Cullins 3a and 3b Assemble with Members of the Broad Complex/Tramtrack/Bric-a-Brac (BTB) Protein Family to Form EssentialUbiquitin-Protein Ligases (E3s) in Arabidopsis*□S

Received for publication, November 23, 2004, and in revised form, February 23, 2005Published, JBC Papers in Press, March 4, 2005, DOI 10.1074/jbc.M413247200

Derek J. Gingerich‡, Jennifer M. Gagne‡, Donald W. Salter‡§, Hanjo Hellmann¶�, Mark Estelle¶,Ligeng Ma‡‡, and Richard D. Vierstra‡**

From the ‡Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706, ¶Department of Biology, IndianaUniversity, Bloomington, Indiana 47405, �Institute for Biology and Applied Genetics, Albrecht-Thaer Weg 6,Freie Universitat Berlin, 14195 Berlin, Germany, and ‡‡Department of Molecular, Cellular andDevelopmental Biology, Yale University, New Haven, Connecticut 06520-8104

Selective modification of proteins by ubiquitination isdirected by diverse families of ubiquitin-protein ligases(or E3s). A large collection of E3s use Cullins (CULs) asscaffolds to form multisubunit E3 complexes in whichthe CUL binds a target recognition subcomplex and theRBX1 docking protein, which delivers the activatedubiquitin moiety. Arabidopsis and rice contain a largecollection of CUL isoforms, indicating that multipleCUL-based E3s exist in plants. Here we show that Ara-bidopsis CUL3a and CUL3b associate with RBX1 andmembers of the broad complex/tramtrack/bric-a-brac(BTB) protein family to form BTB E3s. Eighty genesencoding BTB domain-containing proteins were identi-fied in the Arabidopsis genome, indicating that a diversearray of BTB E3s is possible. In addition to the BTB do-main, the encoded proteins also contain various otherinteraction motifs that likely serve as target recognitionelements. DNA microarray analyses show that BTB genesare expressed widely in the plant and that tissue-specificand isoform-specific patterns exist. Arabidopsis defectivein both CUL3a and CUL3b are embryo-lethal, indicatingthat BTB E3s are essential for plant development.

The covalent attachment of ubiquitin (Ub)1 to specific pro-teins controls numerous cellular processes in eukaryotes, in-

cluding chromatin remodeling, gene expression, endocytosisand vesicular trafficking, and selective protein breakdown (1,2). This ubiquitination is directed by an ATP-dependent conju-gation cascade involving the sequential action of Ub-activating(E1), Ub-conjugating (E2), and Ub-protein ligase (E3) enzymefamilies. As the last components in the cascade, E3s control thespecificity of ubiquitination by identifying appropriate targetsfor Ub transfer. The Ub moiety is connected via an isopeptidebond between the C-terminal Gly of Ub and one or more acces-sible lysyl �-amino groups in the target. In many cases, chainsof poly-Ub are assembled by reiterative conjugation cycles us-ing Lys residues within previously attached Ubs as the bindingsites. The complexity of ubiquitination is illustrated by the factthat almost 1,300 distinct genes encoding E3 components havebeen identified thus far in the Arabidopsis thaliana genomewhose protein products potentially modify an equally largenumber of targets (2).

Studies with yeast and animals have identified four broadfamilies of E3s based on subunit composition and mechanism ofaction. These include the real interesting new gene (RING) E3sand their structural relatives the U-box E3s, the homologous toE6-AP C terminus (HECT) E3s, the anaphase-promoting com-plex (APC), and the Cullin (CUL)-based E3s (1, 2). The CUL-based E3s are multisubunit ligases that use one of several CULisoforms to form a scaffold upon which several other factorsassemble (see Fig. 1A). The resulting complexes interact withboth the target and an E2-Ub intermediate and presumablyalign the two for optimal Ub transfer. The best characterizedCUL-based E3 is the multisubunit SCF complex, named afterits founding member from yeast, which contains SKP1, theCUL CDC53 (or CUL1), and the F-box protein CDC4 (3). Afourth subunit, RBX1 (or ROC1 and HRT1) was subsequentlyidentified as integral to the complex. Biochemical and struc-tural analyses indicate that the RBX1 subunit recruits theUb-E2 intermediate and the SKP1/F-box protein pair serves asa target recognition module. The F-box protein binds the targetdirectly with SKP1 linking the F-box protein to CUL1 (3, 4).Other CUL-based E3s include the von-Hippel Lindau/ElonginB/Elongin C (VBC) E3s that use CUL2 and -5 to assemble

* This work was supported by grants from the National ScienceFoundation Arabidopsis 2010 Program (Grant MCB-0115870 toR. D. V. and M. E.), the Research Division of the University of Wiscon-sin College of Agriculture and Life Sciences (to R. D. V.), a NationalInstitutes of Health postdoctoral fellowship (Grant F32-GM68361 toD. J. G.), and a National Science Foundation Research OpportunityAward fellowship (to D. W. S.). The costs of publication of this articlewere defrayed in part by the payment of page charges. This article musttherefore be hereby marked “advertisement” in accordance with 18U.S.C. Section 1734 solely to indicate this fact.

□S The on-line version of this article (available at http://www.jbc.org)contains Supplemental Figs. 1–4 and Data Sets 5 and 6.

§ Present address: Dept. of Environmental and Biological Sciences,201C Bibb Graves, University of West Alabama, Livingston, AL 35470.

** To whom correspondence should be addressed: Dept. of Genetics,425-G Henry Mall, University of Wisconsin, Madison, WI 53706. Tel.:608-262-8215; Fax: 608-262-2976; E-mail: vierstra@wisc.edu.

1 The abbreviations used are: Ub, ubiquitin; APC, anaphase-promot-ing complex; ASK, Arabidopsis SKP-like; BTB, broad complex/tramtrack/bric-a-brac; Col, Columbia; CUL, Cullin; DDB, damagedDNA-binding protein; E1, Ub-activating enzyme; E2, Ub-conjugatingenzyme; E3, Ub-protein ligase; EST, expressed sequence tag; MATH,meprin and TRAF (tumor necrosis factor receptor-associated factor)homology; RING, real interesting new gene; POZ, poxvirus and zincfinger; RBX, RING box; RT, reverse transcription; SCF, SKP1, CDC53,F-box; SKP, S. cerevisiae suppressor of kinetochore protein; SOCS,

suppressor of cytokine signaling; TAZ, transcriptional adapter zincfinger; TPR, tetratricopeptide repeat; UFO, unusual floral organs; VBC,von-Hippel Lindau (VHL)/Elongin B/Elongin C; Y2H, yeast two-hybrid;COP, constitutive photomorphogenic; ARIA, armadillo repeat proteininteracting with ABF2; BOP1, blade-on-petiole1; NPR, nonexpressor ofPR genes; NPH, non-phototropic hypocotyl; RPT, root phototropism;RT, reverse transcription; BT, BTB-TAZ; HECT, homologous to E6-APC terminus; RUB, related to Ub; At, A. thaliana; Os, O. sativa; Hs;Homo sapiens; Sp, S. pombe; Ce, C. elegans.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 280, No. 19, Issue of May 13, pp. 18810–18821, 2005© 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org18810

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RBX1 with a target recognition module composed of a family ofSOCS box recognition factors and the Elongin B and C adaptorproteins (5), and the damaged DNA-binding protein (DDB) 1E3 complex that uses CUL4 to bind RBX1 and a target recog-nition module containing DDB1 and -2, the de-etiolation pro-tein (DET) 1, and constitutive photomorphogenic (COP) 1 (6).The �10-subunit APC complex also contains a CUL-like pro-tein (APC2) that presumably performs a similar scaffoldingfunction (7).

Searches of various plant genomes indicate that plants uti-lize E3 types similar to those found in yeast and animals(8–12). The only apparent exception is the VHL E3 complexwhere potential orthologs of the Elongin B and C and SOCS boxproteins are not evident. Remarkably Arabidopsis encodes al-most 700 F-box proteins, 21 SKPs (designated ASKs in Arabi-dopsis), and two CUL1 orthologs (CUL1 and -2a), indicatingthat a large array of SCF E3s is assembled in plants (11, 13).Sequence and/or functional orthologs of yeast CUL4 and APC2that should associate with the DDB1/DET1/COP1 and the APCE3 complexes, respectively, are evident in various plant ge-nomes, indicating that these E3 types are present as well (9,12). However, analysis of the Arabidopsis genome has uncov-ered at least seven more CUL-type proteins (12, 14), some ofwhich may be specific to this kingdom, suggesting that moreCUL-based ligases are possible in plants.

Recently a new type of CUL-based multisubunit E3 wasdiscovered in Caenorhabditis elegans, Schizosaccharomycespombe, and humans (15–19). It includes the CUL3 isoform,RBX1, and members of the broad complex/tramtrack/bric-a-brac (BTB) (or poxvirus and zinc finger (POZ)) protein family(20, 21). These proteins share a degenerate BTB(POZ) domainof �120 amino acids that appears to assume a three-dimen-sional structure similar to the CUL1/2 interaction domains inthe SKP1 and Elongin C adaptor proteins (4, 22, 23). Either N-or C-terminal to the BTB domain is one of several interactionmotifs, suggesting that the full-length proteins function asSKP1/F-box protein hybrids that deliver targets to CUL3. Thebest studied example is the C. elegans E3 complex containingthe BTB-protein MEL-26. MEL-26 in association with CUL3and RBX1 promotes the ubiquitination and subsequent turn-over of MEI-1, a subunit of the katanin-like microtubule-sev-ering heterodimer MEI-1/MEI-2 (15, 17, 18).

BTB proteins have been identified in a number of eukaryotes.As examples, the Saccharomyces cerevisiae, S. pombe, C. elegans,Drosophila melanogaster, and human genomes are predicted toencode 3, 3, 105, 141, and 208 BTB domain-containing proteins,respectively (15, 24). In searches of various plant protein se-quence databases, we and others detected likely CUL3 orthologs,suggesting that similar BTB E3 complexes also exist in plants(12, 14).2 Wang et al. (49) provided further support with thediscovery that the Arabidopsis ethylene overproducer (ETO)-1protein contains a BTB domain that binds CUL3a. Furthermoreeto1 mutants contain abnormally high levels of the aminocyclo-propane synthase 5, implying that aminocyclopropane synthase5 is the ubiquitination target of the BTBETO1 complex.

