ww.sciencedirect.com

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 4

Available online at w

journal homepage: www.elsevier .com/locate/he

Relationship between PHA and hydrogen metabolismin the purple sulfur phototrophic bacterium Thiocapsaroseopersicina BBS

Andras Fulop a, Rita Beres a, Roland Tengolics a, Gabor Rakhely a,b,*, Kornel L. Kovacs a,b

aDepartment of Biotechnology, University of Szeged, Kozep Fasor 52, Szeged 6726, Hungaryb Institute of Biophysics, Biological Research Center, Hungarian Academy of Sciences, Temesvari krt 62, Szeged 6726, Hungary

a r t i c l e i n f o

Article history:

Received 27 September 2011

Received in revised form

30 November 2011

Accepted 3 December 2011

Available online 29 December 2011

Keywords:

Hydrogen

Polyhydroxy alkanoates

Nitrogenase

Thiocapsa roseopersicina

Metabolic versatility

Purple sulfur bacteria

* Corresponding author. Department of Biotefax: þ36 62 544352.

E-mail address: rakhely@brc.hu (G. Rakh0360-3199/$ e see front matter Copyright ªdoi:10.1016/j.ijhydene.2011.12.019

a b s t r a c t

Purple sulfur phototrophic bacteria accumulate various storage materials, such as sulfur

globules, glycogen or polyhydroxy alkanoates (PHAs) under appropriate conditions. The

formation of these materials requires reducing power which might be recovered upon their

breakdown. This work aims at the understanding of the metabolism of PHA and its link to

the nitrogenase mediated in vivo H2 evolution in Thiocapsa roseopersicina BBS. The strain

could accumulate 30% of the dry cell weight in the form of PHAs. Analysis of the genome

sequence revealed the loci involved in PHAs synthesis and degradation. Phylogenetic

analysis indicated independent evolution of the anabolic and catabolic proteins. A mutant

carrying deleted PHA biosynthesis genes has been created in a host containing nitrogenase

but none of the hydrogenases. Determination of the H2 evolving capacity of the mutant

revealed significantly reduced H2 production in PHA deficient cells. Addition of excess

electron sources such as thiosulfate stimulated the H2 production via multiple effects.

Copyright ª 2011, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights

reserved.

1. Introduction metabolic processes, the quinone pool, NADH or directly from

Hydrogen is aneconomically soundenergy carrierwhichcanbe

produced by various biological pathways [1]. Hydrogenases are

the dedicated enzymes for hydrogen metabolism; they can

produce or oxidize H2. Nitrogenases can also produce substan-

tial amountofH2as thebyproduct ofnitrogenfixationand these

are practically unidirectional enzymes. In purple sulfur photo-

trophic bacteria, both enzyme systems can be involved in bio-

hydrogen evolution while in the case of non-sulfur phototophs

no H2 evolving hydrogenase has been identified so far.

H2 formation involving either enzyme systems requires

excess electrons, which may derive from the central

chnology, University of S

ely).2011, Hydrogen Energy P

the oxidation of organic/inorganic compounds, such as

formate or reduced sulfur compounds [1]. Most microorgan-

isms utilize reducing power also for the accumulation of

various storage materials, i.e. glycogen, PHA or globules of

elementary sulfur [2]. Accumulation of such excess materials

constitutes a widespread strategy, which enables the adap-

tation of microorganisms to the changing environment and

substrate fluctuations. The capability to conserve energy and

carbon source endows the microbes with a selective advan-

tage under nutrient limitations over those lacking this capa-

bility. The production of the storage materials competes for

the electrons with the H2 evolving enzymes, but upon their

zeged, Kozep fasor 52, Szeged 6726, Hungary. Tel.: þ36 62 546940;

ublications, LLC. Published by Elsevier Ltd. All rights reserved.

i n t e rn a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 44916

consumption electrons can be provided for the hydrogenases

and/or nitrogenases.

PHAs are linear polyesters, which are synthesized in large

quantities when there is plenty of carbon supply in the envi-

ronment but cell proliferation is limited by the availability

of important nutrients such as phosphorus, nitrogen or

sulfur [3]. In Rhodospirillum rubrum, Rhodobacter sphaeroides

and Rhodopseudomonas palustris the switch between the PHB

accumulation and hydrogen production is mediated by the

S-nutrients availability in the growing medium [4]. The prop-

erties of PHAs vary with the producing microbial strain. The

PHAs are ideal reserve materials because they are insoluble in

water, chemically and osmotically inert and can be readily

decomposed to acetate by a series of enzymatic reactions. The

polymers have been classified according to the carbon atom

number of the 3-hydroxyalkanoate units: short chain length

PHAs (PHASCL) contain 3e5 carbon atoms/monomer while

medium chain length PHAs (PHAMCL) are made of 6e15 carbon

atoms/monomer [2].

Although, polyesters are made of more than 150 various

monomermoleculesareknown, themost typicalmonomerunit

is 3-hydroxybutyrate [3]. The ability to produce poly(3-

hydroxybutyrate) (PHB) is common in many bacteria, however

copolymers with other alkanoates, such as 3-hydroxyvalerate,

also frequently occur. The physicochemical properties and the

practical applications of PHAs vary with polymer composition.

The expression enzymes involved in PHA biosynthesis can

be induced and usually nutrient limitation upregulates the

expression of the components involved in the anabolic route.

The following enzymes are involved in the process: a keto-

thiolase (PhbA), which catalyzes the dimerization of acetyl-

CoA, to acetoacetyl-CoA, a reductase (PhbB), which catalyzes

the hydrogenation of the latter to [R]-3-hydroxybutyryl-CoA,

which is further polymerized to PHB by a PHA synthase (PhbC,

PhbE) [3].

In Paracoccus denitrificans, the intracellular PHB granules are

covered by a lipoprotein layer consisting of phasins, PHA

synthase, PHA depolymerase, other proteins and phospho-

lipids [5]. The phasin proteins (PhaP) form a boundary layer on

the PHB granule surface separating the hydrophobic polymer

from the other cytoplasmic constituents [5e7]. The phaR

encodes a repressor regulating the expression of phaP gene

and itself. PhaR can sense the presence of PHB via interacting

with the nascent PHB granules and derepresses the PhaP

expression [8,9].

There are intracellular and extracellular depolymerases

involved in PHA degradation. Since the intracellular PHA

depolymerases hydrolyze the native PHA granules, while the

extracellular PHA depolymerases degrade denaturedmaterial,

they are named as nPHA and dPHA depolymerases, respec-

tively [10,11]. Moreover, both types of depolymerase might act

either on short ormedium length PHAs, therefore four types of

depolymerases are known: n/dPHASCL and n/dPHAMCL depo-

lymerases [10,11].

