Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank...

27
Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State University

Transcript of Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank...

Page 1: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Recent advancements in strawberry integrated disease

management in NC

Mahfuzur Rahman and Frank Louws

Department of Plant Pathology

North Carolina State University

Page 2: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Host resistance mechanism against Anthracnose caused by

Colletotrichum acutatum

Page 3: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Anthracnose ripe fruit rot

Lesions are more sunken under dry condition while salmon color spore mass is common under high relative humidity on less sunken lesions

Page 4: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

All parts of strawberry are susceptible to C. acutatum Anthracnose petiole rot, flower blight & green fruit rot

Sym

ptom

on

gree

n fr

uit

Page 5: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

AFR incidence on 14 genotypes in plasticulture system, ‘07 & ‘08

Page 6: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Invitro evaluation of anthracnose fruit rot severity

1

Genotype

Mean lesion

dia(mm)

a Mean lesion

dia(mm)

b Mean lesion

dia(mm)

c d e Susceptibility

group 8 DAI

(Expt. 1) 8 DAI

(Expt. 2) 8 DAI

(Expt. 3) Seascape 25.0 2 24.5 3 26.0 1 5 -4.2 S Chandler 26.0 1 25.0 2 25.5 3 6 -4.0 S Strawberry Festival

24.0 4 25.7 1 25.9 2 7 -3.8 S

NCS03-05 24.2 3 23.0 4 23.3 4 11 -2.8 MS Albion 19.0 5 20.2 5 21.4 5 15 -1.8 MS NCC99-13 17.3 7 18.5 6 19.7 6 19 -0.8 MS Pelican 18.0 6 17.2 7 19.3 7 20 -0.6 MS Camino 16.0 8 15.0 9 15.8 8 25 0.6 MR NCL03-05 15.0 9 16.2 8 15.3 10 27 1.1 MR Bish 14.8 10 14.0 10 15.6 9 29 1.6 MR Winter Dawn

14.0 11 13.8 11 12.0 12 34 2.8 MR

NCC99-27 13.0 12 13.4 12 13.8 13 37 3.6 R NCL03-06 12.0 13 13.0 13 13.0 11 37 3.6 R NCC02-63 11.5 14 12.0 14 12.0 14 42 4.8 R Mean 17.8 18 18.5 22.4

Page 7: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Rank sum method

a, b and c are genotype ranking using lesion diameter at 8 DAI from three different experiments;

d= rank-sum (a + b +c) for each genotype; e = deviation from the grand mean (G) of the

rank-sums ([e = (d –G)/standard deviation] × 3).

Page 8: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Invitro AFR resistance

Seascape is a day-neutral (everbearing) cultivarNC C02-63 is a short-day advance breeding line

Page 9: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Selection of genotypes possessing QI and AFR resistance

Strawberry genotype

In vitro lesion dia

(mm)

a Quiescent infection severity

b AFR field incidence

(%)

c d e

Chandler 25.5 2 3.7 3 72.61 1 6 -4.6 Albion 20.2 5 2.3 10 68.15 2 17 -1.5 Seascape 26.0 1 2.9 8 64.32 3 12 -2.9 Camino Real 15.6 8 3.7 3 61.58 4 15 -2.1 Festival 25.2 3 4.3 2 59.21 5 10 -3.5 NCS-03-05 23.5 4 4.7 1 44.1 6 11 -3.2 Pelican 18.1 6 1.3 13 30.14 7 26 1.2 NCL-03-05 15.5 9 2.7 9 26.86 8 26 1.2 Winter Dawn 13.3 12 3.2 6 24.23 9 27 1.3 NCC-99-13 17.5 7 3.0 7 23.57 10 24 0.7 NCL-03-06 12.3 13 3.4 5 22.59 11 29 1.9 NCC-99-27 13.4 11 2.1 11 20.03 12 34 3.3 Bish 14.8 10 1.7 12 12.34 13 35 3.6 NCC-02-63 12.2 14 1.1 14 11.09 14 42 5.5 Mean 18.1 2.9 38.27 22.6 1

Page 10: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Variability in overall resistance explained by true fruit resistance and resistance quiescent infection

a Confidence limit

Resistance type R2 Adjusted

R2

Approx 95% CLa for R2 F-

value

Pr>F

Lower CL Upper CL

Lesion diameter 0.60 0.57 0.16 0.85 18.63 0.0010Quiescent infection severity

0.28 0.23 0.01 0.66 4.78 0.0494

Page 11: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Correlation of field AFR incidence with induced level of defense enzyme

y = -0.0265x + 1.9327R² = 0.6132

0.00

0.50

1.00

1.50

2.00

2.50

0 20 40 60 80

Ch

itin

ase

(μm

ol

NA

GA

/mg

pro

tein

)

Field AFR incidence (%)

Page 12: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Detection and quantification of Colletotrichum spp from

quiescent infections

Page 13: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Development of a real time PCR protocol for QI

Oligonucleotide Sequence (5’ to 3’) Length (bp)