Here we provide a description of the CUL3/BTB E3s inArabidopsis. Through reiterative BLAST searches of the nearcomplete genomic sequence, 80 proteins were identified thatcontain the BTB consensus sequence that could be divided into10 subfamilies. Yeast two-hybrid (Y2H) interaction studies con-firmed that members of the BTB family assemble with CUL3aand CUL3b to form E3 complexes. Many, but not all, of the BTBsubfamilies are expressed in most Arabidopsis tissues, imply-ing a pervasive action in plant growth and development. The

importance of the BTB E3s to plant biology was supported byanalysis of a cul3a cul3b double mutant. Loss of both CUL3sgenerated an embryo-lethal phenotype in which embryogenesisarrested at variable stages. Several members of the Arabidop-sis BTB protein family have been previously described as pro-teins of unknown function that participate in specific cellularevents. In addition to ethylene biosynthesis, the list includesdisease resistance (nonexpressor of PR genes (NPR) 1), photo-tropism (non-phototropic hypocotyl (NPH) 3 and root phototro-pism (RPT) 2), hormone perception (armadillo repeat proteininteracting with ABF2 (ARIA)), and leaf morphogenesis (blade-on-petiole1 (BOP1)) (25–29). Their possible roles in selectiveubiquitination by BTB E3s may now help explain their seem-ingly disparate cellular actions.

MATERIALS AND METHODS

Identification of Arabidopsis Genes Encoding BTB Domain Pro-teins—The SMART database (smart.embl-heidelberg.de) was used tolocate the BTB(POZ) domain in 37 BTB proteins from a variety oforganisms (C. elegans, S. cerevisiae, D. melanogaster, S. pombe, Musmusculus, and humans). These sequences were used as queries in NCBIBLASTP searches (final search concluded on 11/12/2003) of the nearcomplete A. thaliana ecotype Columbia (Col)-0 genome sequence avail-able in The Arabidopsis Information Resource (www.arabidopsis.org/Blast/). These queries recovered 48 non-redundant sequences based onan E-value cutoff of 0.02. This cutoff value was sufficient to eliminaterandom sequences and was equally or more stringent than similardomain-based searches in Arabidopsis, including those for F-box pro-teins (see Refs. 11 and 30). BLASTP searches were repeated using theSMART- and PFAM-predicted BTB domains from all 48 proteins asqueries; this search recovered 29 additional loci with sequence scoresbeneath the 0.02 cutoff. This process was repeated a third time withthese additional sequences and recovered two more loci. Finally eightrepresentative Arabidopsis BTB domains were used as queries againstthe six-frame translated Arabidopsis genome. These searches recoveredone additional locus (At3g22104), which was subsequently predicted byhand analysis to encode a BTB domain. Additional BLAST searchesagainst the Arabidopsis protein database with all 80 predicted BTBdomains recovered no additional sequences beneath the cutoff score.The annotation of At3g19850 was revised to include an additional exonand intron at the 5�-end based on sequence alignments with its closesequence relative At1g50280. For At5g19000, alignment of the genomicsequence with that of a corresponding cDNA recovered by a Y2H screennecessitated changes in The Arabidopsis Information Resource-pre-dicted sequence that combined into one intron: 23 bp upstream of thesecond intron, the second intron, the third exon, and the third intron.For At2g40440, the annotation was revised based on sequence align-ment with its closest relative At2g40450, resulting in extension of thesecond predicted exon to a stop codon and removal of the predicted thirdand fourth exons. At3g03510 was revised based on sequence similarityto At5g17850, which altered annotation of the first predicted intron. SeeSupplemental Data Set 6 for the revised sequences.

The SMART/PFAM data bases predicted BTB domains in 79 of the 80proteins. The outer limits of the domain were refined by hand analysisbased on sequence alignments. These adjusted domains were used inthe final alignments. For At2g13690, the BTB domain was predicted bysequence alignment and hand analysis. For the three genes(At1g04390, At2g040740, and At2g30600) that encoded proteins withtwo separate BTB domains, the BTB domain with the lowest SMART orPFAM E-value was used.

Alignment and Phylogenetic Analysis—Using previously identifiedanimal and Arabidopsis CUL sequences as queries, CUL and CUL-like proteins were identified by BLASTP of rice (Oryza sativa) usingthe Gramene comparative genome database (www.gramene.org/db/searches/blast). This search recovered 13 non-redundant rice sequenceswith E-values � 0.00058.

Full-length sequences, BTB domains, and putative SKP1/BTB/DDB-binding regions were aligned using ClustalX PC version 1.81 (31).Unrooted phylogenetic trees were generated in MEGA2.1 (32) by theneighbor-joining method, using the Poisson distance method and pair-wise deletion, and a 1,000� bootstrap replicate. Similar trees wereobtained by phylogenetic analysis with ClustalX (31). Amino acid se-quence alignments were calculated and displayed using MacBoxshadeversion 2.15 (Institute of Animal Health, Pirbright, UK). Additionaldomains were identified from the SMART and PFAM databases,2 D. Gingerich, unpublished data.

Arabidopsis BTB Ubiquitin Ligases 18811

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

BLAST searches, sequence alignments, and the PROF (33) and COILSalgorithms (www.ch.embnet.org/software/COILS_form.html). The Jsubfamily was compared with the NPH3 family.3

RT-PCR and DNA Gel Blot Analyses—For RT-PCR, total RNA iso-lated from 10-day-old seedlings by the TRIzol reagent was used as thetemplate. Each first strand cDNA reaction was performed using gene-specific primers; CUL3a (primer B or D), CUL3b (primer F), ETO1(primer H), EOL1 (primer J), or EOL2 (primer L or N), a PAE2-specificprimer, 1 �g of RNA, and Moloney murine leukemia virus reversetranscriptase (Promega, Madison, WI). Primers for CUL3a are: A, GC-CAACACAGCCTGCAGTACC; B, CCCAACGTGTCCAGAAGCTGA; C,GAGGCGTTTAAGCATCGAGTCG; and D, GTGTAGGTCCTTCT-GAAAGCTC; primers for CUL3b are: E, ATGAGTAATCAGAAGAA-GAGA; and F, GTCCAAGCTCATGAACATGAG; the position of each isidentified in Fig. 2A. Primers for ETO1 are: G, GCAGCATAATCTCT-TCACAAC; and H, CAAAGTAGGGTCAAACTCGGT; primers for EOL1are: I, GCGACTTAAAGATGCATGCGA; and J, GATGGATCAAG-GCTAGATTCT; primers for EOL2 are: K, GCGCAATCTCAAACTCTT-TGA; L, CTACGCAGAAGGAAATATCGC; M, CTCTTGTGTGGT-TCAGGTTCT; and N, CCATGTCAAGATCTTCTTTGGG; the positionof each is identified in Fig. 8C. The PAE2 primers are as describedpreviously (10). RT-PCR products were confirmed by sequencing.

For RNA gel blot analysis, total RNA was isolated from Arabidopsisseedlings by phenol extraction followed by sequential sodium acetateand lithium chloride precipitation by standard methods; 15 �g of whichwas subjected to electrophoresis on 1.2% formaldehyde-agarose gelsfollowed by transfer to nylon membranes. A 650-bp CUL3b probe wasgenerated by PCR amplification of genomic DNA with the primersATGAGTAATCAGAAGAAGAGAAATTTCC and ACAATCACAAGACT-CAATAAAC and labeled with [32P]dCTP using a random primed label-ing kit (Roche Applied Science).

Y2H Analyses—The full-length coding regions for CUL3a and CUL3bwere amplified by RT-PCR from Arabidopsis RNA and the primer pairsATGAGTAATCAGAAGAAGAGG and TTAGGCTAGATAGCGGTA-AAG (CUL3a) and primer E and TTACGCTAGATAGCGGTAAAG(CUL3b) and inserted into the pGBKT7 plasmid (Clontech) as a trans-lational fusion to the GAL4 DNA-binding domain. The CUL3a-DBfusion was used as bait in a Y2H screen of two Arabidopsis cDNAlibraries at the University of Wisconsin-Madison Molecular InteractionFacility, Madison, WI (www.biotech.wisc.edu/MIF/) that were cloned asGAL4 activation domain fusions into pGADT7-rec (Clontech). One li-brary was prepared using RNA isolated from 3-day-old etiolated seed-lings, and the second was a composite prepared from RNA isolated from3-week-old seedlings stressed by various hormone, osmotic, and envi-ronmental extremes. Putative interactors were identified by growth onhistidine dropout medium plus 1 mM 3-amino-1�,2�,4�-triazole and by�-galactosidase activity assays. Positive pGADT7-rec clones were iso-lated from yeast and sequenced. The cDNAs for At4g08445 andAt5g19000 were isolated from the stress library, and the cDNA forAt1g21780 was isolated from the etiolated seedling library.

For directed Y2H assays, the full coding regions for CUL1, CUL3a,CUL3b, RBX1, ASK1, unusual floral organs (UFO), and the variousBTB genes were PCR-amplified from A. thaliana ecotype Col-0. Tem-plates included 7-day-old seedling RNA converted to cDNA by RT-PCR,genomic DNA, and full-length expressed sequence tags (ESTs) providedby the Arabidopsis Biological Resource Center (Columbus, OH) and theRiken Bioresource Center (Yokahama City, Kanagawa, Japan). Thecoding regions were reamplified with primers designed to add 33–36additional nucleotides complementary to the pGADT7-rec and pGBKT7vectors, which would promote in-frame insertion of the products byhomologous recombination in yeast. pGBKT7 was linearized withEcoRI and NdeI, and pGADT7-rec was linearized with SmaI. The in-serts and vectors were transformed into the appropriate yeast strains ata 3:1 ratio using the Frozen-EZ Yeast Transformation II kit accordingto the manufacturer (Zymo Research, Orange, CA).

