RNase L releases a small RNA from HCV RNA that refolds

into a potent PAMP

KRISHNAMURTHY MALATHI,1,4 TAKESHI SAITO,2 NANNETTE CROCHET,2 DAVID J. BARTON,3

MICHAEL GALE JR.,2 and ROBERT H. SILVERMAN1

1Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio 44195, USA2Department of Immunology, School of Medicine, University of Washington, Seattle, Washington 98195-7650, USA3Department of Microbiology, University of Colorado School of Medicine, Aurora, Colorado 80045, USA

ABSTRACT

Triggering and propagating an intracellular innate immune response is essential for control of viral infections. RNase L is a hostendoribonuclease and a pivotal component of innate immunity that cleaves viral and cellular RNA within single-stranded loopsreleasing small structured RNAs with 59-hydroxyl (59-OH) and 39-monophosphoryl (39-p) groups. In 2007, we reported that RNaseL cleaves self RNA to produce small RNAs that function as pathogen-associated molecular patterns (PAMPs). However, the precisesequence and structure of PAMP RNAs produced by RNase L is unknown. Here we used hepatitis C virus RNA as substrate tocharacterize RNase L mediated cleavage products [named suppressor of virus RNA (svRNA)] for their ability to activate RIG-I likereceptors (RLR). The NS5B region of HCV RNA was cleaved by RNase L to release an svRNA that bound to RIG-I, displacing itsrepressor domain and stimulating its ATPase activity while signaling to the IFN-b gene in intact cells. All three of these RIG-Ifunctions were dependent on the presence in svRNA of the 39-p. Furthermore, svRNA suppressed HCV replication in vitro througha mechanism involving IFN production and triggered a RIG-I-dependent hepatic innate immune response in mice. RNase L andOAS (required for its activation) were both expressed in hepatocytes from HCV-infected patients, raising the possibility that theOAS/RNase L pathway might suppress HCV replication in vivo. It is proposed that RNase L mediated cleavage of HCV RNAgenerates svRNA that activates RIG-I, thus propagating innate immune signaling to the IFN-b gene.

Keywords: 39-phosphate; Hepatitis C virus; RIG-I; RNase L; innate immunity

INTRODUCTION

Viral RNAs, often in the form of cytoplasmic 59-triphos-phorylated, double-stranded, or uridine and adenosine-richviral RNAs, are pathogen-associated molecular patterns(PAMPs) that trigger innate immunity through RIG-I-likereceptors (RLR), a familty of cytoplasmic pathogen recog-nition receptors (PRRs) (Horner and Gale 2009; Rehwinkeland Reis e Sousa 2010; Ting et al. 2010; Yoneyama and Fujita2010). These RNA PAMPs interact with either of two RLRs,RIG-I and MDA5, containing N-terminal caspase activationand recruitment domains (CARD) and C-terminal DExD/HBox RNA helicase motifs (Yoneyama et al. 2004; Kato et al.2005, 2006; Gitlin et al. 2006). Subsequently, RIG-I and

MDA5 interact with another CARD protein, IPS-1 (MAVS,VISA, Cardif), in the mitochondrial membrane (Kawai et al.2005; Meylan et al. 2005; Seth et al. 2005; Xu et al. 2005;Loo et al. 2006). IPS-1 then relays the signal to the kinases,IKKe and TBK1 that phosphorylate transcription factor IRF-3. Transcription factor NF-kB is simultaneously activatedthrough IPS-1. The homodimerized and phosphorylated IRF-3 relocalizes to the nucleus along with activated NF-kB andindependently or together activate different target genes, in-cluding the IFN-b gene.

The IFN response against RNA viruses is frequentlymediated by RNase L, part of a ribonucleolytic pathwaycontaining the PRR, 29-59-oligoadenylate synthetase (OAS)(Silverman 2007). Type I IFNs induce at the transcriptionallevel a group of OAS proteins that are activated by viraldsRNA PAMPs to produce 2-5A [px59A(29p59A)n; x = 1–3;n $ 2] from ATP (Hovanessian et al. 1977; Kerr and Brown1978; Hovanessian and Justesen 2007). OAS activators in-clude viral replicative intermediates, ds RNA genomes, an-nealed ss RNAs of opposite polarity and highly structuredss RNA. 2-5A is the ligand and activator of RNase L, a

4Present address: Department of Biological Sciences, University ofToledo, Toledo, OH 43606, USA.

Reprint requests to: Robert H. Silverman, Cleveland Clinic, 9500 EuclidAvenue, NB40, Cleveland, OH 44195, USA; e-mail: silverr@ccf.org; fax:(216) 445-6269.

Article published online ahead of print. Article and publication date areat http://www.rnajournal.org/cgi/doi/10.1261/rna.2244210.

2108 RNA (2010), 16:2108–2119. Published by Cold Spring Harbor Laboratory Press. Copyright � 2010 RNA Society.

ubiquitous enzyme in mammalian cells, including primaryhuman hepatocytes, that lies dormant until viral infectionsoccur (Zhou et al. 2005). Human RNase L is a 741 aminoacid polypeptide containing, from N- to C-termini, nineankyrin repeats, several protein kinase-like motifs, and theribonuclease domain (Hassel et al. 1993; Zhou et al. 1993).2-5A binds to ankyrin repeats 2 and 4 (Tanaka et al. 2004),causing catalytically inactive RNase L monomers to formactivated dimers with potent ribonuclease activity (Dongand Silverman 1995; Cole et al. 1996). Once activated, RNaseL cleaves single-stranded regions of viral and host RNAs,principally at UpAp and UpUp dinucleotides, leaving39-phosphoryl and 59-hydroxyl groups at the termini of theRNA cleavage products (Floyd-Smith et al. 1981; Wreschneret al. 1981). Interestingly, cleavage of cellular (self) RNA byRNase L results in the production of short RNAs thatactivate RNA helicases, RIG-I and MDA5, and the adapterIPS-1 resulting in activation of the IFN-b gene (Malathiet al. 2005, 2007). As a result, circulating levels of IFN-b

production were reduced several fold in Sendai virus- orencephalomyocarditis virus-infected RNase L�/� mice com-pared with infected wild-type mice. In addition, 2-5Atreatment of wild-type mice, but not of RNase L�/� mice,resulted in IFN-b production. However, the sequence andstructure of the small RNAs produced by RNase L, theirinteractions with RIG-I and/or MDA5, and their rolein mediating antiviral innate immunity have remainedlargely unexplored.

Hepatitis C virus (HCV), Hepacivirus genus of theFlaviviridae family, is a virus that has infected about fourmillion adults in the United States and is a major cause ofchronic hepatitis, liver cirrhosis, and hepatocellular carci-noma (Armstrong et al. 2006). During HCV infections, theviral PAMP that triggers type I IFN production is thepolyuridine tract (poly-U/UC) in the 39 nontranslatedregion of the viral genomic RNA (Saito et al. 2008). Poly-U/UC requires a 59-triphosphate to activate RIG-I in thecytoplasm of infected cells. Here we use HCV genomicRNA as a model substrate to characterize the requirementsfor RLR signaling by RNase L cleavage products. Ourfindings demonstrate a requirement for the 39-monophos-phate and complex features in the RNA cleavage productresponsible for potent PAMP activity.