Depending on the growth conditions, purple phototrophic

bacteria are also able to preserve energy in various forms

including PHA [12]. In the purple non-sulfur bacterium R.

sphaeroides cultivated on acetate, high PHB content was

observed [13]. It was later shown that the produced PHB could

be used for H2 production in the absence of external substrate

in Rhodovalum sulfidophilum [14]. The PHB could be converted

slightly more efficiently to H2 than succinate, which was one

of the best substrates for this strain [15]. In R. palustris, R.

sphaeroides and R. rubrum [16,17], a competition for the

reducing equivalents between H2 production and PHB accu-

mulation was pointed out. It should be noted that these

strains harbor only H2 uptake hydrogenases (if any) and

nitrogenase(s).

Our model organism, Thiocapsa roseopersicina BBS is

a photosynthetic purple sulfur bacterium (PSB) which can be

propagated photochemolitoautotrophically on reduced sulfur

compounds and simple organic substrates such as acetate,

succinate, pyruvate, glucose, etc. It contains four active [NiFe]

hydrogenases: two of them aremembrane-associated (HupSL,

HynSL) [18,19], and Hox1 [20] and the recently described Hox2

[21] are soluble hydrogenases. This microbe is able to fix

molecular nitrogen in the absence of alternative nitrogen

sources.

In this work, we studied the PHA and H2 metabolism of T.

roseopersicina BBS. It has been found that e depending on the

growth conditions e the cells synthesize PHB/PHV (poly-

hydroxyvalerate) copolymers of medium chain length. Based

on the genomic DNA sequence data available, the putative

metabolic pathways of PHA synthesis and degradation were

identified and phylogenetically analyzed. In order to disclose

the potential linkage between PHA and hydrogenmetabolism,

a mutant in PHA biosynthesis (PH12B) has been created on

hydrogenase minus background (DC12B) [22]. Comparing the

hydrogen production capacity of the control and pha mutant

strains revealed that PHA could supply reducing power for the

nitrogenase. Addition of electron rich substrates increased

both the PHA degradation rate and the H2 production.

2. Materials and methods

2.1. Bacterial strains and plasmids

Strains and plasmids are listed in Table 1.

Thiocapsa roseopersicina BBS strains were maintained in

Pfennig’s mineral medium (for 1000 ml: 20 g NaCl, 1 g KH2PO4,

1 g MgCl2, 1 g KCl, 1 g NH4Cl, 2 g Na2S2O3, 200 ml) B12 vitamin

(100 mg ml�1), 1 ml Fe-EDTA (3.3 g L�1), 1 ml micro elements

solution (2975 mg Na2-EDTA, 300 mg H3BO4, 200 mg

CaCl2 � 6H2O, 100 mg ZnSO4 � 7H2O, 30 mg MnCl2 � 4H2O,

30 mg Na2MoO4 � 2H2O, 20 mg NiCl2 � 6H2O, 10 mg

CuCl2 � 2H2O in 1000 ml) [23]. The other parameters of culti-

vation in liquid culture or on solid surface are given in [22].

Antibiotics were used in the following concentrations

(mg ml�1): for Escherichia coli: ampicillin (100), kanamycin (25);

for T. roseopersicina: gentamicin (5), kanamycin (25), strepto-

mycin (5), erythromycin (50).

In order to study PHA accumulation and H2 production,

two-stage cultivation conditions were used: (A) For the PHA

accumulating condition, NH4Cl was omitted from the Pfen-

nig’s mineral medium and sodium glutamate was added as

nitrogen source (optimally: 0.17 g/l). The sodium thiosulfate

content was reduced to 2 g/l and sodium acetate concentra-

tion was varied between 2 and 10 g/l. The hypovials were

flushed for 10 min with Ar gas. The cultures were first grown

Table 1 e Strains used in this study.

Strain/plasmid Relevant genotype or phenotype Reference or source

Thiocapsa roseopersicina

BBS wild type [56]

DC12B hypC1D, hypC2D, wild type [22]

PH12B DphbBPRAEC, DC12B This work

E. coli

S17-1(lpir) 294 (recA pro res mod) Tpr, Smr (pRP4-2-Tc::Mu-Km::Tn7), lpir [57]

XL1-Blue MRF’ D(mcrA)183, D(mcrCB-hsdSMR-mrr)173, endA1, supE44,

thi-1, recA1, gyrA96, relA1 lac [F0 proAB lacIqZDM15 Tn10 (Tcr)]cStratagene

Vectors

pBluescript SK (þ) Cloning vector, Ampr Stratagene

pK18mobsacB sacB, RP4 oriT, ColE1 ori, Kmr [28]

pPHA2_2 up- and downstream regions (PHDo7 and PHDo8) of phb biosynthetic

locus in pK18mobsacB, Kmr

This work

pPHA2_1 1069 bp downstream region (PHDo1 and PHDo2) in pK18mobsacB, Kmr This work

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 4 4917

in 500 ml hypovials at 25 �C under a photon flux of approxi-

mately 58 mm s�1 m�2. (B) H2-producing condition: The cells

were grown under PHA accumulation conditions for 5 days

(exponential growth phase) and were collected by centrifu-

gation. The pellet was resuspended in nitrogen free medium

(for 1000ml: 20 g NaCl, 1 g KH2PO4, 1 gMgCl2, 1 g KCl and, 200 ml

B12 vitamin (100 mg ml�1), 1 ml Fe-EDTA (3.3 g L�1), 1 ml micro

elements solution) and the transmittance was adjusted to

0.50e0.65 (at 772 nm). In some cases, the growth mediumwas

supplemented with 5 g L�1 sodium succinate and/or 2 g L�1

sodium thiosulfate. 60 ml aliquots were dispensed in 125 ml

hypovials and were flushed for 10 min with Ar gas before

illumination as above.

2.2. Isolation of the pha genes in T. roseopersicina

The Allochromatium vinosum phbC and phbZ genes were used as

query sequence in a TBLAST search in our local T. rose-

opersicina genome data bank.

2.3. Nucleotid sequence accession numbers

The DNA sequences presented in this studywere submitted to

Genbank under accession no. JN244736 ( phaARPBCE locus) and

JN244737 ( phaZ locus).

2.4. DNA and protein manipulation

DNA manipulations were performed using standard tech-

niques [24,25] or according to themanufacturers’ instructions.

Protein quantification was performed byNon-Interfering Protein

Assay� kit (Calbiochem) according to the manufacturer’s

instructions.

