JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 1990, p. 1913-19170095-1137/90/091913-05$02.00/0Copyright C 1990, American Society for Microbiology

Vol. 28, No. 9

Rapid and Sensitive Detection of Mycobacterium leprae Usinga Nested-Primer Gene Amplification Assay

BONNIE B. PLIKAYTIS,' ROBERT H. GELBER,23 AND THOMAS M. SHINNICK1*Hansen Disease Laboratory, Division of Bacterial Diseases, Center for Infectious Diseases, Centers for

Disease Control, Atlanta, Georgia 303331; Kuzell Institute for Arthritis and Infectious Diseases,San Francisco, California 941152; and Gillis W. Long Hansen

Disease Center, Carville, Louisiana 7072J3

Received 16 April 1990/Accepted 1 June 1990

By using a set of four nested oligonucleotide primers, a two-step polymerase chain reaction assay for thedetection and identification of Mycobacterium leprae that does not require the use of radioactively labeledhybridization probes was developed. The nested-primer procedure amplified a 347-base-pair product from M.leprae genomic DNA. No amplification products were produced from DNAs of 19 other Mycobacterium species,19 non-Mycobacterium species, mouse cells, or human cells. Minor amplification products were observed withthree additional Mycobacterium species, i.e., "M. lufu," M. simiae, and M. smegmatis. These products wereeasily distinguished from the M. leprae product by size and restriction enzyme cleavage patterns. The assaycould amplify the 347-base-pair product from samples containing as little as 3 fg of M. Ieprae genomicDNA-the amount ofDNA in a single bacillus. The assay also amplified target sequences in crude lysates ofM.Ieprae bacilli isolated from tissue biopsy specimens from infected animals and humans. The entire assay, fromsample preparation to data analysis, can be completed in less than 8 h.

The diagnosis of leprosy is often based solely on theobservation of acid-fast bacilli in a lesion displaying charac-teristic histopathologic features. This is due mainly to theinability to cultivate the etiologic agent of leprosy, Myco-bacterium leprae, in vitro. Such a histopathologic diagnosticprocedure is relatively insensitive and does not give adefinitive identification of the infecting organism as M.leprae. Several attempts have been made in recent years toimprove the sensitivity and specificity of the detection of M.leprae with immunologic, biochemical, and nucleic acidprobes (for a review, see reference 2). For example, Clark-Curtiss and Docherty (3) have described a DNA probe thatcan be used in a dot blot hybridization assay to detect aslittle as 1 pg of purified DNA-the amount of DNA inapproximately 300 bacilli.

Recently, several investigators have studied the use ofpolymerase chain reactions (PCR) to detect mycobacteria.In a PCR-based assay, oligonucleotide primers are used todirect the replication (amplification) of a particular targetsequence to a detectable level (10). With respect to detectingM. leprae, Woods and Cole (18) have described a PCR-basedassay in which a single pair of primers to a portion of the M.leprae groEL gene (also called the 65-kilodalton antigengene) or a single pair of primers to a portion of the M. lepraerepetitive sequence is used. Similarly, Hartskeerl et al. (8)used a single pair of primers to amplify a portion of the geneencoding the M. leprae 36-kilodalton antigen from infectedarmadillo tissue. For another Mycobacterium species, M.tuberculosis, primers to a portion of the groEL gene havealso been used to detect bacilli in pure cultures and in clinicalspecimens including sputa, gastric aspirates, and lymphnode biopsy specimens (1, 7).We also have developed a PCR assay to detect M. leprae,

based on amplification of portions of the M. leprae groELgene. The key difference between this assay and thosepreviously reported is that a set of four nested primers was

* Corresponding author.

used. In this procedure, primers are selected so that thereare two outside primers that will direct the amplification of aportion of the target genome and two inside primers that willdirect the amplification of sequences contained within theproduct defined and produced by the outside primers (for areview, see reference 10). Theoretically, this approachshould increase specificity and sensitivity, since successfulamplification requires binding of four different primers andsince a smaller number of cycles is used with each pair ofprimers, so that background or nonspecific amplificationshould be reduced. Also, this assay does not require the useof radioactive probes. The nested-primer approach may alsoreduce the likelihood of false-positive results due to spuriouscontamination of the samples by the end products of priorpositive amplifications, since a rather small number of cyclesis used in the second round of amplification to produce theend product. Such contamination is likely to be the majorsource of contaminating DNA in a clinical laboratory.