RESULTS

Identification of HCV RNA cleavage productsthat bind RIG-I

Here we investigated whether RNase L processes HCV ge-nomic RNA into small RNAs with PAMP activity (designated‘‘suppressor of virus RNA’’ or svRNA). HCV RNA wasselected as a substrate because the RNase L cleavage siteshad been previously determined (Han et al. 2004), thus al-

lowing the termini of cleavage products to be preciselymapped. In addition, an M-fold secondary structure pre-diction of the entire HCV H77 genomic RNA (performed asin Palmenberg and Sgro 1997) was used to identify structuraldomains in the HCV genomic RNA. Based on both knownand predicted structural features in the HCV RNA, we selectedeight regions spanning the entire genome as substrates fordigestion by RNase L (Fig. 1A, lower). The eight HCV RNAsegments were generated by in vitro transcription, puri-fied, and cleaved by RNase L. RNA cleavage products<200 nucleotides (nt) in length were isolated, bound toflag tagged-RIG-I or -MDA5, and cloned (SupplementalFig. S1). Fifteen small RNAs with affinity for RIG-I werecloned, while no clones were obtained using MDA5 (Table1). It was apparent from the comparison of the clonedsequences with previously determined RNase L cleavagesites (Han et al. 2004) that all were partial clones of thesmall RNAs (Table 2).

Prior to investigating the small RNAs, we determinedwhether the uncleaved HCV RNA segments had PAMPactivity. The RNAs were individually transfected intohuman hepatoma Huh7 cells containing the human IFN-b promoter fused to firefly luciferase cDNA. As reportedpreviously (Saito et al. 2008), some of these RNA fragmentsinduced the IFN-b promoter, especially fragments 8703–9416 and 8703–9646 nt, which contains the poly-U/UCregion (9406–9547 nt) (Fig. 1A). In contrast, the smallRNAs generated using RNase L had little or no abilityto induce the IFN-b promoter, except for the small RNAsgenerated from fragments 8703–9416 and 8703–9646 nt(Fig. 1A). Remarkably, cleavage of the 8703–9416 nt frag-ment with RNase L caused a large increase in the ability toinduce the IFN-b promoter, whereas RNase L cleavage ofthe 39-extended fragment (8703–9646 nt) containing thepoly-U/UC region resulted in a modest increase in PAMPactivity (p < 0.0006 and p < 0.038, respectively). In con-trast, PAMP activity associated with poly-U/UC was de-stroyed by digestion with RNase L because of the sequencepreferences of RNase L for UU and UA dinucleotides insingle-stranded RNA (Fig. 1A, rightmost pair of columns).The RNA fragment (8703–9416 nt) that produced thehighest level of PAMP activity upon RNase L cleavageyielded three clones of RIG-I-bound RNAs: svRNA3,svRNA14, and svRNA15 (Tables 1, 2). SvRNA14 andsvRNA15 originated from an identical 82-nt fragment ofthe NS5B gene, but lacked significant structure with amaximum of four predicted consecutive base pairs (asdetermined using MFOLD) (Zuker 2003), and were notpursued further. In contrast, svRNA3 (9192–9281 nt alsofrom the NS5B gene) is a highly structured RNA, includ-ing a stretch of 11 consecutive base pairs. Cleavage ofHCV RNA by RNase L at nt 9191 (UA9191) and nt 9281(UU9281) releases a 90-base fragment of HCV RNAfrom the NS5B coding region that refolds into svRNA3(Fig. 1B).

HCV RNA cleavage product activates RIG-I

www.rnajournal.org 2109

SvRNA3 is formed from HCV genomic RNA throughthe action of RNase L in intact human hepatoma cells

To establish if svRNA3 could be demonstrated to form inintact cells, full-length genomic RNA or HCV RNAfragment 8703–9416 nt, both from HCV 1a, strain H77,were electroporated into Huh7.5 cells. After 24 h, trans-fection of flag-RNase L cDNA was performed to elevatelevels of RNase L followed by treatment with IFN-b toelevate OAS levels (Supplemental Fig. S2A). Production ofHCV core antigen was observed in cells containing full-length HCV RNA demonstrating translation and process-ing of the HCV polyprotein, (Supplemental Fig. S2B).Furthermore, RNase L activation was observed in flag-RNase L expressing cells as measured by the appearance inRNA chips of specific and characteristic rRNA cleavage

products when cells were treated with either 2-5A (activatorof RNase L) or poly(rI:rC) (activator of OAS) (Supple-mental Fig. S2C; Silverman et al. 1983). We observed thatsvRNA3 was generated from HCV RNA in the intact cellsupon activation of RNase L by 2-5A or poly(rI):(rC) asdetermined in Northern blots (Fig. 1C). Results show thatHCV RNA (either the full-length genomic RNA or frag-ment 8703–9416) is processed into svRNA3 when OAS andRNase L are present and active.

Activation of the RNA helicase, RIG-I, by svRNA3is dependent on its 39-p group

A method was devised for producing svRNA3 (59-OH/39-p) in which a precursor (with 59-p3 and a 39-extension ofUUA) was synthesized with T7 RNA polymerase (Fig. 2A).

FIGURE 1. Cleavage of HCV RNA by RNase L produces small RNAs with PAMP activity. (A) Activation of the IFN-b promoter after 18 h inHuh7 cells in response to transfection with undigested or RNase L-digested HCV RNA segments. (B) RNase L releases svRNA3 from two adjacentstem–loops in the NS5B region of the HCV open reading frame. (C) Detection of RNase L-mediated cleavage product of HCV RNA (svRNA3) inHuh7.5 cells at 96 h after electroporated with full-length HCV genomic RNA or a region of HCV RNA encoding svRNA3 (nt 8703–9416) asdetermined in a Northern blot (upper) (Materials and Methods). Small RNAs, <200 nt (10 mg), and 100 ng of svRNA3 were stained with gelstar(Cambrex Bio Science) (lower).

Malathi et al.

2110 RNA, Vol. 16, No. 11

The 59-p3 was removed with calf intestinal phosphatase(CIP), while the UUA sequence, and any possible aberrantextension of the 39-terminus (Cazenave and Uhlenbeck1994; Schlee et al. 2009), was removed by RNase L, whichalso generated a 39-p (Fig. 2B). In every instance, 59-p3/39-OH svRNA3 refers to the precursor, whereas 59-OH/39-p isthe mature RNase L product. In addition, to determine theminimal structural requirements in svRNA3 that contrib-ute to signaling, we also generated derivatives of svRNA3(59-p3 forms) [a complementary form (CsvRNA3), anisolated stem–loop (svRNA3 short), and deletion of the59, 39, or both overhangs (59-D svRNA3, 39-D svRNA3, and59-, 39-D svRNA3)] (Fig. 2C,–G). Activation of the ATPasefunction of RIG-I was obtained with poly-U/UC (59-p3/39-OH) and with svRNA3 (59-p3/39-OH or 59-OH/39-p),but not with the 59-OH/39-OH forms of these RNAs (Fig. 2H).Interestingly, the 59-OH/39-p and 59-p3/39-OH forms ofsvRNA3 were equally active in this assay. Weak activa-tion of RIG-I ATPase was also obtained with the 59- and39-deleted forms of svRNA3 (59-p3/3,-OH), but not withany of the other RNAs. The only RNA that activated theMDA5 ATPase, albeit modestly, was poly(rI):(rC) (Fig. 2H).

The 59-OH/39-p form of svRNA3 stimulated the IFN-b

promoter activity in Huh7 cells to 190% of the levelobtained with the 59-p3/39-OH form, whereas the 59-OH/39-OH form was inactive (Fig. 2I). The 59-p3/39-OH formof poly-U/UC stimulated the IFN-b promoter to 155% ofthe level obtained with 59-OH/39-p svRNA3. These findingsshow that a 39-p group on svRNA3 could effectivelysubstitute for a 59-p3 group to signal to the IFN-b gene.None of the other RNAs induced IFN-b promoter activity.These results suggest that 59- and 39-ss regions of svRNA3and both the upper and lower stems were required foroptimal RIG-I activation.