2.5. Computational analysis, phylogenetic treeconstruction

Protein sequences in the various databases were compared

with the BLAST (P, X) programs (www.ncbi.nih.nlm.gov).

Multiple alignment of the sequences was performed by T-

COFFEE in regular mode [26]. The results of multiple

alignments were saved in phylip format and used as input for

PhyML (http://www.atgc-montpellier.fr/phyml/) [27], where

LG substitution model was applied and the SH-like method

was used to assess the support of the data for internal

branches of a phylogeny. The phylogenetic trees were visu-

alized by the Figtree v1.3.1. software (http://tree.bio.ed.ac.uk/

software/figtree/).

2.6. Deletion of the PHA biosynthetic locus

The pK18mobsacB vector [28] was used for making construct

for deleting the pha biosynthetic genes. The upstream and

downstream regions of the phb biosynthetic locus were

amplified from genomic DNA with the PHADo1 (50

TCCTGCGCCGCTTACGTCTT 30), PHADo2 (50 CATCGCTGCC-

GACGTGTCT 30) upstream primers and with the PHADo7 (50

CTGATCGACGTAGCAGTACC 30), PHADo8 (50 GAGCCACTCTA-CAACCACAT 30) downstream primers (see also Fig. 1). The

upstream1.069 bp PCR productwas inserted into pK18mobsacB

digested by SmaI (pPHA2_1). The downstream 1.162 bp frag-

ment was put into pPHA2_1 previously cleaved by XbaI and

polished (pPHA2_2). This plasmid was conjugated into

a mutant T. roseopersicina strain (DC12B) [22] lacking active

hydrogenase. Single and double recombinants were selected

based on kanamycin resistance and the sacB positive selection

system, respectively [28] (Table 1.). The genotype of the

mutants was further confirmed by sequencing the 1631 bp

fragment amplified by the PHBMo5 (50 CCA-

CATCGGCATCTATGTCA 30) and PHBMo6 (50 TCATCACCGAC-GACAACTTC 30) primers (see also Fig. 1).

2.7. Measurement of thiosulfate and succinate

The thiosulfate concentration was determined spectrophoto-

metrically as described earlier in Ref. [21].

The concentration of succinate was measured using HPLC

(Elite LaChrom, Hitachi) fittedwith an ICsep ICE-COREGAL 64H

organic acid analysis column and equipped with a L-2490

Refractive Index Detector. The temperature of the column and

RI detector was set at 50 �C and 41 �C, respectively. The elution

was performed by a 0.01M H2SO4 solution with the constant

1kbp

PHAD 1

phaB

PHAD 2

phaP phaR phaA phaE phaC

PHAD 7

rsam

PHAD 8PHADo1 PHADo2 PHADo7 PHADo8

PHBMo5 PHBMo6

Fig. 1 e The physical and genetic map of T. roseopersicina pha biosynthetic locus. The rsam gene is coding a protein for

radical S-adenosylmethionin superfamily. For the other genes see text. PCR primers PHADo1 and PHADo2 (upstream

homologous region) PHADo7 and PHADo8 (downstream homologous region) used for deleting the PHA biosynthetic genes

are also indicated. The PHBMo5 and PHBMo6 are PCR primers used for confirmation of the genotype of the strains (details in

Materials and Methods).

i n t e rn a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 44918

flow of 0.8 ml min�1. Preceding the measurements, the

samples were filtered on a 0.2 mm pores size filter to avoid

column contamination.

2.8. PHA analysis

PHAwas quantified by a slightly modified acidic methanolysis

method of Braunegg et al. [29] using commercial PHB as

standard. PHB, methyl(S )-3-hydroxybutyrate (Me-3HB) (99%),

and benzoic acid (99.5%) were purchased from SigmaeAldrich

(St. Louis, USA). Chloroform was from Scharlau Chemia S.A.

(Sentmenat, Spain), methanol (HPLC grade) and sulfuric acid

96% was from Carlo Erba (Rodano, Italy).

The freeze dried cells were suspended in a mixture of 2 ml

methanol acidified with 10% sulfuric acid containing benzoic

acid (0.5 g L�1) as the internal standard.Themixturewasheated

in 10 ml hypovials sealed with PTFE caps at 100 �C for 4 h. The

sampleswere vortexed for 2min every hour, then cooled down

to room temperature and supplemented with 1 ml deionized

water and 1 ml chloroform. Finally, samples were vortexed

again for 2min and the organic phasewas used for subsequent

GC analysis [30]. 1 ml of the previously esterified sample was

loaded onto a Supelco Equity-1 capillary GC column. The inlet

and flame ionization detector temperatureswere set at 265 and

250 �C, respectively. The oven temperature program was the

following: the initial temperature was 50 �C, then it was

increased at a rate of 30 �C min�1 until 170 �C, followed by

a 99 �C min�1 temperature raise rate to 270 �C and kept the

temperature for 3 min. The inlet was operated in split mode at

265 �C, the constant flow rate was 11.8 ml min�1 with helium

carrier. Under these conditions, the retention times for the PHB

derivative (methyl 3-hydroxybutyric acid) and the benzoic acid

internal standard were 2.63 and 4.08 min, respectively. Cali-

bration curve for methyl(S )-3-hydroxybutyrate ester was

determined in the concentration range: 0.13e5.22 mg ml�1. The

PHA content of the samples was determined in 4 independent

parallel measurements.

2.9. Determination of in vivo hydrogen evolutionactivity

After changing the media to H2 production conditions, the T.

roseopersicina cultures (60 ml) were incubated in various

Pfennig media under argon atmosphere in sealed 125 ml

Hypo-Vial flasks. H2 production was followed by gas chro-

matography (Agilent 6890, capillarymolecular sieve 5 column,

TCD detector). Four replicates were done for each in vivo H2

evolution measurement.

2.10. Nitrogenase activity measurements in vitro

A modified acetylene reduction method was used [31]. Acety-

lene (up to 13% of the gas phase) was injected into a hypovial

bottle (60 ml) containing 30 ml of cells and flushed with Ar.

Then, N2 (up to 3% of the gas phase) was injected and the

hypovialswere incubated under light for 4 h. The ethylene and

acetylene content of the gas phase was determined by gas

chromatography (Shimadzu GC-2010 equipped with a HP-

PlotQ column and TCD detector. The inlet was operated at

200 �Candsplitmode (0.5:1)with 23.5mlmin�1 total flow.Oven

temperature was kept at 55 �C during the operation). Three

replicaswereused for eachnitrogenase activitymeasurement.