MATERIALS AND METHODSBacterial strains and growth. The strains used in this study

and their sources are listed in Table 1. The Mycobacteriumstrains were maintained in the Centers for Disease Control(CDC) Hansen Disease Laboratory stock culture collectionon Lowenstein-Jensen slants (BBL Microbiology Systems,Cockeysville, Md.) and transferred to TB Broth with 0.2%Tween 80 and supplemented with Middlebrook oleic aciddextrose complex enrichment (Difco Laboratories, Detroit,Mich.). The Rhodococcus and Corynebacterium specieswere grown on brain heart infusion agar (Difco Laborato-ries). The Klebsiella and Pseudomonas species were grownon Trypticase soy agar (BBL Microbiology Systems), andthe Legionella and Bordetella strains were grown on buff-ered charcoal-yeast extract agar (Carr-Scarborough Micro-biological Inc., Decatur, Ga.). The Streptococcus strainswere grown on Trypticase soy agar with 5% sheep blood.

Isolation of DNA. DNA was isolated from M. tuberculosis,M. avium, Mycobacterium bovis BCG, M. fortuitum, and

1913

on Novem

ber 29, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

1914 PLIKAYTIS ET AL.

TABLE 1. Strains

Species Strain Origina SourceSpecies ~~~~~~ofDNAb

Mycobacterium africanumMycobacterium aviumMycobacterium bovisMycobacterium chelonaeMycobacterium fortuitumMycobacterium gordonaeMycobacterium intracellulareMycobacterium kansasiiMycobacterium leprae"Mycobacterium lufu'Mycobacterium marinumMycobacterium microtiMycobacterium nonchromo-genicum

Mycobacterium phleiMycobacterium scrofulaceumMycobacterium simiaeMycobacterium smegmatisMycobacterium szulgaiMycobacterium tuberculosisMycobacterium ulceransMycobacterium vaccaeICRC bacillusMycobacterium sp.Aerococcus viridansBordetella bronchisepticaCandida albicansClostridium perfringensCorynebacterium pseudo-

tuberculosisCorynebacterium xerosisEnterococcus casseliflavusEnterococcus malodoratusKlebsiella pneumoniaeLegionella pneumophilaNeisseria meningitidisPediococcus pentosaceusPseudomonas aeruginosaRhodococcus equiRhodococcus rubropestuctusRhodococcus sputiStaphylococcus aureusStaphylococcus epidermidisStreptococcus pyogenes

TMC 5122TMC 724BCG-RosenthalTMC 1544TMC 1529TMC 1324TMC 1406TMC 1204

TMC 1218TMC 1601TMC 1481

TMC 1548TMC 1316

607954H37RaTMC 1617TMC 1526

w

11563F6286H317

F8271

F3785SS937SS12264809-84P-1M1027SS12598570036001655001136

SS91

1 B1 A,B2 A,B1 B1 A,B1 B1 B1 B

A, B12 B1 B1 B1 B

1 B1 B3 B4 B5 B1 A,B1 B1 B6 B7 B8 A9 B8 A8 A10 B

10 B8 A8 A9 B9 B8 A8 A9 B5 B5 B5 B8 A8 Ail B

a 1, D. D. Gwinn, National Institute of Allergy and Infectious Diseases,Bethesda, Md.; 2, Sol R. Rosenthal, University of Illinois Research Founda-tion, Chicago; 3, M. J. Colston, MRC, London, England; 4, NormanMorrison, Johns Hopkins University, Baltimore, Md.; 5, Ray Butler, Divisionof Bacterial Diseases, CDC; 6, C. V. Bapat, Indian Cancer Research Center(ICRC), Bombay, India; 7, P. Talwar, National Institute of Immunology, NewDelhi, India; 8, Steve O'Connor, Division of Bacterial Diseases, CDC; 9,Jacquelyn Sampson, Division of Bacterial Diseases, CDC; 10, RobertWeaver, Division of Bacterial Diseases, CDC; 11, Richard Facklam, Divisionof Bacterial Diseases, CDC; 12, Daniel L. Shunga, Merck Institute forTherapeutic Research, Rahway, N.J.

b A, CsCl-purified DNA; B, crude cell lysate prepared as described inMaterials and Methods.

