Supporting InformationNicolaï et al. 10.1073/pnas.1010198107SI Materials and MethodsDrosophila Strains and Genetics.All stocks were raised on standardfly food at 25 °C except for the cross between cry39–GAL4 (1)and UAS–DenMark, UAS–syt::GFP flies that was maintained at28 °C. The GAL4 driver lines used in this study are: elav–GAL4,Pdf–GAL4, and cry39–GAL4 (kindly provided by P. Taghert,Washington University Medical School, Saint Louis, MO);GH146–GAL4 (2, 3); EH–GAL4 (4); 201Y–GAL4 (5); yw; GAL4109(2)-68[w+](6); GAL4–221; and ato–GAL4-14a (7). TheUAS-reporter stocks were the following: UAS–DenMark; UAS–GFP[w+]; UAS–mCD8::GFP (8) UAS–Syt::GFP (9), and UAS–LacZ. In addition, stocks bearing two or three responder con-structs eventually in combination with a driver insertion werealso used: pdf GAL4 > UAS–GFP; 201Y–GAL4 > UAS–GFP,UAS–DenMark and UAS–DenMark, UAS–syt::GFP.

Labeling of RP2 Neurons. RP2 neurons in larval nerve cords werelabeled genetically using the “FLPout”method outlined in ref. 10and in ref. 11. Briefly, w−;; RN2-FLP, Tub84B-FRT-CD2-FRT-GAL4, UAS-mCD8::GFP or w−;; RN2-FLP, Tub84B-FRT-CD2-FRT-GAL4 males were crossed to w−; UAS-DenMark virgins.Embryos were collected on apple juice agar plates and incubatedat 29 °C. Expression of yeast Flippase induces recombinationbetween the FRT sites in a stochastic fashion and thus inducesexpression of UAS-reporter gene(s) under Tub84B–GAL4 con-trol in few, isolated RP2 (and occasionally aCC and pCC) neu-rons. Larvae in the process of hatching (20–21 h after egg laying)were collected and nerve cords dissected immediately in Soer-ensen phosphate buffer (pH 7.4). Nerve cords were attacheddorsal side up to poly-L-lysine (Sigma)-coated coverslips andfixed in 3.7% formaldehyde in Soerensen phosphate buffer (pH7.4) for 2 min at room temperature, then washed with Soerensenphosphate buffer and imaged. Manual “DiI” retrograde labelingof RP2 neurons was carried out essentially as described by ref.12. Briefly, Oregon-R larvae reared at 29 °C in the process ofhatching (20–21 h after egg laying) were dissected flat on Sylgard(World Precision Instruments)-coated coverglasses as outline inref. 13 using Histoacryl Blue tissue glue (Braun Melsungen),leaving the muscle field intact and depositing a droplet of DiI(Invitrogen) dissolved in sunflower vegetable oil (4 mg/mL) onthe RP2 boutons located on the distal edge of muscle LL1 inabdominal segments A2–A4.

Quantitative Analysis of Dendritic Trees of RP2 Neurons. Dendritictrees of RP2 neurons were reconstructed digitally from confocalimage stacks using customized modules to obtain quantitativedata on total dendritic tree length and number of dendritic tips(end segments) (14, 15).

Quantification of MD Dendritic Arbors. Images of MD neurons wereskeletonized and subsequently automatically analyzed using the“Skeletonize3D” and “AnalyzeSkeleton” free plugins for Im-ageJ/FIJI (freely downloadable from the FIJI website: URL:http://pacific.mpi-cbg.de/wiki/index.php/Fiji).

Immunostainings on Drosophila Brains. Immunostainings on brainswere performed as described in ref. 16. Primary and secondaryantibodies were diluted as follows: mouse anti-ChAT (DHSBmAb4B1) 1:50; rat anti-DN cadherin (DHSB DN-EX#8) 1:20;mouse anti-bruchpilot (nc82) 1:100; rabbit polyclonal anti-DsRed (Clontech cat. no. 632496) 1:500; mouse anti::GFP mAB3E6 (Invitrogen cat. no. A11120) 1:1,000; rabbit anti::GFP (In-

vitrogen cat. no. A11122) 1:1,000; Alexa 488, 555, and 647coupled secondary antibodies (Invitrogen) 1:200.