3. Results and discussion

3.1. PHA accumulation

Various photosynthetic bacteria are able to accumulate

considerable amounts of PHAs [12e17,32e34]. Similarly to the

heterotrophic bacteria [3,12], accumulation of PHAs in

photosynthetic bacteria is reversibly associated with nitrogen

availability in the growth medium [12,16].

Inorder to find theoptimalmediumfor PHAaccumulation in

T. roseopersicina, the concentrations of several small organic

compounds and thiosulfate have been varied in media con-

taining limited amounts of glutamate as nitrogen source (data

not shown). Acetatewas found as the best substrate similarly to

several other purple bacteria [12,13,34]. Analysis of the

biopolymers revealed that PHAs produced by T. roseopersicina

are copolymers composed of 3-hydroxybutyrate and 3-

hydroxyvalerate. The mol% of 3-hydroxyvalerate varied

between 5 and 41% depending on the growth conditions. The

highest yield of PHA was achieved in cells propagated on 10 g/l

of sodium acetate and 0.17 g/l sodium glutamate: T. rose-

opersicinaaccumulated30.5� 4%ofPHAofdry cellweight (DCW)

and the ratioof3-hydroxybutyrateand3-hydroxyvalerate in the

polymer was 84:16. This yield puts T. roseopersicina BBS into

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 4 4919

group of the best PHAproducing purple photosynthetic bacteria

grown on acetate [12]. No PHA accumulation was observed in

the presence of succinate, pyruvate and glucose.

3.2. Genes involved in PHA synthesis and degradation inT. roseopersicina

A genomic locus containing six genes coding for enzymes

involved in PHA biosynthesis was identified in the genome

sequence database of T. roseopersicina (unpublished data)

using the A. vinosum PhbC protein as query sequence (Fig. 1.).

All genes required for PHA biosynthesis in T. roseopersicina

were found in this locus. The genomic organization of these

genes was similar to that of A. vinosum [35]. A similar strategy

was used to find the gene coding for PHA depolymerase

( phaZ ) located in a distinct genomic locus.

In the PHA biosynthetic locus, the genes are localized in

two e oppositely oriented e gene clusters (Fig. 1). One cluster

consists of the phaARPB genes, which encode for b-ketothio-

lase (PhaA), P(3HA) synthesis regulatory protein (PhaR), P(3HA)

granule associated phasin (PhaP) and NADPH-dependent

acetoacetyl-CoA reductase (PhaB), respectively. There are

two inversely oriented genes: phaC- phaE which encode for

a two component P (3HB) synthase.

The deduced protein sequences of the phaARPB and phaCE

genes were compared to the corresponding protein sequences

in the Genbank. All gene products significantly resembled the

corresponding enzymes of various species (see below).

Generally, the similarity was highest to the corresponding

proteins of A. vinosum (Fig. 1).

The central enzymes involved the polyester formation are

the PHA synthases (PHASs) polymerizing the b-hydroxy fatty

acids into PHA biopolyesters. These enzymes are grouped into

four classes (classes IeIV) based on their subunit composition

and substrate specificity [36e38]. T. roseopersicina apparently

has a class III type heterodimer PHA synthase composed of

a polymerase and an “additional” subunit. These enzymes

dominantly occurring in g-Proteobacteria and in cyanobac-

teria prefer CoA thioesters of (R)-3-hydroxy fatty acids

comprising 3 to 5 carbon atoms [39,40].

Site directed mutagenesis of the A. vinosum PHA synthase

revelealed Cys-149, Asp-302 and His-331 are involved in

enzyme catalysis [41]. Moreover, substitution of the highly

conserved Trp425 by alanine strongly reduced the enzyme

activity in Ralstonia eutropha [42]. Trp425 has been suggested to

play a role in the dimerization of the PhaC subunits. These e

and many other conserved e residues could be clearly iden-

tified in T. rosepersicina PhaC protein, as well.

InA. vinosum, the functional type-III PHA synthase requires

both the PhaE and PhaC subunits [43], neither of the subunits

is active alone. In bacteria possessing a class III PHA synthase,

phaC and phaE are jointly organized in the genomes and most

probably constitute a single operon. This is likely in T. rose-

opersicina, as well. The resemblance among PhaC proteins was

more pronounced than among the PhaE proteins. The latter

“additional” subunit was dissimilar in the various PHA poly-

merases. However, they contained a C-terminal element

similar to the phasins suggesting that PhaE had a role in

binding the PHA synthases to the surface of PHA granules [44].

However, the exact function of PhaE is still ambiguous.

The second PHA related locus contains only the PHB

depolymerase gene ( phaZ ). PHA depolymerases are carbox-

ylesterases belonging to the a/b-hydrolase fold family [11].

Majority of the PHA depolymerases have few conserved

regions, such as the Ser-His-Asp catalytic triad, a GxSxG

sequence motif (known as ‘lipase box’) and a non-catalytic

histidine [11,45]. In addition to these regions, a so-called

oxyanion hole can be easily recognized, which might be

located N- or C-terminally relative to the lipase box (type I and

type II catalytic domains) [45,46]. The in silico analysis of the T.

roseopersicina PhaZ protein identified all conserved regions

listed above. The PHA Depolymerase Engineering Database

(DED, http://www.ded.uni-stuttgart.de; [47]) classified T. rose-

opersicina PhaZ as an extracellular dPHASCL depolymerasewith

a catalytic domain type 1, where the oxyanion hole was

located N-terminally from the lipase box. Sequence compar-

ison of PhaZ proteins showed that the T. roseopersicina enzyme

had the highest identity to the Xanthobacter autotrophicus Py2

(53%), Methylobacterium extorquens species (52%), Azotobacter

vinelandii DJ (48%) and A. vinosum DSMZ 180 (38%).

A careful search in the T. roseopersicina genome did not

identify any additional putative gene(s) involved in PHAs

synthesis and degradation.

3.3. Phylogeny of PhaC and PhaZ

The identity level of the PhaC and PhaE proteins of T. rose-

opersicina and A. vinosum involved in PHA biosynthesis (90 and

70%, see Fig. 1) was more pronounced than that of the PhaZ

enzymes (38%). This observation prompted us to further

investigate the codon usage and phylogeny of the related

genes/proteins. The PHA polymerase PhaC subunit and the

depolymerase PhaZ proteins were used as model sequences.