IFN-b induction was compared in wild-type (WT) andgene deficient mouse embryo fibroblasts (mef) treated withsvRNAs1, -2 (Supplemental Fig. S3), and svRNA3 (Fig. 2J)(all with 59-OH/39-p termini). While svRNA1, svRNA2, andsvRNA3 all required RIG-I and IPS-1 expression (but notMDA5) for IFN-b induction, svRNA3 was about 30-foldmore active. Furthermore, the 59-p3/39-OH and 59-OH/39-p versions of svRNA3 were equally potent PAMPs in WTmef (Fig. 2J).

Viral RNA PAMPs that signal through RIG-I induceconformational changes that displace the C-terminal re-pressor domain (RD) allowing interaction with the adapterprotein, IPS-1 (Saito et al. 2007). SvRNA3 with either59-p3/39-OH or with 59-OH/39-p formed a stable complexwith full-length RIG-I, but not with an N-terminal poly-peptide of RIG-I (Fig. 3A). Efficient displacement of theRIG-I RD was obtained with 59-p3-polyU/UC and either59-p3 or 39-p forms of svRNA3 (Fig. 3B). The dephos-phorylated forms of these RNAs lacked activity.

SvRNA3 induces a hepatic innate immune responsein mice

To study the effects of svRNA3 on hepatic innate immunityin vivo, WT or RIG-I-deficient mice were treated by hydro-dynamic tail vein injection with either svRNA3 (59-OH/39-p)or, as a positive control, poly-U/UC (59-p3/39-OH). Thisprocedure efficiently introduces the HCV RNA and itssubgenomic counterparts into the mouse hepatocytes, thusmodeling the viral RNA–host interactions of an acute HCVinfection (Saito et al. 2008). Both svRNA3 (59-OH/39-p)and the poly-U/UC (59-p3/39-OH) RNA were equallypotent in the RIG-I-dependent induction of IFN-b by 8 hin WT, but not in RIG-I-deficient mice, as determined by

TABLE 1. Sequences of partial HCV svRNA fragments bound to RIG-I

Name HCV sequence HCV nt Genomic region Clones isolated

svRNA1 acctccaccaga 2413–2424 p7(ion channel)/NS2 (cysteine protease) sixsvRNA2 acgctgggctttgg 4122–4135 NS3 (serine protease/RNA helicase) threesvRNA3 aaactcactccaatagcg 9204–9221 NS5B eightsvRNA4 gggtgtgcgcgcgacgaggaagacttccga

gcggtcgcaacctcgaggtagacgtcagcctatc473–536 C (core) one

svRNA5 ggcgccactggacg 1228–1241 E1 glycoprotein onesvRNA6 tgatcgctggtgctcactggggag 1381–1404 E1 glycoprotein twosvRNA7 ccggctggttag 1645–1656 E2 glycoprotein twosvRNA8 aggggtggaggttg 3403–3416 NS2/NS3 (serine protease/RNA helicase) onesvRNA9 acggcgtacgc 3429–3439 NS2/NS3 (serine protease/RNA helicase) onesvRNA10 acacgccgtgggcctat 3863–3879 NS2/NS3 (serine protease/RNA helicase) onesvRNA11 agcacctgggtgc 5313–5324 NS4A (serine protease cofactor)/NS4B

(membrane alterations)one

svRNA12 caggagatgggcg 7044–7056 NS5A (phosphoprotein) twosvRNA13 cctgtgcctccgcctcgg 7308–7325 NS5A (phosphoprotein)/NS5B (RdRP) onesvRNA14 accctacaaccccc 8761–8775 NS5B (RdRP) onesvRNA15 ctggctaggcaac 8822–8834 NS5B (RdRP) two

HCV RNA cleavage product activates RIG-I

www.rnajournal.org 2111

specific ELISAs performed on sera (Fig. 4A). By 24 h post-treatment circulating IFN-b levels returned to basal levels.A dramatic induction of ISG54 protein was observed in theliver after 8 h of treatment with svRNA3 or poly-U/UC inWT mice, but not in RIG-I-deficient mice (Fig. 4B) indic-ative of paracrine signaling of IFN-b. In addition, levelsof mRNAs for ISG56, IFN-b, and RIG-I were highly inducedat 8 h in WT, but not in RIG-I-deficient mice, and weredeclining by 24 h post-treatment with either svRNA3 orpoly-U/UC (Fig. 4C,–E).

SvRNA3 or 2-5A inhibits HCV replicationin Huh7 cells

To determine if svRNA3 could inhibit HCV replication invitro through a paracrine mechanism, conditioned mediafrom Huh7 cells transfected with svRNA3, CsvRNA3, orpoly-U/UC were added to Huh7.5 cells (harboring a de-fective form of RIG-I) (Sumpter et al. 2005) for 12 h priorto infection with HCV strain JFH-1 for 48 h (Wakita et al.

2005). Focus-forming unit (FFU) assays with anti-HCVantibody showed antiviral activity with poly-U/UC (59-p3/39-OH) and svRNA3 (59-p3/39-OH or 59-OH/39-p), but notwith the same RNAs containing 59-OH and 39-OH termini(Fig. 4F). The complement of svRNA3, CsvRNA3, was inac-tive in these assays, while IFN-b, included as a positivecontrol, inhibited HCV infection. In addition, direct ac-tivation of RNase L in Huh7 cells reduced HCV yields to33% 6 11 (p = 0.0091) of that obtained for the control in-fected cells as measured by FFU, even though these cells havea relatively low level of RNase L (Fig. 5). Presumably, theanti-HCV effect would be even greater in human hepato-cytes in vivo, which are known to express RNase L at higherlevels (Zhou et al. 2005). We therefore evaluated OAS1 andRNase L expression in human HCV patients via confocalmicroscopy analysis of immunostained liver sections. BothOAS1 and RNase L were abundant in HCV-infected hepa-tocytes from patients (Fig. 6). The merged images suggest,but do not prove, colocalization with the viral NS5A pro-tein. However, NS5A does mark intracellular sites of HCV

TABLE 2. Complete sequences of svRNAs

Name HCV nt Sequences

svRNA1 2395–2429 UGUCCACCGGCCUCAUCCACCUCCACCAGAACAUUsvRNA2 4112–4140 UGUUGCUGCAACGCUGGGCUUUGGUGCUUsvRNA3 9191–9281 AAGAACAAAGCUCAAACUCACUCCAAUAGCGGCCGCUGGCCGGCUGGACUUGUCCGGUUGGUUC

ACGGCUGGCUACAGCGGGGGAGACAUsvRNA4 472–536 UGGGUGUGCGCGCGACGAGGAAGACUUCCGAGCGGUCGCAACCUCGAGGUAGACGUCAGCCUAUCsvRNA5 1215–1257 ACCUUCUCUCCCAGGCGCCACUGGACGACGCAAGACUGCAAUsvRNA6 1280–1423 ACGGGUCAUCGCAUGGCAUGGGAUAUGAUGAUGAACUGGUCCCCUACGGCAGCGUUGGUGGUAG

