Proc. Natl. Acad. Sci. USAVol. 90, pp. 2925-2929, April 1993Biochemistry

Relaxase (Tral) of IncPa plasmid RP4 catalyzes a site-specificcleaving-joining reaction of single-stranded DNA

(bacterial conjugation/active-site tyrosine/sequence-specific recognition of single-stranded DNA/termination of transfer DNA replication)

WERNER PANSEGRAUt, WERNER SCHRODERt, AND ERICH LANKAt§tMax-Planck-Institut fur Molekulare Genetik, Abteilung Schuster, Ihnestrasse 73, D-1000 Berlin 33, Federal Republic of Germany; and tFreie UniversitatBerlin, Institut fur Biochemie, Fabeckstrasse 36a, D-1000 Berlin 33, Federal Republic of Germany

Communicated by F. William Studier, December 14, 1992

ABSTRACT Conjugative DNA transfer of the self-transmissible broad-host-range plasmid RP4 is initiated bystrand- and site-specific cleavage at the nick site (nic) of thetransfer origin (oriT). Cleavage results in covalent attachmentof the plasmid-encoded relaxase (TraI) to the 5'-terminal2'-deoxycytidine residue at nic. We demonstrate that Tyr22 isthe center of the catalytic site of TraI, mediating cleavage viaformation of a phosphodiester between the DNA 5' phosphoryland the aromatic hydroxyl group. The specificity of cleavageseen with form I oriT DNA was verified with short oligodeoxy-ribonucleotides embracing the nick region. The reaction re-quires TraI and Mg2+ but is independent of the relaxosomecomponent TraJ. Cleavage produces one oligonucleotide frag-ment with a free 3' hydroxyl, the other part forms a covalentTral-oligonucleotide adduct. Like nicking of form I oniT DNA,Tral-catalyzed oligonucleotide cleavage reaches an equilibriumwhen about 30% of the input Tral exists as a covalent protein-DNA complex. In the presence of two differently sized oligo-nucleotides, defined hybrid oligonucleotides are produced,demonstrating that TraI catalyzes recombination of two singlestrands at nic. This rmding shows that TraI possesses cleaving-joining activity resembling that of a type I topoisomerase.Reactions are dependent on the sequence of the 3'-terminal 6nucleotides adjacent to nic. Only certain base changes in a fewpositions are tolerated, whereas the sequence of the 5' terminalnucleotides apparently is irrelevant for recognition by Tral.The reactions described here further support the hypothesisthat DNA transfer via conjugation involves a roiling circle-likemechanism which generates the immigrant single strand whileDNA-bound TraI protein scans for the occurrence of a secondcleavage site at the donor-recipient interface.

Horizontal gene transfer by bacterial conjugation requires thegeneration of a defined DNA single strand by a rollingcircle-type mechanism of replication. Following relaxosomeformation, the key step in this process is site-specific hydro-lysis of a scissile phosphodiester bond at oriTby the relaxase,which becomes covalently attached to the 5' phosphoryl endofthe DNA (for review see ref. 1). Covalent adduct formationis thought to conserve the bond energy required for recircu-larization of the transferred strand by a site-specific recom-bination event at the nick site of oriT. Use of the IncPaplasmid RP4 as a model system for studying the molecularmechanisms of DNA processing during conjugation showedthat all genes required for relaxosome formation are clusteredadjacent to the intergenic oriT (2). During assembly of RP4relaxosomes, the proteins TraJ, TraI, and TraH interact atoriT in a cascade-like mechanism preparing the superhelicalplasmid for initiation of transfer DNA replication (2). Theapplication of purified components in vitro revealed that TraJis a specific oriT-binding protein (3) that directs the relaxase