Codon adaptation index (CAI) provides information about

the age of a gene in the genome of a given organism. If a gene

is young in a given host (the gene acquiring event happened

relatively short time ago) it’s codon usage had no time to be

adapted to the preferred codon usage of the strain. Therefore,

these genes should have relatively lower CAI values. CAI

calculation for the phaC and phaZ did not reveal significant

differences in CAI value/the codon usage of these two genes,

therefore conclusions on the timing of potential gene transfer

events could not be made.

Phylogenetic trees were constructed for the PhaC and PhaZ

proteins. Representative sequences from each class of PHA

synthases were chosen according to Ref. [37] and the PhaZ

sequences were extracted from the same or closely related

strains. Phylogenetic trees were constructed for both proteins

following the protocol described in theMaterials andMethods.

Fig. 2A shows that the PhaC protein of T. roseopersicina forms

a branch with the following photosynthetic bacteria: A. vino-

sum, Thiocystis violacea and Thiorhodococcus drewsii. In the case

of the PhaZ proteins, the T. roseopersicina enzyme has the

closest relationship to the PhaZ of the non-photosynthesizing

Xanthobacter autotrophicus, M. extorquens and there are 4

branching points between the A. vinosum and T. roseoperscina

enzymes (Fig. 2B). The best identities values are much smaller

for the PhaZ (around 52e53%) than for the PhaC proteins

(86e90%). Moreover, the T. roseopersicina group of PhaC

proteins is branchedmuch earlier than that of the PhaZ group

Fig. 2 e Phylogenetic tree of PhaC (A) and PhaZ (B) proteins. Aerhyd: Aeromonas hydrophila, Agrotum: Agrobacterium

tumefaciens, Alvin: Allochromatium vinosum, Avine: Azotobacter vinelandii, Bameg: Bacillus megaterium, BacINT005: Bacillus sp.

INT005, Burcar: Burkholderia caryophylli, Caucre: Caulobacter crescentus CB15, Cauvib: Caulobacter vibrioides Chromovi:

Chromobacterium violaceum, Metex: Methylobacterium extorquens, Paden: Paracoccus denitrificans, PseaerC1, PseaerC2:

Pseudomonas aeruginosa PcaC1, PcaC2, PsepuC1, PsepuC2: Pseudomonas putida PcaC1, PcaC2, PsestuC2: Pseudomonas stutzeri

PcaC2, Raleu: Ralstonia eutropha, RaleuZ1, RaleuZ2, RaleuZ3, RaleuZ4,: Ralstonia eutropha PcaZ1,Z2,Z3,Z4, Rhocap:

Rhodobacter capsulatus, Rhospha: Rhodobacter sphaeroides, Rhodru: Rhodococcus ruber, Rhode: Rhodococcus equi, Rhoru:

Rhodospirillum rubrum, SynPCC6803: Synechocystis sp. PCC 6803, Thiro: Thiocapsa roseopersicina, Thivio: Thiocystis violacea,

Thiodr: Thiorhodococcus drewsii, Vibcho: Vibrio cholerae V51, Xauto: Xanthobacter autotrophicus.

i n t e rn a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 44920

which is a very last branch on the rooted phylogenetic trees.

These observations clearly indicate the independent evolution

of the PHA anabolic and catabolic genes/enzymes.

3.4. Mutant analysis

Deletion of the locus ( phaARPB and phaCE genes) involved in

the alkanoate biosynthesis in. T. roseopersicina (PH12B strain)

was performed on a genetic background lacking all active

hydrogenases [22], whichwas named as DC12B strain, in order

to find out if the reducing power coming from PHB degrada-

tion can lead to nitrogen fixation coupled hydrogen produc-

tion (see Materials and Methods).

In T. roseopersicina, the removal of the PHA biosynthetic

locus totally eliminated the polyester from the cells. Under

PHA accumulation conditions both PH12B and DC12B strains

were able to grow in the presence of high concentration of

acetate (10 g/l sodium acetate) and the PH12B strain reached

even higher cell densities relative to the DC12B strain.

3.5. Hydrogen production from PHA

In order to study the PHA driven and nitrogenase mediated H2

production, it is reasonable to choose a strain lacking hydrog-

enases capable to take up hydrogen [48e50]. PHA degradation

was examined in DC12B and PH12B cell suspensions in the

absence of any additional external substrate (Fig. 3A.). First, the

cells were cultivated under PHA accumulating conditions then

themedia were replaced by carbon freemedia and the amount

of evolved H2 was analyzed after 5 days (see Materials and

Methods). Analysis of the H2 producing capacities of the cell

suspensions revealed approximately two times higher H2

production by the hydrogenase deficient DC12B cells relative to

the PH12B strain, which lacks both hydrogenase and PHA syn-

thase activity. In DC12B, about 50% of the H2 production is

clearly associated with the PHA degradation and it was most

accentuated during the first 48 h of the H2 production growth

mode (Fig. 3B). After 48 h the PHA decomposition stopped

(Fig. 3B open circle) and the biohydrogen production was

similar to that of the PH12B strain (Fig. 3A). PHA was not

detectable in the PH12B strain under the same conditions.

The nitrogenase activities of DC12B and PH12B were prac-

tically identical, indicating that nitrogenase activity was not

affected by the deletion of the PHA biosynthetic locus (Fig. 4,

open triangles and lozenges). Interestingly, the acetylene

reduction assay of the T. roseopersicina Mo-nitrogenase could

be performed only in the presence of N2. It should be noted

that there is no clear reason why N2 is required for acetylene

reduction. This is in contrast to the previous findings stating

that N2 and acetylene compete for a common or shared

binding site [51].

Therefore, the lower hydrogen evolving capacity of the

PHA biosynthesis mutant PH12B strain, relative to the corre-

sponding parental strain, might be attributed to the lack of

PHA in the PH12B strain. It is to be noted that this strain could

still produce some H2 although in the H2 production medium

Fig. 3 e The comparison of the nitrogenase catalyzed

hydrogen evolution and PHA consumption of the pha

containing (DC12B) and Dphastrains (PH12B) in the absence

and presence of thiosulphate. (A) Cumulative normalized

hydrogen production. (B) The normalized cellular PHB

content as a function of time during hydrogen production.

PHB extracted from PH12B was undetectable during

cultivation period. “DT” indicates the addition of

thiosulphate to the hydrogen producing medium.

Fig. 4 eNitrogenase activities of the pha containing (DC12B)

and Dphastrains (PH12B) in the absence and presence of

thiosulphate. “DT” indicates the addition of thiosulphate

to the hydrogen producing medium.

Fig. 5 e Thiosulfate consumption of the pha containing

(DC12B) and Dphastrains (PH12B) in the presence or

absence of succinate. “DS” and “DT” indicates the

addition of succinate and thiosulphate to the solution,

respectively.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 4 4921

there are no external carbon and nitrogen sources available.

