i

ISOLATION, CLONING AND SEQUENCING OF VITAMIN A,

VITAMIN C AND FOLATE GENES (cDNA) FROM SEA

BUCKTHORN (HIPPOPHAE RHAMNOIDES L.) FRUIT

BERRIES

SHAZIA ARIF

(Reg. No. 2001-URTB-3139)

Session 2008-2011

ii

Department of Plant Breeding and Molecular Genetics Faculty of

Agriculture, Rawalakot University of Azad Jammu & Kashmir

ISOLATION, CLONING AND SEQUENCING OF VITAMIN

A, VITAMIN

ISOLATION, CLONING AND SEQUENCING OF VITAMIN

A,

VITAMIN C AND FOLATE GENES (cDNA) FROM SEA BUCKTHORN

(HIPPOPHAE RHAMNOIDES L.) FRUIT BERRIES

By

SHAZIA ARIF

(Reg. No. 2001-URTB-3139)

(M.Sc. (Hons.) Plant Breeding and Molecular Genetics

A thesis submitted in partial fulfillment of the requirement for the degree

of

Doctor of Philosophy

In

Plant Breeding and Molecular Genetics

iii

Session 2008-2011

Department of Plant Breeding and Molecular Genetics

FACULTY OF AGRICULTURE, RAWALAKOT THE

UNIVERSITY OF AZAD JAMMU AND KASHMIR

“In the name of ALLAHA, the most Beneficent, the

most Merciful”

iv

v

vi

DEDICATION

I dedicate this humble effort to

my affectionate and loving

Parents, my late brother, my

husband, my Brother & Sisters

TABLE OF CONTENTS

Sr. No. Page No.

