. Michels

fusion junction sites to the region of the second group of six transmembrane domains.

The homology demonstrated here among the Sac- charomyces maltose permease, the Saccharomyces high affinity glucose transporter, the human HepG2 glucose transporter, the K . lactis lactose permease and the E. coli xylose and arabinose transporters is re- markable. These proteins appear to be members of a family of related sugar transporters, even though their mechanisms of transport differ. Some are active trans- porters utilizing proton symport and others function by facilitated diffusion. The Saccharomyces galactose transporter, which transports by facilitated diffusion, also is reported to be a member of this family of sugar transporters (SZKUTNICKA et al. 1989). An evolution- ary relationship is strongly implied among all of these proteins. However, homology resulting from a com- mon ancestry is difficult to distinguish from conver- gent evolution. Sequence convergence could result from the fact that all are sugar transporters with similar functional constraints placed upon their struc- tures.

Transmembrane domains 1, 2, 4, 5, 7, 8 and 1 1 of MAL61 protein contain several polar and negatively charged residues (serine, threonine, asparagine, glu- tamine, aspartate and glutamate). Particularly note- worthy is domain 1, which contains seven polar resi- dues (4 threonine, 2 serine, 1 glutamine) and two charged residues (1 aspartate, 1 glutamate) and has an average hydrophobicity value that just exceeds the 0.42 minimum proposed by EISENBERG (1984). Graphic analysis of the membrane-spanning domains indicates that the polar and charged residues con- tained in these domains would largely be localized to the same face of the proposed alpha-helical structure in the case of domains 2, 4, 5, 8 and 1 1. MUECKLER et al. (1985) suggest that the hydroxyl and amide side chains in an amphipathic a-helix could line a trans- membrane channel and function in the transport of the sugar. A similar structural organization may exist in the maltose permease. Additionally, since the trans- port of maltose in Saccharomyces is a proton symport system, it is possible that the charged residues located in the transmembrane domains of the MAL61 protein function in proton transport in a fashion similar to that seen in the lactose permease of E. coli (HERZLIN- GER, CARRASCO and KABACK 1985; CARRASCO et al. 1986; SERRANO 1977).

The addition of glucose to maltose-induced fer- menting cultures not only leads to the cessation of synthesis of maltose permease but also leads to the loss of any existing maltose permease activity by an as yet undefined process referred to as glucose-induced inactivation (GORTS 1969; BUSTURIA and LAGUNAS 1985). Glucose-induced inactivation also affects the activity of several other enzymes in Saccharomyces

(reviewed in HOLZER 1984; JONES 1984; ACHSTETTER and WOLF 1985). These include enzymes of the glu- coneogenic pathway (fructose-l,6-bisphosphatase, cy- toplasmic malate dehydrogenase and phosphoenolpy- ruvate carboxykinase), aminopeptidase I , uridine nu- cleosidase, the high affinity glucose transporter (SNFS protein) and galactose permease (WITT, KRONAU and HOLYER 1966; FERGUSON, BOLL and HOLYER 1967; GANCEW 197 1; HAARASILTA and OURA 1975; MA- TERN and HOLZER 1977; MACNI et al. 1977; FREY and ROHM 1979; BISSON and FRAENKEL 1984; RAMOS, SZKUTNICKA and CIRILLO 1988). Maltose uptake is almost completely inactivated within 90 minutes fol- lowing the addition of glucose to the culture medium (GORTS 1969; BUSTURIA and LAGUNAS 1985). The most recent results indicate that this deadaptation inactivates both the high and low affinity uptake sys- tems but earlier studies report that only the high affinity transport is affected. Glucose specifically ini- tiates the inactivation since the transfer of a maltose fermenting culture to a noninducing medium contain- ing ethanol does not lead to the rapid loss of maltose transport activity. Recovery from glucose inhibition requires that the cells be returned to inducing medium and recovery does not occur if d e novo protein synthe- sis is inhibited. These results imply that glucose-in- duced inactivation irreversibly destroys the maltose transport protein.