The CUL and BTB coding regions, cloned into the respectivepGBKT7 and pGADT7-rec vectors, were transformed into the haploidyeast strains YPB2a and LB414� (34). Empty plasmids and thosecontaining ASK1 and UFO cDNAs were from Gagne et al. (11). Allplasmids were verified as correct by DNA sequence analyses. Yeastwere mated on yeast extract-peptone-dextrose medium plus adenine for24 h at 30 °C and then grown on complete supplemental medium(Q-BIOgene, Carlsbad, CA) minus leucine and tryptophan. �-Galacto-sidase activity was measured by overlay assay (35), and growth was

tested on complete supplemental medium containing 5 mM 3-amino-1�,2�,4�-triazole but without leucine, tryptophan, and histidine. Foreach mating, 5 �l of cells with an A600 of 3 � 10�2 were spotted andgrown for 5 days at 23 °C.

Identification and Analysis of the cul3a-1 and cul3b-1, eto1, eol1, andeol2 Mutations—The insertion mutants cul3a-1 (SALK_046638),eto1-11 (SALK_019825), eto1-12 (SALK_061581), eto1-13 (SALK_113656), eol1-1 (SALK_144028), eol2-1 (SALK_015094), eol2-2(SALK_114207), and eol2-3 (SALK_138238) were identified in theSIGNAL T-DNA collection (signal.salk.edu/cgi-bin/tdnaexpress)generated from the Col-0 ecotype and obtained from the ArabidopsisBiological Resource Center. The cul3b-1 insertion mutant was identi-fied in the University of Wisconsin T-DNA collection generated in theWassilewskija ecotype. The SALK mutations were tracked by PCRusing the gene-specific primers A and B (cul3a-1), TGAAGACAAGCT-GCCACCAGA and ACGCTGTCGTTTCTCCCGAGT (eto1-11), TGAGC-CTGTCAGTATACAACCAGCA and GACGGGAAAGACTGGCGTCTC(eto1-12), TGAGCCATCTTCTCAACCAAATCA and AAAAAGATACCA-CAAACAAACACA (eto1-13), CAAGCCAAAACCAAAGTGGACA andCTCGAGAAGGCAACCGAATTG (eol1-1), ATCCATCAGCACTGCCA-CACA and TGCTTCAGAATGATCCCAGCA (eol2-1), TGTTGAGTGC-CAACATTGCCT and TCTCTTGCTCTCTCCGTCTCCC (eol2-2), andACATCAATGGCGTGCCTCCTA and CCCAAATTTTCACAAATTA-AAAGCC (eol2-3) in combination with either a left border (Lba1; TG-GTTCACGTAGTGGGCCATCG) or a right border (CGCTTCAGTGA-CAACGTCGAGCA) T-DNA-specific primer. The cul3b-1 mutation wasfollowed by PCR using the gene-specific primers GACGTCCCAACAAG-TAGCTTT and GTCCAAGCTCATGAACATGAG in combination withthe border primer JL202 (CATTTTATAATAACGCTGCGGACATC-TAC). For phenotypic analyses of the cul3a-1 and cul3b-1 mutants,wild-type and mutant seeds were surface-sterilized in 50% bleach,placed on half-strength Murashige and Skoog medium (Invitrogen)-containing agar and incubated at 4 °C for 2 days. The plates were thenincubated at 21 °C in a 16-h light/8-h dark photoperiod. After 2 weeksthe seedlings were genotyped and transferred to soil. Siliques of differ-ent stages of maturity were harvested, opened, and fixed for 15 min atroom temperature in neutral buffered formalin (Histofix). They werecleared for 24 h at room temperature with Hoyer’s solution (7.5 g of gumarabic, 100 g of chloral hydrate, and 5 ml of glycerol in 30 ml of water).Cleared wild-type and mutant embryos were examined by differentialinterference contrast microscopy using a Leica DMLB2 microscope(Leica Microsystems AG, Wetzlar, Germany).

For phenotypic analyses of the eto1, eol1, and eol2 mutants, wild-typeand mutant seeds were surface-sterilized in 50% bleach, placed onhalf-strength Murashige and Skoog medium (minus sugar)-containingagar, incubated at 4 °C for 4 days, exposed to light for 1 h, and thenmoved to the dark at 23 °C for 3 days. Hypocotyl lengths were measuredfrom microscope images using NIH Image (version 1.61).

Microarray Analysis of BTB Superfamily Gene Expression—Expres-sion patterns of the Arabidopsis BTB gene family was determined byanalysis of total RNA with a DNA microarray created with 70-mergene-specific oligonucleotides for the near complete gene list of A. thali-ana Col-0 (36). Each slide included a total of 26,090 oligonucleotidefeatures and 192 mismatch negative control features. Wild-type Col-0RNA was isolated by the Qiagen RNeasy plant miniprep kit (Valencia,CA) from roots from 6-day-old seedlings, seeds, rosette leaves from3-week-old plants, cauline leaves and stem from 4-week-old plants,floral organs at flowering, and siliques 3 or 8 days after pollination. Atleast two independent biological RNA samples were used for eachtissue/stage. Fluorescent labeling of probe, slide hybridization, washingand scanning, and data analysis were as described previously (36). Twoto four high quality replicate data sets (three replicates for most) wereobtained for each experiment with at least one quality data set fromeach independent RNA sample. A negative control cutoff value fordetermining genes that were “expressed” versus “not expressed” foreach hybridization was obtained by ranking the values of the 192negative control mismatch oligonucleotide features from low to highand using the 90% percentile spot (number 173) as the cutoff value.

RESULTS

Sequence Analysis of Arabidopsis and Rice CUL3 Proteins—Sequence alignments indicate that plants encode a highly di-verse set of CULs (12, 14), but the functions of only a few havebeen described thus far. To help assign functions, we morethoroughly characterized the Arabidopsis CUL family andidentified CUL and CUL-like proteins in the near completegenome of the monocot rice (O. sativa). CULs are defined by the

3 As defined by E. Liscum and A. Motchoulski, personalcommunication.

Arabidopsis BTB Ubiquitin Ligases18812

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

presence of one or more signature domains important for theirscaffolding functions. These include two �-helical domains (hel-ices II and V) near the N terminus that bind specific adaptordomains (e.g. SKP and Elongin B) and a CUL homology do-main, a portion of which binds RBX1 (4, 23) (Fig. 1B). ManyCULs also share a positionally conserved Lys for RUB1/NEDD8 attachment whose reversible recruitment appears toplay an important role in resetting CUL-type E3 complexesduring their ubiquitination cycles (37).

In our exhaustive search of the Arabidopsis genomic data-base, no additional loci were evident beyond the 11 describedpreviously (12, 14) (Fig. 1B). In rice, 13 genes predicted toencode CUL proteins were recovered (Supplemental Fig. 1).Phylogenetic analysis with representative CULs from othereukaryotes allowed us to cluster most into six separate cladesthat potentially reflect their functional specificity (Fig. 1C).Like CUL1 orthologs in other eukaryotes (38–42), AtCUL1directly interacts with RBX1 and SKP1/F-box target recogni-tion modules to form SCF E3s (11, 34, 43). AtCUL2a has beensuggested to interact with SKP1/F-box target recognition mod-ules by Y2H analysis (14). A third CUL1-like locus also exists,designated AtCUL2b (At1g43140); it contains a frameshift inthe coding region that should direct the synthesis of a trun-cated protein missing the CUL homology domain and down-stream sequence (14). Although AtCUL2b expression was notapparent from the EST database (www.Arabidopsis.org) orthe Massively Parallel Signature Sequencing databases(mpss.udel.edu/at/java.html (44)), we detected possible lowlevel expression in leaves and sepals by DNA microarray anal-ysis (data not shown). Rice encodes three canonical CULs thatcluster within the plant CUL1/2 group (GRMP00000100454,GRMP00000100813, and GRMP0000039783), which we predictform SCF-type E3s and thus were named OsCUL1a, OsCUL1b,and OsCUL1c, respectively (Supplemental Fig. 1).

Members of the CUL2 and CUL5 groups can be found inmammals, Drosophila, and C. elegans but not in the yeasts S.cerevisiae and S. pombe. No Arabidopsis or rice orthologs ofCUL2/5, Elongin B, Elongin C, or proteins bearing a SOCS boxmotif were evident in the near complete genomic databases,2

strongly suggesting that plants do not utilize this E3 subtype.Arabidopsis and rice each encode one CUL isoform thatclustered within the CUL4 group (At5g46210 andGRMP00000027181, designated AtCUL4 and OsCUL4, respec-tively) (Fig. 1C). A single CUL-related protein was detected inArabidopsis and rice (GRMP00000143862) that is similar tothe APC2 subunit of the animal APC E3 complex (7).

Many of the remaining Arabidopsis and rice CUL and CUL-like proteins are substantially smaller in size then the canonicalCULs. Although they are missing obvious CUL homology do-mains and the RUB1/NEDD8 attachment sites, these truncatedforms still contain many of the N-terminal features found in thecanonical CULs, including a predicted series of N-terminal �-hel-

FIG. 1. Structure of CUL-based E3s and organization of therice and Arabidopsis CUL family. A, organization of the CUL-basedE3s based on the three-dimensional structure of human SCF�TrCP,SCFSKP2, and VBCVHL E3 complexes (4, 23, 73). Binding of the sub-strate to the target recognition factor triggers Ub transfer from a Ub-E2intermediate bound to the RBX1-CUL subcomplex. K, lysines that serveas ubiquitination sites in the target or RUB-binding sites in CULs. B,protein organization of the Arabidopsis CUL protein family. The posi-tions of the various signature domains are indicated. The amino acidlength of each is listed on the right. C, unrooted phylogenetic tree of the

Arabidopsis (At) and rice (Os and GRMP) CUL families with represent-ative CULs from yeasts and animals. Clades of functionally distinctsubtypes are indicated by the brackets. The Arabidopsis CULs areunderlined. Dm, D. melanogaster; Mm, M. Musculus; Sc, S. cerevisiae.D–F, alignment of the regions surrounding helices II and V of Arabi-dopsis and rice CUL members with related truncated forms and repre-sentative CULs from other species. Black and gray boxes indicate iden-tical and similar amino acids, respectively. Arrowheads indicate theequivalent amino acids positions in CUL1 that contact SKP1 (4). Theresidues important for CUL3 binding to BTB proteins (16 –18)are underlined. The numbers reflect the amino acid positions forthe top AtCUL presented in each alignment. The sequence ofGRMP00000147911 in D begins at the predicted start of the protein.The sequence of GRMP0000066741 in E is predicted to contain a gapbeginning in the second helix. A full alignment of each Arabidopsis andrice CUL can be found in Supplemental Fig. 1. aa, amino acids.