CUCAGCUGCUCCGGAUCCCACAAGCCAUCAUGGACAUGAUCGCUGGUGCUCACUGGGGAGUCCUGGCGGGCAUAGCGU

svRNA7 1542–1755 GGUCUCCUUACACCAGGCGCCAAGCAGAACAUCCAACUGAUCAACACCAACGGCAGUUGGCACAUCAAUAGCACGGC

CUUGAAUUGCAAUGAAAGCCUUAACACCGGCUGGUUAGCAGGGCUCUUCUAUCAACACAAAUUCAACUCUUCAGGCUGUCCUGAGAGGUUGGCCAGCUGCCGACGCCUUACCGAUUUUGCCCAGGGCUGGGGUCCUA

svRNA8 3374–3470 GCUUGGGCCAGCCGACGGAAUGGUCUCCAAGGGGUGGAGGUUGCUGGCGCCCAUCACGGCGUACGCCCAGCAGACGAGAGGCCUCCUAGGGUGUAUA

svRNA9 3374–3470 GCUUGGGCCAGCCGACGGAAUGGUCUCCAAGGGGUGGAGGUUGCUGGCGCCCAUCACGGCGUACGCCCAGCAGACGAGAGGCCUCCUAGGGUGUAUA

svRNA10 3733–3912 ACCUGGUCACGAGGCACGCCGAUGUCAUUCCCGUGCGCCGGCGAGGUGAUAGCAGGGGUAGCCUGCUUUCGCCCCGGCCCAUUUCCUACUUGAAAGGCUCCUCGGGGGGUCCGCUGUUGUGCCCCGCGGGACACGCCGUGGGCCUAUUCAGGGCCGCGGUGUGCACCCGUGGAGUGGCU

svRNA11 5218–5399 ACAGACUGGGCGCUGUUCAGAAUGAAGUCACCCUGACGCACCCAAUCACCAAAUACAUCAUGACAUGCAUGUCGGCCGACCUGGAGAUCGUCACGAGCACCUGGGUGCUCGUUGGCGGCGUCCUGGCUGCUCUGGCCGCGUAUUGCCUGUCAACAGGCUGCGUGGUCAUAGUGGGCAGGATT

svRNA12 6984–7232 UGCACCGCCAACCAUGACUCCCCUGACGCCGAGCUCAUAGAGGCUAACCUCCUGUGGAGGCAGGAGAUGGGCGGCAACAUCACCAGGGUUGAGUCAGAGAACAAAGUGGUGAUUCUGGACUCCUUCGAUCCGCUUGUGGCAGAGGAGGAUGAGCGGGAGGUCUCCGUACCUGCAGAAAUUCUGCGGAAGUCUCGGAGAUUCGCCCGGGCCCUGCCCGUCUGGGCGCGGCCGGACUACAACCCCCCGCUA

svRNA13 7289–7361 CCACCUCCACGGUCCCCUCCUGUGCCUCCGCCUCGGAAAAAGCGUACGGUGGUCCUCACCGAAUCAACCCUA

svRNA14 8754–8837 CCCGUGACCCUACAACCCCCCUCGCGAGAGCCGCGUGGGAGACAGCAAGACACACUCCAGUCAAUUCCUGGCUAGGCAACAU

svRNA15 8754–8837 CCCGUGACCCUACAACCCCCCUCGCGAGAGCCGCGUGGGAGACAGCAAGACACACUCCAGUCAAUUCCUGGCUAGGCAACAU

Boldface indicates partial cloned svRNA sequences. SvRNA sequences as shown map to the nearest RNase L cleavage sites (Han et al. 2004).

Malathi et al.

2112 RNA, Vol. 16, No. 11

replication and was previously shown to be a bindingpartner of OAS1 (Taguchi et al. 2004; Wakita et al. 2005).

DISCUSSION

Our results define features in an RNase L-mediated RNAcleavage product necessary for RIG-I activation. The find-ing of a previously unrecognized role for a 39-p in RIG-Iactivation, effectively substituting for a 59-p3 group, is anovel paradigm for an RNA PAMP. The predicted struc-ture of svRNA3 includes a broken-stem–loop with 59 and39overhangs, both of which contribute to the activationof RIG-I. Surprisingly, the main double-stranded stem ofsvRNA3 (svRNA3 short) including a 39-p lacked PAMPactivity. Results indicate that in addition to 39-p a higherorder structure is necessary for recognition by and activationof RIG-I. For instance, we have observed that svRNA4(65 nt) bearing 39-p or 59-p3 did not stimulate RIG-I activity.

These findings suggest the following scenario for innateimmunity against HCV (Fig. 7). At early times of infection,

RIG-I detects and responds to the HCV PAMP, poly-U/UCin the HCV 39-UTR in concert with a 59-p3 group, leadingto activation of IRF3 and synthesis of type I IFN (Saito et al.2008). IFN-b induces tissue-wide transcriptional activationof OAS genes and viral dsRNA activates OAS to produce2-5A (Han and Barton 2002), which activates RNase L.Specifically, RNase L cleaves ss regions of HCV RNA onthe 39 side of UUp and UAp dinucleotides, including de-stroying the poly-U/UC PAMP (Fig. 1A). While it ispremature to conclude that svRNA will amplify innateimmune signaling against HCV, our data suggest this pos-sibility. However, in addition, the intracellular host innateimmune response is blunted by the action of different HCVproteins, including the NS3/4A protease complex thatcleaves IPS-1, the HCV core protein that binds STAT1,and NS5A protein that suppresses activation of PKR (forreview, see Horner and Gale 2009).

RNase L cleaves at sites throughout the HCV genomicRNA producing many small RNAs, but svRNA3 is by farthe most active PAMP that is released during this process.

FIGURE 2. Activation of RIG-I ATPase activity and IFN-b induction by svRNA3 and its derivatives. Predicted RNA secondary structure of (A)svRNA3 (59-p3/39-OH); (B) svRNA3 (59-OH/39-p); (C) CsvRNA3 (59-p3/39-OH), complement of svRNA3; (D) svRNA3 short (59-OH/39-OH or59-OH/39-p), the main stem–loop structure of svRNA3; (E) 59DsvRNA3 (59-p3/39-OH), svRNA3 deleted for the 59-ss overhang; (F) 39DsvRNA3(59-p3/39-OH), svRNA3 deleted for the 39-ss overhang; (G) 59 39DsvRNA3 (59-p3/39-OH), svRNA3 deleted for both the 39- and 59-ss overhangs.(H) Activation of RIG-I or MDA5 ATPase (20 min at 37°C) by the indicated RNAs. (I) Activation of the IFN-b promoter in Huh7 cells after 18 hby transfection of the indicated RNAs. ( J ) Induction of IFN-b by svRNA3 in mouse embryo fibroblasts (mef ). IFN-b levels in supernatants ofWT, RIG-I-deficient, MDA5-deficient, or IPS1-deficient mouse embryo fibroblasts 18 h after transfection with 30 pmol of svRNA3. IFN-b proteinlevels were measured by ELISA. RNA structures were as predicted by mfold software (Zuker 2003).

HCV RNA cleavage product activates RIG-I

www.rnajournal.org 2113

Remarkably, IFN sensitivity of HCV strains in vivo never-theless correlates with the number of potential RNase Lcleavage sites (Han et al. 2004). Accordingly, there are fewerpotential RNase L cleavage sites in IFN-resistant genotype1a and 1b compared to IFN-sensitive genotypes 2a, 2b, 3a,and 3b (Han and Barton 2002). Our new findings indicatethat an RNase L cleavage product of HCV RNA is ableto stimulate RIG-I signaling. SvRNA3, composed of RNAsequences from two adjacent stem–loop structures withinthe NS5B portion of the HCV open reading frame, refoldsinto a RIG-I activator after its release by RNase L (Fig. 1B).HCV1a RNA is cleaved efficiently by RNase L at UA9191,UU9281 UU9282, and UA9283 (Han et al. 2004), liberatingsvRNA3 with a 39 phosphoryl group (Fig. 1B). Importantly,RNA sequences and structures in this region of HCV RNAare phylogenetically conserved and they are required forHCV RNA replication (Tuplin et al. 2002, 2004; Lee et al.2004; You et al. 2004; Diviney et al. 2008). Single-strandedUA and UU dinucleotides are phylogenetically conserved atnt 9281–9283 in HCV genotypes 1, 2, 3, 4, 5, and 6(Diviney et al. 2008, Fig. 6A). The 9284UCACAGC9290

sequences immediately adjacent to these single-strandedUA and UU dinucleotides are invariant in HCV genotypes1–6 and they form a kissing interaction with complemen-tary sequences in the HCV 39 NTR (Diviney et al. 2008, Fig.8). The 9300GCCCG9304 sequences in the subsequent loopare also invariant in HCV genotypes 1–6 and are predictedto form a pseudoknot via base-pairing to 9108CGGGC9112

sequences upstream in the NS5B ORF (Diviney et al. 2008).The RNA sequences and structures in this region of HCVNS5B are well conserved across all six HCV genotypes.