The mechanism of this irreversible inactivation is unknown. Studies on aminopeptidase I and the glu- coneogenic enzymes fructose- 1,6-bisphosphatase, cy- toplasmic malate dehydrogenase and phosphoenolpy- ruvate carboxykinase from Saccharomyces indicate that the glucose-induced inactivation of these enzyme activities is paralleled by a decrease in the amount of cross-reacting material suggesting that inactivation re- sults from their selective proteolysis (NEEFF et al. 1978; FREY and ROHM 1979; FUNA-YAMA, GAN- CEDO and GANCEDO 1980; MULLER, MULLER and HOLZER 1981; TORTORA et al. 1981). While maltose permease is an integral membrane protein and these enzymes are cytosolic proteins, it is nevertheless tempting to propose that the irreversible inactivation of maltose permease is the result of proteolytic deg- radation. In a survey of several proteins from different eukaryotic organisms, RECHSTEINER and coworkers have found a correlation between short half-life and the presence of sequences rich in proline, glutamate, serine and threonine (so-called PEST-regions) which they propose target proteins for proteolysis (ROGERS, WELL and RECHSTEINER 1986; RECHSTEINER 1987; RECHSTEINER, ROGERS and ROTE 1987). A search of the MAL61 and SNFS proteins reveals potential PEST sequences located in the N-terminal cytoplasmic regions. These are found at residues 49-78 of MAL61 protein (score of 0.64) and at residues 1-13 (score of

Sequence of Maltose Permease 483

7.85) and 63-91 (score of 1.66) of SNFS protein. ROGERS, WELL and RECHSTEINER (1986) also suggest that a protein containing a region with a low positive PEST score could be subject to degradation only under certain physiological conditions, such as when that region was phosphorylated, thereby increasing the negative charge of the region. In such cases, the degradation of a protein could be regulated, as is seen in glucose-induced inactivation of the gluconeogenic enzymes. It is worth noting that the N-terminal pep- tide of Saccharomyces fructose- 1,6-bisphosphatase contains a PEST-region (score of 1.7). Whether or not PEST regions are relevant in the Saccharomyces system remains to be determined, but the possibility that a common mechanism exists for the glucose- induced inactivation of all of these proteins even though they are located in different cellular compart- ments and lack any obvious sequence similarities is an interesting one to pursue.

The authors wish to thank JOHN CELENZA, LINDA MARSHALL- CARLSON and MARIAN CARLSON for providing the hydropathy plots of MAL61 and SNFS protein shown in Figure 4, and MARTIN RECHSTEINER for providing the program used to perform the PEST- search analysis. The authors are indebted to HOWARD SHUMAN for many hours of enlightened discussion. They also wish to thank EVAN READ for help in the preparation of the figures.

This work was supported by a National Science Foundation Visiting Professorship for Women Award (RII-8700006) to C. A. M., by a National Institute of Health Research Award (GM28216) to C. A. M. and by a Board of Higher Education- Professional Staff Congress Research Award.

LITERATURE CITED

ACHSTETTER, T., and D. H. WOLF, 1985 Proteinases, proteolysis and biological control in the yeast Saccharomyces cerevisiae. Yeast 1: 139-157.

BARNETT, J. A., 1976 The utilization of sugars by yeasts. Adv. Carbohdyr. Chem. Biochem. 32: 126-234.

BISSON, L. F., and D. G. FRAENKEL, 1983a Transport of 6-deox- yglucose in Saccharomyces cerevisiae. J. Bacteriol. 155: 995- 1000.

BISSON, L. F., and D. G . FRAENKEL, 1983b Involvement of kinase in glucose and fructose uptake by Saccharomyces cereuisiae. Proc. Natl. Acad. Sci. USA 80: 1730-1734.