(TraI) to nic. The role of TraH is to stabilize the initialcomplex of form I oriT DNA, TraJ, and TraI by specificprotein-protein interactions (2).We report on the mechanism of site- and strand-specific

cleavage at oriT as part of a study of components involved inthe initiation and termination processes of RP4-mediatedDNA transfer. The specific interaction of RP4 relaxase withdefined oligodeoxyribonucleotide substrates served to de-scribe (i) the cleavage and rejoining reaction, (ii) the nucle-otide specificity within the nick region, and (iii) the nature ofthe covalent bond between the DNA and the relaxase. To testthe hypothesis that termination of transfer DNA replicationoccurs by site-specific recombination between single-stranded oriT sites, we employed purified TraI of plasmidRP4 in an in vitro assay detecting strand exchange at nic.Consideration of analogous DNA sequences in a variety ofother DNA transfer systems, including the agrobacterial Tiplasmids, leads us to suggest that the mechanism describedhere is a widespread mode ofgene transmission between bothclosely and remotely related organisms.

MATERIALS AND METHODSProteins and DNA. TraI and TraIA3 were purified as

described (2). Oligodeoxyribonucleotides were labeled eitherat their 3' ends by using [a-32P]ddATP (3000 Ci/mmol; 1 Ci= 37 GBq) and terminal deoxynucleotidyltransferase (Am-ersham) or at their 5'-ends by using [y-32P]ATP (3000 Ci/mmol) and phage T4 polynucleotide kinase (4).

Cleavage and Site-Specific Recombination of Oligodeoxyri-bonucleotides by TraL Oligodeoxyribonucleotides (5 pmol)were incubated with Tral (4 ,ug, 50 pmol) in 20 ,ul ofTNM (20mM Tris HCl, pH 8.8/50 mM NaCl/5 mM MgCl2) for 3 hr at370C. When appropriate, the reaction was stopped by theaddition ofSDS (10 mg/ml) and proteinase K (100 ,Ag/ml) andincubation for an additional 30 min at 37°C. Products wereanalyzed in a 20% (wt/vol) polyacrylamide gel containing 8M urea. Reaction products were quantified by autoradiogra-phy of gels with the storage phosphor technology (5).

Sequencing the Active Site of TraL Preparation of radio-labeled substrate. Oligodeoxyribonucleotide (17-mer, 5'-TTCACCTATCCTGCCCG-3', 1 nmol) was labeled at the 3'end with [a-32P]dATP (3.3 pmol; 3000 Ci/mmol). [a-32P]-dATP was used instead of [a-32P]ddATP to avoid differentseparation properties of labeled and unlabeled oligonucle-otide-peptide adducts during HPLC. Due to the great molarexcess of oligonucleotide over the labeled nucleotide, themajority of radiolabeled oligonucleotides were 18-mers car-rying only one 3' [32P]dAMP. The labeled 18-mer was isolatedby preparative TLC using the United States BiochemicalSurePure system. To obtain an amount of oligonucleotidesuitable for preparative cleavage by TraI, unlabeled 18-mer

§To whom reprint requests should be addressed.

2925

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

2926 Biochemistry: Pansegrau et al.

5'-TTCACCTATCCTGCCCGA-3' was added in 200-fold ex-cess.Formation of covalent TraI-oligonucleotide adduct. One

hundred sixty nanomoles of the mixture of labeled andunlabeled 18-mer was incubated with 80 nmol of TraIA3 in 2ml TNM for 3 hr at 37°C. The reaction was stopped byaddition of SDS (10 mg/ml) and proteinase K (100 ,ug/ml),and incubation was continued for 1 hr. After lyophilization,the reaction mixture was dissolved in 0.5 ml of water. Aftercentrifugation for 15 min at 20,000 x g and 0WC, the super-natant was applied to a C18 reversed-phase column (4 x 250mm) equilibrated with 10 mM triethylammonium acetate (pH6.5). Peptides were eluted over a period of 3 hr at 0.8 ml/minwith a linear gradient of 6-30% acetonitrile in 10 mM trieth-ylammonium acetate (pH 6.5). Eluted peptides were detectedby A220. Fractions containing pepproK-d(pCCCGA*) wereidentified (i) by measuring radioactivity and (ii) by gelelectrophoresis. pepPrOK-d(pCCCGA*) was eluted at 18.5%acetonitrile (pepproK means a proteinase K-generated Tralpeptide with a few amino acid residues; an asterisk indicatesthe presence of a [32P]phosphoryl group). One and a halfnanomoles was obtained. The peak fraction (750 pmol) wasanalyzed on an Applied Biosystems model 473A sequencer(6).