C The precise taxonomic position of "M. lufu" is uncertain, although it isclearly a Mycobacterium species (4, 11). Preliminary studies suggest that itbelongs to the M. avium complex (R. C. Good, personal communication).

armadillo-grown M. leprae and was purified on CsCl gradi-ents by published procedures (17). CsCl-purified DNAs fromAerococcus, Candida, Clostridium, Neisseria, Enterococ-cus, Pediococcus, and Staphylococcus species were ob-tained from Steve O'Connor, Division of Bacterial Diseases,CDC. HeLa cell DNA was isolated and purified by phenol-chloroform extraction and ethanol precipitation.

TABLE 2. Sequences of oligonucleotide primersSpecies and Residue' Sequenceprimer'

M. lepraeL1 1236-1253 GTGGCTCAGATCCGTACCL2 1813-1792 (C) ATGCCACCGGTCGGGTCGCTCGL3 1458-1476 CTACAGGCTGCTCCGGCTCL4 1804-1782 (C) GTCGGGTCGCTCGCCGGAGCTGC

M. tuberculosisTi 1281-1298 GTGGCCCAGATCCGCCAGT2 1856-1837 (C) CATGTCGCCGCCACCGGGAAT3 1503-1521 TTGCAAGCGGCCCCGACCCT4 1846-1827 (C) CCACCGGGAACGGAAGCCTT

a The primer sequence is found in the groEL gene sequence of the indicatedspecies.

b Residue numbers are listed by using the numbering scheme ofMehra et al.(9) for M. Ieprae and Shinnick (14) for M. tuberculosis. C indicates that theprimer sequence corresponds to the complement of the indicated residues.The sequences are written in the 5' to 3' direction.

Preparation of crude lysates of bacterial suspensions. Ap-proximately 5 x 10' cells were harvested from liquid cul-tures by centrifugation, suspended in 500 ,uI of 10 mM Trishydrochloride (pH 8.0)-i mM EDTA-10 mM NaCÎ, andtransferred to a 1.5-ml screw-top plastic microfuge tubecontaining 500 itl of siliconized 0.1-mm-diameter glass beadsand 250 ,ul of chloroform. The mixture was homogenized for2 min at room temperature; a Mickle apparatus (H. Mickle,Gomshell Surrey, England) was used to disrupt the cells.Two minutes of homogenization was sufficient to break>90% of the bacilli, as determined by microscopy. The glassbeads were allowed to settle out, and the aqueous superna-tant was transferred to a fresh tube and boiled for 10 min.Twenty micrograms of RNase (Sigma Chemical Co., St.Louis, Mo.) was added to each sample, and the sampleswere incubated at 37°C for 30 min. Portions of the crudelysates were electrophoresed on 0.75% agarose gels contain-ing 0.75 ,ug of ethidium bromide per ml to estimate DNAconcentration.

Processing of tissue samples. Tissue homogenates of mousefootpad tissue, armadillo lung tissue, and five biopsy speci-mens from three lepromatous leprosy patients were preparedas previously described (12, 13). Briefly, the tissue wasminced and then homogenized in a Mickle apparatus for 1min in the presence of 3-mm-diameter glass beads in 2 ml ofHanks balanced salt solution. Bacteria were harvested fromthe tissue homogenates by centrifugation, and crude bacte-rial lysates were prepared as described above, except thatchloroform was not present during the homogenization stepand the samples were not treated with RNase.