Arabidopsis BTB Ubiquitin Ligases 18813

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

ices used to bind adaptor proteins like SKP1 (Fig. 1B and Sup-plemental Fig. 1). In fact, the predicted helix II and helix Vregions for several displayed sufficient sequence similarity tospecific full-length CULs to suggest that they interact with thesame adaptors (Fig. 1, D–F). For instance, the II and V helicalregions in At1g59790, At1g59800, and GRMP00000141463 aremost related to those in the Arabidopsis and rice CUL1/CUL2group (Fig. 1E), whereas the II and V helices in At3g46910 aremost related to those in the CUL4 group (Fig. 1F), suggestingthat they bind to SKP1- and DDB1-type adaptors, respectively.For three proteins (At1g12100, GRMP00000160626, and the pre-dicted full-length GRMP00000053839), the predicted helix II andhelix V regions are sufficiently unrelated, suggesting that theyinteract with unique adaptor proteins (Supplemental Fig. 1).There is evidence for expression of three of these shorter CUL-like genes in Arabidopsis: an EST in the database for At4g12100,a Massively Parallel Signature Sequencing data base entry forAt1g59800 in a population of silique RNA, and a DNA microarraysignal for At3g46910 (44).2 It is not yet known whether theAt1g59790 locus is expressed. It is immediately adjacent toAt1g59800, indicating that the pair arose by tandem duplication.

Both Arabidopsis and rice encode potential orthologs ofanimal and S. pombe CUL3. The two Arabidopsis isoforms,AtCUL3a (At1g26830) and AtCUL3b (At1g69670), are 88%identical to each other and share between 35 and 51% se-quence identity and 49 and 63% similarity to their animalcounterparts. These two proteins along with three rice se-quences (GRMP00000153145, GRMP00000147914, andGRMP00000096442, which we have named OsCUL3a,OsCUL3b, and OsCUL3c, respectively) and one more distantlyrelated and shorter rice sequence (GRMP00000147911) clus-tered together in a distinct clade with other eukaryotic CUL3sequences (Fig. 1C). Included in this group are CeCUL3,HsCUL3, and SpCUL3, which were demonstrated previously tointeract with BTB domain-containing proteins (15–19). Se-quence alignments of representative CUL3 proteins show thatthe plant versions are strongly related to their animal andfungal counterparts especially around the helix II and V re-gions. (Fig. 1D). In particular, the conserved Leu-47, Ser-48,Phe-49, and Glu-50, residues that are predicted to be criticalcontact points for the interaction of C. elegans and S. pombeCUL3 with their respective BTB proteins MEL-26 and BTB3(16–18) are conserved in the Arabidopsis and rice CUL3s butnot in the other CUL isoforms (Fig. 1, D–F).

CUL3a and CUL3b are Essential for Arabidopsis EmbryoDevelopment—To define the roles for CUL3a and CUL3b inArabidopsis development, we identified T-DNA lines contain-ing insertions in the coding regions of these two genes (Fig. 2A).The cul3a-1 allele (SALK_S046638) in the Col-0 ecotype con-tains a T-DNA insert within the second exon with the leftborder junction at nucleotide 1801 (from the translation startsite). The right border junction is at nucleotide 1815, implyingthat the insertion caused a 14-base pair deletion. The cul3b-1allele, obtained from the University of Wisconsin T-DNA col-lection in the Wassilewskija ecotype, contains a T-DNA inser-tion near the end of the first exon with the left border junctionoccurring at nucleotide 152 of the coding region. We failed todetect the CUL3a or CUL3b transcripts in the correspondinghomozygous cul3b-1 and cul3b-1 seedlings by RT-PCR or theCUL3b mRNA in the cul3b-1 seedlings by RNA gel blot anal-ysis (Fig. 2, B and C). As a consequence, it is likely that thatthese mutants represent null alleles.

Plants homozygous for either the cul3a-1 or cu3b-1 muta-tions appear to germinate and develop normally under stand-ard growth conditions, indicating that neither locus is essentialby itself (data not shown). To test for functional redundancy,

we attempted to generate individuals homozygous for bothmutations. Double heterozygous cul3a-1 cul3b-1 F1 plantsfrom a cross of single homozygous plants also grew normally.We then analyzed the F2 progeny generated by self-pollination.In a population of 97 F2 seedlings, we identified all expectedallelic combinations by PCR genotyping except individuals thatwere homozygous for insertions in both loci, strongly suggest-ing that at least one intact CUL3 locus is required for Arabi-dopsis embryogenesis. To confirm this possibility, we identifiedby PCR individuals that were homozygous for one mutationand heterozygous for the other. These cul3a-1/CUL3a cul3b-1/cul3b-1 and cul3a-1/cul3a-1 cul3b-1/CUL3b plants appearedindistinguishable from wild-type plants and flowered normally,indicating that at least one wild-type allele of CUL3 is suffi-cient (Fig. 3A). PCR genotyping of 59 progeny from self-polli-nation of these plants also failed to identify any individualshomozygous for insertions at both loci, confirming the impor-tance of the CUL3 loci.

Upon close examination of the siliques following self-pollina-tion of both sets of cul3a/cul3b homozygous/heterozygousplants, an obvious defect in embryogenesis was evident. Inaddition to seeds that developed normally, a class of defectiveseeds emerged that likely represented double homozygous in-dividuals. Initially these defective seeds expanded normallybut instead of turning green as they matured, these seedsremained white and later became brown and shriveled (Fig.3B). In addition to these, a smaller percentage of the develop-ing seeds failed to expand and remained as small nubs attachedto the funiculus, possibly representing embryos that under-went very early arrest (Fig. 3C). We also found empty spaces inthe siliques that were the either the result of reabsorption ofearly arrested seeds or possibly failed female gametogenesis.We were unable to accurately count the number of nubs andempty spaces. For the homozygous cul3a-1 parent, 17.5% of theseeds were defective versus 12.5% for the homozygous cul3b-1mutant parent when we counted just the white/shriveled seeds(Table I). Whether this difference means that more embryosfrom parents containing an intact CUL3b locus proceeded fur-ther in development and thus were counted by us as abortedseeds is not yet known.

To determine the stage of embryo arrest of the white-coloredabnormal seeds, immature siliques from selfed cul3a-1/CUL3acul3b-1/cul3b-1 and cul3a-1/cul3a-1 cul3b-1/CUL3b plantswere opened, fixed, and cleared by Hoyer’s solution, and theseeds were visualized by differential interference contrast mi-

FIG. 2. Description of the Arabidopsis cul3a-1 and cul3b-1 mu-tations. A, diagram of the CUL3a and CUL3b genes. Boxes and linesdenote exons and introns, respectively. The positions of the T-DNAs areindicted by the arrowheads. The locations of the primers used forRT-PCR in B are indicated by the horizontal arrows. B, RT-PCR anal-ysis of mRNA isolated from homozygous cul3a-1 and cul3b-1 seedlings.RT-PCR of the PAE2 mRNA is included as a control. C, RNA gel blotanalysis of total RNA isolated from wild-type (WT) and homozygouscul3b-1 seedlings. Equal loads of RNA were verified by ethidium bro-mide (EtBr) staining of the gels.

Arabidopsis BTB Ubiquitin Ligases18814

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

croscopy. As can be seen in Fig. 3D, these seeds containedembryos displaying the hallmarks of embryo arrest. Wild-typeseeds from siliques of a similar developmental age and greenseeds of the same silique bearing the mutant seeds containedembryos at various late stages of embryogenesis, includingtorpedo and walking stick (45). In older siliques, fully matureembryos were found. In contrast, the white (and likely doublehomozygous mutant) seeds arrested at much earlier stages,including globular and heart stages, and never proceeded fur-ther. In a few mutant seeds, it appeared that the cotyledonsbegin torpedo stage elongation, but hypocotyl elongation wasnot observed (Fig. 3D). The stage of embryo arrest was variableeven within the same silique, suggesting that this defect wasnot primarily caused by a block in a specific developmentalcheckpoint but more likely the result of a general growth inhi-bition of the embryo.

Arabidopsis CUL3a and CUL3b Interact with BTB DomainProteins—To help define why Arabidopsis cul3a/b mutants areembryo-lethal, we exploited a Y2H assay to identify potentialbinding partners. To avoid biasing the screen, we used full-length CUL3a as bait to search two random cDNA librariesgenerated from Arabidopsis RNA. The two libraries, totaling�1.8 � 107 clones, were created from RNA derived from 3-day-old etiolated seedlings and 3-week-old seedlings subjected to anarray of environmental stresses. These screens identified threeclones that tested positive by growth on histidine dropout me-dium and by �-galactosidase assays. One prey was a predictedfull-length cDNA derived from locus At4g08455, whereas theother two were partial cDNAs that encoded amino acids 126through 326 of locus At1g21780 or amino acids 176 through 407of locus At5g19000.

Subsequent directed Y2H interactions showed that the threeprey specifically bound full-length versions of both CUL3a andCUL3b (Fig. 4A). By comparing their derived amino acid se-quences, we discovered that the three prey contained a con-served region predicted by the SMART and PFAM databases tobe a BTB domain (46, 47) (Fig. 4B). Although scans of thefull-length protein sequences of At4g08455 and At1g21780failed to predict additional protein motifs, a meprin and TRAFhomology (MATH) motif was evident N-terminal to the BTBdomain in At5g19000 (Fig. 4B). In C. elegans, humans, andplants, similar pairings of MATH and BTB domains have beenobserved with the proteins confirmed as CUL3 interactors (15,17, 18). Both the truncated (without MATH domain) and full-length forms of At5g19000 interacted with CUL3a and CUL3b,indicating that the MATH domain is not essential for CUL3binding and that the BTB domain alone mediates the CUL3interaction (Fig. 4A).