Finally, because RNase L has a relatively broad antiviralactivity for many RNA viruses (Silverman 2007), chemicalfeatures of svRNA such as, but not limited to, the 39-pgroup, or methods that will activate RNase L in vivo maylead to broad-spectrum antiviral agents active against HCVand other important viral pathogens.

MATERIALS AND METHODS

Mice, cells, and virus

Rig-i�/� mice and mef and Ips1�/� mef were provided by S. Akira(Osaka, Japan) (Kato et al. 2005 ; Kumar et al. 2006) and Mda5�/�

mef were provided by M. Colonna and M. Diamond (St. Louis,Missouri) (Gitlin et al. 2006). Huh7 and Huh7.5 (T55I mutantRIG-I) (Sumpter et al. 2005) human hepatoma cells, and plasmidp90/HCV FL-long pU (AF009606) encoding a full-length HCVgenome, genotype 1a (strain H77), were kindly provided byC. Rice (Rockefeller University) (Blight et al. 2003). A clone ofHCV JFH-1 was provided by T. Wakita (Tokyo, Japan) (Wakitaet al. 2005). 293T and DU145 cells were obtained from AmericanType Culture Collection.

Synthesis and purification of HCV RNA

Subgenomic HCV RNA fragments were produced from T7promoter-linked PCR products generated from HCV H77 plas-mid. The HCV DNA was transcribed using the T7-Megascript kitaccording to the manufacturer’s protocol (Applied Biosystems).RNA was purified according to the protocol provided with theMegaclear kit (Applied Biosystems). As an alternative to in vitrosynthesis, some of the smaller RNAs (<50 nt) with either a 39-OHor a 39-p group were chemically synthesized at IDT, Inc. The pres-ence of 39-p group was confirmed by mass spectrophotometricanalysis.

Cleavage of HCV RNA by RNase L

HCV RNA (100 mg per reaction) was digested in vitro withpurified recombinant human RNase L (2 mg) (Dong et al. 1994)and unfractionated 2-5A (10 mM) prepared as described (Thakuret al. 2007). Control reactions were with RNase L in the absenceof 2-5A. Cleavage of the RNA was monitored in reactions thatincluded trace amounts (0.1 nM) of an RNA FRET probecontaining multiple cleavage sites for RNase L (Thakur et al.2007). Samples were taken from 0 to 60 min at 22°C to measurefluorescence as an indicator of RNase L activity. To generate smallRNAs with 39-p ends, the RNA were digested in vitro withpurified RNase L and crude 2-5A as above. Small RNAs lackingthe 39-p or 59-p3 were generated by incubating with 10 units CIP(NEB) for 1 h at 37°C and 10 min for 75°C. Removal of 59-p3 wasmonitored in a parallel reaction using 59-32P-end labeled svRNA3and CIP. Reactions were monitored up to 1 h until removal ofradiolabeled 32P from svRNA3 was complete as monitored ona 12% sequencing gel (Malathi et al. 2007). Small RNA cleavageproducts (<200 nt) were purified using a solid-phase fractionationmethod (mirVana miRNA Isolation Kit, Ambion). To confirmcomplete cleavage of svRNA3, trace amounts of dephosphorylated

FIGURE 3. SvRNA3 binds RIG-I causing the release of its repressordomain (RD). (A) RIG-I binding of svRNA3 with different termini (asshown) as determined by gel-shift analysis of full-length (FL) RIG-I orits N-terminal (N) polypeptide (1–228 amino acids). (B) Release ofRIG-I RD by partial trypsin digestion. The silver-stained gel imageshows trypsin digestion products of Flag-RIG-I incubated with 3, 6,15, or 30 pmol of the indicated RNA.

Malathi et al.

2114 RNA, Vol. 16, No. 11

svRNA3 and svRNA39-p were labeled at its 59-OH with [g32-P]-dATP and T4 polynucleotide kinase (NEB, MA) and separated on12% sequencing gels and subjected to autoradiography. RNAdigestions were also monitored by analysis on RNA chips (AgilentBioanalyzer). To map the RNase L cleavage site in svRNA3, theRNA product was converted to cDNA using ExactSTART SmallRNA Cloning Kit (EPICENTRE Biotechnologies) and sequenced.Briefly, the RNAs were tailed with polyA polymerase andconverted to cDNA using oligo-dT(12-18) and MMLV reversetranscriptase (Epicentre Biotechnologies) and sequenced.

Additional plasmids, reagents, and transfection

Plasmids pEF-TAK Flag-RIG-I, pEF-TAK Flag-MDA5, recombi-nant full-length (RIG-I) and N-RIG (encoding amino acids 1-228)were described previously (Saito et al. 2007, 2008). In vitro tran-scribed HCV RNA (1 mg) or svRNAs (30 pmol or as indicated)

were transfected using Lipofectamine 2000as per maufacturer’s protocol. Cells weretransfected with 5 mM 2-5A complexed withLipofectamine 2000 (Invitrogen) or poly(rI:rC)(1 mg/mL) complexed with Fugene 6 (Roche)as described previously (Malathi et al. 2007).For IFN-b promoter assays, Huh7 cells (2 3

105 per well in six-well plates) were tran-siently transfected with hIFN-b-luc (1 mg)encoding firefly luciferase cDNA under thecontrol of the human IFN-b promoter(Sumpter et al. 2005) and a Renilla lucif-erase control plasmid (pRL-TK) (0.1 mg).After 24 h, 1 mg HCV RNA segment, 30pmol of HCV svRNA3 or its derivatives,were complexed with lipofectamine 2000and transfected. Control cells were treatedwith lipofectamine 2000 only. After 18 h, sam-ples were subjected to dual luciferase assays(Promega).

Expression and purificationof Flag-RIG-I and Flag-MDA5

293T cells (4 3 106) were transfected usinglipofectamine 2000 (Invitrogen) with 10 mgof FLAG-tagged human RIG-I (pEF-BOSFlag-RIG-I) or human MDA5 (pEF-BOSFlag-MDA5) or vector alone. At 48 h post-transfection, cells were lysed and Flag-RIG-Ior Flag-MDA5 immunoprecipitated as de-scribed (Sumpter et al. 2005; Plumet et al.2007). To purify Flag-RIG-I or Flag-MDA5proteins, the immunoprecipitated beadswere incubated with 100 mg/mL of Flagpeptide in 50 mM Tris-HCl, pH 7.4, 150mM NaCl for 20 min at 25°C. The Flag-tagged proteins were concentrated usingMicrocon centrifugal devices with a 30-kDaMWCO (Millipore) and the purity of theprotein determined by SDS/polyacrylamidegel electrophoresis.