Oligonucleotide primers. Primers corresponding to por-tions of the sequence of the M. leprae (Li through L4) andM. tuberculosis groEL (Tl through T4) genes were synthe-sized and provided by Brian Holloway, CDC. The primerscorresponded to sequences present in the M. leprae gene butnot in the M. tuberculosis gene or vice versa. The sequencesand locations of these primers are listed in Table 2. PrimersL1 and L2 should amplify a 578-base-pair (bp) piece of theM. leprae groEL gene, and L3 and L4 should amplify a347-bp piece of this 578-bp product. Primers Tl and T2should amplify a 576-bp piece of the M. tuberculosis groELgene that contains sites for primers T3 and T4, which shouldamplify a 344-bp piece.PCR. The template DNA in 10 ,uI of H20 was added to 90

,uI of reaction mix containing each deoxynucleoside triphos-

J. CLIN. MICROBIOL.

on Novem

ber 29, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

NESTED-PRIMER PCR FOR M. LEPRAE 1915

1 9 .r 4 5 g

578bp-%-

347bp-_-

A B

FIG. 1. Amplification of M. Ieprae DNA by using primers Lithrough L4. (A) One nanogram of M. leprae CsCl-purified genomicDNA was amplified with primers Li and L2 (lane 1) or primers L3and L4 for 25 cycles (lane 2) or with primers LM and L2 for 25 cyclesfollowed by L3 and L4 for 15 cycles (lane 3). Size markers are apBR322 Hinfl digest (lane 4). (B) Samples were amplified withprimers LM and L2 for 25 cycles and L3 and L4 for 15 cycles. TargetDNA was used as follows: Lane 1, 1 pg; lane 2, 0.4 pg; lane 3, 0.2pg; lane 4, 0.1 pg; lane 5, none. Lanes 6 and 7, The amplificationproducts after 30 cycles in round 1 and 30 cycles in round 2 startingwith 0.1 pg of DNA (lane 6) or 0.003 pg of DNA (lane 7).

phate at 200 ,uM, each primer at 1.0 puM, 2.5 U of Taqpolymerase, 10 mM Tris hydrochloride (pH 8.3), 50 mMKCl, 1.5 mM MgCl2, and 0.01% gelatin as recommended bythe GeneAmp Kit manufacturer (Perkin Elmer Cetus, Nor-walk, Conn.). The amplifications were carried out in aprogrammable thermal controller (MJ Research, Watertown,Mass.) in a two-step cycle of 75 s at 94°C followed by 3 minat 68°C. The samples were usually amplified through 25cycles by using the outside pair of primers (Li and L2); 10%of the amplified mixture was then transferred to a fresh tubecontaining reaction mixture with the inside primers (L3 andL4). The second amplification was usually allowed to pro-ceed through 15 cycles. Ten microliters of the reaction mixwas electrophoresed on 1.5% agarose gels, and the reactionproducts were visualized by ethidium bromide fluorescence.

Restriction enzyme digestion. Nucleic acids were recov-ered from the reaction mixture by chloroform extractionfollowed by ethanol precipitation. Each sample was sus-pended in 20 pl of 10 mM Tris-i mM EDTA (pH 8.0), and 5,ul of the suspension was digested with PstI (InternationalBiotechnologies, Inc., New Haven, Conn.) or RsaI (Be-thesda Research Laboratories, Gaithersburg, Md.), as de-scribed by the supplier. The digested DNA was electro-phoresed on 1.5% agarose gels and visualized by ethidiumbromide fluorescence.

RESULTS

Amplification of M. leprae DNA using primers Lt throughL4. CsCl-purified M. leprae genomic DNA (1 ng) wasamplified with each pair of primers for 25 cycles. As ex-pected, primers Li and L2 produced a 578-bp fragment (Fig.1A, lane 1), and primers L3 and L4 generated a 347-bpfragment (Fig. 1A, lane 2). A 347-bp band was also producedwhen 1 ng of M. leprae DNA was amplified by the nestedprimer procedure (Fig. 1A, lane 3). To confirm that the347-bp product did correspond to the expected portion of theM. leprae groEL gene, the amplified product was digestedwith either PstI or RsaI. PstI digestion yielded 254- and

