Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the...

8
Saint Cecilia Church Saint Cecilia Church Trinity Sunday June 7, 2020

Transcript of Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the...

Page 1: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

Saint Cecilia Church

Saint Cecilia Church Trinity Sunday June 7, 2020

Page 2: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

#179 2

NEW MASS SCHEDULE

Sunday Vigil 5:00pm (Saturday)

6:30 and 10:00am

Monday through Friday 6:30 and 8:30 am

Saturday 8:30 am

OFFICES

Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Marcia Mason School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130

Website: www.stceciliafc.org

School: scsfoxchase.org

CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner

PASTOR EMERITUS Reverend Msgr. Francis X. Dreger

PAROCHIAL VICAR Reverend Robert Lucas

PERMANENT DEACON Deacon Patrick Diamond

PRINCIPAL Sister Jane Mary Carr, IHM

VICE PRINCIPAL Sister Joan Felicia O’Reilly, IHM

SACRAMENTS

All sacraments are currently postponed.

Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240.

Marriage Couples must contact a priest six months prior to the wedding.

Reconciliation Saturdays from 4:00 to 5:00pm

Homebound Visitation Please contact the Rectory.

This past Wednesday and Thursday, Saint Cecilia Church was

professionally cleaned by Southampton Window Cleaning and

Janitorial Service, Inc. Floors and pews were scrubbed,

polished and sanitized.

Saint Cecilia Church will reopen Saturday, June 13 with the

8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on

Saturday. Sunday Masses will be 6:30am and 10:00am.

In addition to parishioners attending the 10:00am Mass live in

Church, we will also live-stream it for those who wish not to

come to Church in person.

The Archbishop has suspended Sunday obligations until further

notice.

Weekday Masses will begin Monday, June 15 at 6:30 & 8:30am.

GUIDELINES

Parishioners must wear masks while in church.

Social distancing is encouraged (6 ft. apart)

No missalettes or music issues will be in pews. You are

welcome to bring a prayer book or your device to follow

along with the readings.

Two doors will remain open to enter church.

Ushers will help with seating, communion and exiting.

The Crying Room and Restroom will be closed until further

notice.

Confessions will resume Saturday, June 13 (4:00-5:00pm).

Confessionals will not be used. A kneeler will be placed at

the front altar and the priest will be seated in the sanctuary.

Page 3: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

#179 3

We love our Advertisers Please patronize the businesses

who advertise in our

church bulletin every week.

REFLECTION: Who is this God who is so revelatory

to Moses? Who is this God who is about to take the Isra-

elites, a broken and recalcitrant people and make them

new again? This is the God who chooses to be with us,

despite our own unworthiness.

This is the God who comes in a cloud, who may not be

seen, but certainly is experienced. And what do Moses

and the people experience of this God? How shall they

"name" God? Judging from today’s story God is: patient

and compassionate; takes the initiative to reach out to us;

is not dissuaded by our sins; is faithful to us, even when

we have built our own idols to worship; can take a bro-

ken people and make them whole again.

So we ask ourselves:

From my present experience: What name would I

give God?

Has the reality of God changed for me in recent

years?

What events in my life influenced that change?

Solemnity of The Most Holy Trinity June 7, 2020

The Liturgy of the Word

First Reading A reading from the Book of Exodus

Early in the morning Moses went up Mount Sinai as the Lord had commanded him, taking along the two stone tablets.

Having come down in a cloud, the Lord stood with Moses there and proclaimed his name, “Lord.” Thus the Lord passed before him and cried out, “The Lord, the Lord, a mer-ciful and gracious God, slow to anger and rich in kindness and fidelity.” Moses at once bowed down to the ground in worship. Then he said, “If I find favor with you, O Lord, do come along in our company. This is indeed a stiff-necked people; yet pardon our wickedness and sins, and receive us as your own.”

The word of the Lord. Thanks be to God.

Responsorial Psalm Glory and praise forever!

Second Reading A reading from the second Letter of St.

Paul to the Corinthians

Brothers and sisters, rejoice. Mend your ways, encourage one another, agree with one another, live in peace, and the God of love and peace will be with you. Greet one another with a holy kiss. All the holy ones greet you. The grace of the Lord Jesus Christ and the love of God and the fellowship of the Holy Spirit be with all of you.

The word of the Lord. Thanks be to God.

Gospel A reading from the holy Gospel according to John

God so loved the world that he gave his only Son, so that everyone who believes in him might not perish but might have eternal life. For God did not send his Son into the world to condemn the world, but that the world might be saved through him. Whoever believes in him will not be con-demned, but whoever does not believe has already been condemned, because he has not believed in the name of the only Son of God.