RESULTSSite-Specific Cleavage of Oligonucleotides by TraL. Muta-

tions in the nick region of plasmid RP4 (Fig. 1) demonstratedthat several positions in the 8-bp stretch between the TraJbinding region and nic are crucial to Tral-mediated cleavage(7). This indicated that other nucleotides in addition to nicinteract with the relaxase. It is expected, therefore, thatrecognition of oriT sequences by Tral is not exclusivelymediated by the TraJ-oriT complex. It is also conceivable thatbinding of TraK in this region changes the local DNAtopology so that nic is exposed as a single strand for cleavageby Tral (8).To test the hypothesis of DNA single-strand cleavage,

short oligodeoxyribonucleotides spanning the nick regionwere synthesized and incubated with Tral. The reactionmixture was electrophoresed in a sequencing gel to separatethe reaction products (Fig. 2A). To visualize the cleavageproducts derived from both sides of nic, two oligonucleotideswere radioactively labeled at either the 5' or the 3' end. Theoligonucleotides indeed function as substrates for the relax-ase because, in addition to the input material, other definedbands were detected. According to our model, cleavage at nicresults in a free 3' hydroxyl end and a covalently attachedTraI at the 5' nucleotide (9). Reactions containing the 5'-labeled substrates yielded an oligonucleotide migrating as a

nic

TCGCGGGTGGGCCTACTTCA XTAT T CCGGCTGAGCGCCCACCCGGATGAAGT ATA AC G GGCCGAC

00

TraJ binding region

j I

nick region

FIG. 1. Organization of the relaxosome assembly region of theRP4 oriT. Arrows indicate the positions of inverted sequence re-

peats. Only the right half of a 19-bp inverted repeat is included.Deviations from the symmetry are marked by dots within arrows.

Larger dots above and below the sequence designate nucleotides thatare protected against attack by hydroxyl radicals in a TraJ-oriTcomplex (3). The size of the dots is proportional to the degree ofprotection. Nucleotides that were identified as important for recog-nition of oriT by Tral (7) are boxed. The extent of the nick region andthe TraJ-binding region is indicated by brackets. nic is representedby a wedge.

A

-18-mer= = _-~~~~17-mer. ....... ..... . _PePPOK-

- d(pCCCG)ddA-- 13-mer

a b c d e f5' 5' 5' 3' 3' 3' label- + + - + + Tral- - + - - + proteinase K

B

n 20ov

00vOz'o 10ia0.4)

10 20molar ratio 118-mer]/LTral]

FIG. 2. Site-specific cleavage of single-stranded oligonucleotidesby Tral. (A) Tral was incubated with oligonucleotides and reactionswere stopped and analyzed as described under Materials and Meth-ods. Presence or absence of Tral in the reactions is shown. Whereindicated, the cleavage reaction was followed by proteinase K diges-tion. Oligonucleotides were 32P-labeled at their 3' or 5' end. Positionsof bands corresponding to the input oligonucleotides [17-mer with5'-end label, d(p*TTCACCTATCCTGVCCCG), and 18-mer with3'-end label, d(TTCACCTATCCTGVCCCG)ddA*] and cleavageproducts [13-mer with 5'-end label, d(p*TTCACCTATCCTG), orpepproK-d(pCCCG)ddA* with 3'-end label] are indicated at right. (B)Tral was incubated with various amounts of 3'-end-labeled 18-mer asdescribed above. The reactions were stopped by SDS addition anddigested with proteinase K. The yield of Tral that could be capturedas covalent oligonucleotide adduct is expressed as percentage of theinput Tral.