The S. pombe and animal CUL3s also associate with RBX1 toform BTB E3 complexes (15, 16). To confirm that binding of thethree BTB proteins was specific for CUL3 and that the CUL3-BTB complex would in turn bind RBX1 to form BTB E3s, wetested by Y2H assay various combinations of CUL3a, CUL3b,and CUL1 with RBX1, ASK1, and the representative F-boxprotein UFO. As can be seen in Fig. 4A, both CUL3s along withCUL1 interacted with the common RBX1 factor (Fig. 4A).

TABLE ICharacterization of developing seed from cul3a-1 cul3b-1 double mutant plants

Developing siliques obtained after self-fertilization of individuals homozygous for one mutation and heterozygous for the other were opened, andthe developing seeds were counted and assigned to wild-type (WT) or mutant classes according to appearance. Not included in this count were thesmall nub/empty space classes.

WT (green) Mutant (white/brown) Total Percent mutant

%

cul3a-1/cul3a-1 cul3b-1/CUL3b 534 113 647 17.5cul3a-1/CUL3a cul3b-1/cul3b-1 1,312 187 1,499 12.5CUL3a/CUL3a CUL3b/CUL3b 361 2 363 0.55

FIG. 3. Phenotype of cul3a-1 cul3b-1 mutants in Arabidopsis. A,3-week-old plants homozygous and heterozygous for the cul3a-1 andcul3b-1 as compared with a wild-type (WT) sibling. B, siliques fromwild-type or homozygous/heterozygous plants following self-pollination.C, close up of siliques showing seeds with early embryo arrest. D,individual developing seeds from B cleared with Hoyer’s reagent andvisualized by differential interference contrast microscopy. The pre-dicted genotypes of the embryo are indicated.

Arabidopsis BTB Ubiquitin Ligases 18815

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

CUL3 failed to bind ASK1, and CUL1 failed to bind any of thethree BTB proteins. In contrast, CUL1 bound to ASK1, andASK1 in turn interacted with UFO with the four-subunit com-plex (UFO-ASK1-CUL1-RBX1) likely forming the SCFUFO E3(Fig. 4A).

Arabidopsis Encodes 80 Putative BTB Domain-ContainingProteins—Given the strong possibility that plant BTB proteins,like their animal and yeast counterparts, function in CUL3-based Ub ligases, we attempted to define the full complementin Arabidopsis. By reiterative NCBI BLASTP searches of thecomplete Arabidopsis genome using animal and yeast BTBsequences as queries and an empirically determined E-valuecutoff of 0.02, we identified 80 loci encoding one or more BTBmotifs. Preliminary SMART searches of the rice genome indi-cated that over 112 potential BTB proteins are present in thisspecies as well.2 For several of the Arabidopsis loci, availableESTs predicted the presence of multiple splice variants. Inthree cases (At1g01640, At2g30600, and At3g05675), this al-ternative splicing changed the 5�-untranslated regions withoutaffecting the protein-coding regions, whereas in two cases(At3g61600 and At5g55000), this alternative splicing changedthe sequence of the C-terminal 4 and 17 residues, respectively.The corresponding BTB genes are spread throughout theArabidopsis genome. Nearly all are singletons with just oneexample of apparent tandem duplication (At2g40440 andAt2g40450).

Analysis of the amino acid sequences both up- and down-stream of the BTB domain identified other protein-proteininteraction motifs in members of the Arabidopsis BTB family,including ankyrin, armadillo, pentapeptide, and tetratricopep-tide (TPR) repeats and transcriptional adapter zinc finger

(TAZ), MATH, and NPH3 domains (Fig. 6B). Like BTB proteinsin other eukaryotes (48), the signature BTB domain is typicallynear the N terminus. Interestingly several proteins in theArabidopsis BTB superfamily have been described previously,including NPH3, ETO1, NPR1, POZ-BTB protein 1, RPT2,ARIA, BOP1, and the BTB-TAZ (BT) 1–5 family (see below).With the exception of ETO1 (49), the biochemical functions ofthese proteins are unknown.

As can be seen from an alignment of the total collection(Supplemental Fig. 2) and representative members (Fig. 5), aconsensus BTB motif emerged that contains three conservedregions separated by short variable sequences. Importantly,the residues in the BTB domains of CeMEL-26 and SpBTBP3,previously identified to be important for binding CUL3, are inthese conserved stretches (16, 17), particularly Asp-2, His-20,Ile-60, Asp-62, Asp/Glu-120, Tyr-122, and Ile/Leu-125 (Fig. 5).Several Arabidopsis BTB domains appear to contain aminoacid insertions of variable sizes and locations (SupplementalFig. 2 and Fig. 5). Although such insertions have been noted inthe BTB domains of other eukaryotes (48), their functionalsignificance awaits the three-dimensional structure of thisregion.

Using the BTB domain alone, a phylogenetic tree of thecomplete Arabidopsis family was generated using MEGA2.1and a bootstrap value of 1,000 (Fig. 6A). The tree clusteredthe family into 10 families containing from two to 31 mem-bers (designated A–J) with two families split further into twosubfamilies (A1 and A2 and D1 and D2). The four ArabidopsisBTB proteins demonstrated by Y2H assay to bind AtCUL3(Fig. 4 and Ref. 49) were found in four separate clades (A1, C,D2, and E), implying that other proteins within these sameclades also interact with CUL3a/b. Weber et al. (50) recentlysupported this notion by showing that another member of theMATH domain-containing A1 family also binds CUL3a/b. Forthe remaining clades, representative BTB proteins weretested for binding with CUL3a/b by Y2H assay, but interac-tions were not apparent when compared with negative con-trols (data not shown). However, the fact that many of theresidues predicted to be important for CUL3 binding in otherorganisms, including Asp-2, His-20, Ile-60, Asp-62, and Tyr-122 (16, 17), are also conserved in these clades suggests thatthey form a similar interface (Fig. 5). We note that some ofthe predicted BTB proteins lack one or more of these con-served residues. This list includes ETO1, which can bindAtCUL3a (49), indicating that only a subset of these residuesmay be necessary for BTB-CUL3 interaction.

When the BTB tree in Fig. 6A was color-coded for the pres-ence of other motifs predicted by SMART, a similar clusteringwas evident, thus providing independent support for the group-ings. For example, all six MATH domain-containing, all fiveTAZ motif-containing, and all 30 of the NPH3 domain-contain-ing BTB proteins were grouped together in the separate A1, E,and J clades, respectively. The only exception was the ankyrinrepeat protein At2g04740, which failed to group with the otherankyrin-containing members within the G family. At2g04740has a significantly different structure than the six members ofthe G family, suggesting it is not evolutionarily related to theseankyrin-containing proteins. The eight BTB proteins in the D1clade are substantially shorter (165–282 residues in length)and contain only the BTB domain. Similar BTB-alone proteinsexist in S. pombe and C. elegans and where tested were foundto bind CUL3 (16, 17). The absence of obvious target-bindingelements implies either a novel role or that a second targetrecognition component is required, much like the SKP1/F-boxhybrid in SCF E3s.

Like most Arabidopsis F-box proteins (11), few in the BTB

FIG. 4. Interaction of Arabidopsis CUL3a and CUL3b with sev-eral members of the BTB protein family. A, Y2H analyses ofCUL3a and CUL3b with RBX1 and several BTB proteins by growthselection at 23 °C for 5 days on 5 mM 3-amino-1�,2�,4�-triazole. Speci-ficity was confirmed by Y2H analysis of CUL1 with RBX1 and the F-boxprotein UFO. pGBKT7 and pGADT7 are the DNA-binding and activa-tion domain vectors without inserts. pGBKT7/p53 and pGADT7/COILexpress unrelated proteins and are included as negative controls. B,diagram of the BTB proteins identified by a screen of a random Arabi-dopsis cDNA library for interaction with CUL3a. The positions of theBTB and MATH domains are shown. The gray/black boxes denote thesize of the cDNA identified in each screen. The amino acid (aa) lengthof each full-length protein is listed on the right.

Arabidopsis BTB Ubiquitin Ligases18816

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

collection appear to have obvious sequence orthologs in othereukaryotes. For example, no yeast and animal BTB proteinshave been found to be associated with armadillo, TPR, and

NPH3 domains (48). Of the 32 previously identified NPH3-containing proteins in Arabidopsis (26), 30 also contain a BTBdomain and cluster in the J family. In addition, 24 members of

FIG. 5. Sequence alignment of representative Arabidopsis BTB domains. The �120-amino acid core BTB sequences from bric-a-brac,tramtrack, and MEL-26 were aligned with representatives for each of the 12 Arabidopsis BTB protein groups by ClustalX and displayed withMacBoxshade using a threshold of 55%. Conserved and similar amino acids are shown in black and gray boxes, respectively. Dashes denote gaps.Designations on the left identify the BTB family (see Fig. 6) and Arabidopsis Genome Initiative number for each protein. Members shown tointeract with CUL3a or CUL3b by Y2H assay (Fig. 4 and Refs. 49 and 50) are underlined. Asterisks mark the amino acid positions important forthe CUL3-BTB interactions between C. elegans and S. pombe CUL3 and MEL-26/BTB3 (16, 17). Predicted � helices and � sheets are indicated bythe boxes and bold lines, respectively. A full alignment of all 80 BTB motifs from Arabidopsis can be found in Supplemental Fig. 2.