Cloning and sequencing of svRNAs

The small RNAs generated by RNase L-digestion of HCV RNA(pooled) (16 mg) were added to the immunoprecipitated Flag-RIG-I or Flag-MDA5 (1–2 mg) in 100 mL final volume. Themixtures were stirred for 4 h at 4°C, the complex was collected bya brief (30 sec) centrifugation at 2000 g. The beads were washedtwice in the same buffer (500 mL) containing 100 mM NaCl. Thebound RNAs were recovered after acid phenol extraction usingthe mirVana miRNA Isolation Kit (Ambion) and cloned using themiRCat-33 microRNA Cloning Kit Integrated DNA Technologies(IDT). The 39 cloning linkers were ligated to small RNA species inpreparation for cDNA synthesis and amplification. Reverse transcrip-tion of the linkered RNA species was followed by PCR amplificationand cloning of the PCR the amplicons using TOPO-TA Cloning kit(Invitrogen). Plasmid DNA was prepared and sequenced to identifythe HCV RNA fragments. Subsequently, the precise ends of the

FIGURE 4. HCV svRNA3 induces a hepatic innate immune response and suppresses HCVreplication by a paracrine mechanism. (A–E) Hydrodynamic tail vein injection of poly-U/UC(59-p3/39-OH) or svRNA3 (59-OH/39-p) in WT and Rig-I�/� mice (n = 3). (A) Induction ofcirculating IFN-b by poly-U/UC or svRNA3. (B) Hepatic induction of ISG54 protein asdetermined by immunohistochemistry (IHC) by poly-U/UC or svRNA3. (C–E) Hepaticinduction of Isg56, Ifnb, and Rig-i mRNAs by poly-U/UC or svRNA3 as determined by qRT-PCR. (F) Paracrine inhibition of HCV infections by poly-U/UC (59-p3/39-OH) or svRNA3 (59-OH/39-p). Huh7.5 cells (in triplicate) were treated for 12 h before HCV infection with mediumcontaining IFN-b or conditioned medium from Huh7 cells transfected with the indicatedRNAs. The graph shows the number of infected cells as determined by focus-forming unit(FFU) assay at 48 h after infection.

HCV RNA cleavage product activates RIG-I

www.rnajournal.org 2115

fragments were determined by comparing to the RNase L-mediatedcleavage sites in HCV H77 RNA (Han et al. 2004).

RIG-I binding and activation assays by gel-shiftanalysis and partial trypsin digestion

Complex formation between 10 pmol of purified N-RIG (RIG-Iamino acids 1–228, control) or full-length RIG-I (FL) and 6 pmolof indicated RNAs was determined by incubating for 15 min at37°C in binding buffer (20 mM Tris-HCl pH 8.0, 1.5 mM MgCl2,1.5 mM dithiothreitol), followed by electrophoresis on a 2%agarose gel and staining with Sybr Green II RNA Gel stain kit(Lonza) (Saito et al. 2008). The gel-shift was visualized using a UVilluminator (302 nm) with a Sybr Green detection filter. Effect ofRNA on RIG-I activation was determined by limited trypsin diges-tion of the RIG-I /RNA complex. The complex formed between15 pmol of purified RIG-I protein and increasing amounts (3, 6,15, or 30 pmol) of polyU/UC or svRNA3 containing the indicatedends was digested with trypsin for 15 min at 37°C. After inactiva-tion of trypsin, one-tenth of the reaction mix was separated on4%–15% gradient SDS polyacrylamide gel and silver-stained(Saito et al. 2008; Takahasi et al. 2008).

ATPase activation assays

ATPase assays were performed in helicase buffer (25 mM Tris-HCl, pH 7.4, 3 mM dithiothreitol) in the presence of 2 mM ATP,3 mM MgCl2 as described (Gee et al. 2008). The standardizedreactions contained 225-nM full-length Flag-RIG-I in a 20 mLreaction at 37°C typically ranging from 5 to 90 min. Reactionsamples were stopped by rapid dilution (20-fold) in acidicmalachite green solution (Cytoskeleton) supplemented with 10

mM EDTA and incubated for 15 min, and the absorbance wasdetermined at 650 nM.

Western blots

Expression of Flag-hRNase L (48 h post-transfection) and HCVcore protein (48 and 96 h post-electroporation) was determinedon immunoblots using anti-FLAG monoclonal antibody (Sigma-Aldrich) or mouse monoclonal anti-HCV core antibody (AffinityBioreagent, C7-50). Levels of expression of RNase L in Huh7,Huh7.5, and DU145 cells were determined on immunoblots using30 mg of total cell lysates probed with anti-hRNase L monoclonalantibody (Dong and Silverman 1995). All secondary antibodieswere purchased from Cell Signaling. Immunoreactive bands weredetected using ECL reagents (GE Healthcare).

Hydrodynamic tail vein injections of mice

Two hundred mg of poly-U/UC (59-p3/39-OH) or svRNA3 (59-OH/39-p) RNA in PBS (50 mL) were mixed with 40 mL oftransfection reagent (Altogen) and incubated 15–20 min at roomtemperature. A transfection enhancer reagent (10 mL) was added,vortexed gently, and incubated 10 min at room temperature. TwomL of 5% glucose was added and the solution was injected intothe tail vein (Saito et al. 2008).

Immunohistochemistry

Mouse livers fixed in 4% paraformaldehyde were sectioned andimmunostained using 1:1000 dilution of anti-mouse ISG54antibody (provided by Dr. G. Sen, Cleveland Clinic) by thehistology core at Cleveland Clinic. The sections were counter-stained with hematoxylin. Liver biopsies recovered from patientswith chronic hepatitis C virus infection (viral genotype 1b) wereprocessed for immunostaining using monoclonal antibody spe-cific to RNase L (Dong and Silverman 1995), OAS1 monoclonalantibody (a kind gift from Dr. Shawn Iadonato, Kineta, Inc.

FIGURE 5. Inhibition of HCV replication in response to 2-5Aactivation of RNase L. (A) RNase L levels in lysates (30 mg) ofDU145 prostate cancer cells and hepatoma cell lines Huh7 andHuh7.5 as determined in immunoblots (different exposures of thesame blot are shown). Blots were probed with monoclonal antibodyreactive to human RNase L (Dong and Silverman 1995) and com-pared to anti-b-actin as control. (B) Huh7 cells were either mocktransfected or transfected with 2-5A trimer (p359A29p59A29p59A)before or after HCV infection (JFH1 strain) for 8 h. Supernatantswere harvested at 48 h post-infection and titered for HCV by focus-forming assays.

FIGURE 6. Hepatic expression of HCV NS5A, OAS1, and RNase L inHCV-infected liver. Images show a 0.15 mm optical section of liverbiopsy specimen stained with Draq-5 to show nuclei (blue), andimmunostained with antibodies specific to NS5A (red) and (A) OAS1(green) or (B) RNase-L (green). The left panel of each set features themerged image showing sites of protein codistribution (yellow).Images represent a single patient and are representative of analysesfrom six different patients with chronic HCV infection (data notshown). 60X magnification.

Malathi et al.

2116 RNA, Vol. 16, No. 11

Seattle, WA), and polyclonal anti-NS5A (a gift from Dr. Jin Ye,University of Texas Southwestern Medical Center).

Quantitative RT-PCR analysis

Mouse liver RNA was extracted from tissue soaked in RNAlaterreagent (Ambion) using RNeasy kit (Qiagen). One-step quanti-tative RT-PCR was performed using Applied Biosystems TaqManUniversal PCR master mix containing gene-specific primers formouse Ifnb, rig-i, and isg56 and TaqMan probe (sequences shownin Supplemental Table S1). PCR was performed with an AppliedBiosystems 7500 instrument and all data were presented as relativeexpression units after normalization to Gapdh mRNA.

ELISAs

Murine IFN-b from WT, Rig-i�/� mice, and culture supernatantsderived from MEFs were measured by using ELISA kits purchasedfrom PBL Biomedical Laboratories.