Calculation of the Relative Distribution of DenMark in the LarvalMushroom Bodies. We calculated the relative distribution ofDenMark in the dendritic field (calyx) vs. the axonal bundles(lobes) of the larval mushroom bodies. For this purpose, we firstcorrected the background of confocal sections based on the offset.For each section, DenMark expression was then normalized bythe corresponding CD8::GFP expression on a pixel-by-pixel basis.Finally, a ratio of the normalized DenMark expression in the calyxvs. the lobes was calculated.

Confocal Microscopy and Imaging. Larval motoneurons were visu-alized by confocal microscopy (BioRad and Leica DM-RXA) andthe final processing was done with ImageJ. Larval and adultsbrains images were acquired either on a LEICA DM RXA mi-croscope coupled to a LEICA TCS SL confocal system or bya Nikon A1-R confocal (Nikon) mounted on a Nikon Ti-2000inverted microscope (Nikon) and equipped with 405, 488, 561,and 639 nm lasers fromMelles Griot and processed using ImageJand Adobe Photoshop. In Fig. 1 D–G labeled neurons wereimaged with a Yokagawa CSU-22 confocal field scanner moun-ted on an Olympus BX51WI spinning disk microscope, usinga 60×/1.2 NA (Olympus) water immersion objective. Image Z-stacks were acquired using MetaMorph software (MolecularDevices) and processed using ImageJ (National Institutes ofHealth, http://rsb.info.nih.gov/ij/) and Photoshop CS2 (AdobeSystems) software.

Primary Hippocampal Neurons. Primary hippocampal neurons werederived from isolated hippocampi of E17 mouse embryos andmaintained in neurobasal medium supplemented with B27 for 14d postplating. Neurons were fixed for 30 min in 4% PFA in PBSand following a brief permeabilization blocked and processed forimmunocytochemistry as described previously (17). Indirectdouble immunofluorescent staining was done using a polyclonalantibody directed to ICAM5 (B36.1) (18) and a monoclonalantibody against synaptobrevin II (cl.69.1, gift of R. Jahn, MPIGöttingen, Germany). Mouse hippocampal neurons were kept inculture for 3 d and subsequently an immunofluorescence stainingfor tau (dephospho epitope recognized by clone Tau-1 Chem-icon no. MAB3420) was performed. Amaxa electroporation wasused for transfection.Images were captured on a confocal microscope (Radiance

2100; Carl Zeiss MicroImaging) connected to an upright mi-croscope (Eclipse E800; Nikon) and using an oil-immersion planApo 60× A/1.40 NA objective lens. Final processing was doneusing Lasersharp 2000 (Carl Zeiss MicroImaging) and withAdobe Photoshop (Adobe).

Electroretinogram Recordings (ERGs). ERGs were recorded from 7-to 11-d-old flies as described (19), except flies were immobilizedwith liquid Pritt glue and we used a green LED light digitallycontrolled to present 1-s light pulses. Data were stored ona personal computer with Clampex 10 and processed withClampfit and Canvas 7.

Negative Geotaxis Assay.Motor deficits were assessed by deviationfrom normal negative geotaxis behavior. Five adult flies perreplication were placed in an empty plastic vial. After a 10-minrest period, the flies were tapped to the bottom of the vial, and thenumber of flies able to climb 10 cm in 15 s was recorded. The

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 1 of 8

assays were repeated three times at 1-min intervals. Four repli-cations were performed for each dataset and 20 flies were testedboth for the control (ElavGAL4) and the experimental group(ElavGAL4; UAS–DenMark, UAS–syt::GFP).