13-mer, which is the expected size for cleavage at nic (Fig.2A, lanes b and c). The 3'-labeled counterparts can bevisualized only after treatment with proteinase K because, incontrast to the covalent TraI-oligonucleotide adduct [Tral-d(pCCCG)ddA*], which does not migrate into the gel (datanot shown), pepproK-d(pCCCG)ddA* does (Fig. 2A, lanes eand f). The electrophoretic mobility of the pentanucleotide isreduced by the remaining amino acid residues. Tral-mediatedcleavage of oligonucleotides depends on the presence ofMg2+ and has a pH optimum at 8.8 (data not shown). Thereaction is essentially indifferent to the concentration of Na+or K+. Only at >250 mM NaCl or KCl is cleavage efficiencyreduced significantly.The Covalent Tral-Oligonucleotide Adduct Exists in an

Equilibrium with Noncleaved Oligonucleotides. To find outwhether or not Tral-mediated oligonucleotide cleavage is areversible process, Tral was incubated with an excess oflabeled 18-mer at various molar ratios (Fig. 2B). Plotting theyield of Tral-oligonucleotide adduct against the molar ratio ofsubstrate and enzyme reveals that the reaction reaches anequilibrium when about 30% of the input TraI exists ascovalent Tral-oligonucleotide complex. A corresponding re-sult is obtained when the 18-mer is incubated with an excessof TraI and the yield of Tral-oligonucleotide adduct is relatedto the input oligonucleotide (data not shown). The latterresult indicates that incomplete cleavage is not due to a

Proc. Natl. Acad. Sci. USA 90 (1993)

n4)

Proc. Natl. Acad. Sci. USA 90 (1993) 2927

partially inactive Tral preparation but is a property of thereaction itself.A 6-nt Sequence Is the Core Region Required for the

TraI-Mediated Cleaving-Joining Reaction. To define the se-quence requirements for the cleaving-joining reaction, we

employed a set of synthetic 22-mer oligonucleotides contain-ing single base exchanges in the nick region. The functionalboundaries of the nick region were previously identified bytesting hydroxylamine mutants of oriT in vivo and in vitro (7).The mutant oligonucleotides contained preferentially trans-versions because these cannot be obtained by hydroxylaminemutagenesis (Fig. 3). An oligonucleotide in which the G at nic(GVC) is replaced by A is not cleaved. This result demon-strates the high specificity of the cleavage reaction andconfirms the data obtained with oriT mutant DNA describedpreviously (7). Essentially, 6 nt located upstream of nicappear to be critical for recognition by Tral, whereas down-stream of nic no base specificity could be found within thefirst 2 nt (Fig. 3).

Tral Catalyzes Site-Specific Recombination/Joining of Sin-gle-Stranded Oligodeoxyribonucleotides. oriT sites are subjectto site-specific recombination dependent on the presence oftransfer gene products (for review see ref. 1). To see whetherTral can join fragments cleaved from two distinguishablepartners, we modified our standard reaction by offering twooligonucleotides of different lengths (30- and 18-mer, Fig. 4).Either both or only one of the oligonucleotides was labeled atthe 3' end in order to define the origins of the hybrid products.Both of the expected hybrid oligonucleotides (26- and 22-mer)were generated, indicating that the cleaving-joining reactioncatalyzes site-specific recombination in vitro.TraI-d(pCCCG)ddA* Transfers Its DNA Moiety to a Pre-