347bp _ I -

FIG. 2. Specificity of M. leprae primers in the presence ofextraneous DNA. Each template was amplified through 25 cycles inround 1 and 15 cycles in round 2, by using the indicated primers.Lane 1, 1 ng of M. tuberculosis genomic DNA, primers Ti throughT4; lane 2, 25 ng of M. tuberculosis genomic DNA, primers Lithrough L4; lane 3, 1 pug of M. tuberculosis genomic DNA plus 10 pgof M. leprae genomic DNA, primers Li through L4; lane 4, 1 ng ofM. leprae genomic DNA, primers Li through L4; lane 5, 1 p.g ofHeLa cell DNA, primers Li through L4; lane 6, 1 ,ug of HeLa cellDNA plus 0.03 pg ofM. leprae genomic DNA (101 HeLa genomes to1 M. leprae genome), primers Li through L4.

93-bp fragments, and RsaI digestion yielded 193- and 154-bpfragments, as predicted from the sequence of the M. lepraegene (data not shown).

Sensitivity of the nested-primer assay. Serial twofold dilu-tions of M. leprae genomic DNA (1 ng to 3 fg) were amplifiedfor 25 cycles in the first round and 15 cycles in the secondround. The 347-bp product was observed starting with aslittle as 0.2 pg of purified genomic DNA (Fig. 1B, lane 3).Given that the M. leprae genome has a size of 2.2 x 109daltons or a weight of -0.0036 pg (5), 0.2 pg correspondswith the amount of DNA in -60 cells. By increasing thenumber of cycles to 30 in both the first and second rounds,positive signals could be generated with as little as 0.003 pgof genomic DNA (Fig. 1B, lane 7). Of course, not all samplescontaining 0.003 pg of DNA produced a positive result. Infact, the distribution of positive and negative results insamples containing 0.003 pg of DNA was consistent with aPoisson distribution for a single target (i.e., single genome)in these samples (data not shown). Thus, it appears that theprocedure is capable of detecting a single target sequence ina sample.

Specificity of the nested-primer assay. As an initial test ofspecificity, 25 ng of CsCl-purified M. tuberculosis genomicDNA or 1 ,ug of purified DNA from HeLa cells was amplifiedby using primers L1 through L4. No amplified products wereobserved with M. tuberculosis DNA (Fig. 2, lane 2) orhuman DNA (Fig. 2, lane 5); the expected products wereamplified from 1 ng of M. leprae DNA (Fig. 2, lane 4) (the M.tuberculosis DNA used here was amplifiable, since primersTi through T4 [Table 2] were able to amplify the expected344-bp band from 1 ng of M. tuberculosis DNA; Fig. 2, lane1). In addition, primers L1 through L4 could specificallyamplify M. leprae target sequences in mixtures containingthese DNAs. That is, primers Li through L4 were able toamplify the M. leprae sequences from samples containing M.leprae genomic DNA and either M. tuberculosis or human

VOL. 28, 1990

on Novem

ber 29, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

1916 PLIKAYTIS ET AL.

123 4 i 2 ;3 4 45 `u

13

* f2f .s1 i {

FIG. 3. Cross-reactivities of the M. leprae-nested primers. (A)Amplification products obtained by using primers Li and L2 (25cycles) and L3 and L4 (15 cycles) and crude cell lysates from"M. lufu" (lane 1), M. smegmatis (lane 2), M. simiae (lane 3), andM. Ieprae (lane 4). (B) Amplification products by using primers Liand L2 (25 cycles) and L3 and L4 (15 cycles) and mixturescontaining 0.2 pg of a control plasmid, pRL47, and portions (_105cells) of cell lysates of M. avium (lane 1), M. bovis BCG (lane 2),M. fortuitum (lane 3), M. gordonae (lane 4), M. microti (lane 5),Bordetella bronchiseptica (lane 6), or Rhodococcus equi (lane 7).The plasmid contains the binding sites for primers Li through L4and a 70-bp internal deletion which allows its amplification product(277 bp) to be distinguished from that of M. Ieprae genomic DNA(347 bp) (lane 8).