BISSON, L. F., and D. G . FRAENKEL, 1984 Expression of kinase- dependent glucose uptake in Saccharomyces cerevisiae. J. Bacte- riol. 159: 1013-1017.

BUSTURIA, A., and R. LAGUNAS, 1985 Identification of two forms of the maltose transport system in Saccharomyces cerevisiae and their regulation by catabolite inactivation. Biochim. Biophys. Acta 820: 324-326.

CARRASCO, N., L. M. ANTES, M. S. POONIAN and H. R. KABACK, 1986 Lac permease of Escherichia coli: histidine-322 and glu- tamic acid -325 may be components of a charge relay system. Biochemistry 2 5 0 4486-4488.

CELENZA, J. L., L. MARSHALL-CARLSON and M. CARLSON, 1988 The yeast SNF3 gene encodes a glucose transporter homologous to the mammalian protein. Proc. Natl. Acad. Sci. USA 85: 2 130-2 134.

CHANG, Y. D., and R. C. DICKSON, 1988 Primary structure of the lactose permease gene from the yeast Kluyueromyces lactis. J. Biol. Chem. 263: 16696-16703.

CHANG, Y. S., R. A. DUBIN, E. PERKINS, D. FORREST, C. A. MICHELS and R. B. NEEDLEMAN, 1988 MAL63 codes for a positive regulator of maltose fermentation in Saccharomyces cerevisiae. Curr. Genet. 14: 201-209.

CHARRON, M. J., R. A. DUBIN and C. A. MICHELS, 1986 Structural and functional analysis of the MALI locus of Saccharomyaes cereuisiae. Mol. Cell. Biol. 6: 3891-3899.

CHARRON, M. J., and C. A. MICHELS, 1987 The constitutive, glucose repression insensitive mutation present at the MAL4 locus of Saccharomyces maps to MAL43. Genetics 1 1 6 23-3 1.

CHARRON, M. J., and C. A. MICHELS, 1988 The naturally occur- ring mutant alleles of MALI in Saccharomyces species evolved by various mutagenic processes including chromosomal re- arrangement. Genetics 1 2 0 83-93.

CHARRON, M. J., E. READ, S. R. HAUT and C. A. MICHELS, 1989 Molecular evolution of the telomere-associated MAL loci of Saccharomyces. Genetics 122: 307-3 16.

DE KROON, R. A., and V. V. KONINCSBERGER, 1970 An inducible transport system for alpha-glucosides in protoplasts of Saccha- romyces carlsbergensis. Biochim. Biophys. Acta 204: 590-609.

DUBIN, R. A., R. B. NEEDLEMAN, D. GOSSETT and C. A. MICHELS, 1985 Identification of the structural gene encoding maltase within the MAL6 locus of Saccharomyces carlsbergensis. J. Bac- teriol. 1 6 4 605-610.

EISENBERG, D., 1984 Three-dimensional structure of membrane and surface proteins. Annu. Rev. Biochem. 53: 595-623.

FEDEROFF, H. J., J. D. COHEN, T . R. ECCLESHALL, R. B. NEEDLEMAN, B. A. BUCHFERER, J. GIACALONE and J. MARMUR, 1982 Isolation of a maltase structural gene from Saccharomy- ces carlsbergensis. J. Bacteriol. 1 4 9 1064-1070.

FERCUSON, J. J., M. BOLL and H. HOLYER, 1967 Yeast malate dehydrogenase: enzyme inactivation in catabolite repression. Eur. J. Biochem. 1: 21-25.

FREY, J., and K. H. ROHM, 1979 The glucose-induced inactivation of aminopeptidase I in Saccharomyces cereuisiae. FEBS Lett. 100:

FUNAYAMA, S., J. GANCEDO and C. GANCEDO, 1980 Turnover of yeast fructose bisphosphatase in different metabolic conditions. Eur. J. Biochem. 109: 61-66.