formed nic 3' Terminus. To find out whether a preformed nic3' terminus can act as an acceptor of oligonucleotide frag-ments, 3'-end-labeled 30-mer was incubated with Tral in amodified recombination reaction. Following a preincubationstep, a 13-mer oligonucleotide covering the Tral recognitionregion but ending at the nic 3' terminus was added at variousmolar ratios (Fig. SA, lanes a-f). A 22-mer product demon-strates that the 13-mer participates in the recombinationreaction either by displacing the 5' end of the 30-mer com-plexed with Tral or by reaction with free TraI-d(pCCCGGC-TG)ddA*, which might exist under the conditions employed.Quantitative evaluation of the reaction partners (Fig. 5B)revealed that (i) even at moderate molar ratios of 13-mer to30-mer an efficient transfer of the 30-mer 3'-terminal part tothe 13-mer takes place and (ii) addition of the 13-mer de-creases the yield of Tral-oligonucleotide adduct by shiftingthe cleavage equilibrium to the joined-oligonucleotide form.

Tral recognition

C T A T C C T GvC CA 1.2 0.9 N.D. X 0.8 N.D. X 1.3 1.0C - 1.3 0.5 N.D. * * N.D. X *

G N.D. 1.2 0.1 X N.D. X X - 1.0 N.D.

T N.D. _ 0.3 - N.D. N.D. 0 1.1 1.0 N.D.

FIG. 3. Cleavage efficiencies of altered oligodeoxyribonucle-otides encompassing the nick region. Oligonucleotides labeled attheir 3' ends were incubated under standard conditions with Tral.Reactions were stopped by the addition of SDS and proteinase K.Products were quantified as described under Materials and Methodsand cleavage efficiencies were normalized to the unaltered oligonu-cleotide [22-mer, d(ACTTCACCTATCCTGVCCCGGC)ddA*]. Nu-cleotide exchanges in certain positions of the 22-mer are related tothe bases listed at left. X, no cleavage product was detectable (<0.02of the cleavage efficiency with the unaltered 22-mer); N.D., notdetermined. A bracket marks nucleotide positions that are importantfor recognition of the oligonucleotide by Tral. The cleavage site isindicated (V).

-30-mer- - 26-mer

- 22-mer

~4UI __ .- 18-mer

a b c d e- + + + + Tral+ + + + - Mg2++ + + - + 30-mer*- - - + - 29-mer+ + - + + 18-mer*- - + - - 17-mer

Bnic

30-m er18-mer

1[Tral, Mg2+26-mer

W ~~~~22-mer

FIG. 4. Site-specific recombination of oligonucleotides catalyzedby Tral. (A) Tral was incubated with the indicated oligonucleotides.After 2 hr, reactions were stopped by the addition of SDS andanalyzed electrophoretically. Presence or absence of Tral, Mg2+,and oligonucleotides in the reaction mixtures is indicated. Oligonu-cleotides that were 32P-labeled at their 3' ends are marked with anasterisk. The terms 17-mer and 23-mer refer to the correspondingunlabeled oligonucleotides. Positions of bands corresponding to theinput oligonucleotides [30-mer, d(GGGCCTACTTCACCTATCCTGVCCCGGCTG)ddA*, and 18-mer; see Fig. 2] and recombinationproducts (22-mer and 26-mer) are indicated at right. (B) Schematicrepresentation of the Tral-mediated recombination of oligonucleo-tides at nic.

Peptide Mapping of the Covalent Attachment Site of TraI tothe 5'-Terminal Nucleotide at the Cleavage Site. To locate thecenter of the catalytic site of Tral we analyzed oligonucleo-tide cleavage reaction products that were digested withtrypsin (Fig. 6A, lanes b-d), Glu-C (lanes e-g), Lys-C (lanesh-j), or proteinase K (lanes k-m) to generate small peptidessusceptible to separation in sequencing gels. Three of theproteases used (trypsin, Glu-C, and Lys-C) yielded peptide-oligonucleotide adducts with identical electrophoretic mobil-ity (Fig. 6A). Inspection of the amino acid sequence of Tralrevealed that Tyr22 would be located on peptides generatedby the three proteases, which have not only very similarmolecular weights but also identical charges (Fig. 6B). Sincethis situation is unique within the Tral sequence, we tenta-tively assigned the Tral active site to Tyr22. This assumptionwas supported by the finding that the Tyr22 -* Phe mutantTral protein is inactive in terms ofDNA cleavage and that theproteinase K-generated peptide-oligonucleotide adduct ofanother Tral mutant (Thr24 -> Ala) has an altered electro-phoretic mobility as compared to the wild-type peptide(unpublished work).

