RESEARCH POSTER PRESENTATION DESIGN © 2012

www.PosterPresentations.com

End point PCR The primer pair LeptoF/LeptoR was designed according to the WSCB COI sequence available on GenBank (Accession N° JQ996145.2), using Beacon Designer 7.5 software (Table 2). First, the primers were tested on PCR assays carried out using as template genomic DNA from WCSB specimens from all four sites (A, B, C, D). The primer specificity was assessed using as putative negative controls the genomic DNA of the 5 above-mentioned insect control species, as well as stone pine DNA. The sensitivity of this PCR-based protocol was also evaluated, using as template (2 µl/25 µl reaction) different amounts of WCSB DNA (from 100 pg to 10 fg/µl). The presence of WCSB DNA inside its saliva was also verified by this PCR assay.

HRM analysis The primer pair LeptoRTF/LeptoRTR was also designed on a WCSB COI sequence (Accession N° JQ996145.2), expected to produce a shorter amplicon (171 bp), and to be used in Real Time PCR. Melting curves of PCR amplicons were obtained with temperatures ranging from 60°C to 95°C. Data acquisition was performed for every 0.2°C increase in temperature, with a 10 s step. Each sample was tested in three independent experiments, and analyzed by High-Resolution Melting (HRM) analysis software (Bio-Rad Laboratories, Inc.), which automatically clusters the samples according to their melting profiles and assigns a confidence score to each sample. The confidence level threshold for a sample to be included in a cluster was 99.5%. Amplicon specificity was evaluated on WCSB DNA as template, on DNA from the 5 control species, and from stone pine. Sensitivity was assessed by Real Time PCR, using as template (2 µl/25 µl reaction) different amounts of WCSB DNA (from 100 pg to 1 fg/µl), in presence or not of spiked stone pine DNA. As cycle threshold we referred to water (negative control), taking into account its 35 cycles above which amplification was not considered as reliable.

In planta assays Diagnostic trials were carried out using both WCSB specific primer pairs to detect traces of WCSB DNA in attacked stone pine seeds. PCR samples included the DNA extracted from seeds fed on by the WCSB during force-feeding sessions. As control DNA extracted from sound seeds was used. Moreover, DNA samples were also extracted from seeds externally contaminated with WCSB excrements.

The western conifer seed bug (WCSB) Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae) was accidentally introduced in Italy in 1999 then it spread to most of Europe within a decade (Figure 1). Known as a pest of coniferous tree seed orchards in North America, it may also play a role in stone pine conelet abortion and abscission for North American conifers [1]. For this reason it is also considered to be a major factor in the losses of stone pine (Pinus pinea L.) nut production in the Mediterranean region [2], however more research is needed regarding the WCSB impact on stone pine fructification in Europe, since all known WCSB diagnostic tools refer to North American conifers and may be ineffective on stone pine.

INTRODUCTION

Based on the assumption that WCSB DNA may be present in salivary residues inside attacked tissues, a PCR-based approach was set up having as a target the available WCSB COI nucleotid sequences. The WCSB molecular detection is essential to specifically ascertain the damage occurring on stone pine cones and seeds, and caused by this pest. This study would thus contribute to widen the spectrum of DNA barcoding applications in entomology. The aim of this study was to develop highly specific PCR-based methods for the sensitive detection of WCSB DNA, whose efficacy as a diagnostic on WCSB attacked stone pine seeds was here assessed as well.

An effective diagnostic tool is still needed to help assessing the role of the WCSB in the loss of stone pine nut production. Since some conelet mortality as well as loss of seed set can also be due to natural causes an effective diagnostic marker is necessary to discern the real percentage of fructification specifically damaged by the WCSB. Both primer pairs implemented during this study showed high specificity. In fact, only WCSB COI DNA was targeted by the primers, never interfering with other DNAs extracted from pine cone-associated insects. No interference occurred even when the DNA from P. prasina was used to test marker specificity (i.e. the species most closely related to the WCSB among those we used as controls, and occasionally observed feeding on pine cones during our field samplings). End Point PCR sensitivity of 100 fg/µl was enough to confirm our hypothesis that WCSB DNA could be detected inside the insect saliva. However, End Point PCR was not able to identify seed samples fed on by the WCSB. Even the higher sensitivity granted by the Real Time PCR (10 fg/µl) was not enough to unambiguously detect WCSB DNA into attacked seed samples. However, our markers granted the identification of all seed samples contaminated with WCSB excrements. Thus, the sensitivity of our DNA based markers may find other applications in identifying, surveying, and monitoring of the WCSB. For example, these diagnostic tools could be applied in seed storages to verify the presence of the WCSB by detecting small insect traces on harvest samples, thus assessing also its abundance. Moreover, this study showed for the first time how DNA barcoding knowledge can be useful in pest diagnostics, even when only insect excrements are available. Finally, our study revealed how HRMA can be a promising tool for detecting intraspecific differences among insect populations. In fact, our methodology may find applications in phylogenetics, allowing preliminary screening of DNA samples from different populations, even before sequencing.