I Title page ii

II Certification iii

III Declaration iv

IV Dedication v

V Table of contents v

VI List of Tables xi

VII List of Figures xii

VIII Abbreviations xxii

vii

IX Acknowledgement xxviii

X Abstract xxx

01 CHAPTER 1 01

01 GENERAL INTRODUCTION 01

1.1 Sea buckthorn (Hippophae rhamnoides) 01

1.2 Origin and History. 02

1.3 Chemical composition and Nutritional value 03

1.4 Vitamins 05

1.4.1 Ascorbic Acid 05

1.4.2 Caroteniods and Tocopherols 06

1.4.3 Flavonoids 08

1.4.4 Folate 09

1.5 Amino acids 10

1.6 Scope 11

1.7 OBJECTIVES 15

02 CHAPTER 2 16

02 ASCORBATE OXIDASE (AO) GENE (Abstract) 16

2.1 INTRODUCTION 17

2.2 MATERIALS AND METHODS 21

2.3 Designing of Primers 22

2.4 RNA isolation protocol (TRIzol® Reagent) 23

viii

2.5 Rapid Amplification of cDNA Ends (RACE-PCR) 23

2.6 RT-PCR Amplification Protocol for Hr-AO cDNA 24

2.7 Gene purification 25

2.8 Gene Cloning protocol 27

2.8.1 TA cloning Vector 27

2.8.2 Set up the ligation reaction 27

2.8.3 Host Cells 28

2.8.4 Electroporation of E. coli: 28

2.8.5 E. coli cells Preparation for Electroporation. 30

2.8.6 Colony PCR procedure 32

2.8.7 Plasmid DNA extraction 33

2.8.8 Plasmid PCR and sequencing 35

2.8.9 Gateway cloning 36

2.8.10 Gateway® Entry Clone 36

2.8.11 LR Reaction. 40

2.8.12 Transformation 41

2.9 AO gene expression analysis 42

2.9.1 Semi-quantitative RT-PCR 42

2.9.2 ATGene (Arabidopsis thaliana AO gene) expression Pattern 43

2.10 RESULTS 43

ix

2.10.1 Isolation and sequence analysis of large fragment of AO cDNA

from sea buckthorn

43

2.10.2 Gate way cloning 46

2.10.3 Differential expression of AO gene 47

2.10.4 Phylogenetic analysis 50

2. 11 DISCUSSION 54

2.12 CONCLUSIONS 58

03 CHAPTER 3 59

03 FOLATE (HPPK-DHPS) GENE (Abstract) 59

3.1 INTRODUCTION 60

3.2 MATERIALS AND METHODS 65

3.2.1 Plant Material 65

3.2.2 Designing of Primers 65

3.2.3 DNA Extraction 66

3.2.4 PCR Amplification and Molecular Cloning 67

3.2.5 Isolation of RNA and expression Analysis 67

3.2.6 ATGene (Arabidopsis thaliana gene) expression evaluation for

HPPK-DHPS

68

3.2.7 Sequence Analysis and Phylogenetic Reconstruction 69

3.2.8 Homology Modeling and Protein Structure Prediction 70

x

3.3 RESULTS 71

3.3.1 Amplification of HrHPPK-DHPS Gene from Sea buckthorn 71

3.3.2 HPPK-DHPS is differentially expressed in Sea buckthorn tissues 72

3.3.3 Sequence analysis of HPPK-DHPS identified

from sea buckthorn

75

3.3.4 Phylogenetic reconstruction of HPPK-DHPS Genes 79

3.3.5 Tertiary structure of Folate protein 81

3.4 DISCUSSION 83

3.5 CONCLUSIONS 88

04 CHAPTER 4 88

04 CAROTENIODS BIOSYNTHESIS GENES (LCY-β AND PSY)

(Abstract)

89

4.1 INTRODUCTION 90

4.2 MATERIALS AND METHODS 95

4.2.1 Plant Material 95

4.2.2 Designing of Primers 95

4.2.3 RNA extraction and PCR Amplification 96

4.2.4 Expression analysis of Genes 97

4.2.5 ATGene (Arabidopsis thaliana Gene) expression analysis of LCY

and PSY

98

4.2.6 Molecular Cloning and Sequence analysis 99

4.3 RESULTS 100

xi

4.3.1 Isolation of Hr-Lcyb and Hr-Psy Genes 100

4.3.2 Differential Gene Expression Analysis 102

4.3.3 Sequence analysis 106

4.3.4 Phylogenetic Analysis 114

4.4 DISCUSSION 117

4.5 CONCLUSIONS 122

4.6 General summary 123

4.7 Conclusions and future recommendations 127

4.8 List of published papers and books 129

05 CHAPTER 5 131

05 Literature cited 131

LIST OF TABLES

Table No. Page No

2.1 Comparative list of the Vitamin C contents in sea buckthorn berries,

seed oil and pulp.

20

2.2. Detail of Primers used in this study for H. rhamnoides AO cDNA

cloning, expression analysis (RT-PCR) and Gateway cloning.

22

xii

2.3. Overview of different AO genes, function and expression in specific

tissues with their reference source.

50

2.4 List showing organisms and accessions used in phylogenetic tree

construction.

3. 1. Detail of Primers used for Hr-HPPK-DHPS gene amplification and

expression studies.

66

4.1. Constituents of sea buckthorn Fruit 94

4.2. Detail of Primers used in this study for H. rhamnoides Lcy and Psy

cDNA cloning and expression analysis (RT-PCR)

96

LIST OF FIGURES

Figure No.

Page No.

2.1 Structure of ascorbic acid (a) ascorbic acid (reduced form), (b)

dehydroascorbic acid (oxidized form).

17

2.2. Map of Vector pTZ57R/T used for TA cloning purpose. 27

2.3. The map of pDONAR™201 vector used in gateway cloning. 38

2.4 Map of the destination vector used in Gateway cloning. 41

xiii

2.5 (a) Isolation of high quality total RNA from sea buckthorn tissues. (b)

Amplification of Hr-AO gene using RACE technique of PCR. (c) PCR

confirmation of the clones carrying recombinant plasmids with M13 and

short internal primers. M=1Kb DNA ladder.

44

2.6 Alignment of Hr-AO and S. lycopersicum nucleotide sequences with

Mac VectorTM 7.2.3. (Accerlrys Inc.)Gcg/Wisconsin pakage university

of Wisconsin). The top sequence is that of tomato AO and the bottom

HrAO-Like. The identical bases are shown against a black background.

45

2.7 (a) Amplification of Hr-AO product by standard PCR with gateway

primers. (b). Gel showing pDONAR recombinant plasmids. (c&d) The

pDEST vector pXCG-mYFP (51delta 35s) SB512 colony and plasmid

46

PCR confirmation respectively. (e) Stable integration of AO-PB clones

carrying the recombinant plasmid into destination vector. (f) pDEST AO

recombinant plasmid confirmation through PCR. M= 1 kb marker.

2.8 Hr-AO transcript amplifications in vegetative bud, shoot apex, green leaf,

green fruit and mature orange red fruit tissues of sea buckthorn through

semi quantative RT-PCR in comparisons with control Actin gene. Actin

gene is used as control, to check equal loading and PCR quality check.

47

xiv

2.9 Arabidopsis thaliana AO (AT5G21100) gene expression pattern from

global data set of microarray under different conditions: (a) in different

plant tissues, (b) hormonal conditions, (c) Abiotic stress, and (d) light

exposures respectively.

48

2.10 Phylogenetic reconstruction of ascorbate oxidase gene from different

species. Neighbor joining tree was made by means of MEGA5 software.