Peptide Sequencing of Oligonucleotide-Bound Tral RevealsTyr22 as the Site of Covalent Attachment. Preliminary sequenc-ing experiments using Tral peptides covalently attached tonicked oriT plasmid DNA indicated that the very N-terminalpart of the protein forms the phosphodiester linkage. Thisresult is in agreement with the finding that the smallest solubledeletion derivative of Tral truncated at the C terminus(TraIA3, 417 amino acids; ref. 10) is fully active in thecleaving-joining reaction with plasmid DNA as well as with

Biochemistry: Pansegrau et al.

2928 Biochemistry: Pansegrau et al.

A -~~~~~~~~18-mer_s_s_ _ _ 1 ~~~pep-_ ~~__ = g J ~~~d(PCCCG)ddA'

~--- -22-mer

a b c d e f g h i j k I mpepproK

--' - - - - -d(pCCCGGCTG)ddA*

a b c d e f g

~~~~~_ 1 3 m e r

B10-

E0

0 5 10molar ratio [1 3-mer]/[30-mer]

FIG. 5. Reaction of covalent Tral-oligonucleotide adduct with apreformed 3' terminus. (A) Tral (80 pmol) was incubated for 1 hrunder standard conditions with 3'-end-labeled 30-mer (16 pmol, seeFig. 4), followed by addition ofvarious amounts of unlabeled 13-mer,d(TTCACCTATCCTG). Incubation was continued for 2 hr beforethe reactions were stopped. Lanes: a, 4 pmol of 13-mer; b, 8 pmol;c, 16 pmol; d, 32 pmol; e, 80 pmol; f, 160 pmol; g, 13-mer omitted.Positions of the bands corresponding to the input oligonucleotide(30-mer) and the products of the transfer reaction (22-mer) and of thecleavage reaction are indicated at right. (B) Reaction products shownin A were quantified and the radioactivity found in each band wasplotted against the molar ratio of the input oligonucleotides. *,pepproK-d(pCCCGGCTG)ddA*; e, 30-mer; o, 22-mer.

- Tryp Glu-C Lys-C ProK

B 5 10 15 20 25 30

T T TT Y YTYMAIAVPMRSIKKSOFA,LV TDEPG ER....

Tryp vGlu-C U

i Ef3 @ l Lys-C 0

FIG. 6. Mapping of oligonucleotide-associated peptides by diges-tion of TraI-d(pCCCG)ddA* with specific proteases. (A) The 3'-end-labeled 18-mer oligonucleotide was incubated with Tral. Reactionswere terminated by addition ofproteases together with the respectivecompounds: trypsin, 10 mM CaCl2, 0.1% SDS; endoproteinaseGlu-C, 10 mM CaCl2, 0.1% SDS; endoproteinase Lys-C, 0.1% SDS;proteinase K, 1% SDS. Lanes: a, protease omitted; b-d, trypsin (50,100, and 200 ng/,l, respectively); e-g, endoproteinase Glu-C (20,200, and 2000 ng/,u); h-j, endoproteinase Lys-C (5, 10, and 20ng/,ul); k-m, proteinase K (10, 100, and 1000 ng/ml). Positions ofbands corresponding to the input 18-mer and to Tral peptidescovalently linked to d(pCCCG)ddA* are marked at right. (B) Cleav-age sites of various proteases are symbolized above and below theN-terminal amino acid sequence of Tral. Peptides containing theactive-site tyrosine (shaded box) are indicated by bars. Positions ofcharged amino acid residues are marked by 3 or E.

second-cleavage model of DNA transfer termination (1).However, another possible hypothesis, supported by thefinding that a preformed nic 3' terminus can function asacceptor for the TraI-catalyzed joining reaction (Fig. 5), is