Amplicon length (DMT)b

Sense (ColTqF1) GGCCCTTAAAGGTAGTGGCG 20 95 (0) Sense (ColTqF2) GCTTGGTGTTGGGGCCC 17 127 (1.1) Sense (ColTqF3) GCTTGGTGTTGGGGCCCTAC 20 127(0.6) Anti-sense (ColTqR1) GGTTTTACGGCAAGAGTCCCT 21 - Probe (ColTqP1) CCCTCCCGGAGCCTCCTTTGCGTA 24 - Capture probe TCGCATTTCGCTGCGTTCTTCATCG

ATGCCAGAACCAAGAGA

-

The primer/probe set and capture probe was designed from the consensus sequence using Beacon Designer software from 45 ITS sequences of C. acutatum and C. gloeosporioides. bDMT-Difference in melting temperature of amplicons from C. acutatum and C. gloeosporioides template when reverse primer is used with different combinations of forward primers.

Page 14: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Species discrimination by melt curve analysis

glo GCTTGGTGTTGGGGCCCT ACAGCTGATGT AGGCCCTCAAAGGTAGTGGCGGACCCTCCCG

acu GCTTGGTTTT GGGGCCCCACGGCCGACGTGGGCCCTT AAAGGTAGTGGCGGACCCTCCCG

glo GAGCCTCCTTTGCGTAGTAACTTT ACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT

acu GAGCCTCCTTTGCGTAGTAACT - AACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT

glo AAAACC

acu T AAACC

SNP class Base change Typical Tm melt curve shift

1 C/T and G/A Large (>0.5°C)

2 C/A and G/T

3 C/G

4 A/T Very Small (<0.2°C)

Primer binding site

Page 15: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Melt curve (HRM) analysis in Rotor gene 6000 qPCR system

C. gloeosporioides C. acutatum

Page 16: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Utilization of the tool in assessing field samples

Superior detection capacity

Superior in terms of “sensitivity, specificity and speed”

Lowest detection limit is 5 cfu/1pg

Page 17: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

AFR prediction based on foliar quiescent infection 2009

No

AF

R

Page 18: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Chemical control of AFR 2008

Treatments and rates (units product/A) ScheduleAFRInc (%)

Yield (M) (lb/A)

Not-treated……………………………………. --- 46.72 a 12,685 c

Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lbPristine WG 1.45 lbCaptEvate 68WDG 4.5 lbAbound 25 SC..……………………………….

Spray# 1Spray# 2,4Spray# 3,5,7,9Spray# 6,8

21.60 c 20,151 a

Captan 50WP 4.0 lb + Topsin-M 70 WP 1.1lbPristine WG 1.45 lbCaptEvate 68WDG 4.5 lb…………………….

Spray# 1Spray# 2,4Spray# 3

29.87 bc 18,130 ab

Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lbDistinguish 16 fl. oz…………………………..

Spray#1,3,5,7,9Spray#2,4,6,8

33.89 b 16,832 abc

Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lbAbound 25 SC………………………………..

Spray#1,3,5,7,9Spray#2,4,6,8

44.72 a 16,135 abc

Page 19: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Efficacy of reduced spray schedule and premixed active ingredients ‘09

Fungicide rate (formulation/acre)z* Scheduley AFR Inc(%)w,x

Yield/plant(g)w

Non-treated…………………………………… xxx 37.55 a 233.94 c

Captan 50 WP 4.0 lb + Topsin M 70 W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lbAbound 25 SC..……………………………….

spray #1spray #2,4spray # 3,5,7spray # 6,8

7.19 c 330.06 ab

Captan 50 WP 4.0 lb + Topsin M 70 W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb……………………..

spray #1spray #2,4spray # 3

11.00 bc 329.9 ab

A16001EW 14.0 fl OzCaptan 50 WP 4.0 lb…………………………..

Spray#1,2,4,5Spray#3 19.37 b 283.61 bc

A13703 SC14.0 fl OzCaptan 50 WP 4.0 lb…………………………..

Spray#1,2,4,5Spray#3 15.54 b 392.63 a

A16001EW = a premix of difenoconazole + cyprodinil (Inspire Super).

A13703 = a premix of difenoconazole + azoxystrobin (Quadris Top).

Page 20: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Precision disease management for sustainable strawberry production in the

Southeast U.S/Prediction based spray program

The variable %INF is calculated from the equation:

In (%INF / [1-%INF]) = -3.70 + 0.33W – 0.069WT + 0.0050WT2 – 0.93 x 10 – 4WT3 where W = the duration of a preceding wetness interval and T= mean temperature( 0C) during the interval.