The Value on each node indicated bootstraps replication of 1000. This

species along with accession used in tree includes AY971876-

L.esculentum-AO, XM_002528929-R.communis-AO,

XM_003532792G.max-L-AO XM_003638399-M.truncatula-AO,

Y15295-M. truncatulaL-AO, AB457618-P.sativum-AO, AF529300-

G.max-AO, D43624-

N.tabacum-AO, XM_002312802-P.trichocarpa-AO, XM_003555611-

G.max-AO, NM_197271-O.sativa-AO, NM_147871-A.thaliana-AO,

NM_001203424-A.thaliana-AO, AY099586-A.thaliana-AO, BT003407-

A.thaliana-AO, XM_003336029-P.graminis-AO,

XM_003713188M.oryzae-AO, XM_001875289-L.bicolor-AO, AF206722-

B.juncea-AO,

53

D55677-C.maxima-AO, X55779-Pumpkin-AO, AF233594- C.melo-AO,

J04494-Cucumber-AO, FR750377-C.sativus-AO, Y10226-C.melo-AO,

AB004798-A.thaliana-AO, B1698178-I.pine-AO, FJ896040-F.ananassa-

AO, EF528482-M.domestica-AO and Gu321223-M.pumila-AO

3.1 Structure of Folate (a) and 5-methyltetrahydrofolate(b) found in sea

buckthorn.

60

xv

3.2 The systematic presentation of plant folate biosynthesis pathway. The

main pathway enzymes includes 1, GTP cyclohydrolase I; 2, nudix

hydrolase; 3, non-specific phosphatase; 4, DHN aldolase; 5, ADC

synthase; 6, ADC lyase; 7, HPPK-pyrophosphokinase; 8, dihydropteroate

synthase; 9, dihydrofolate synthase; 10, dihydrofolate reductase; 11,

folylpolyglutamate synthase. 12,DHN, dihydroneopterin; 13, ADC,

aminodeoxychorismate; 14, PABA, p-aminobenzoate, 15,-PPP

triphosphate.

62

3.3 Amplification of HrHPPK-DHPS gene. (a) Image of Genomic DNA

isolated from three different sea buckthorn samples (S1, S2, S3) run along

1kb DNA ladder. (b), PCR amplification of full length sequence of folate

gene (HPPK-DHPS) from sea buckthorn genomic

DNA. M= 1kb DNA ladder.

71

3.4 Cloning of HrHPPK-DHPS gene. (a) Positive colony PCR confirmation

with M13 primers. (b) purified recombinant plasmids HrHPPK-DHPS

gene. (c) PCR confirmation of recombinant plasmid with internal short

gene specific primers. M= 1kb DNA ladder.

72

3.5 RNA isolation from different tissues of sea buckthorn shown

against HindIII Marker. RT-PCR analysis of HPPK-DHPS gene

transc different tissues (leaf, Fruit, Bud, Seed) of sea buckthorn

against 50bp ladder. 18S rRNA was used as internal control.

λ DNA/

pts in

as shown

73

ri

xvi

3.6 AtGene Expression pattern for HPPK-DHPS gene (AT4G30000) from

global data set of microarray in: (a) different plant tissues, (b) under

different hormonal conditions, (c) abiotic stress conditions and (d)

response to different light conditions.

74

3.7 Alignment of newly isolated HrHPPK-DHPS amino acid sequence with

its ortholog from S. lycopersicum (FJ972198) using MaVectorTM7.2.3.

(Accerlrys Inc.) gcg/ Wisconsin pakage university of Wisconsin). The

similar regions are shown against a black background and differences are

exposed against white background.

76

3. 8 Alignment of newly isolated HrHPPK-DHPS nucleotide sequence with

its ortholog from S. lycopersicum (FJ972198) using MaVectorTM7.2.3.

(Accerlrys Inc.) gcg/ Wisconsin pakage university of Wisconsin). The

identical regions are shown against a black background and differences

are exposed against white background.

77

3.9 Multiple sequence alignment of newly isolated HrHPPK-DHPS amino

acid sequence with Mac VectorTM

7.2.3. (Accerlrys Inc.) gcg/ Wisconsin

pakage university of Wisconsin) from sea buckthorn and its ortholog from

S. lycopersicum, G. max, A. thaliana and T. aestivum amino acid in

blocks highlight similarity. The strictly conserved

78

regions are shown against black background.

xvii

3.10 Phylogenetic reconstruction of HrHPPK-DHPS gene. Neighbor joining

tree is constructed using MEGA 5.0 software. Values on the nodes indicate

the bootstrap replication of 1000. Phylogenetic inference of enzymes

containing the two domains HPPK and DHPS was made using 15

complete coding sequences H. rhamnoides, S. lycopersicum (GenBank

accession No. FJ972198) T. aestivum (EF208803), B. distachyon

(XM003562616), O. sativa (NM001066822), O. sativa (AK068210), P.

sativum (Y08611), M. truncatula (XM003614065),

C. arietinum (XM004490156) G. max (XM003518734), G. max

(XM003517802), A. thaliana (NM105586), A. thaliana

(NM001203939), A. lyrata (XM002888660) and A. thaliana

(BT033093) were included in the alignment. Four clusters are enclosed by

brackets. A scale is given at the bottom.