This residual H2 formation is most probably linked to the

utilization of other storage material(s), like glycogen or

elementary sulfur (S0).

Light dependence of the in vivo nitrogenase mediated H2

production was also tested. After the PHA accumulation step

half of the bottles were wrapped in aluminum foil and were

further incubated in the dark. Both DC12B and PH12B could

evolve H2 only under continuous illumination, no hydrogen

production was observed in the dark (data not shown).

3.6. Effect of thiosulfate and succinate on PHAconsumption and H2 production

In the purple nonsulphur bacterium, R. sulfidophilum succinate

was found as one of the best substrate for H2 production [52].

Later, it was also demonstrated that the conversion to H2 is

a little bit more efficient from PHB than from succinate [15].

These observations prompted us to investigate the effect of

succinate on PHA metabolism and nitrogenase mediated H2

production.

In T. roseopersicina, thiosulfate is the primary electron

source and it is one of the key compounds connected to

central redox pool and H2 metabolism [53,54]. Upon addition

of Na-thiosulfate, the thiosulfate utilization by DC12B was

significantly (around 40%) higher as compared to that of the

PH12B strain (Fig. 5, open squares and circles). Interestingly,

thiosulfate could stimulate the PHA utilization after 48 h

incubation and almost all PHA was consumed after 5 days

(Fig. 3B). The presence of thiosulfate substantially e but to

similar extente increased the acetylene reduction activities in

both strains which were diminished to the basic level at the

late incubation period. Finally, the H2 production was also

elevated by addition of thiosulfate in both strains. This effect

might be due to the following reasons: thiosulfate could

i n t e rn a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 44922

(i) feed electrons to the nitrogenase via the quinone pool,

(ii) increase the in vitro nitrogenase activity and (iii) accelerate

the PHA decomposition yielding more electrons for H2 evolu-

tion. The molecular background of the interaction between

thiosulfate and PHA utilization is still unclear.

Addition of succinate to the PHA containing and Dpha cell

suspensions indicated that the nitrogenase mediated H2

production can be driven by succinate (Fig. 3A vs Fig. 6A,

open squares and triangles). Addition of succinate practi-

cally doubled the H2 evolution in both the DC12B and PH12B

T. roseopersicina strains, which was significantly weaker

effect than that of thiosulfate (>4x, see Fig. 3A). Supple-

mentation of succinate had moderate effect on thiosulfate

utilization (Fig. 5, compare filled squares to open ones and

filled circles to open ones) and PHA degradation (Fig. 6B, see

also Fig. 3B).

Fig. 6 e The comparison of the nitrogenase catalyzed

hydrogen evolution and PHA consumption of the pha

containing (DC12B) and Dphastrains (PH12B) in the

presence or absence of thiosulfate. (A) Cumulative

hydrogen evolution normalized to the cellular proteins. (B)

Specific PHB content as a function of time during hydrogen

production. PHB extracted from PH12B was undetectable

during hydrogen production period. “DS” and “DT”

indicates the addition of succinate and thiosulphate to the

solution, respectively.

Combined addition of thiosulfate and succinate had

proportional effect on H2 production which was around 7e8

times higher in these cultures than in the samples incubated

in carbon and thiosulfate free media (Fig. 6A, vs Fig. 3A).

From these experiments it can be concluded that e among

the compounds studied e thiosulfate is the best substrate for

biohydrogen production in T. roseopersicina. The strain still can

use both PHA and succinate for H2 evolution with similar

efficacy. Moreover, an interaction between the thiosulfate and

PHA metabolism could be observed which had a further

positive effect on H2 production.

4. Conclusions

T. roseopersicina BBS is suitable for studies of energy metabo-

lism in purple bacteria due to its metabolic versatility. Mining

in the genome sequence database of T. roseopersicina revealed

the presence of orfs coding for putative proteins showing

significant homology to the subunits of the gene products

involved in PHAs biosynthesis and degradation.

Both PHB accumulation and H2 evolution represent alter-

native ways for discharging excess reducing power and both

take place under unbalanced growth conditions [16,55]. The

results obtained in this study confirm that the T. roseopersicina

BBS (i) has the genes involved in PHAs biosynthesis and

degradation; (ii) the phylogeny of the PhaC and PhaZ proteins

is apparently distinct and indicates their different evolu-

tionary history; (iii) the strain is able to accumulate PHA (30.5%

of DCW); (iv) the stored PHA is good substrate for H2 produc-

tion in a two-stage process where the H2-producing phase is

separated from the PHA accumulating growth condition; (v) in

contrast to purple non-sulfur bacteria, this H2 evolution is

strictly light dependent; there is no PHA driven hydrogen

evolution in the dark (vi) addition of electron rich substrates,

e.g. thiosulphate, succinate to the H2-producing medium

substantially increases the H2 production by donating elec-

trons, by increasing the nitrogenase activity and via acceler-

ating the PHA degradation.

Acknowledgments

ThisworkwassupportedbyEUprojectsHyVolutionFP6-IP-SES6

019825 and FP7 Collaborative Project SOLAR-H2 FP7-Energy-

212508, and by domestic funds (GOP-1.1.2.-07/1-2008-0007,

TAMOP-4.2.1/B-09/1/KONV-2010-0005,Baross_DA07_DA_TECH-

07-2008-0012, andKN-RET-07/2005).TheSTSMfinancial support

for A. Fulop by COST 868 Action is appreciated.

r e f e r e n c e s

[1] Benemann JR. Hydrogen biotechnology: progress andprospects. Nat Biotechnol 1996;14:1101e3.

[2] Dawes EA. Storage polymers in prokaryotes. In: Mohan S,Daw C, Cole J, editors. Prokaryotic structure and function:a new perspective. Cambridge: University Press; 1992. p.81e122.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 4 4923

[3] Anderson AJ, Dawes EA. Occurrence, metabolism, metabolicrole and industrial uses of bacterial polyhydroxyalkanoates.Microbiol Rev 1990;54:450e72.

[4] Melnicki MR, Eroglu E, Melis A. Changes in hydrogenproduction and polymer accumulation upon sulfur-deprivation in purple photosynthetic bacteria. Int J HydrogenEnergy 2009;34(15):6157e70.

[5] Steinbuchel A, Aerts K, Babel W, Follner C, Liebergesell M,Madkour MH, et al. Consideration on the structure andbiochemistry of bacterial polyhydroxyalkanoic acidinclusions. Can J Microbiol 1995;41:94e105.