FIG. 6. Phylogenic tree of the complete BTB protein superfamily from Arabidopsis. A, the �120-amino acid BTB domains from all 80possible BTB proteins were aligned by ClustalX. The alignment was used to generate a non-rooted phylogenetic tree with MEGA2.1 using thePoisson distance method and a bootstrap value of 1,000. The 10 subfamilies identified from the phylogenic analysis are marked on the bottom.Individual members of the tree are color-coded by the nature of the domain(s) either N- or C-terminal to the BTB domain. Where possible,designations for proteins previously identified by other methods were used. Asterisks indicate members that interact with CUL3a or CUL3b by Y2Hassay. An expanded version of the tree bearing the Arabidopsis Genome Initiative numbers for each locus can be found in Supplemental Fig. 3.Ank, ankyrin; Arm, armadillo; CC, coiled coil; Pent, pentapeptide; CaM BD, calmodulin-binding domain. “A2,” “D2,” “F,” and “H” identifysequences/motifs not yet annotated that are common to members of the respective clades. B, grouping of the BTB subfamilies based on the natureof additional motifs outside of the BTB domain along with a protein diagram of representative members. aa, amino acids.

Arabidopsis BTB Ubiquitin Ligases 18817

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

the J family contain a C-terminal coiled-coil motif, as predictedby SMART and/or COILS, that may serve as another protein-protein interaction site (26). One lone exception in the J group(At3g49900) was not predicted by PFAM to have an NPH3domain and does not contain many of the conserved residuesthat define this motif. For several clades (A2, D2, F, and H), noadditional motifs were predicted by SMART or PFAM. How-ever, hand alignments identified one or more conserved regionsthat appear to be plant-specific and may be important fortarget recognition (Fig. 6B). For example, the five members ofthe H family all share a �300-amino acid region of 32–63%similarity C-terminal to the BTB domain. Finally three mem-bers of the Arabidopsis BTB superfamily were predicted tohave two separate BTB domains (At2g04740 and At1g04390 (Ifamily) and At2g30600 (F family)).

The Arabidopsis BTB Superfamily Is Widely Expressed—Evidence in the literature supports the involvement of BTBproteins in a wide range of processes in Arabidopsis (see be-low), suggesting that the corresponding genes are expressed inmany cell types. To examine this, we used a 70-mer oligonu-cleotide microarray to profile the expression of 75 of the 80 BTBgenes in 12 RNA populations isolated from various tissues atone or more developmental stages (Fig. 7). We considered agene to be expressed if the signal exceeded a calculated nega-tive control cutoff value (see “Materials and Methods”). Basedon this criterion, 72 of the 75 genes showed significant expres-sion in at least one tissue. These expression data compared wellwith the Massively Parallel Signature Sequencing data set forthe same genes (data not shown) and with published RNA gelblot analyses of the E (TAZ) family (51), strongly suggestingthat the profiles reflect the mRNA abundance in planta.

Overall the microarray data showed that mRNAs for mostBTB genes are detectable in most tissues tested with someindividual mRNAs accumulating to high levels (Fig. 7). Typi-cally members from the same clade displayed similar expres-sion patterns. For instance, the genes in the A1, E, and Ffamilies were nearly all highly expressed, whereas genes

within the D1 subfamily failed to display expression in mosttissues beyond non-expressed controls. In some cases, strongtissue/development-specific expression was evident even whencompared with other members within the same family. Forexample, At1g30440 expression in pistils was induced �4-foldfollowing pollination to a level at least 2-fold higher than anyother J family member in that tissue. Two members of the Efamily (At3g48360 and At5g63160) were highly expressed inrosette leaves, whereas another member of the E family(At5g67480) was highly expressed in stamens (Fig. 7). OtherBTB genes showing very high level expression includeAt5g64330 and At2g30600 in petals, At2g46260 in stamens,and At5g45110 in roots. Transcripts for all five of the confirmedCUL3 interactors (this report and Refs. 49 and 50) were de-tected: mRNA abundance for ETO1, At1g21780, andAt2g39760 was generally high, particularly in petals and roots,whereas the mRNA abundance for At5g19000 and At4g08455was generally low with best expression detected in petals androots, respectively.

Members of the TPR Subfamily of BTB Proteins Have Differ-ing Functions—Members of many of the BTB subfamilies aresubstantially similar in amino acid sequence to each other,raising the possibility that BTB proteins within the subgroupsshare similar or overlapping functions. To test this possibility,we isolated 5� and exonic T-DNA insertion mutants in thegenes encoding each of the three members of the TPR (“C”)subfamily that includes ETO1 (At3g51770), EOL1(At4g02680), and EOL2 (At5g58550) (Fig. 8C). These threeBTB proteins have been implicated in the regulation of ethyl-ene synthesis through the recognition and presumed ubiquiti-nation of aminocyclopropane synthase 5 and related enzymes(49). The EOL1 and -2 proteins are 47 and 52.6% identical toETO1, respectively, with all three displaying substantiallyoverlapping patterns of expression (Fig. 7). Because null eto1mutants generate a constitutive ethylene phenotype (49), wetested whether similar phenotype(s) could be generated by eol1and eol2 mutants, presumably through stabilization of amino-cyclopropane synthase 5 or its relatives.

As shown in Fig. 8B, T-DNA insertion mutants eto1, eol1,and eol2 were identified that dramatically block mRNA ac-cumulation (as determined by RT-PCR). Consistent with pre-vious studies (49, 52), the three homozygous alleles of eto1(eto1-11 to -13) generated a constitutive ethylene “triple re-sponse” in etiolated seedlings, consisting of a shortening andswelling of the hypocotyl and an exaggerated apical hook, aphenotype that was presumably induced by ethylene overpro-duction (Fig. 8, C and D). In contrast, a similar triple re-sponse phenotype was not apparent for the eol1 and eol2mutants. The single eol1-1 mutant and the three eol2 mu-tants (eol1-1 to -3) grew like wild type. Thus, despite theirsimilar sequence, the three members of the C subfamily maynot share identical functions in targeting aminocyclopropanesynthase 5-type proteins for degradation.

DISCUSSION

Recent interaction analyses of CUL3s from yeast and ani-mals have led to the identification of the BTB-CUL3-RBX com-plex as another major class of E3s directing protein ubiquiti-nation. In the complex, CUL3 serves to bring together theUb-E2 docking protein RBX1 with a target recognition modulecomposed of one of many BTB proteins that associate withCUL3 through its BTB domain. A reconstituted BTBMel-26 E3,consisting of the BTB protein MEL-26, CUL3, and RBX1, hasbeen shown to ubiquitinate a target (MEI-1) in vitro, thusconfirming the Ub ligase activity of this complex (15). In thiscapacity, the single BTB proteins perform the same functionsas the SKP1/F-box protein hybrid in SCF E3 complexes. Pre-

FIG. 7. Microarray expression analysis of the Arabidopsis BTBgene superfamily. RNA from various Arabidopsis tissues was isolatedand used to probe a 70-mer oligonucleotide microarray containing 75 ofthe 80 Arabidopsis BTB genes. Values represent the median of expres-sion levels from two to four independent replicate experiments, depend-ing on tissue type, and normalized between the different organs. Geneswere considered expressed or not expressed based on comparison to anegative control cutoff value (see “Materials and Methods”). Not ex-pressed genes are indicated on the graph by the absence of a value. BTBgenes not represented on the chip are indicated by the asterisks. Anexpanded view of the data along with Arabidopsis Genome Initiativenumbers for each gene can be found in Supplemental Fig. 4.

Arabidopsis BTB Ubiquitin Ligases18818

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

liminary genetic studies in multicellular eukaryotes indicatethat BTB E3s are critical to various processes (18, 19, 49). Infact, the sheer number of BTB proteins predicted in C. elegans,Drosophila, and humans (105, 141, and 208, respectively) im-plies that this E3 type is a major contributor to selective ubiq-uitination in these species.

Here we demonstrate that Arabidopsis, and likely rice andother plants, similarly assemble BTB E3s composed of theCUL3a or CUL3b isoforms, RBX1, and one of a multitude ofBTB proteins. In a recent report, Weber et al. (50) provided

further support by showing that another Arabidopsis BTB pro-tein containing a MATH domain interacts with CUL3a/b. Res-idues important for BTB docking by CUL3 and for CUL3 dock-ing by the BTB domain in the yeast and animal versions(15–18) are strongly conserved in the Arabidopsis and ricecounterparts, strongly suggesting that a similar interactionlattice is used to bind the plant BTB proteins to the CUL3a/b-RBX1 subcomplex. Although predicted to be similar to themechanism used by CUL1 and -2 to bind the adapter proteinsSKP1 in the SCF E3s (4, 22), sufficient differences within thedocking interface must be present to prevent inappropriateinteractions of CUL3 with SKP1 and CUL1/2 with BTBproteins.

By acting as recognition factors, BTB proteins target a di-verse array of proteins for ubiquitination (and likely degrada-tion), including those needed for mitotic spindle degradation inC. elegans (MEI-1) (15, 17, 24), oxidative and electrophilicstress gene expression in humans (NRF2) (19), and ethylenebiosynthesis in Arabidopsis (aminocyclopropane synthase 5)(49), suggesting that CUL3-based E3s regulate a wide range ofprocesses in different organisms. Their importance has beenborne out by analysis of cul3 mutants. Although knock-outs ofCUL3 in S. cerevisiae have no obvious phenotypes (53), RNAinterference knock-downs of CeCUL3 disrupt microtubule-me-diated processes (54), whereas deletion of the single CUL3genes in S. pombe and mice caused abnormal cell elongationand slow growth (55) and misregulation of the cell cycle at Sphase and embryo lethality, respectively (56). We show herethat loss of both CUL3a and CUL3b in Arabidopsis generatesan embryo-lethal phenotype. Although AtCUL1 knock-out mu-tants also result in embryo lethality, embryo arrest in thesemutants consistently occurs very early in embryogenesis priorto the first cell divisions following fertilization (12), implyingthat the Ub ligases formed by CUL1 and CUL3a/3b have dis-tinct roles in Arabidopsis embryogenesis. That the CUL3a/cul3a-1 cul3b-1/cul3b-1 and cul3a-1/cul3a-1 CUL3b/cul3b-1seedlings are phenotypically normally despite having only onefunctional copy of CUL3a or CUL3b, respectively, stronglysuggests that the two loci functionally overlap.