Reverse Strahler Analysis of vpda Neurons. We used the Strahlermethod (20, 21) to order and analyze the branching patterns ofthe da neurons. Terminal branches were assigned an order ofone. Where two first-order branches met, an order of two wasassigned. Where two second-order branches met, an order ofthree was assigned and so on for the whole cell. If a lower orderbranch (i.e., one) met a higher order branch (i.e., two), thehigher branch order was carried on without change. Once den-drites were ordered in such a manner, the assignments werereversed (22) (so that extensions from the cell body became thelowest order branches and the terminals became the highestorder branches). Then each order of branches was comparedbetween control and DenMark fly, by simple Student’s T-tests(Table S1).

Technical Notes on the Use of DenMark. To better understand thecharacteristics of this marker, we attempted to determine the

optimal conditions for its use. We asked whether we couldgenerate a smaller marker by deleting the extracellular domain ofICAM5. However, we find that somatodendritic specificity in fliesrequires the ICAM5 extracellular domain, as a deletion constructlacking this domain is expressed throughout the entire neuron inMBs (Fig. S7). This means that the marker is at this point bestused in its full-length form. Furthermore we asked whether theprotein would keep its localization when it was overexpressed atvery high levels. For this purpose we compared flies heterozy-gous for 201Y–Gal4, DenMark and mCD::GFP to flies homo-zygous for the same combination. We find that under triplehomozygous conditions, the axonal compartment becomes visi-ble with DenMark, even though the marker continues to showsignificantly greater enrichment in the dendritic compartment(Fig. S8). Nonetheless, we suggest using the marker in one copywhenever possible. Furthermore, the possibility to detect Den-Mark with the anti-DsRed antibody allows detection of lowlevels of the marker at single cell resolution, facilitating theanalysis at the single cell level and increasing the stability of thepreparations from a few days to a few weeks after mounting.

1. Klarsfeld A, et al. (2004) Novel features of cryptochrome-mediated photoreception inthe brain circadian clock of Drosophila. J Neurosci 24:1468–1477.

2. Stocker RF, Heimbeck G, Gendre N, de Belle JS (1997) Neuroblast ablation inDrosophila P[GAL4] lines reveals origins of olfactory interneurons. J Neurobiol 32:443–456.

3. Heimbeck G, Bugnon V, Gendre N, Keller A, Stocker RF (2001) A central neural circuitfor experience-independent olfactory and courtship behavior in Drosophilamelanogaster. Proc Natl Acad Sci USA 98:15336–15341.

4. McNabb SL, et al. (1997) Disruption of a behavioral sequence by targeted death ofpeptidergic neurons in Drosophila. Neuron 19:813–823.

5. Yang MY, Armstrong JD, Vilinsky I, Strausfeld NJ, Kaiser K (1995) Subdivision of theDrosophila mushroom bodies by enhancer-trap expression patterns. Neuron 15:45–54.

6. Gao FB, Brenman JE, Jan LY, Jan YN (1999) Genes regulating dendritic outgrowth,branching, and routing in Drosophila. Genes Dev 13:2549–2561.

7. Hassan BA, et al. (2000) atonal regulates neurite arborization but does not act asa proneural gene in the Drosophila brain. Neuron 25:549–561.

8. Lee T, Lee A, Luo L (1999) Development of the Drosophila mushroom bodies:Sequential generation of three distinct types of neurons from a neuroblast.Development 126:4065–4076.

9. Zhang YQ, Rodesch CK, Broadie K (2002) Living synaptic vesicle marker:Synaptotagmin-GFP. Genesis 34:142–145.

10. Roy B, et al. (2007) Metamorphosis of an identified serotonergic neuron in theDrosophila olfactory system. Neural Dev 2:20.

11. Ou Y, Chwalla B, Landgraf M, van Meyel DJ (2008) Identification of genes influencingdendrite morphogenesis in developing peripheral sensory and central motor neurons.Neural Develop 3:16.

12. Landgraf M, Jeffrey V, Fujioka M, Jaynes JB, Bate M (2003) Embryonic origins ofa motor system: Motor dendrites form a myotopic map in Drosophila. PLoS Biol 1:E41.