[6] Pieper-Furst U, Madkour MH, Mayer F, Steinbuchel A.Purification and characterization of a 14-kilodalton proteinthat is bound to the surface of polyhydroxyalkanoic acidgranules in Rhodococcus ruber. J Bacteriol 1994;176:4328e37.

[7] Maehara A, Ueda S, Nakano H, Yamane T. Analyses ofa polyhydroxyalkanoic acid granule-associated 16-kilodaltonprotein and its putative regulator in the pha locus ofParacoccus denitrificans. J Bacteriol 1999;181:2914e21.

[8] Maehara A, Doi Y, Nishiyama T, Takagi Y, Ueda S, Nakano H,et al. PhaR, a protein of unknown function conserved amongshort-chain-length polyhydroxyalkanoic acid-producingbacteria, is a DNA binding protein and represses Paracoccusdenitrificans phaP expression in vitro. FEMS Microbiol Lett2001;200:9e15.

[9] Maehara A, Taguchi S, Nishiyama T, Yamane T, Doi Y. Arepressor protein, PhaR, regulates polyhydroxyalkanoate(PHA) synthesis via its direct interaction with PHA. J Bacteriol2002;184:3992e4002.

[10] Tokiwa Y, Calabia BP. Degradation of microbial polyesters.Biotechnol Lett 2004;26:1181e9.

[11] Jendrossek D, Handrick R. Microbial degradation ofpolyhydroxyalkanoates. Annu Rev Microbiol 2002;56:403e32.

[12] Liebergesell M, Hustede E, Timm A, Steinbuchel A, ClintonFuller R, Lenz RW, et al. Formation of poly(3-hydroxyalkanoates) by phototrophic and chemolithotrophicbacteria. Arch Microbiol 1991;155:415e21.

[13] Brandl H, Gross RA, Lenz RW, Lloyd R, Clinton Fuller R. Theaccumulation of poly (3-hydroxyalkanoates) in Rhodobactersphaeroides. Arch Microbiol 1991;155:337e40.

[14] Maeda I, Idehara K, Okayama N, Miura Y, Yagi K,Mizoguchi T. Poly(3-hydroxybutyrate) as an endogeneoussubstrate for H2 evolution in Rhodovulum sulfidophilum.Biotechnol Lett 1997;19:1209e12.

[15] Maeda I, Miyasaka H, Umeda F, Kawase M, Yagi K.Maximization of hydrogen production ability in high-Densitysuspension of Rhodovulum sulfidiphilum cells usingintracellular poly (3-hydroxybutyrate) as sole substrate.Biotechnol Bioeng 2002;81:474e81.

[16] De Philippis R, Ena A, Guastini M, Sili C, Vincenzini M.Factors affecting poly-b-hydroxybutyrate accumulation incyanobacteria and in purple non-sulfur bacteria. FEMSMicrobiol Rev 1992;103:187e94.

[17] Hustede E, Steinbuchel A, Schlegel HG. Relationship betweenthe photoproduction of hydrogen and the accumulation ofPHB in nonsulphur purple bacteria. Appl MicrobiolBiotechnol 1993;39:87e93.

[18] Colbeau A, Kovacs KL, Chabert J, Vignais PM. Cloning andsequencing of the structural (hupSLC ) and accessory(hupDHI ) genes for hydrogenase biosynthesis in Thiocapsaroseopersicina. Gene 1994;140:25e31.

[19] Rakhely G, Colbeau A, Garin J, Vignais PM, Kovacs KL.Unusual organization of the genes coding for HydSL, thestable [NiFe] hydrogenase in the photosynthetic bacteriumThiocapsa roseopersicina BBS. J Bacteriol 1998;180:1460e5.

[20] Rakhely G, Kovacs AT, Maroti G, Fodor BD, Csanadi G,Latinovics D, et al. Cyanobacterial type, heteropentameric,NADþ reducing [NiFe] hydrogenase in the purple sulfur

photosynthetic bacterium, Thiocapsa roseopersicina. ApplEnviron Microbiol 2004;70:722e8.

[21] Maroti J, Farkas A, Nagy IK, Maroti G, Kondorosi E, Rakhely G,et al. A second soluble Hox-type NiFe enzyme complete thehydrogenase set in Thiocapsa roseopersicina BBS. Appl EnvironMicrobiol 2010;76(15):5113e23.

[22] Maroti G, Fodor BD, Rakhely G, Kovacs AT, Arvani S,Kovacs KL. Accessory proteins functioning selectively andpleiotropically in the biosynthesis of [NiFe] hydrogenases inThiocapsa roseopersicina. Eur J Biochem 2003;270:2218e27.

[23] Pfennig N, Truper HG. The family Chromatiaceae. In:Balows A, Truper HG, Dworkin MW, Harder, Schleifer KH,editors. The prokaryotes. Berlin: Springer; 1991. p. 3200e21.

[24] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning:a laboratory manual. 2nd ed. New York: Cold Spring Harbor;1989.

[25] Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,Smith JA, et al. Current protocols in molecular biology. NewYork: Wiley; 1996.

[26] Notredame C, Higgins D, Heringa. T-Coffee: a novel methodfor multiple sequence alignments. J Mol Biol 2000;302(1):205e17.

[27] Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W,Gascuel O. New algorithms and methods to estimatemaximum-likelihood phylogenies: assessing theperformance of PhyML 3.0. Syst Biol 2010;59:307e21.

[28] Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G,Puhler A. Small mobilizable multi-purpose cloning vectorsderived from the Escherichia coli plasmids pK18 and pK19:selection of defined deletions in the chromosome ofCorynebacterium glutamicum. Gene 1994;145:69e73.

[29] Braunegg G, Sonnleitner B, Lafferty RM. A rapid gaschromatographic method for the determination of poly-b-hydroxybutyric acid in microbial biomass. Eur J ApplMicrobiol Biotechnol 1978;6:29e37.

[30] Betancourt A, Yezza A, Halasz A, Trea HV, Hawari J. Rapidmicrowave assisted esterification method for the analysis ofpoly-3-hydroxybutyrate in Alcaligenes latus by gaschromatography. J Chrom 2007;1154:473e6.

[31] Stewart WDP, Fitzgerald GP, Burris RH. In situ studies on N2

fixation using the acetylene reduction technique. Proc NatlAcad Sci USA 1967;58:2071e8.

[32] Kranz RG, Gabbert KK, Locke TA, Madigan MT.Polyhydroxyalkanoate production in Rhodobacter capsulatus:genes, mutants, expression, and physiology. Appl EnvironMicrobiol 1997;63:3003e9.