Our genomic analyses indicate that Arabidopsis encodes asuperfamily of 80 proteins containing the consensus BTB do-main with an equally large number likely in rice. Althoughsome appear similar to those found in animals (e.g. MATH/BTBproteins), a majority have sequences and domain structuresthat appear to be plant-specific. Absent from the Arabidopsissuperfamily are two BTB protein types prominent in the ani-mal kingdom, the actin-binding Kelch/BTB proteins and theDNA-binding zinc finger BTBs (restricted to vertebrates andarthropods) (48). Interestingly 97 members of the ArabidopsisF-box superfamily contain Kelch repeats, raising the possibilitythat the corresponding SCF E3 ligases have assumed therole(s) played by the missing Kelch-containing BTB E3s inplants. Also missing from the Arabidopsis superfamily is theBTB-like T1 tetramerization domain present in potassiumchannels (48). Taken together, this diversity among BTB pro-teins from different eukaryotes implies that the BTB domainhas become connected to a variety of protein interaction do-mains during evolution.

Prior to our phylogenetic analysis, genetic studies linkedindividual BTB proteins to several processes in plants. Forexample, NPH3 and RPT2 were both discovered as proteinsrequired for phototropism toward blue light where they inter-act with and act downstream of the PHOT1 and PHOT2 pho-toreceptors (26, 57). NPR1 regulates pathogen-response geneexpression in the salicylic acid-mediated systemic acquiredresistance defense pathway as well as regulating the jasmonic

FIG. 8. Description and phenotype of TPR (C) BTB subfamilymutants in Arabidopsis. A, diagram of the ETO1, EOL1, and EOL2genes. Boxes and lines denote exons and introns, respectively. Thepositions of the T-DNAs are indicted by the arrowheads. The locationsof the primers used for RT-PCR in B are indicated by the horizontalarrows. B, RT-PCR analysis of mRNA isolated from wild-type Col-0 andseedlings homozygous for the eto1-11, eto1-12, eto1-13, eol1-1, eol2-1,eol2-2, and eol2-3 mutations. RT-PCR of the PAE2 mRNA is included asa control. C, representative 3-day-old etiolated seedlings germinated inthe dark on solid Murashige and Skoog medium (minus sugar). D,hypocotyl lengths of three-day-old etiolated seedlings shown in C. Eachbar represents the average (�S.D.) of 10–14 seedlings. WT, wild type.

Arabidopsis BTB Ubiquitin Ligases 18819

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

acid-mediated defense pathway (25). ARIA acts as a positiveregulator of abscisic acid responses possibly via direct interac-tion with the abscisic acid response transcription factor ABF2(28). BOP1 is involved in leaf morphogenesis and repressesexpression of class 1 KNOX genes, which regulate meristemcell activity (29). ETO1 was identified from a screen for Arabi-dopsis mutants in ethylene perception; it binds CUL3a andlikely forms a BTBETO1 E3 that targets aminocyclopropanesynthase 5 for degradation (49).

For other Arabidopsis BTB proteins, possible functions havebeen inferred biochemically. For example, Du and Poovaiah(51) have recently described the five TAZ members of the Efamily as calmodulin-binding proteins and designated themBT1–5. A conserved 24-amino acid region near their C terminicontains the calmodulin-binding site (51). At2g13690 was firstannotated as interacting with the WD protein PRL1, a proteinthat has pleiotropic effects on Arabidopsis hormone and sugarresponses and development (58). PRL1 interacts with SNF1protein kinases and with the SCF components ASK1 and CUL1and a 26 S proteasome subunit (13), suggesting that PRL1 hasa central role in Ub-mediated events. At5g55000, which isunique in the superfamily because it contains C-terminal pen-tapeptide repeats (Fig. 6), was found by Y2H analysis to inter-act with Arabidopsis formin homology 1 (59), a protein requiredfor polar pollen tube extension by inducing actin cable assem-bly (60). Based on sequence homology, members of the F familyare potential orthologs of a barley BTB protein, GMPOZ, iso-lated by its interaction with the gibberellin-inducible transcrip-tion factor GAMYB. Reductions in GMPOZ alter regulation ofgibberellin- and abscisic acid-responsive genes in aleurone cells(61). One member of the F family named POZ-BTB protein 1(At3g61600) was also identified in a screen for ArabidopsiscDNAs that could activate the glucose repression pathway inyeast (62).

Thus far, only a small number of the 80 Arabidopsis BTBproteins have been confirmed as CUL3-binding proteins (thisreport and Refs. 49 and 50); thus, it remains possible that someBTB proteins perform functions outside of ubiquitination. Forexample, certain animal BTB proteins also use their BTB do-mains for homo- and heterodimerization and appear to havefunctions that may not be reconciled solely with assembly intoa BTB E3 complex. The DNA-binding C2H2 zinc finger domain/BTB class of proteins present in vertebrates and Drosophila(48) act as transcriptional regulators by using the BTB domainto assist in interactions with various co-repressor proteins andhistone deacetylase I (63–65) as well as mediate homodimer-ization (66, 67) and heterodimerization (20). One member ofthis group, promyelocytic leukemia zinc finger, has been shownto interact with HsCUL3 via its BTB domain (15), thus raisingthe possibility that a single BTB protein can use its BTBdomain to bind CUL3, itself, and other proteins. The BTBdomains of the actin-associated Kelch repeat/BTB proteins ofanimals and poxviruses (including Keap1, Mayven, and Kelch)may also display a similar set of diverse interactions. Likepromyelocytic leukemia zinc finger, the BTB domain in mem-bers of this group mediate dimerization (68–70), and one(Keap1) can interact with CUL3 to target breakdown of thetranscription factor Nrf2 (15, 19). In a similar fashion, ourpreliminary data with some members of the Arabidopsis BTBfamily indicate that they can homodimerize and heterodimer-ize with close family members,2 whereas those of Inada et al.(57) suggest that the BTB domain of RPT2 interacts withNPH3. Finally it is possible that some BTB proteins bind CUL3not for the purpose of bringing targets to the E3 complex but sothat they are ubiquitinated themselves (16). Such “self”-ubiq-uitination could play a role in regulating BTB protein levels

similar to that reported for some F-box and SOCS box proteins(71, 72).

The discovery of CUL3-based BTB E3s further expands thediversity of Ub ligases in plants and brings the estimatednumber well beyond 1,300 in Arabidopsis when all types andisoforms are included (HECT, RING/U-box, APC, SCF, andBTB). However, because the five truncated CUL-type proteinsfrom Arabidopsis await assignment, it is possible that theactual collection of E3s is considerably larger than this currentprediction. The unusual organization of these shorter formsraises the intriguing possibility that plants contain other CUL-based E3s that are kingdom-specific. With 80 potential mem-bers, the BTB E3 family has the capacity to selectively ubiq-uitinate an equally large number of proteins. In fact,preliminary genetic analysis of just one of the BTB subfamiliesencoding ETO1, EOL1, and EOL2 suggests that even closelyrelated BTB proteins have non-redundant functions. Determin-ing the roles of BTB proteins in Arabidopsis biology will beaided by reverse genetic analysis of the individual members aswell as by biochemical/interaction studies directed towardidentifying potential targets/interacting factors. Using ETO1,NPR1, NPH3, BT1–5, ARIA, and BOP1, which are involved inhormone biosynthesis, defense signaling, photoperception,Ca2� signaling, hormone perception, and leaf morphogenesisas examples, BTB proteins clearly have the potential to playpervasive and diverse roles in plant biology.

Acknowledgments—We thank the Arabidopsis Biological ResourceCenter for providing the EST clones and SALK T-DNA lines,Eileen Maher and the University of Wisconsin-Madison Molecular In-teraction Facility for work with the Y2H library screens, Ben Harrisonand Dr. Donna Fernandez for assistance with the embryo microscopyand interpretation, and Dr. Xing-Wang Deng for access to microarrayanalyses.

Note Added in Proof—A complementary study of CUL3a and theBTB gene family in Arabidopsis was recently published by Dieterle etal. (Plant J. 41, 386–399). It demonstrates several BTB-CUL3 inter-actions by Y2H analysis, including one with At5g13060 that has notbeen described elsewhere.

REFERENCES

1. Hershko, A., and Ciechanover, A. (1998) Annu. Rev. Biochem. 67, 425–4792. Smalle, J., and Vierstra, R. D. (2004) Annu. Rev. Plant Physiol. Plant Mol.

Biol. 55, 555–5903. Deshaies, R. J. (1999) Annu. Rev. Cell Dev. Biol. 15, 435–4674. Zheng, N., Schulman, B. A., Song, L., Miller, J. J., Jeffrey, P. D., Wang, P.,

Chu, C., Koepp, D. M., Elledge, S. J., Pagano, M., Conaway, R. C., Conaway,J. W., Harper, J. W., and Pavletich, N. P. (2002) Nature 416, 703–709

5. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., andHilton, D. J. (2002) Trends Biochem. Sci. 27, 235–241

6. Wertz, I. E., O’Rourke, K. M., Zhang, Z., Dornan, D., Arnott, D., Deshaies,R. J., and Dixit, V. M. (2004) Science 303, 1371–1374

7. Capron, A., Serralbo, O., Fulop, K., Frugier, F., Parmentier, Y., Dong, A.,Lecureuil, A., Guerche, P., Kondorosi, E., Scheres, B., and Genschik, P.(2003) Plant Cell 15, 2370–2382

8. Azevedo, C., Santos-Rosa, M. J., and Shirasu, K. (2001) Trends Plant Sci. 6,354–358

9. Capron, A., Okresz, L., and Genschik, P. (2003) Trends Plant Sci. 8, 83–8910. Downes, B. P., Stupar, R. M., Gingerich, D. J., and Vierstra, R. D. (2003) Plant

J. 35, 729–74211. Gagne, J. M., Downes, B. P., Shiu, S. H., Durski, A. M., and Vierstra, R. D.

(2002) Proc. Natl. Acad. Sci. U. S. A. 99, 11519–1152412. Shen, W. H., Parmentier, Y., Hellmann, H., Lechner, E., Dong, A., Masson, J.,

Granier, F., Lepiniec, L., Estelle, M., and Genschik, P. (2002) Mol. Biol. Cell13, 1916–1928