GANCEDO, C., 1971 Inactivation of fructose 1,6-diphosphatase by glucose in yeast. J. Bacterial. 107: 401-405.

GOLDENTHAL, M. J., J. D. COHEN and J. MARMUR, 1983 Isolation and characterization of a maltose transport mutant in the yeast Saccharomyces cerevisiae. Curr. Genet. 7: 195-1 99.

GORTS, C. P. M., 1969 Effect of glucose on the activity and the kinetics of the maltose-uptake system and alpha-glucosidase in Saccharomyces cerevisiae. Biochim. Biophys. Acta 1 8 4 299-305.

HAARASILTA, S., and E. OURA, 1975 On the activity and regula- tion of anaplerotic and gluconeogenic enzymes during the growth process of Baker’s yeast. Eur. J. Biochem. 52: 1-7.

HARRIS, G., and C. C. THOMPSON, 1961 The uptake of nutrients by yeasts. 111. The maltose permease of a brewing yeast. Biochim. Biophys. Acta 52: 176-183.

HENIKOFF, S., 1984 Unidirectional digestion with exonuclease I11 creates targeted breakpoints for DNA sequencing. Gene 28:

HERZLINGER, D., N. CARRASCO and H. R. KABACK, 1985 Functional and immunochemical characterization of a mutant of Escherichia coli energy uncoupled for lactose trans- port. Biochemistry 2 4 221-229.

HOLZER, H., 1984 Mechanism and function of reversible phos- phorylation of fructose-l,6-bisphosphatase in yeast, pp. 143- 154 in Enzyme Regulation by Reversible Phosphorylation-Further Advances, edited by P. Cohen. Elsevier, Amsterdam.

JONES, E. W., 1984 The synthesis and function of proteases in Saccharomyces: genetic approaches. Annu. Rev. Genet. 18: 233- 270.

261-264.

351-359.

484 Q. Cheng and C. A. Michels

KABACK, R. H., 1983 The Lac carrier protein in Escherichia coli. J. Membr. Biol. 76: 95-1 12.

KIM, J., and C. A. MICHELS, 1988 The MAL63 gene of Saccharo- myces encodes a cysteine-zinc finger protein. Curr. Genet. 14:

KYTE, J., and R. F. DOOLITTLE, 1982 A simple method for dis- playing the hydropathic character of a protein. J. Mol. Biol.

LAGUNAS, R., C. DEJUAN and B. BENITO, 1986 Inhibition of biosynthesis of Saccharomyces cerevisiae sugar transport system by tunicamycin. J. Bacteriol. 168: 1484-1486.

MAGNI, G., I . SANTARELLI, P. NATALINI, P. RUGGIERI and A. VITA, 1977 Catabolite inactivation of baker's yeast uridine nucleo- sidase. Isolation and purification of a specific inactivase. Eur. J. Biochem. 75: 77-82.

MAIDEN, M. C. J., E. 0. DAVIS, S. A. BALDWIN, D. C. M. MOORE and P. J. F. HENDERSON, 1987 Mammalian and bacterial sugar transport proteins are homologous. Nature 325: 641- 643.

MANOIL, C., D. BOYD and J. BECKWITH, 1988 Molecular genetic analysis of membrane protein topology. Trends Genet. 4: 223- 226.

MATERN, H., and H. HOLZER, 1977 Catabolite inactivation of the galactose uptake system in yeast. J. Biol. Chem. 252: 6399- 6402.

MESSING, J., 1983 New M13 vectors for cloning. Methods En- zymol. 101: 20-78.

MUECKLER, M., C. CARUSO, S. A. BALDEWIN, M. PANICO, I. BLENCH, H. R. MORRIS, W. J. ALLARD, G. E. LIENHARD and H. F. LODISH, 1985 Sequence and structure of a human glucose transporter. Science 2 2 9 941-945.