13. Baines RA, Bate M (1998) Electrophysiological development of central neurons in theDrosophila embryo. J Neurosci 18:4673–4683.

14. Evers JF, Muench D, Duch C (2006) Developmental relocation of presynaptic terminalsalong distinct types of dendritic filopodia. Dev Biol 297:214–227.

15. Evers JF, Schmitt S, Sibila M, Duch C (2005) Progress in functional neuroanatomy:Precise automatic geometric reconstruction of neuronal morphology from confocalimage stacks. J Neurophysiol 93:2331–2342.

16. Ramaekers A, et al. (2005) Glomerular maps without cellular redundancy at successivelevels of the Drosophila larval olfactory circuit. Curr Biol 15:982–992.

17. Annaert WG, et al. (1999) Presenilin 1 controls gamma-secretase processing ofamyloid precursor protein in pre-golgi compartments of hippocampal neurons. J CellBiol 147:277–294.

18. Esselens C, et al. (2004) Presenilin 1 mediates the turnover of telencephalin inhippocampal neurons via an autophagic degradative pathway. J Cell Biol 166:1041–1054.

19. Verstreken P, et al. (2003) Synaptojanin is recruited by endophilin to promotesynaptic vesicle uncoating. Neuron 40:733–748.

20. Strahler (1953) Revisions of Horton’s quantitative factors in erosional terrain. TransAm Geophys Un 34:345.

21. Uylings HB, Smit GJ, Veltman WA (1975) Ordering methods in quantitative analysis ofbranching structures of dendritic trees. Adv Neurol 12:347–354.

22. Berry M, Hollingworth T, Anderson EM, Flinn RM (1975) Application of networkanalysis to the study of the branching patterns of dendritic fields. Adv Neurol 12:217–245.

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 2 of 8

Fig. S1. Expression of the ICAM5–mCherry fusion protein in vertebrates. (A) ICAM5 accumulates in a distinct compartment in primary hippocampal neurons.Double-immunofluorescence staining for endogenous ICAM5 (B36.1) and synaptobrevin II (SYB2, mAb cl.69.1) in wild-type hippocampal neurons (14 d in vitro).ICAM5 labeling is localized to the somatodendritic plasmalemma in contrast to synaptobrevin II, which marks axonal termini. (A and A′) Higher magnificationof boxed regions in A, white arrows point to synaptic contact points. (A′′) Schematic representation of ICAM5 showing the extracellular amino terminal and theintracellular carboxy-terminal domains. (B′) Schematic representation of the ICAM5–mCherry fusion protein (DenMark). The mCherry sequence (red) is insertedbetween the transmembrane and the extracellular domain (black), using two molecular linkers (green). (B) DenMark is somatodendritically localized in mousehippocampal neurons. Indeed, we detected no colocalization between the axonal marker tau immunoreactivity (Chemicon no. 3420) and DenMark expressionin mouse hippocampal neurons. Amaxa electroporation was used for transfection. A maximal projection of the confocal stack is shown.