The Gospel of the Lord. Praise to you, Lord Jesus Christ.

Focus: God is one and yet three—a Trinity of pure love.

Today’s feast is a celebration of God’s self-revelation to us through the mystery of the Incarnation. For it is in Christ that we come to know that within the Godhead there is a Trinity of three divine persons to whom belong all glory, praise, and honor, and from whom all life flows.

Liturgy of the Word: On Mount Sinai, Moses encounters

the God of Israel as the God of compassion and kindness. Saint Paul urges the Corinthians to live in fellowship and peace as brothers and sisters, children of the one God. In the Gospel, Jesus teaches that his mission is grounded in the total love of the Father for all of creation.

Mass Schedule for Weekend ~ June 13-14

Saturday (Vigil) Celebrant: Fr. Bonner

5:00pm Lector: Dale Tan

6:30am Celebrant: Fr. Bonner

Lector: Anne Corcoran

10:00am Celebrant: Fr. Lucas

Lector: Colleen Demusz

https://www.facebook.com/St-Cecilia-Church-Fox-Chase

If you feel uncomfortable visiting our church in person for Sunday Mass, we understand. However, it is still important to keep holy the Lord’s Day. We will continue to livestream Mass at 10:00am on Sundays.

Page 4: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

#179 4

Let us continue praying for . . . .

Those who are sick with the coronavirus and all their caregiv-ers, nurses, doctors, EMTs, scientists, essential workers, government officials, firefighters, law enforcement—especially our police officers, military, students, teachers, parents and those staying at home.

The Pope’s Monthly Intentions

The Way of the Heart

We pray that all those who suffer may find their way in

life, allowing themselves to be touched by the Heart of

Jesus.

Let us pray for the souls of all the faithful departed, especially

Wendy A. Feilke

Barbara Walters

Anna Thackray

Looking for a Job or Career Change? Ascension Press, an Exton based Catholic publishing and

media company has several positions available, such as

General Manager, Podcast Coordinator, and other future

opportunities. Ascension Press has been providing quality

Catholic faith formation resources to parishes, schools,

families and individuals since 1998. We are recognized by

Catholic leaders, educators and laity for our ground-

breaking and award-winning Catholic study programs. If

you would like to bring your talents and skills to our team,

please visit

https://study.ascensionpress.com/pages/about_us/careers

Let us especially pray for all that is happen-ing throughout our city and country

Lord God, crime is on the increase within our city and our

country.

From the depths of our hearts we pray that you will comfort,

heal, and bless all victims of crime.

We ask that you protect all people from the evil of crime and

violence.

We pray especially for life-changing conversion for all crim-

inals and the violent—

remove all evil from their hearts, fill them with your good-

ness and love that they may cease their evil works and that

our city and land be free from the scourge of crime and vio-

lence.

We pray also for the grace to purge ourselves of all vio-

lence—

in our own thoughts and actions,

in our family life,

in our friendships,

in relationships with others

Lord, I personally commit to refrain from violent acts or

words and to settle conflicts.

I further swear to teach others, especially our youth, that

violence is too quick an answer that produces irreparable,

life-long and threatening results.

Amen.

Arise: Restoring Our ‘In Person’ Encounter with

Christ in the Mass

This is a summary of the video by Fr. Eric Banecker, Parochial Vicar at St. Pius X Parish in Broomall and

printed in the Parish Bulletin with his permission.

Restoring Our “In Person” Encounter with Christ in the Mass

by Fr. Eric Banecker, Parochial Vicar, St. Pius X, Broomall (Summary)

I Corinthians 10:16-17

“Presiding at Mass is my favorite part of being a priest.” Every

week the pews are filled as we gather to worship the living God, believing that Jesus Christ is risen from the dead and truly pre-

sent to us in our midst in the Eucharist. It is a great pain for us, a necessary pain to protect the health and well being of others,

that we cannot gather as a community of faith. The Eucharist fulfills our spiritual desires to encounter Christ.

Fr. Banecker shares his profound experience of visiting Jerusa-

lem and walking in the footsteps of Jesus and his mother Mary on the road to Calvary and visiting the Church of the Holy Sep-

ulcher where the Passion, Death and Resurrection of our Lord

took place. The sad division of our Church is apparent in the separate Greek Orthodox and Roman Catholic altars on the

erected on Rock of Calvary. As he placed his hand in the ex-posed rock underneath the Greek Orthodox altar, the actual

spot where the Cross of Christ was placed, he heard these words, “This is the Chalice of my Blood, the Blood of the new

and eternal Covenant which will be poured out for you and

many,” recited by a priest celebrating Mass in Spanish a few feet away at the Roman Catholic altar.