MULLER, M., H. MuLLERand H. HOLZER, 1981 Immunochemical studies on catabolite inactivation of phosphoenolpyruvate car- boxykinase in Saccharomyces cerevisiae. J. Biol. Chem. 2 5 6 723- 727.

NEEDLEMAN, R. B., and C. A. MICHELS, 1983 Repeated family of genes controlling maltose fermentation in Saccharomyces curls- bergensis. Mol. Cell. Biol. 3: 796-802.

NEEDLEMAN, R. B., D. B. KABACK, R. A. DUBIN, E. L. PERKINS, N. G. ROSENBERG, K. A. SUTHERLAND, D. B. FORREST and C. A. MICHELS, 1984 MAL6 of Saccharomyces: A complex genetic locus containing three genes required for maltose fermenta- tion. Proc. Natl. Acad. Sci. USA 81: 281 1-2815.

NEEFF, J., E. HAGELE, J. NAUHAUS, U. HEER and D. MECKE, 1978 Evidence for catabolite degradation in the glucose-de-

319-323.

157: 105-132.

pendent inactivation of yeast cytoplasmic malate dehydrogen- ase. Eur. J. Biochem. 87: 489-495.

OKADA, H., and H. 0. HALVORSON, 1964 Uptake of alpha-thio- ethyl-D glucophranoside by Saccharomyces cereuisiae. 11. General characteristics of an active transport system. Biochim. Biophys. Acta 82: 547-555.

RAMOS, J., K. SZKUTNICKA and V. P. CIRILLO, 1988 Relationship between low- and high-affinity glucose transport system of Saccharomyces cerevisiae. J. Bacteriol. 170: 5375-5377.

RAMOS, J., K. SZKUTNICKA and V. P. CIRILLO, 1989 Characteristics of galactose transport in Saccharomyces cerevisiae cells and re- constituted lipid vesicles. J. Bacteriol. 171: 3539-3544.

RECHSTEINER, M., 1987 Regulation of enzyme levels by proteol- ysis: The role of PEST regions. Adv. Enzyme Regul. 27: 135- 151.

RECHSTEINER, M., S. ROGERS and K. ROTE, 1987 Protein struc- ture and intracellular stability. Trends Biochem. Sci. 12: 390- 394.

ROGERS, S., R. WELLS and M. RECHSTEINER, 1986 Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 2 3 4 364-368.

SANGER, F., S. NICKLEN and A. R. COUISON, 1977 DNA sequenc- ing with chain termination inhibitors. Proc. Natl. Acad. Sci.

SERRANO, R., 1977 Energy requirements for maltose transport in yeast. Eur. J. Biochem. 8 0 97-102.

SERRANO, R., M. C. KIELLANDBRANDT and G. FINK, 1986 Yeast plasma membrane ATPase is essential for growth and has homology with (Na+ + K+), K+- and Ca2+-ATPases. Nature 3 1 9 689-693.

SOLLITTI, P., and J. MARMUR, 1988 Primary structure of the regulatory gene from the MAL6 locus of Saccharomyces curls- bergensis. Mol. Gen. Gent. 213: 56-62.

SZKUTNICKA, K., J. F. TSCHOPP, L. ANDREWS and V. P. CIRILLO, 1989 Sequence and structure of the yeast galactose trans- porter. J. Bacteriol. 171: 4486-4493.

TORTORA, P., M. BIRTEL, A. LENZ and H. HOLZER, 1981 Glucose- dependent metabolic interconversion of fructose-l,6-bisphos- phatase in yeast. Biochem. Biophys. Res. Commun. 100: 688- 695.

WITT, I . , R. KRONAU and H. HOLYER, 1966 Repression von Alkoholdehydrogenase, Malatdehydrogenase, Isocitratlyase und Malatsynthase in hefe durch glucose. Biochim. Biophys. Acta 118: 522-537.

USA 7 4 5463-5467.

Communicating editor: E. W. JONES