DNA at ratios as high as 105 foreign genomes to 1 M. lepraegenome (Fig. 2, lanes 3 and 6). Thus, not only do Li throughL4 seem to be specific for M. leprae, but large amounts ofextraneous DNA do not appear to interfere with the ampli-fication of the M. Ieprae target sequences.The species specificity of primers Li through L4 was

further assessed in nested primer amplifications of 41 speciesof bacteria. In these studies, the starting templates were 1 jxg(four Mycobacterium species) or 1 ng (nine non-Mycobacte-rium species) of CsCl-purified DNA (Table 1) or portions ofcrude lysates containing DNA from i105 bacteria (22 My-cobacterium and 10 non-Mycobacterium species) (Table 1).The crude bacterial lysates were made by homogenizationwith 0.1-mm-diameter glass beads, as described in Materialsand Methods. None of these amplifications produced the347-bp M. leprae product. However, assays of three of thespecies, "M. lufu," M smegmatis, and M. simiae, did yielddetectable products. The products were 750, 1600 and 500,and 350 bp, respectively (Fig. 3A, lanes 1 through 3). Eachcould be easily distinguished from the M. leprae product bysize or restriction fragment pattern produced by RsaI or PstI(data not shown).To ensure that the crude lysates did not contain a compo-

nent(s) that inhibited amplification, 0.2 pg of a control DNAwas added to each of seven of the cell lysates, and theamplification reactions were then carried out in the usualmanner. The control DNA was a plasmid (pRL47) carrying a

690-bp fragment of the M. leprae groEL gene that containsthe binding sites for all four primers and a 70-bp internaldeletion (residues 1514 through 1583). This deletion allowsthe products of the amplification of the control DNA (508and 277 bp) to be easily distinguished from the amplifiedproducts of M. Ieprae genomic DNA (578 and 347 bp). In allseven reactions, amplification of the 277-bp fragment was

accomplished at an expected rate of efficiency (Fig. 3B,

FIG. 4. Amplification of M. leprae from tissue homogenates.Lanes 1 through 3 show the amplification products using primers Liand L2 for 25 cycles followed by L3 and L4 for 15 cycles and a crudelysate of acid-fast bacilli harvested from an M. leprae-infectedmouse footpad (lane 1), a biopsy specimen from a lepromatousleprosy patient (lane 2), and a biopsy of lung tissue from a tubercu-losis patient (lane 3). Lane 4 contains the amplification product byusing M. tuberculosis primers Tl through T4 and the lysate from thetuberculosis patient biopsy.

lanes 1 through 7). Thus, the crude lysates did not contain acomponent that inhibited the amplification process.

Detection of M. leprae in tissues. Bacilli were harvestedfrom tissues of infected mice, and crude lysates of the bacilliwere prepared as described in Materials and Methods.Portions of the lysates were then assayed by the nested-primer procedure. The expected 347-bp amplification prod-uct was obtained when 10 ,ul of the cell lysates (Fig. 4, lane1), as well as dilutions of the lysate, was used. Positivesignals were generated in dilutions containing as few as 1,000bacilli. By increasing the number of cycles, the detectionlimit improved to 20 organisms per sample. Thus, amplifica-tion of target sequences in crude lysates appears to be about20-fold less sensitive than amplification of purified DNA.

Primers Li through L4 could also amplify M. lepraesequences that had been recovered from tissue homogenatesof five biopsy specimens from three lepromatous leprosypatients. Approximately 105 to 106 bacilli were harvestedfrom each of the homogenates by centrifugation, and crudebacterial lysates were made as described in Materials andMethods. Portions of the crude lysates were then amplifiedwith the nested primers Li through L4. The 347-bp amplifi-cation product was obtained in samples of each of the fivehomogenates. A representative amplification product isshown in Fig. 4, lane 2. As negative controls for thisexperiment, lung biopsy specimens from three tuberculosispatients previously shown to contain M. tuberculosis byculture and microscopy were amplified by using the nestedprimers Li through L4. None of these biopsy samplesproduced an amplification product (Fig. 4, lane 3). However,each of the lung specimens was positive for M. tuberculosiswhen tested with the M. tuberculosis nested primers Tithrough T4 in a PCR-based assay (Fig. 4, lane 4).