Jesus’ death and Resurrection is not just some historical event.

It becomes reality for us again in the Mass. Jesus Christ is pre-sent to us again in the form and under the appearance of bread

and wine at every Mass celebrated around the world just as he was on Calvary 2000 years ago.

Many of us have taken advantage of the tools of technology and

online Masses for which we are grateful but let us never take for granted the experience of being physically present at Mass or

the experience of receiving Holy Communion. Let’s never take

the sacraments, our community of faith and the life of the Church for granted again. Let’s ask the Lord to restore in us a

great love and devotion for Jesus in the Eucharist and through that grace bring the mercy of Christ to the world through the

spiritual and corporal works of mercy that many people now and in the weeks and months ahead will need.

Page 5: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

#179 5

Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111

A Christ-Center Community Committed to Academic Excellence

Extra Curricular Activities

Student Council

Future Cities Team

Forensics

Mathletes

Altar Servers

Service Commission

School Band/Strings Program

CYO Sports

Scouting

Reading Olympics

Looking for a great school ~ Here we are!

Registration for Pre-K through grade 7 now being accepted

Academics

Religious Education

Archdiocesan Elementary Curriculum

Honors Math

Science Lab Program

Technology

Music Education

Physical Education/Health

Fine Arts

Special Services

CARES (after school program)

CORA (Educational & Counseling Services)

SHALOM Program

NDS Program (we offer FREE break-fast and lunch for students)

Catapult (Title 1 Reading, ELL, Family Counseling )

Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care

To register for 2020-2021,

please call the school’s main office at 215-725-8588.

For tuition information, please email Lisa Hnat at

[email protected]

Page 6: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

www.RENTAGRANDSON.org

Office: 215-606-3550cell: 215-990-6770

Ma GiesFounder

ma [email protected]

RENT A GRANDSON PROPERTY SERVICES

ROOFINGROOFINGSERVICING YOUR PARISH

FOR OVER 20 YEARSA+ Rating/BBB Cert. • 24/7 Emer. Svc.

Financing AvailableCall today for your FREE ESTIMATE

215215--726726--17701770www.libertyroofi ngpa.com

Archdiocesan Member

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly

payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

MASSES FOR THE WEEK OF June 8

MONDAY, June 8 6:30am – Vincenzo & Lucia DiSandro

8:30am – Margaret Lewis

TUESDAY, June 9 6:30am – Catherine Dowrick

8:30am – Edward Urewich

WEDNESDAY, June 10 6:30am – Pasquale & Rosina Liberatore

8:30am – Richard Findley

THURSDAY, June 11 6:30am – Joseph & Catherine Chenntski 8:30am – Dec’d members Mealey & Bocchicchio Families

FRIDAY, June 12 6:30am – Thanksgiving for Prayers Answered 8:30am – Bill Fischer

SATURDAY, June 13 8:30am – Harry Lemly

5:00pm – George R. Bronisz

Remember Our Sick and Suffering

Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Rita Kravitz Maki Turner Kirsten Hosack-Edling Helen Flood Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Linda Reinboth Gregory Farrell Ed MacNew Timothy Martin John Smykal Roseanne Gallagher Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Amanda Gleason Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Frank Basil Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Kathleen Hogan

Page 7: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Sweeney’sVerree Tavern

KITCHEN OPEN FROM 11 AM TO MIDNIGHT

The all new Kim’s Crab CakesPhilly’s Largest Wings

All Soups & Chili HomemadeTAKE OUT AVAILABLE

All Major Sporting Events With 6 Colored TV’s

Finest Tavern Food Now Available in our

New Private Dining Room

7968 VERREE RD.215–725-3366

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

Christenings, Weddings & Parties

ROCKLEDGE FIRE HOUSE505 HUNTINGDON PIKE

215-379-8373215-379-8373

Hall RentalsHall Rentals

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBS

CITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-

To all those essential workers keeping us safe, your

service is invaluable &

appreciated.

grte

& Logitrtststtsttttsttttt uctur

nformatioCommunity- Critical Man

ical al Services - Defens

e - Commercial Facis - Residential & Shelte

& Facilities - Hygiene Prod

yourmunity munity cal Mancal Ma

service is& Hazardou& Hazardou

invaluable &Commercial FaciCommercial Faci

appreciatedesidential & Shelte& Shelteies - Hygiene Prodies - Hygiene Prod

esrvic

overnmacturateteee

ivate & Public Healthcanforcement, Public Safe

ponders -lture - Energy Se

Waterwaste - Trans - Public WoCommunic

y

To all thoseivate & Publicivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

eepings - PublicuCommunCommun

s safe,chnologychnolog

Lacare - L- -- - - - --- - -- - afety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficecececececececececececececece

- Fooooooooooood & d &d &d &d &d &d &d &d &d & d &d & d & d & d & AAAAAAAAAAgrAAAAASector r rrrr rr rr rrrr r - Wa- Wa- Wa WW WaWaWa WaWaWa- Wa- WaWWasstes

ansportattattattatattattattattattattattattattattation ion ionion onon on onononon on ion on on & L&&&&&&Wooooooorks & - Infrffffffffff astststtsttstastastststtstststicatatatatatttttatattatattioionionionsionsionionionionionionioionsionion & I&&&&&&&&&& nf

y Workeorkerkekekekekekekeorkekeorkekekeorkers -rs -rs -rs -rs -rsrs -rs -rs -rs -rs rs -rs -rs -s - Coment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkers -

uring -g ----g ---g -g ---g -- CheCheCheCheCheheCheCheCheCheheCheCheChehemicteteteteteeeeeeeeeeerialrrrrrrr s FiFFiFiFiFFFiFiFiFFiFiFiFinancanaaanannanannancancaan ial

dustristristristristritrtritristristristristristristrtrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Basase asa -esssssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkekkkkkekerskekkkekekkk -

cesicescescescescescesicesicesicescesicesicescesces & F

e,gygy

thank

you

yg&&&& S&&&&& SS&& SS&& S& SS& SServierervvvivieerervivvrvvrrr ir iee ces - Private & Pu

tthcacattt aat aat aaacat at at ct re -re re -reree -erere -rerrerrerr LLLawLaLawLawLawLawawwLL wL wLaaLaawwLLaLLLLLLLLLL ww EnfEnfEEnfEnEnfnfEnfEnfnffEnfEEnfEnE fffEnfEnE orceorceorceorceorceorceorceoo cecorceo eorceeementmmmmmmmmm , Puy yyy -yyy -yyyy OffiOOOfOfOffOffiOOOOOOOOOOOO fifificcererccccccc s &&&&&&&&&&&&&& FirsFirsFiriiFirsirsirsiii t Ret Ret Rt RRRRRRRRRtt Rtt R sponsponsponpsppp ddddd

ygS

Local, trusted, proven, effective, supportive, referrrals, relationships, affordable, repetitous, versatile, lasting. This describes the power of...

ve, supuuuu portive, refefefefefefefferrrals, relationshipsppppppp ,,,, affordable, rererererepetitous, versatile, last

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my

name?” before entering their vehicle to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson#WHATSMYNAME

Page 8: Saint Cecilia Church · 6/7/2020  · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

THOMAS A. CUNNINGHAM, ESQ.Attorney At Law

AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE

109 Huntingdon Pike • Rockledge, PA 19046215-722-6230

Traveling Hair DresserServicing Men, Women & Children

Parishioner for 48 years

215-806-8187

Krissy Tamaro

Reichwein

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

Parishioner

We Care and It Shows

10400 Roosevelt Blvd., Philadelphia215-698-5600 • www.stnrehab.org

Physical, Occupational & Speech Th erapy • Short & Long Term Care • Dementia Unit (IMC) • Memory Care (SJN) • Adult Daycare (SJN)

We Acknowledge -We Appreciate

Occupational & Speech Th erapy • Short & Long Term Care • Dementia Unit (IMC) • Memory Care (SJN) • Adult DayBeautiful On-Site Chapel with Daily Mass Respite Stay Available

2990 Holme Ave., Philadelphia215-335-2100 • www.imrehab.org

Over “105 Years” in Real Estate SalesOver “105 Years” in Real Estate Sales4½% Sales Commission*Free Home Analysis*Multiple Listing Broker*No Sale Sign Required*No Franchise Fees*Free Notary Service

Contact JOE FASY 215-745-85007219 Rising Sun Avenue • Philadelphia, PA 19111

JOSEPH F.X. FASYBroker of Record

Serving Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

Independent LivingPersonal CareSkilled Nursing

Short-Term Rehabilitation9896 Bustleton Ave. • Philadelphia, PA • 215.934.3009 • www.paulsrun.org

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

A Heavenly Hair Salon215-379-1880

Angel Cuts

See You Soon!930 Fox Chase Road, Rockledge

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org