13. Farras, R., Ferrando, A., Jasik, J., Kleinow, T., Okresz, L., Tiburcio, A.,Salchert, K., del Pozo, C., Schell, J., and Koncz, C. (2001) EMBO J. 20,2742–2756

14. Risseeuw, E. P., Daskalchuk, T. E., Banks, T. W., Liu, E., Cotelesage, J.,Hellmann, H., Estelle, M., Somers, D. E., and Crosby, W. L. (2003) Plant J.34, 753–767

15. Furukawa, M., He, Y. J., Borchers, C., and Xiong, Y. (2003) Nat. Cell Biol. 5,1001–1007

16. Geyer, R., Wee, S., Anderson, S., Yates, J., and Wolf, D. A. (2003) Mol. Cell 12,783–790

17. Xu, L., Wei, Y., Reboul, J., Vaglio, P., Shin, T. H., Vidal, M., Elledge, S. J., andHarper, J. W. (2003) Nature 425, 316–321

18. Pintard, L., Willis, J. H., Willems, A., Johnson, J. L., Srayko, M., Kurz, T.,Glaser, S., Mains, P. E., Tyers, M., Bowerman, B., and Peter, M. (2003)Nature 425, 311–316

Arabidopsis BTB Ubiquitin Ligases18820

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19. Kobayashi, A., Kang, M. I., Okawa, H., Ohtsuji, M., Zenke, Y., Chiba, T.,Igarashi, K., and Yamamoto, M. (2004) Mol. Cell. Biol. 24, 7130–7139

20. Bardwell, V. J., and Treisman, R. (1994) Genes Dev. 8, 1664–167721. Zollman, S., Godt, D., Prive, G. G., Couderc, J. L., and Laski, F. A. (1994) Proc.

Natl. Acad. Sci. U. S. A. 91, 10717–1072122. Ahmad, K. F., Engel, C. K., and Prive, G. G. (1998) Proc. Natl. Acad. Sci.

U. S. A. 95, 12123–1212823. Stebbins, C. E., Kaelin, W. G., Jr., and Pavletich, N. P. (1999) Science 284,

455–46124. Pintard, L., Willems, A., and Peter, M. (2004) EMBO J. 23, 1681–168725. Dong, X. (2004) Curr. Opin. Plant Biol. 7, 547–55226. Motchoulski, A., and Liscum, E. (1999) Science 286, 961–96427. Scott, S. V., Nice, D. C., III, Nau, J. J., Weisman, L. S., Kamada, Y., Keizer-

Gunnink, I., Funakoshi, T., Veenhuis, M., Ohsumi, Y., and Klionsky, D. J.(2000) J. Biol. Chem. 275, 25840–25849

28. Kim, S., Choi, H. I., Ryu, H. J., Park, J. H., Kim, M. D., and Kim, S. Y. (2004)Plant Physiol. 136, 3639–3648

29. Ha, C. M., Jun, J. H., Nam, H. G., and Fletcher, J. C. (2004) Plant Cell Physiol.45, 1361–1370

30. Shiu, S. H., and Bleecker, A. B. (2003) Plant Physiol. 132, 530–54331. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins,

D. G. (1997) Nucleic Acids Res. 25, 4876–488232. Kumar, S., Tamura, K., Jakobsen, I. B., and Nei, M. (2001) Bioinformatics 17,

1244–124533. Rost, B., Fariselli, P., and Casadio, R. (1996) Protein Sci. 5, 1704–171834. Gray, W. M., del Pozo, J. C., Walker, L., Hobbie, L., Risseeuw, E., Banks, T.,

Crosby, W. L., Yang, M., Ma, H., and Estelle, M. (1999) Genes Dev. 13,1678–1691

35. Duttweiler, H. M. (1996) Trends Genet. 12, 340–34136. Ma, L., Sun, N., Liu, X., Jiao, Y., Zhao, H., and Deng, X. W. (2005) Plant

Physiol., in press37. Chiba, T., and Tanaka, K. (2004) Curr. Protein Pept. Sci. 5, 177–18438. Feldman, R. M., Correll, C. C., Kaplan, K. B., and Deshaies, R. J. (1997) Cell

91, 221–23039. Dias, D. C., Dolios, G., Wang, R., and Pan, Z. Q. (2002) Proc. Natl. Acad. Sci.

U. S. A. 99, 16601–1660640. Nayak, S., Santiago, F. E., Jin, H., Lin, D., Schedl, T., and Kipreos, E. T. (2002)

Curr. Biol. 12, 277–28741. Furukawa, M., Ohta, T., and Xiong, Y. (2002) J. Biol. Chem. 277, 15758–1576542. Kominami, K., Ochotorena, I., and Toda, T. (1998) Genes Cells 3, 721–73543. Gray, W. M., Hellmann, H., Dharmasiri, S., and Estelle, M. (2002) Plant Cell

14, 2137–214444. Meyers, B. C., Lee, D. K., Vu, T. H., Tej, S. S., Edberg, S. B., Matvienko, M.,

and Tindell, L. D. (2004) Plant Physiol. 135, 801–81345. Laux, T., and Jurgens, G. (1997) Plant Cell 9, 989–100046. Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998) Proc. Natl. Acad.

Sci. U. S. A. 95, 5857–586447. Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S.,

Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L., Studholme, D. J.,

Yeats, C., and Eddy, S. R. (2004) Nucleic Acids Res. 32, D138–D14148. Aravind, L., and Koonin, E. V. (1999) J. Mol. Biol. 285, 1353–136149. Wang, K. L., Yoshida, H., Lurin, C., and Ecker, J. R. (2004) Nature 428,

945–95050. Weber, H., Bernhardt, A., Dieterle, M., Hano, P., Mutlu, A., Estelle, M.,

Genschik, P., and Hellmann, H. (2005) Plant Physiol. 137, 83–9351. Du, L., and Poovaiah, B. W. (2004) Plant Mol. Biol. 54, 549–56952. Guzman, P., and Ecker, J. R. (1990) Plant Cell 2, 513–52353. Michel, J. J., McCarville, J. F., and Xiong, Y. (2003) J. Biol. Chem. 278,

22828–2283754. Kurz, T., Pintard, L., Willis, J. H., Hamill, D. R., Gonczy, P., Peter, M., and

Bowerman, B. (2002) Science 295, 1294–129855. Kominami, K., and Toda, T. (1997) Genes Dev. 11, 1548–156056. Singer, J. D., Gurian-West, M., Clurman, B., and Roberts, J. M. (1999) Genes

Dev. 13, 2375–238757. Inada, S., Ohgishi, M., Mayama, T., Okada, K., and Sakai, T. (2004) Plant Cell

16, 887–89658. Nemeth, K., Salchert, K., Putnoky, P., Bhalerao, R., Koncz-Kalman, Z., Stank-

ovic-Stangeland, B., Bako, L., Mathur, J., Okresz, L., Stabel, S., Geigen-berger, P., Stitt, M., Redei, G. P., Schell, J., and Koncz, C. (1998) Genes Dev.12, 3059–3073

59. Banno, H., and Chua, N. H. (2000) Plant Cell Physiol. 41, 617–62660. Cheung, A. Y., and Wu, H. M. (2004) Plant Cell 16, 257–26961. Woodger, F. J., Jacobsen, J. V., and Gubler, F. (2004) Plant Cell Physiol. 45,

945–95062. Thelander, M., Fredriksson, D., Schouten, J., Hoge, J. H., and Ronne, H. (2002)

Plant Mol. Biol. 49, 69–7963. Hong, S. H., David, G., Wong, C. W., Dejean, A., and Privalsky, M. L. (1997)

Proc. Natl. Acad. Sci. U. S. A. 94, 9028–903364. David, G., Alland, L., Hong, S. H., Wong, C. W., DePinho, R. A., and Dejean, A.

(1998) Oncogene 16, 2549–255665. Lin, R. J., Nagy, L., Inoue, S., Shao, W., Miller, W. H., Jr., and Evans, R. M.

(1998) Nature 391, 811–81466. Dong, S., Zhu, J., Reid, A., Strutt, P., Guidez, F., Zhong, H. J., Wang, Z. Y.,

Licht, J., Waxman, S., Chomienne, C., Chen, Z., Zelent, A., and Chen, S.-J.(1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3624–3629

67. Espinas, M. L., Jimenez-Garcia, E., Vaquero, A., Canudas, S., Bernues, J., andAzorin, F. (1999) J. Biol. Chem. 274, 16461–16469

68. Zipper, L. M., and Mulcahy, R. T. (2002) J. Biol. Chem. 277, 36544–3655269. Robinson, D. N., and Cooley, L. (1997) J. Cell Biol. 138, 799–81070. Soltysik-Espanola, M., Rogers, R. A., Jiang, S., Kim, T. A., Gaedigk, R., White,

R. A., Avraham, H., and Avraham, S. (1999) Mol. Biol. Cell 10, 2361–237571. Zhou, P., and Howley, P. M. (1998) Mol. Cell 2, 571–58072. Narazaki, M., Fujimoto, M., Matsumoto, T., Morita, Y., Saito, H., Kajita, T.,

Yoshizaki, K., Naka, T., and Kishimoto, T. (1998) Proc. Natl. Acad. Sci.U. S. A. 95, 13130–13134

73. Wu, G., Xu, G., Schulman, B. A., Jeffrey, P. D., Harper, J. W., and Pavletich,N. P. (2003) Mol. Cell 11, 1445–1456

Arabidopsis BTB Ubiquitin Ligases 18821

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Ligeng Ma and Richard D. VierstraDerek J. Gingerich, Jennifer M. Gagne, Donald W. Salter, Hanjo Hellmann, Mark Estelle,

ArabidopsisUbiquitin-Protein Ligases (E3s) in Complex/Tramtrack/Bric-a-Brac (BTB) Protein Family to Form Essential

Cullins 3a and 3b Assemble with Members of the Broad

doi: 10.1074/jbc.M413247200 originally published online March 4, 20052005, 280:18810-18821.J. Biol. Chem. 

  10.1074/jbc.M413247200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2005/03/10/M413247200.DC1

  http://www.jbc.org/content/280/19/18810.full.html#ref-list-1

This article cites 72 references, 38 of which can be accessed free at

by guest on September 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from