oligonucleotides (data not shown). To demonstrate the site ofcovalent attachment directly, we isolated the proteinaseK-generated peptide-oligonucleotide adduct by preparativeHPLC. Since after reaction of Tral with oligonucleotide onlya minor fraction of the input protein can be found covalentlyattached to DNA (see above), we used TraIA3 to improve therelative abundance of the desired peptide-oligonucleotidecomplex. N-terminal sequencing of pepPrOK-d(pCCCGA*) re-vealed that following proteinase K treatment a tetrapeptidehaving the sequence Lys-Xaa-Ile-Thr, corresponding to aminoacids 21-24 of Tral, remained covalently attached to thepentanucleotide (Fig. 7). In the second degradation cycle (Fig.7III) no significant signal was found. This position corre-sponds to Tyr22, which apparently constitutes the linkagebetween Tral and the DNA and therefore escapes detection.

DISCUSSIONModels for the mechanism of conjugative DNA transfer arebased on the rolling-circle mode of DNA replication mainlybecause a DNA single strand is transferred unidirectionallyfrom donor to recipient cells (11). We present evidence thatthe RP4 relaxase catalyzes functions required for initiationand termination of rolling-circle replication. The 5' phospho-ryl terminus of the strand destined to be transferred iscovalently attached to Tyr22 ofTral. During transmission, thestrand being transferred is constantly scanned for the recon-stituted nick-region sequence. A transesterification occurswhen the sequence is recognized by TraI to yield a closedcircular DNA molecule (Fig. 8A). Our results agree with the

D E0.06

0.06o l E

0.04 tI iJ

4 8 12 16 20 2428< e.-AI

0.3

0.2

0.1 T

0 1 a,.4 8 12 16 20 24 28

retention time [min]

0.3

0.2A

0.1

0 . JI.L4 8 12 16 20 24 28

0.3-

0.2-

A0.1

4 8 12 16 20 24 28

FIG. 7. HPLC traces from N-terminal sequence analysis ofproteinase K-generated Tral peptide covalently attached to oligo-nucleotide. pepproK-d(pCCCGA*) (750 pmol) was isolated by HPLCand sequenced. Phenylthiohydantoin amino acid derivatives weredetected by measuring the absorbance at 220 nm. (I) Standardmixture of phenylthiohydantoin amino acid derivatives (60 pmoleach); the peak labeled with A was assigned to diphenylthiourea, aside product that usually forms during Edman degradation. (II-VI)Cycles 1-5 of Edman degradation of peppr0K-d(pCCCGA*). III-VIare difference plots that were obtained by subtracting the trace of thepreceding cycle from the actual trace. Assignments of the phenyl-thiohydantoin derivatives yielding the sequence Lys-Xaa-Ile-Thr(KXIT) are indicated.

IMIWINW '-W .W-11,-,,. -,.. "F.".

Proc. Natl. Acad. Sci. USA 90 (1993)

-30-mer

5

Proc. Natl. Acad. Sci. USA 90 (1993) 2929

A Tral

-_L/f \~~_1 9-bp inverted

T_recognition/

5' a srong interactio

FIG. 8. Alternative models for termination of transfer DNA

replication by transesterification reactions.

that a unit-length transfer strand is transmitted without

extension at the 3' hydroxyl end (Fig. 8B). This mechanism

would require a priming reaction on the retained strand to

restore the double-stranded plasmid in the donor cell.

Apparently, cleavage and rejoining of oligonucleotides in

vitro are dependent on the presence of a 6-nt sequence. Yet,

even within this short sequence, some base exchanges are

allowed without loss of activity. Since nucleotide sequences

which would fulfill the requirements for in vitro cleavage and

rejoining are present several times on RP4, further signals

that increase the specificity of the termination reaction must

exist. A possible candidate for this function is the 19-bp

inverted repeat sequence adjacent to the nick region, only the

right half of which is needed for relaxosome formation. The