Detection of svRNA3 in intact cells

Huh7.5 cells (1 3 107) were electroporated with 30 mg of in vitrotranscribed full-length HCV 1a RNA, RNA corresponding to nt8703–9416 or mock treated using 0.4-cm gap cuvette (0.22 kV,960 mF) and Gene Pulsar II from Bio-Rad. After 24 h, 8 mg ofplasmid Flag-hRNase L was transfected using Fugene 6 reagent asper manufacturer’s protocol. After 48 h (72 h post-electropora-tion), cells were treated with IFN-b (1000 IU/mL) and incubatedfor another 18 h. Poly(rI:rC) (1 mg/mL) or 5 mM of 2-5A wastransfected using Fugene6 or lipofectamine 2000 reagent, re-spectively, for 6 h. Cell lysates were prepared from aliquots ofsamples for immunodetection of Flag-hRNase L and HCV coreprotein. Total RNA was isolated using the TRIZOL reagent. Tomonitor RNase L cleavage of RNA, RNA (4 mg) was separated and

analyzed on RNA chips (Agilent BioAnalyzer) to monitor activa-tion of RNase L. Small RNAs (<200 nt) were purified usinga solid-phase fractionation method (mirVana miRNA IsolationKit, Ambion). Small RNA (150 mg) from different treatments and1 ng of svRNA3 (59-OH/39-p) was electrophoresed on 8% PAGE.The RNAs were transferred to BrightStar-Plus membrane (Ambion)and immobilized by UV cross-linking. Probe was synthesized usingmiRNA StarFire System corresponding to the sequence of svRNA3(59-gaaccaaccggacaagtccagccggccagcggccgctattggag-39) with [a-32P]-dATP (6000 Ci/mmol, Perkin Elmer). Hybridization was doneat 42°C in ULTRAhyb-Oligo Hybridization buffer (Ambion) for18 h. RNA samples (10 mg) and 100 ng of svRNA3 (59-OH/39-p)were stained with Gel Star Nucleic acid stain (Lonza) to compareloading of the samples.

Ethics statement

Liver biopsies were obtained with informed, written consent frompatients with chronic HCV infection with full approval from theUniversity of Washington Institutional Research Board (IRB) onHuman Subjects. Mouse experiments were conducted in accor-dance with guidelines set forth by the institutional Animal Careand Use Committee of the University of Washington.

SUPPLEMENTAL MATERIAL

Supplemental material can be found at http://www.rnajournal.org.

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health (NIH)grants 1RC1A1086041 and CA44059 and from the Mal and LeaBank Chair (to R.H.S.); Research Scholar Grant RSG-02-063-01-MBC from the American Cancer Society (to D.J.B.); and NIHgrants DA024563 and AI060389 (to M.G., T.S., and N.C.). Wethank Ann Palmenberg and Jean-Yves Sgro (Madison, WI) forproviding a secondary structure prediction of HCV H77 RNA. Wethank Babal Kant Jha (Cleveland) for preparing the RNase L and2-5A and Craig P. Chappell (Seattle) for expert advice andassistance in hydrodynamic tail vein injections of mice.

Received April 28, 2010; accepted August 5, 2010.

REFERENCES

Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL,Alter MJ. 2006. The prevalence of hepatitis C virus infection in theUnited States, 1999 through 2002. Ann Intern Med 144: 705–714.

Blight KJ, McKeating JA, Marcotrigiano J, Rice CM. 2003. Efficientreplication of hepatitis C virus genotype 1a RNAs in cell culture.J Virol 77: 3181–3190.

Cazenave C, Uhlenbeck OC. 1994. RNA template-directed RNAsynthesis by T7 RNA polymerase. Proc Natl Acad Sci 91: 6972–6976.

Cole JL, Carroll SS, Kuo LC. 1996. Stoichiometry of 29,59-oligoade-nylate-induced dimerization of ribonuclease L. A sedimentationequilibrium study. J Biol Chem 271: 3979–3981.

Diviney S, Tuplin A, Struthers M, Armstrong V, Elliott RM,Simmonds P, Evans DJ. 2008. A hepatitis C virus cis-actingreplication element forms a long-range RNA–RNA interactionwith upstream RNA sequences in NS5B. J Virol 82: 9008–9022.

FIGURE 7. Hypothetical temporal appearance and roles of thePAMPs, poly-U/UC, and svRNA3, in the innate immune responseagainst HCV infections. Active (A) and inactive (I) forms of OAS andRNase L are indicated.

HCV RNA cleavage product activates RIG-I

www.rnajournal.org 2117

Dong B, Silverman RH. 1995. 2-5A-dependent RNase moleculesdimerize during activation by 2-5A. J Biol Chem 270: 4133–4137.

Dong B, Xu L, Zhou A, Hassel BA, Lee X, Torrence PF, Silverman RH.1994. Intrinsic molecular activities of the interferon-induced 2-5A-dependent RNase. J Biol Chem 269: 14153–14158.

Floyd-Smith G, Slattery E, Lengyel P. 1981. Interferon action: RNAcleavage pattern of a (29-59)oligoadenylate–dependent endonucle-ase. Science 212: 1030–1032.

Gee P, Chua PK, Gevorkyan J, Klumpp K, Najera I, Swinney DC,Deval J. 2008. Essential role of the N-terminal domain in theregulation of RIG-I ATPase activity. J Biol Chem 283: 9488–9496.

Gitlin L, Barchet W, Gilfillan S, Cella M, Beutler B, Flavell RA,Diamond MS, Colonna M. 2006. Essential role of mda-5 in type IIFN responses to polyriboinosinic:polyribocytidylic acid andencephalomyocarditis picornavirus. Proc Natl Acad Sci 103:8459–8464.

Han JQ, Barton DJ. 2002. Activation and evasion of the antiviral 29-59oligoadenylate synthetase/ribonuclease L pathway by hepatitis Cvirus mRNA. RNA 8: 512–525.

Han JQ, Wroblewski G, Xu Z, Silverman RH, Barton DJ. 2004.Sensitivity of hepatitis C virus RNA to the antiviral enzymeribonuclease L is determined by a subset of efficient cleavage sites.J Interferon Cytokine Res 24: 664–676.

Hassel BA, Zhou A, Sotomayor C, Maran A, Silverman RH. 1993. Adominant negative mutant of 2-5A-dependent RNase suppressesantiproliferative and antiviral effects of interferon. EMBO J 12:3297–3304.

Horner SM, Gale M Jr. 2009. Intracellular innate immune cascadesand interferon defenses that control hepatitis C virus. J InterferonCytokine Res 29: 489–498.

Hovanessian AG, Justesen J. 2007. The human 29-59oligoadenylatesynthetase family: Unique interferon-inducible enzymes catalyzing29-59 instead of 39-59 phosphodiester bond formation. Biochimie89: 779–788.

Hovanessian AG, Brown RE, Kerr IM. 1977. Synthesis of lowmolecular weight inhibitor of protein synthesis with enzyme frominterferon-treated cells. Nature 268: 537–540.

Kato H, Sato S, Yoneyama M, Yamamoto M, Uematsu S, Matsui K,Tsujimura T, Takeda K, Fujita T, Takeuchi O, et al. 2005. Celltype-specific involvement of RIG-I in antiviral response. Immunity23: 19–28.

Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K,Uematsu S, Jung A, Kawai T, Ishii KJ, et al. 2006. Differential rolesof MDA5 and RIG-I helicases in the recognition of RNA viruses.Nature 441: 101–105.

Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ,Takeuchi O, Akira S. 2005. IPS-1, an adaptor triggering RIG-I-and Mda5-mediated type I interferon induction. Nat Immunol 6:981–988.

Kerr IM, Brown RE. 1978. pppA29p59A29p59A: An inhibitor ofprotein synthesis synthesized with an enzyme fraction frominterferon-treated cells. Proc Natl Acad Sci 75: 256–260.