RESULTS AND DISCUSSION

CONCLUSIONS

[1] Bates S. L., Strong W. B., Borden J. H., 2002b. Abortion and seed set in lodgepole and western white pine conelets following feeding by Leptoglossus occidentalis (Heteroptera: Coreidae). Environmental Entomology, 31: 1023-1029.[2] Bracalini M., Benedettelli S., Croci F., Terreni P., Tiberi R., Panzavolta P., 2013. Cone and Seed Pests of Pinus pinea: Assessment and Characterization of Damage. Journal of Economic Entomology, 106: 229-234.[3] Campbell B. C., Shea P. J., 1990. A simple technique for assessing feeding damage by Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae) on cones. The Canadian Entomologist, 122: 963-968. [4] Schowalter T. D., Sexton J. M., 1990. Effect of Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae) on seed development of Douglas-fir at different times during the growing season in western Oregon. Journal of Economic Entomology, 83: 1485-1486.[5] Bates S. L., Borden J. H., Kermode A. R., Bennet R. G., 2000. Impact of Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae) on Douglas-fir seed production. Journal of Economic Entomology, 93: 1444-1451.[6] Lait C. G., Bates S. L., Kermode A. R., Morrisette K. K., Borden J. H., 2001. Specific biochemical marker-based techniques for the identification of damage to Douglas-fir seed resulting from feeding by the western conifer seed bug, Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae). Insect Biochemistry and Molecular Biology, 31: 739-746[7] Lait C. G., Bates S. L., Morrissette K. K., Kermode A. R., Borden J. H., 2001. Biochemical assays for identifying seeds of lodgepole pine and other conifers, that were fed on by Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae). Canadian Journal of Botany, 79: 1349-1357.[8] Bates S. L., Lait C. G., Borden J. H., Kermode A. R., 2002. Measuring the impact of Leptoglossus occidentalis (Heteroptera: Coreidae) on seed production in lodgepole pine using an antibody-based assay. Journal of Economic Entomology, 95: 770-777.[9] Lait C. G., Miller D. R:, Bates S. L., Borden J. H., Kermode A. R., 2003. Biochemical assay detects feeding damage to loblolly pine seeds by the Leaffooted pine seed bug (Hemiptera: Coreidae). Journal of Entomological Science, 38: 644-653.[10] Madhusadhan V. V., Taylor G. S., Miles P. W., 1994. The detection of salivary enzymes of ohytophagous Hemiptera: a compilation of methods. Annals of Applied Biology, 124: 405-412.Ward R. D., Zemlak T. S., Innes B. H., Last P. R., Hebert, P. D. N., 2005. DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society B: Biological Sciences, 360: 1847-1857.

REFERENCES

  The primer pair LeptoF-LeptoR proved to be a specific molecular marker for WCSB DNA. Amplicons of the expected length (658 bp) were obtained only when WCSB DNA was used as template in PCR tests. In no case DNA from other species, from both stone pine and the five control insects, interfered with the primers (Figure 2). Concerning sensitivity, the theoretical threshold was verified to be as low as 100 fg/µl WCSB DNA (Figure 3). The presence of WCSB DNA in its saliva was confirmed by positive results in PCR reactions (Figure 4), although WSCB genomic DNA extracted from its saliva and used as template could not be observed on electrophoretic gel images. The primer pair LeptoRTF-LeptoRTR also proved to be a specific molecular marker for WCSB DNA, and no aspecific signals were obtained using the other five insect species and stone pine DNA. Real Time PCR resulted ten times more sensitive in amplifying WCSB DNA (threshold of 10 fg/µl) (data not shown). Moreover, sensitivity did not vary whether or not stone pine DNA was added as a spike to WCSB DNA. Furthermore, HRM analysis underlined some differences among WCSB DNA samples. More specifically, WCSB samples from all but one site (Site B) clustered during HRMA melting profiling (Figure 6). Sequencing verified these results, showing three SNPs differing among obtained clusters (data not shown).

CONTACTmatteo.bracalini@unifi.it

Department of Agri-Food Production and Environmental Sciences (DISPAA) University of Florence, Italy

Matteo Bracalini, Matteo Cerboneschi , Francesco Croci,Tiziana Panzavolta , Riziero Tiberi , Stefania Tegli

DNA based markers to characterize insect pest damage: diagnostic trials on Leptoglossus occidentalis (Hemiptera: Coreidae)

OBJECTIVES

MATERIAL AND METHODSSpecimens DNA from several WCSB specimens, as well as that from other control species, was extracted. WCSB adult specimens were collected in four areas as reported in Table 1. WCSB laboratory rearings were established to provide constant availability of specimens to be used during force feeding sessions. Five other insect species were used as negative control: Palomena prasina (L.) (Hemiptera, Pentatomidae, Pentatominae), Ernobius impressithorax Pic, Ernobius parens (Mulsant and Rey) (Coleoptera, Ptinidae, Ernobinae), Pissodes validirostris (Sahlberg) (Coleoptera, Curculionidae, Molytinae), and Dioryctria mendacella (Staudinger) (Lepidoptera, Pyralidae, Phycitinae).