If threshold expressed by %INF is 0.15 will indicate the need for Captan spray

When threshold reaches 0.50 will indicate the need for pyraclostrobin spray

Page 21: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Skybit weather forecast•

E-WEATHER                                               FORECAST AND SUMMARY    For: NC-NEW HANOVER-CASTLE HAYNE                        Date: THU JUN  3, 2010                                                                                                       <----------------- 0-48 HOUR FORECAST---------------->     DATE                          Jun  3                         Jun  4             HOUR (EDT)           8a 11a  2p  5p  8p 11p  2a  5a  8a 11a  2p  5p  8p 11p     ------------------------------------------------------------------------------  TEMP (F)              75  83  86  84  79  75  74  73  75  84  87  85  80  76     2"- SOIL TEMP (F)    77  81  84  86  85  82  78  75  76  80  84  87  86  82     REL HUM (%)          91  71  63  68  79  89  91  95  90  66  58  63  76  89     6HR PRECIP(in)      .00/    .00/    .00/    .00/    .00/    .00/    .00/        6HR PRECIP PROB(%)   19/     13/     22/     13/     16/      9/     23/        3HR EVAP (in)       .02 .06 .11 .10 .04 .00 .00 .00 .01 .07 .12 .10 .04 .02     3HR WETNESS (hrs)     2   2   0   0   0   0   1   3   3   3   0   0   0   0     WIND DIR (pt)       SSW  SW SSW SSW SSW SSW SSW  SW WSW WSW SSW   S SSW  SW     WIND SPEED (mph)      6   9  10  11   8   4   4   5   6   6   7  11   7   3     CLOUD COVER         OVC BKN BKN BKN SCT BKN BKN BKN BKN SCT SCT BKN OVC OVC     3HR RADIATION (ly)    8  88 173 149  59   1   0   0  18 126 208 166  48   0     PCT RADIATION (%)    32  56  71  70  74 100 --- ---  72  79  85  78  60   0     

Page 22: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

W Tln(inf/(1-inf)) inf/(1-inf) INF INF(%)1 20 -3.494 0.030379 0.0295 2.951 25 -3.423125 0.03261 0.0316 3.161 30 -3.451 0.031714 0.0307 3.071 35 -3.647375 0.026059 0.0254 2.541 40 -4.082 0.016874 0.0166 1.665 20 -2.67 0.069252 0.0648 6.485 25 -2.315625 0.098704 0.0898 8.985 30 -2.455 0.085863 0.0791 7.915 35 -3.436875 0.032165 0.0312 3.125 40 -5.61 0.003661 0.0036 0.36

10 20 -1.64 0.19398 0.1625 16.2510 25 -0.93125 0.394061 0.2827 28.2710 30 -1.21 0.298197 0.2297 22.9710 35 -3.17375 0.041846 0.0402 4.0210 40 -7.52 0.000542 0.0005 0.0514 26 0.240048 1.27131 0.5597 55.9715 20 -0.61 0.543351 0.3521 35.2115 25 0.453125 1.573221 0.6114 61.1415 30 0.035 1.03562 0.5087 50.8715 35 -2.910625 0.054442 0.0516 5.1615 40 -9.43 8.03E-05 0.0001 0.0120 20 0.42 1.521962 0.6035 60.3520 25 1.8375 6.280817 0.8627 86.2720 30 1.28 3.59664 0.7824 78.2420 35 -2.6475 0.070828 0.0661 6.6120 40 -11.34 1.19E-05 0.0000 0.00

Page 23: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

HOBO leaf wetness smart sensor

SENSOR

Page 24: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Determination of wetness hours

Page 25: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Prediction based spray schedule

Treatments # of sprays applied

AFR incidence (%)ab

Marketable yield

(lb/plant)b

Non treated control - 8.45 a 0.73 b

Regular Schedule Captan 50WP 4.0 lb + Topsin M 70W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Pristine WG 1.45 lb ………………………

12, 43, 5, 76, 8

3.22 b 0.87 a

Prediction based schedule Captan 50WP 4.0 lb Captan 50WP 4.0 lb Pristine WG 1.45 lb

123 4.43 b 0.75 ab

aDisease incidence was calculated from all harvested fruits over 8 weeksbMeans in a column followed by the same letter are not significantly different by Fisher’s protected LSD test (α ≤ 0.05).

Page 26: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Host Resistance

Integrated Strawberry

Disease ManagementReduced spray

schedule Optimum fertility

Calcinit-Ca(NO3)2

Treatment (rate/A)

Schedule yGray mold

(%)Non-treated… n.a. 17.8 aCaptan + Topsin-MPristine Switch Pristine……..

Spray# 1Spray#2Spray#3Spray# 4

7.3 b

Captan+Topsin-M Pristine Switch……….

Spray# 1Spray# 2,4,6,8Spray# 3,5,7,9

6.1 b ing stock

Removal of senesced tissue &

Sensitive Detection Tool Quiescently

Infected – exclude from planting stock

Infected fruits

Weather based

Prediction

Weather based

Prediction

Weather based

Prediction

Weather based

Prediction

Weather based

Prediction

Weather based

Prediction

Page 27: Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Acknowledgements Mike Carnes and Jim Driver NC strawberry growers association North American Strawberry growers association California strawberry commission Southern region IPM center SkyBit - ZedX, Inc

SkyBit - ZedX, Inc.