("4bp34''hp>S 34 rLw

A

J. CLIN. MICROBIOL.

on Novem

ber 29, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

NESTED-PRIMER PCR FOR M. LEPRAE 1917

DISCUSSION

The groEL gene was chosen as the target for amplificationbecause its nucleotide sequence had been determined forboth M. leprae and M. tuberculosis (9, 14). Therefore,sequences that were different between the two species andthat therefore might be specific for each could be identified.Also, since this gene is highly conserved (15) and appears tobe required for viability in bacteria (6), there is strongselective pressure to maintain the amino acid sequence ofthe GroEL protein. In addition, it appears that the M. lepraegenome is exceedingly stable. Clark-Curtiss and Walsh (5)estimate that there is only 0.25% sequence variation amongthe four M. leprae isolates examined. This suggests that thesequence of the groEL gene should be quite stable, andfalse-negative results due to mutation should be rare.A nested-primer amplification approach was used to in-

crease specificity and sensitivity, to avoid the use of radio-active probes, and to shorten the time required to obtain aresult. Sensitivity and specificity are increased because (i)successful amplification requires the binding of four primers;(ii) fresh reagents are added after 25 cycles; and (iii) back-ground bands are reduced, since each pair of primers isresponsible for only a small number of amplification cycles.In addition, by using nested primers, a sensitivity of detec-tion comparable to that obtained by using 32P-labeled hybrid-ization probes to detect the amplification products can beobtained. Thus, the use of radioactivity (and concerns re-garding the shelf-life of a radioactive reagent) as well as theneed to transfer the products to nitrocellulose and performhybridization reactions and autoradiography is avoided.This, in turn, reduces to some extent the amount of experi-mental manipulation required and the overall time for anal-ysis. The entire nested-primer assay, from preparation of thecrude lysate to analysis of the gel, can be finished in less than8 h, in contrast to the 24 to 48 h needed for the PCR assaysinvolving radioactive probes (1, 7).The specificity of the assay was assessed by using 22

Mycobacterium species and 19 non-Mycobacterium species.These particular species were chosen for study because theyare phylogenetically closely related to M. leprae or they arespecies that might be found in clinical samples such as sputa,nasal secretions, or skin biopsies. None of these organismsproduced the 578- or 347-bp M. leprae product; however,"M. lufu" produced a moderate amount of a 750-bp product,and M. simiae and M. smegmatis produced marginally vis-ible amounts of a 350-bp product and 1,600- and 500-bpproducts, respectively. The cross-reactivities with "M.lufu" and M. simiae are curious, since "M. lufu" has beenused as a model system for antileprosy drug studies (11) andM. simiae has been reported to share antigenic determinantswith M. leprae and to provide immunologic protectionagainst M. leprae infection (16). Although the origin of thesebands is uncertain, they should not be confused with theexpected amplification products, since they are easily distin-guished by their sizes and by fragments produced by therestriction enzyme PstI or RsaI.

Overall, the results indicate that nested-primer PCR canbe used to specifically amplify sequences of M. leprae. Theassay can detect as few as 20 organisms in crude lysateswithout the need to purify the DNA or use radioactiveprobes, when a total of 60 cycles of amplification is used.This is much more sensitive than clinical tests currently inuse. Moreover, the test identifies the organism in the sampleas M. leprae. Thus, the results reported here are quite

encouraging for the potential use of PCR technology in therapid detection and definitive identification of small numbersof M. leprae in clinical specimens.

ACKNOWLEDGMENTS

We thank Ray Butler, Jacquelyn Sampson, Robert Weaver, andRichard Facklam for providing cultures; Steve O'Connor for pro-viding purified DNA; Vijay Varma for providing clinical specimens;Rosalind Van Landingham and Laura Walker for providing mousetissue homogenates; and Sathish Mundayoor for providing pRL47DNA.