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 3 of 8

ATGCCGGGGCCTTCGCCAGGGCTGCGCCGAGCGCTCCTCGGCCTCTGGGCTGCCCTGGGCCTGGGGATCCTAGGCATCTCAGCGGTCGCGCTAGAACCTTTCTGGGCGGACCTTCAGCCCCGCGTGGCGCTCGTGGAGCGCGGGGGCTCGCTGTGGCTCAACTGCAGCACTAACTGTCCGCGGCCGGAGCGCGGTGGCCTGGAGACCTCGCTACGCCGAAACGGGACCCAGAGGGGTCTGCGCTGGCTGGCTCGGCAGCTGGTGGACATCCGAGAGCCTGAGACCCAGCCGGTCTGCTTCTTCCGCTGCGCGCGCCGCACACTCCAAGCGCGTGGACTCATCCGAACTTTCCAGCGACCGGATCGGGTAGAGCTGGTGCCGCTCCCTTCTTGGCAGCCAGTGGGCGAGAACTTCACCTTGAGCTGCAGGGTCCCGGGAGCAGGACCCCGAGCGAGCCTCACATTGACCCTGCTGCGGGGCGGCCAGGAGCTGATTCGCCGCAGTTTCGTAGGCGAGCCACCCCGAGCGCGGGGTGCGATGCTCACCGCCAGGGTCCTGGCACGCAGGGAGGACCACAGGGTCAATTTCTCATGCCTCGCCGAGCTTGACCTGCGGCCACACGGCTTGGGACTGTTTGCAAATAGCTCGGCCCCCAGACAGCTCCGTACCTTTGCCATGCCTCCACATTCCCCGAGTCTTATTGCTCCCCGAGTCTTAGAAGTGGACTCAGAAAGGCCGGTGACTTGCACGTTGGATGGACTGTTTCCTGCCCCAGAAGCCGGGGTTTACCTCTCTCTGGGAGATCAGAGGCTCAATCCTAATGTGACCCTCGATGGGGACAGCCTTGTGGCCACTGCCACAGCTACAGCAAGCGCAGAACAGGAAGGCACCAAACAGCTGATGTGCGTCGTGACCCTCGGGGGCGAAAGCAGGGAGACCCAGGAAAACCTGACTGTTTACAGCTTCCCGACTCCTCTTCTGACTTTGAGTGAGCCAGAAGCCCCCGAGGGAAAAATGGTGACCATAAGCTGCTGGGCAGGGGCTCGAGCCCTTGTCACCCTGGAGGGAATTCCAGCTGCGGTCCCGGGGCAGCCCGCTGAGCTCCAGTTAAATGTTACAAAGAACGATGACAAGCGGGGCTTCTTCTGCGACGCCGCCCTCGATGTGGACGGGGAAACTCTAAGAAAAAACCAGAGCTCTGAGCTTCGTGTCCTGTATGCACCTCGCCTGGATGACTTGGATTGTCCCAGAAGCTGGACGTGGCCAGAGGGTCCAGAGCAGACCCTCCACTGCGAGGCCCGCGGAAACCCTGAGCCCTCGGTGCACTGTGCAAGGCCTGAGGGCGGGGCGGTGCTAGCGCTGGGCCTATTGGGTCCAGTGACCCGTGCCCTCGCAGGCACTTACCGATGCACAGCAGTCAATGGGCAAGGCCAGGCGGTCAAAGATGTGACCCTGACCGTGGAATATGCCCCAGCGCTGGACAGTGTAGGCTGCCCAGAACATATTACTTGGCTGGAGGGAACGGAGGCATCGCTTAGCTGTGTGGCACACGGGGTCCCACCACCTAGCGTGAGTTGTGTGCGCTCTGGAAAGGAGGAAGTCATGGAAGGGCCTCTGCGCGTGGCCCGGGAGCACGCCGGCACTTACCGATGCGAAGCCATCAACGCCAGAGGATCAGCGGCCAAAAATGTGGCCGTCACGGTGGAATATGGTCCCAGTTTTGAGGAGTTGGGCTGCCCCAGCAACTGGACGTGGGTAGAGGGATCTGGAAAGCTGTTTTCCTGTGAAGTTGATGGGAAGCCAGAACCACGTGTGGAGTGCGTAGGCTCGGAGGGTGCAAGCGAAGGGATAGTGTTGCCCTTGGTGTCCTCAAACTCTGGTCCTAGAAACTCTATGACCCCTGGTAACCTGTCACCGGGCATTTACCTCTGCAACGCCACCAACCGGCACGGCTCCACAGTCAAAACAGTCGTCGTGAGCGCGGAGTCGCCGCCACAGATGGATGAATCCAGTTGCCCGAGTCACCAGACCTGGCTGGAAGGAGCTGAGGCTACCGCGCTGGCCTGCAGTGCCAGGGGCCGCCCCTCTCCACGGGTGCATTGCTCCAGGGAGGGTGCCGCCAGGCTGGAGAGGCTACAGGTGTCCCGAGAGGATGCGGGGACCTACCGCTGTGTGGCCACCAATGCGCATGGCACGGATTCACGGACGGTCACTGTGGGTGTGGAATACCGGCCTGTGGTGGCTGAGCTGGCAGCCTCGCCCCCAAGCGTGCGGCCGGGCGGTAACTTCACTCTGACCTGCCGCGCAGAGGCTTGGCCTCCAGCCCAGATCAGCTGGCGCGCGCCCCCGGGGGCTCTCAACCTCGGCCTCTCCAGCAACAATAGCACTCTGAGCGTGGCGGGAGCCATGGGCAGCCATGGCGGCGAGTATGAGTGTGCAGCGACCAATGCGCATGGGCGCCACGCACGGCGCATCACAGTGCGCGTGGCCGGCGGATCTGGCGGATCTGGCGGATCTAAGCTT gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagGGCGGATCTGGCGGATCTGGCGGATCTGGTACCGGTCCATGGCTGTGGGTCGCTGTGGGCGGTGCGGCAGGGGGCGCGGCGCTGCTGGCCGCTGGGGCCGGCCTGGCCTTCTACGTGCAATCCACCGCTTGCAAGAAGGGCGAGTACAACGTCCAGGAGGCTGAGAGCTCAGGCGAGGCCGTGTGTCTCAATGGCGCGGGCGGGACACCGGGTGCAGAAGGCGGAGCAGAGACCCCAGGCACTGCAGAGTCACCTGCAGATGGCGAGGTTTTCGCTATCCAGCTGACATCTTCCTGA