hairpin structure that might form on single-stranded DNAcould function as a pausing signal for DNA transfer, enabling

Tral to execute the recircularization reaction.

Recently, sequence comparison studies with the IncP nick

region revealed a striking nucleotide sequence similarity tothe nick regions of several other transmissible plasmids,including the border sequences of agrobacterial Ti and Ri

plasmids (7, 12). Our experiments testing oligonucleotides

containing single base exchanges (Fig. 3) suggest that all the

nick and border regions listed in ref. 12 might function assubstrates in the single-stranded-DNA cleaving-joining re-

action catalyzed by RP4 TraI. Preliminary experiments usingpurified VirD2 protein have indeed demonstrated that similar

cleaving-joining reactions can be performed on syntheticoligonucleotides containing the lower strand of Ti bordersequences, as well as on RP4 nick-region oligonucleotides(W.P., F. Schoumacher, B. Hohn, and E.L., unpublishedwork). These results are paralleled by the finding that cognaterelaxases share conserved sequence motifs possibly involvedin specific recognition of single-stranded DNA or in thecatalytic activity of the enzymes (ref. 12; W.P. and E.L.,unpublished work). Sequence similarities found in variousrelaxases as well as in their target sequences strongly suggestthat many different DNA transfer systems have evolved froma common ancestor and that therefore the mechanistic detailsdiscussed here are generally applicable. The finding that theactive-site Tyr22 of RP4 Tral corresponds to Tyr29 of pTiA6VirD2, the presence of which was shown to be essential forin vivo nicking of border sequences (13), confirms the hy-pothesis that bacterial conjugation and T-DNA transfer toplants are analogous processes.

We are grateful to Heinz Schuster for generous support andstimulating discussions. We appreciate the constructive commentsand critical reading of the manuscript by Ellen L. Zechner. This workwas financially supported by Sonderforschungsbereich Grant344/B2 of the Deutsche Forschungsgemeinschaft to E.L.

1. Wilkins, B. & Lanka, E. (1993) in Bacterial Conjugation, ed.Clewell, D. B. (Plenum, New York), pp. 105-136.

2. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R. & Lanka, E.(1990) Proc. Natl. Acad. Sci. USA 87, 6555-6559.

3. Ziegelin, G., Furste, J. P. & Lanka, E. (1989) J. Biol. Chem.264, 11989-11994.

4. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) MolecularCloning: A Laboratory Manual (Cold Spring Harbor Lab.,Plainview, NY).

5. Johnston, R. F., Pickett, S. C. & Barker, D. L. (1990) Elec-trophoresis 11, 355-360.

6. Hewick, R. M., Hunkapiller, M. W., Hood, L. E. & Dreyer,W. J. (1981) J. Biol. Chem. 256, 7990-7997.

7. Waters, V. L., Hirata, K. H., Pansegrau, W., Lanka, E. &Guiney, D. G. (1991) Proc. Natl. Acad. Sci. USA 88, 1456-1460.

8. Ziegelin, G., Pansegrau, W., Lurz, R. & Lanka, E. (1992) J.Biol. Chem. 267, 17279-17286.

9. Pansegrau, W., Ziegelin, G. & Lanka, E. (1990) J. Biol. Chem.265, 10635-10644.

10. Furste, J. P., Pansegrau, W., Ziegelin, G., Kroger, M. &Lanka, E. (1989) Proc. Natl. Acad. Sci. USA 86, 1771-1775.

11. Ohki, M. & Tomizawa, J.-I. (1968) Cold Spring Harbor Symp.Quant. Biol. 33, 651-658.

12. Pansegrau, W. & Lanka, E. (1991) Nucleic Acids Res. 19, 3455.13. Vogel, A. M. & Das, A. (1992) J. Bacteriol. 174, 303-308.

Biochemistry: Pansegrau et al.