LITERATURE CITED1. Brisson-Noel, A., B. Gicquel, D. Lecossier, V. Levy-Frebault, X.

Nassif, and A. J. Hance. 1989. Rapid diagnosis of tuberculosis byamplification of mycobacterial DNA in clinical samples. Lancetii:1069-1071.

2. Clark-Curtiss, J. E. 1988. Benefits of recombinant DNA tech-nology for the study of Mycobacterium leprae. Curr. Top.Microbiol. Immunol. 138:61-79.

3. Clark-Curtiss, J. E., and M. A. Docherty. 1989. A species-specific repetitive sequence in Mycobacterium leprae DNA. J.Infect. Dis. 159:7-15.

4. Clark-Curtiss, J. E., W. R. Jacobs, M. A. Docherty, L. R.Ritchie, and R. Curtiss III. 1985. Molecular analysis ofDNA andconstruction of genomic libraries of Mycobacterium leprae. J.Bacteriol. 161:1093-1102.

5. Clark-Curtiss, J. E., and G. P. Walsh. 1989. Conservation ofgenomic sequences among isolates of Mycobacterium leprae. J.Bacteriol. 171:4844-4851.

6. Fayet, O., T. Ziegelhoffer, and C. Georgopoulos. 1989. ThegroES and groEL heat shock gene products of Escherichia coliare essential for bacterial growth at all temperatures. J. Bacte-riol. 171:1379-1385.

7. Hance, A. J., B. Grandchamp, V. Levy-Frebault, D. Lecossier, J.Rauzier, D. Bocart, and B. Gicquel. 1989. Detection and identi-fication of mycobacteria by amplification of mycobacterialDNA. Mol. Microbiol. 3:843-849.

8. Hartskeerl, R. A., M. Y. L. De Wit, and P. R. Klatser. 1989.Polymerase chain reaction for the detection of Mycobacteriumleprae. J. Gen. Microbiol. 135:2357-2364.

9. Mehra, V., D. Sweetser, and R. Y. Young. 1986. Efficientmapping of protein antigenic determinants. Proc. Natl. Acad.Sci. USA 83:7013-7017.

10. Mullis, K. B., and F. A. Faloona. 1987. Specific synthesis ofDNA in vitro via a polymerase-catalyzed chain reaction. Meth-ods Enzymol. 155:335-350.

11. Seydel, J. K., and E. G. Wempe. 1982. Bacterial growth kineticsof 'M. lufu' in the presence and absence of various drugs aloneand in combination. A model for the development of combinedchemotherapy against M. Ieprae. Int. J. Lepr. 50:20-30.

12. Shepard, C. C., and D. H. McRae. 1968. A method for countingacid-fast bacteria. Int. J. Lepr. 36:78-82.

13. Shepard, C. C., R. Van Landingham, and L. L. Walker. 1980.Searches among mycobacterial cultures for antileprosy vac-cines. Infect. Immun. 29:1034-1039.

14. Shinnick, T. M. 1987. The 65-kilodalton antigen of Mycobacte-rium tuberculosis. J. Bacteriol. 169:1080-1088.

15. Shinnick, T. M., M. H. Vodkin, and J. C. Williams. 1988. TheMycobacterium tuberculosis 65-kilodalton antigen is a heatshock protein which corresponds to Common Antigen and tothe Escherichia coli GroEL protein. Infect. Immun. 56:446 451.

16. Singh, N. B., A. C. R. E. Lowe, R. J. W. Rees, and M. J.Colston. 1989. Vaccination of mice against Mycobacteriumleprae infection. Infect. Immun. 57:653-655.

17. Wayne, L. G., and W. M. Gross. 1968. Isolation of deoxyribo-nucleic acid from mycobacteria. J. Bacteriol. 95:1481-1482.

18. Woods, S. A., and S. T. Cole. 1989. A rapid method for thedetection of potentially viable Mycobacterium leprae in humanbiopsies: a novel application of PCR. FEMS Microbiol. Lett.65:305-310.

VOL. 28, 1990

on Novem

ber 29, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from