Fig. S2. Sequence of the TLN–Cherry fusion protein. The TLN sequence (blue) and the Cherry sequence (red), flanked by the two molecular linkers (green).

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 4 of 8

Fig. S3. DenMark as a marker for developmental specialization in rat hippocampal neurons in vitro. Expression of DenMark and of dendritic (MAP-2) andaxonal (Tau) markers are compared at different stages in cultured rat hippocampal neurons. In all panels, Tau1 and MAP-2 expression was revealed using thefollowing commercial antibodies: Tau, Chemicon no. MAB3420 and MAP2, Santa Cruz no. sc20172. DenMark expression was either visualized directly (A–O) orwith the help of an anti-dsRed antibody (P–T; Clontech no. 632496). (A–E) After 1 d in vitro (1 DIV), both DenMark and MAP-2 are present in the axon (ar-rowheads), where they colocalize with Tau1. (F–J) At 3 DIV, DenMark and MAP-2 are still present in the axon, but start to get restricted to its proximal part(arrowheads). (K–O) At 5 DIV, DenMark and MAP-2 become even more restricted to the proximal part of the axon (arrowheads). (P–T) At 10 DIV, DenMark andMAP-2 are fully restricted to the dendrites (arrows), whereas Tau1 marks the axons (arrowheads). (Scale bars, 10 μm.)

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 5 of 8

Fig. S4. DenMark expression in flies does not cause major defects in neuronal function. (A) Overexpression of DenMark in the entire nervous systemthroughout development does not lead to major defects in synaptic transmission. Flies containing the elav–GAL4 driver were crossed to flies with the UAS–DenMark and UAS–syt::GFP transgenes. CantonS flies were used as controls (referred to as G1). ERGs in response to a 1-s green light pulse are recorded byplacing a recording electrode on the eye and a reference electrode in the thorax (n = 5). The response of elav–GAL4/+; ; UAS-syt::GFP, UAS-DenMark/+ fliesappears normal and represents the mean of the response observed in flies homozygous for either the driver or responder constructs alone. (B) Overexpressionof DenMark does not induce impaired motor performance. Motor performance of flies with elav–GAL4 driving UAS–DenMark and UAS–syt::GFP was tested ina negative geotaxis climbing assay. The motor performance of elav–GAL4; UAS–DenMark, UAS–syt::GFP adult females was compared with the motor per-formance of elav–GAL4 control flies. The number of flies above the 10 cm mark after 15 s was scored. No significant difference is detected between the twogenotypes (n = 20, P = 0.36 in a χ2 test).