Force feeding Stone pine seed samples (10 mg each) were supplied to WCSB adults, during force-feeding sessions in the laboratory. At the end of each session, seed samples were collected, distinguished in two categories (sound and pierced), and finally stored separately at –20°C. In addition, seed samples contaminated by WCSB excrements were also separately collected and stored. Molecular biology techniques Genomic DNA was obtained from insect and seed tissues using the Puregene® Solid Tissue protocol (Gentra Systems Inc., Minneapolis, Minn.). Hind femora and/or thorax were used to extract DNA from larger adult insects (WCSB, P. validirostris, P. prasina), while whole specimens were used for adults of Ernobius and D. mendacella. Liquid saliva was extracted from WCSB live specimens, using a parasympathomimetic drug [10]. PCR amplicons were purified from agarose gel using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel GmbH & Co, Düren, Germany), and cloned with InsTAclone® PCR Cloning Kit (Thermo Fisher Scientific, Inc.). Sequencing was performed by Eurofins MWG Biotech, Ebersberg, Germany.

Staining, radiographic and biochemichal techniques have been used to assess WCSB damage to seeds of North American conifers [3-5]. However, the specificity of these techniques is questionable. For instance, a polyclonal antibody raised against salivary glands extracted from the WCSB detects the presence of residual salivary proteins in attacked seeds of several American conifers [6-8], but it gave positive results also with seeds fed on by another hemipteran (Leptoglossus corculus Say) [9]. These techniques have never been tested on stone pine seeds, nor have found application for the stone pine in Europe yet. Hence, a specific diagnostic tool to assess WCSB damage on stone pine fructification is still to be implemented, in the efforts of monitoring this pest as well as evaluating future control programs.

Primer name Sequence (5’-3’) Amplicon Lenght (bp) Accession N°

LeptoF TACCCTTTACTTTATTTTTG658 JQ996145.2

LeptoR AAATAAATGCTGATATAAAATAGLeptoRTF AGAAGAAGTAGAAGTGCTGTAATACC

171 JQ996145.2LeptoRTR AGCCTCTGTTGATTTAGCCATT

Figure 1 – Adult of the Western Conifer Seed Bug (WCSB), Leptoglossus occidentalis Heidemann.

Sampling area Coordinates Region CountryA N 43°47'15", E 11°44'33" Tuscany ItalyB N 44°03'32", E 10°54'59" Tuscany ItalyC N 45°50'17", E 11°49'46" Veneto ItalyD N 47°33'30", E 21°38'22" Hajdú-Bihar Hungary

Figure 5 – Diagnostic test on Stone pine seeds using COI PCR primers. Lanes: R) Ruler; 1) Sound seed; 2) WCSB Attacked seed; 3) Seed contaminated by WCSB excrements; 4) WCSB DNA; 5) Water.

Figure 2 – Specificity test using COI PCR primers. Lanes: R) Ruler; 1) Sound stone pine seed; 2-6) control insect species; 7-10) WCSB from site A, B, C, D; 11) Water; 12) Laboratory reared WCSB.

End Point PCR failed to detect WCSB DNA in attacked seed samples (Figure 5). However, this protocol allowed to identify all seed samples which were contaminated with WCSB excrements. Similarly, Real Time PCR could not unequivocally detect WCSB DNA in attacked seed samples. In fact, DNA from both sound and WSCB attacked seeds gave amplification signals over the 35th cycle, though the sound seed showed a different melting temperature when compared with the other samples (Figure 7). This difference in melting temperatures needs to be more deeply investigated in order to definitely assess its diagnostic value. Once again, seeds stained with WCSB excrements showed enough WCSB DNA content to give significant and specific Real Time PCR signals (Figure 7).

Figure 3 – Sensitivity test on COI PCR primers, using as template (2 µl/25 µl reaction) different amounts/µl of WCSB DNA. Lanes: R) Ruler; 1) 100 pg; 2) 10 pg; 3) 1 pg; 4) 100 fg; 5) 10 fg; 6) Water.

Table 2 – Primers designed and used in this study.

Table 1 – Details of sampling areas for WCSB specimens.

1000 bp

500 bp

Figure 4 – WCSB DNA detected inside the insect’s liquid saliva. Lanes: R) Ruler; 1) WCSB saliva; 2) Water; 3) WCSB specimen.

Figure 6 – Difference plot obtained in HRM assay, performed in three replicates using the LeptoRTF/LeptoRTR primer pair on WCSB DNA samples from all sites. Green cluster: Site A, C, and D; red cluster: Site B. RFU: Relative Fluorescence Units.

Figure 7 – Melting temperature analysis performed using the LeptoRTF/LeptoRTR primer pair on genomic WCSB DNA (green curve) and seed samples: seed contaminated with WCSB excrements (red), seed fed upon by the WCSB (blue), sound seed (pink).

500 bp

1000 bp

500 bp

1000 bp