[33] Mas J, Van Gemerden H. Storage products in purple andgreen sulfur bacteria. In: Blankenship R, Madigan M, Bauer C,editors. Anoxygenic photosynthetic bacteria. Dordrecht:Kluwer; 1995. p. 973e90.

[34] Khatipov E, Miyake J, Asada Y. Accumulation of poly-b-hydroxybutyrate by Rhodopseudomonas sphaeroides on variouscarbon and nitrogen substrates. FEMS Microbiol Lett 1998;162:39e45.

[35] Liebergesell M, Steinbuchel A. Cloning and nucleotidesequence of genes relevant for biosynthesis ofpolyhydroxyalkanoic acid in Chromatium vinosum strain D.Eur J Biochem 1992;209:135e50.

[36] Rehm BHA, Steinbuchel A. Biochemical and genetic analysisof PHA synthases and other proteins required for PHAsynthesis. Int J Biol Macromol 1999;25:3e19.

[37] Rehm BHA. Polyester synthases: natural catalysts forplastics. Biochem J 2003;376:15e33.

[38] Solaiman DKY, Ashby RD. Rapid genetic characterization ofpoly (hydroxyalkanoate) synthase and its applications.Biomacromolecules 2005;6:532e7.

[39] Yuan W, Jia Y, Tian J, Snell KD, Muh U, Sinskey AJ, et al. ClassI and III polyhydroxyalkanoate synthases from Ralstonia

i n t e rn a t i o n a l j o u r n a l o f h y d r o g e n en e r g y 3 7 ( 2 0 1 2 ) 4 9 1 5e4 9 2 44924

eutropha and Allochromatium vinosum: characterization andsubstrate specificity studies. Arch Biochem Biophys 2001;394:87e98.

[40] Hai T, Hein S, Steinbuchel A. Multiple evidence forwidespread and general occurrence of type-III PHAsynthases in cyanobacteria and molecular characterizationof the PHA synthases from two thermophilic cyanobacteria:Chlorogloeopsis fritschii PCC 6912 and Synechococcus sp. strainMA19. Microbiology 2001;147:3047e60.

[41] Jia Y, Kappock TJ, Frick T, Sinskey AJ, Stubbe J. Lipasesprovide a new mechanistic model for polyhydroxybutyrate(PHB) synthases: characterization of the functional residuesin Chromatium vinosum PHB synthase. Biochemistry 2000;39:3927e36.

[42] Gerngross TU, Snell KD, Peoples OP, Sinskey AJ, Csuhai E,Masamune S, et al. Overexpression and purification of thesoluble polyhydroxyalkanoate synthase from Alcaligeneseutrophus: evidence for a required posttranslationalmodification for catalytic activity. Biochemistry 1994;33:9311e20.

[43] Muh U, Sinskey AJ, Kirby DP, Lane WS, Stubbe J. PHAsynthase from Chromatium vinosum: Cys 149 is involved incovalent catalysis. Biochemistry 1999;38:826e37.

[44] Liebergesell M, Rahalkar S, Steinbuchel A. Analysis of theThiocapsa pfennigiipolyhydroxyalkanoate synthase: subcloning,molecular characterization and generation of hybrid synthaseswith the corresponding Chromatium vinosum enzyme. ApplMicrobiol Biotechnol 2000;54:186e94.

[45] Jaeger KE, Steinbuchel A, Jendrossek D. Substratespecificities of bacterial polyhydroxyalkanoatedepolymerases and lipases: bacterial lipases hydrolyze poly(omega-hydroxyalkanoates). Appl Environ Microbiol 1995;61:3113e8.

[46] BehrendsA,Klingbeil B, JendrossekD.Poly (3-hydroxybutyrate)depolymerases bind to their substrate by a C-terminal locatedsubstrate binding site. FEMSMicrobiol Lett 1996;143:191e4.

[47] Knoll M, Hamm TM, Wagner F, Martinez V, Pleiss J. The PHAdepolymerase engineering database: a systematic analysistool for the diverse family of polyhydroxyalkanoate (PHA)depolymerases. BMC Bioinform 2009;10:89.

[48] Kars G, Gunduz U, Rakhely G, Ycel M, Ero�glu _I, Kovacs LK.Improved hydrogen production by hydrogenase deficientmutant strain of Rhodobacter sphaeroides O.U.001. Int JHydrogen Energy 2008;33:3056e60.

[49] Kars G, Gunduz U, Yucel M, Rakhely G, Kovacs LK, Ero�glu _I.Evaluation of hydrogen production by Rhodobacter sphaeroidesO.U.001 and its hupSL deficient mutant using acetate andmalate as carbon sources. Int J Hydrogen Energy 2009;34:2184e90.

[50] Kars G, Gunduz U. Towards a super H2 producer:improvements in photofermentative biohydrogenproduction by genetic manipulations. 2010;35:6646e6656.

[51] Kim CH, Newton WE, Dean DR. Role of the MoFe proteinalpha-subunit histidine-195 residue in FeMo-cofactorbinding and nitrogenase catalysis. Biochemistry 1995;34:2798e808.

[52] Maeda I, Chowdhury WQ, Idehara K, Yagi K, Mizoguchi T,Akano T, et al. Improvement of substrate conversion tomolecular hydrogen by three-stage cultivation ofa photosynthetic bacterium, Rhodovulum sulfidophilum.Appl Biochem Biotechnol 1998;70e72:301e10.

[53] Rakhely G, Laurinavichene TV, Tsygankov AA, Kovacs KL.The role of Hox hydrogenase in the H2 metabolism ofThiocapsa roseopersicina. Biochim Biophys Acta 2007;1767:671e6.

[54] Laurinavichene TV, Rakhely G, Kovacs KL, Tsygankov AA.The effect of sulfur compounds on H2 evolution/consumption reactions, mediated by various hydrogenases,in the purple sulfur bacterium, Thiocapsa roseopersicina. ArchMicrobiol 2007;188:403e10.

[55] Steinbuchel A. Polyhydroxyalkanoaic acids. In: Byrom D,editor. Biomaterials: novel materials from biological sources.New York: Stockton Press; 1991. p. 124e213.

[56] Bogorov LV. The properties of Thiocapsa roseopersicina, strainBBS, isolated from an estuary of the White Sea.Mikrobiologija 1974;43:326e32.

[57] Herrero M, Lorenzo V, Timmis KN. Transposon vectorscontaining non-antibiotic resistance selection markers forcloning and stable chromosomal insertion of foreign genesin gram-negative bacteria. J Bacteriol 1990;172:6557e67.