A A’ A’’

C C’ C’’

D

L1L2

L3adult

B B’ B”

D’’D’

DenMark GFP merge

Syt-GFP

Fig. S5. DenMark as a marker for developmental specialization in Drosophila. Mushroom body (MB) neurons were marked by crossing flies with the MB driver201Y–GAL4 driving UAS–GFP to UAS–DenMark flies. Brains were dissected from first (A–A′′), second (B–B′′) and third (C–C′′) instar larvae and adults (D–D′′). Z-projections of confocal image stacks are shown. (A) In first instar larvae DenMark is largely homogeneously distributed in the axonal lobes and the dendriticcalyx. (B) At the second instar, DenMark shows stronger expression in dendrites and cell bodies than in axons. (C) By the third instar, DenMark is highly specificto dendrites, present in cell bodies but essentially absent from axons. (D) In adult flies, DenMark is almost exclusively localized in the calyx and somas, althoughsome expression can also be detected in the peduncle, the most proximal part of the axonal tracts.

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 6 of 8

L1L2

L3adult

DsCAM17.1-GFP FASII merge

A A’ A’’

C C’ C’’

B B’ B’’

D D’ D’’

Fig. S6. Distribution of Dscam during MB development. Localization of the DsCam17.1::GFP marker in the mushroom bodies is described at the three larvalstages and in the adult brain. Immunostainings against GFP and the lobes (axonal)-specific fasII protein were performed. Although it is highly enriched in thecalyx since the first instar, DsCam17.1::GFP expression is detected in the axonal tracts during the three larval instars. However, the axonal localization ofDsCam17.1::GFP is progressively restricted to the most proximal axonal compartment, the peduncle (devoid of FasII immunoreactivity). Similar to DenMark,expression of DsCam17.1::GFP in the adult brain is restricted to cell bodies, the calyx, and the very proximal part of the peduncle. All images correspond tomaximal Z-projections of confocal stacks. Dorsal is at the Top. (Scale bars, 20 μm in A–B′′ and 50 μm in C–D′′.)

A B C

∆ICAM5-Cherry GFP merge

Fig. S7. The extracellular domain of ICAM5 is required for the somatodendritic localization. Deletion of the extracellular domain of ICAM5, resulting ina truncated form of DenMark (ΔICAM5–Cherry), leads to the loss of its somatodendritic localization (A) similar to GFP (B, C) when expressed in the third instarlarvae mushroom bodies using the 201Y–GAL4 driver line. Maximal Z-projections of confocal image stacks are shown.

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 7 of 8

w;201YGal4>UAS-DenMark, UAS-mCD8::GFP;

w;201YGal4>UAS-DenMark, UAS-mCD8::GFP/+;

merge

DenMark

mCD8::GFP

Fig. S8. Dose-dependent localization of DenMark expression. Two populations of flies were compared that bear either one or two copies of the 201Y–GAL4driver and UAS–mCD8::GFP and UAS::DenMark responder transgenes in the brains of wandering third instar larvae were processed and expression of mCD8::GFP and of DenMark imaged using the exact same settings. Here we show that increasing DenMark expression level by, for instance, increasing the number oftransgene copies can lead to the leaking out of DenMark toward the axonal compartments. Nevertheless, even in this case, DenMark remains enriched in thecalyx (the dendritic compartment). (Scale bars, 50 μm.)

Table S1. Reversed Strahler analysis of vpda neurons

Genotype First order Second order Third order Fourth order

CD8–GFP 2 (±0.63) 10.33 (±4.46) 41.17 (±18.25) 6.17 (±15.11)DenMark 1.33 (±0.52) 6.17 (±2.56) 24 (±8.46) 5.5 (±13.5)P value 0.07 0.08 0.07 0.94

Nicolaï et al. www.pnas.org/cgi/content/short/1010198107 8 of 8