Kumar H, Kawai T, Kato H, Sato S, Takahashi K, Coban C,Yamamoto M, Uematsu S, Ishii KJ, Takeuchi O, et al. 2006.Essential role of IPS-1 in innate immune responses against RNAviruses. J Exp Med 203: 1795–1803.

Lee H, Shin H, Wimmer E, Paul AV. 2004. cis-acting RNA signals inthe NS5B C-terminal coding sequence of the hepatitis C virusgenome. J Virol 78: 10865–10877.

Loo YM, Owen DM, Li K, Erickson AK, Johnson CL, Fish PM,Carney DS, Wang T, Ishida H, Yoneyama M, et al. 2006. Viraland therapeutic control of IFN-b promoter stimulator 1during hepatitis C virus infection. Proc Natl Acad Sci 103:6001–6006.

Malathi K, Paranjape JM, Bulanova E, Shim M, Guenther-JohnsonJM, Faber PW, Eling TE, Williams BR, Silverman RH. 2005. Atranscriptional signaling pathway in the IFN system mediated by

29-59-oligoadenylate activation of RNase L. Proc Natl Acad Sci 102:14533–14538.

Malathi K, Dong B, Gale M Jr, Silverman RH. 2007. Small self-RNAgenerated by RNase L amplifies antiviral innate immunity. Nature448: 816–819.

Meylan E, Curran J, Hofmann K, Moradpour D, Binder M,Bartenschlager R, Tschopp J. 2005. Cardif is an adaptor proteinin the RIG-I antiviral pathway and is targeted by hepatitis C virus.Nature 437: 1167–1172.

Palmenberg AC, Sgro, J. 1997. Topological organization of picorna-viral genomes: Statistical prediction of RNA structural signals.Seminars in Virology 8: 231–241.

Plumet S, Herschke F, Bourhis JM, Valentin H, Longhi S, Gerlier D.2007. Cytosolic 59-triphosphate ended viral leader transcript ofmeasles virus as activator of the RIG I-mediated interferon re-sponse. PLoS ONE 2: e279. doi: 10.1371/journal.pone.0000279.

Rehwinkel J, Reis e Sousa C. 2010. RIGorous detection: Exposing virusthrough RNA sensing. Science 327: 284–286.

Saito T, Hirai R, Loo YM, Owen D, Johnson CL, Sinha SC, Akira S,Fujita T, Gale M Jr. 2007. Regulation of innate antiviral defensesthrough a shared repressor domain in RIG-I and LGP2. Proc NatlAcad Sci 104: 582–587.

Saito T, Owen DM, Jiang F, Marcotrigiano J, Gale M Jr. 2008. Innateimmunity induced by composition-dependent RIG-I recognitionof hepatitis C virus RNA. Nature 454: 523–527.

Schlee M, Roth A, Hornung V, Hagmann CA, Wimmenauer V,Barchet W, Coch C, Janke M, Mihailovic A, Wardle G, et al. 2009.Recognition of 59 triphosphate by RIG-I helicase requires shortblunt double-stranded RNA as contained in panhandle of nega-tive-strand virus. Immunity 31: 25–34.

Seth RB, Sun L, Ea CK, Chen ZJ. 2005. Identification and character-ization of MAVS, a mitochondrial antiviral signaling protein thatactivates NF-kB and IRF 3. Cell 122: 669–682.

Silverman RH. 2007. Viral encounters with OAS and RNase L duringthe IFN antiviral response. J Virol 81: 12720–12729.

Silverman RH, Skehel JJ, James TC, Wreschner DH, Kerr IM. 1983.rRNA cleavage as an index of ppp(A29p)nA activity in interferon-treated encephalomyocarditis virus-infected cells. J Virol 46: 1051–1055.

Sumpter R Jr, Loo YM, Foy E, Li K, Yoneyama M, Fujita T, LemonSM, Gale M Jr. 2005. Regulating intracellular antiviral defense andpermissiveness to hepatitis C virus RNA replication through acellular RNA helicase, RIG-I. J Virol 79: 2689–2699.

Taguchi T, Nagano-Fujii M, Akutsu M, Kadoya H, Ohgimoto S,Ishido S, Hotta H. 2004. Hepatitis C virus NS5A protein interactswith 29,59-oligoadenylate synthetase and inhibits antiviral activityof IFN in an IFN sensitivity-determining region-independentmanner. J Gen Virol 85: 959–969.

Takahasi K, Yoneyama M, Nishihori T, Hirai R, Kumeta H, Narita R,Gale M Jr, Inagaki F, Fujita T. 2008. Nonself RNA-sensingmechanism of RIG-I helicase and activation of antiviral immuneresponses. Mol Cell 29: 428–440.

Tanaka N, Nakanishi M, Kusakabe Y, Goto Y, Kitade Y, NakamuraKT. 2004. Structural basis for recognition of 29,59-linked oligoad-enylates by human ribonuclease L. EMBO J 23: 3929–3938.

Thakur CS, Jha BK, Dong B, Das Gupta J, Silverman KM, Mao H,Sawai H, Nakamura AO, Banerjee AK, Gudkov A, et al. 2007.Small-molecule activators of RNase L with broad-spectrum anti-viral activity. Proc Natl Acad Sci 104: 9585–9590.

Ting JP, Duncan JA, Lei Y. 2010. How the noninflammasome NLRsfunction in the innate immune system. Science 327: 286–290.

Tuplin A, Wood J, Evans DJ, Patel AH, Simmonds P. 2002.Thermodynamic and phylogenetic prediction of RNA second-ary structures in the coding region of hepatitis C virus. RNA 8:824–841.

Tuplin A, Evans DJ, Simmonds P. 2004. Detailed mapping of RNAsecondary structures in core and NS5B-encoding region sequencesof hepatitis C virus by RNase cleavage and novel bioinformaticprediction methods. J Gen Virol 85: 3037–3047.

Malathi et al.

2118 RNA, Vol. 16, No. 11

Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z,Murthy K, Habermann A, Krausslich HG, Mizokami M, et al.2005. Production of infectious hepatitis C virus in tissue culturefrom a cloned viral genome. Nat Med 11: 791–796.

Wreschner DH, McCauley JW, Skehel JJ, Kerr IM. 1981. Interferonaction–sequence specificity of the ppp(A29p)nA-dependent ribo-nuclease. Nature 289: 414–417.

Xu LG, Wang YY, Han KJ, Li LY, Zhai Z, Shu HB. 2005. VISA is anadapter protein required for virus-triggered IFN-b signaling. MolCell 19: 727–740.

Yoneyama M, Fujita T. 2010. Recognition of viral nucleic acids ininnate immunity. Rev Med Virol 20: 4–22.

Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T,Miyagishi M, Taira K, Akira S, Fujita T. 2004. The RNA helicase

RIG-I has an essential function in double-stranded RNA-inducedinnate antiviral responses. Nat Immunol 5: 730–737.

You S, Stump DD, Branch AD, Rice CM. 2004. A cis-actingreplication element in the sequence encoding the NS5B RNA-dependent RNA polymerase is required for hepatitis C virus RNAreplication. J Virol 78: 1352–1366.

Zhou A, Hassel BA, Silverman RH. 1993. Expression cloning of 2-5A-dependent RNAase: a uniquely regulated mediator of interferonaction. Cell 72: 753–765.

Zhou A, Molinaro RJ, Malathi K, Silverman RH. 2005. Mapping ofthe human RNASEL promoter and expression in cancer andnormal cells. J Interferon Cytokine Res 25: 595–603.

Zuker M. 2003. Mfold web server for nucleic acid folding andhybridization prediction. Nucleic Acids Res 31: 3406–3415.

HCV RNA cleavage product activates RIG-I

www.rnajournal.org 2119