80

3.11 Conserved domain of newly isolated HrHPPK-DHPS gene obtained from

domain search data base showed hppk superfamily and

pterin_binding domain.

81

3.12 Predicted 3D structure of HrHPPK-DHPS proteins from different plant

species shown at the same scale. A, X-ray Structure of the template

Bifunctional 6-hydroxymethyl-7, 8- Dihydroxypterin Pyrophosphokinase

Dihydropteroate Synthase From Saccharomyces

Cerevisiae (Lawrence et al., 2005) B, 3D structure of sea buckthorn

HPPK-DHPS produced using MODELER 9v10, C, 3D model of S.

82

xviii

lycopersicum, D, 3D model of A. thaliana, E, 3D Model of G. max. F,

Model of T. aestivum. Models in different protein structure were colored

according to different domains. Pterin binding domain DHPS was given

Blue color, HPPK domain was shown by red color. Interdomain linker was

given grey color.

4.1 Structure of important caroteniods reported in Sea buckthorn. (a)

αcarotene, (b) Lycopene.

91

4. 2 Structures of different forms of Carotenoids reported to be present in the

sea buckthorn.

92

4.3. Systematic presentation of caroteniod biosynthetic pathway in plant. The most

important enzymes that participate in pathway includes geranylgeranyl

pyrophosphate (GGPP), phytoene synthase (PSY), phytoene desaturase

(PDS), lycopene-β-cyclase (LCYB lycopene-ε-cyclase (LCYE) β-ring

hydroxylase (HYDβ) ε-ring hydroxylase (HYDε), zeaxanthin epoxidase

(ZEP), Violaxanthin de-epoxidase (NSY) and Epoxycarotenoid

dioxygenase (NCED).

93

4.4 (a) Comparison of RNA band intensity from different tissues including

bud, root, apex, leaves, seed and fruits. (2) Amplification of full length

cDNA of Hr-Lcyb (c) Hr-Psy gene amplification through RT-PCR. M

stand for 1kb DNA ladder.

101

4.5 (A) a. Positive colony PCR of Hr-Lcyb with M13 primers. b. Purified

selected recombinant plasmid with target gene inserts. (B). a. positive

colony of Hr-PSY confirmed by PCR with M13 primers. b. Recombinant

101

xix

purified plasmid of Hr-PSY gene. c. Recombinant Hr-PSY plasmid PCR

confirmation. M stand for 1kb DNA ladder.

4.6 (a) Photograph showing different tissues of sea buckthorn a. bud, b. apex,

c. root. D. leaf, e. seed, f. fruit. (b) RT-PCR analysis of Hr-lcyb and HrPsy

gene transcripts in above mentioned tissues of sea buckthorn in

comparison with internal control actin-1. M stand for 1kb DNA ladder.

102

4.7. Relative Gene Expression pattern for Lycopene β-cyclase gene

(AT3G10230) from global data set of microarray: (a) in different plant

tissues, (b) hormonal conditions, (c) abiotic stress and (c) light exposures

respectively.

104

4. 8. Relative Gene Expression pattern for Phytoene synthase gene

(AT5G17230) from global data set of microarray: (a) in different plant

tissues, (b) hormonal conditions, (c) abiotic stress and (d) light exposures

respectively.

105

4.9 Alignment of newly isolated Hr-Lcyb nucleotide sequence with its

ortholog from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.)

gcg/ Wisconsin pakage university of Wisconsin). The similar regions are

shown against a black background and differences are exposed against

white background.

108

xx

4.10 Alignment of newly isolated Hr-Lcyb amino acid sequence with its

ortholog from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.)

gcg/ Wisconsin pakage university of Wisconsin). The conservations in

sequence are shown against a black background and differences are

109

exposed against white background.

4.11 Alignment of newly isolated Hr-Psy nucleotide sequence with its ortholog

from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/

Wisconsin pakage university of Wisconsin). The similar regions are

shown against a black background and differences are exposed against

white background.

110

4.12 Alignment of newly isolated Hr-Psy amino acid sequence with its ortholog

from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/

Wisconsin pakage university of Wisconsin) software. The similarities are

shown against a black background and differences are exposed against

white background.

111

xxi

4.13 Multiple sequence Alignments of newly isolated Hr-Lcyb amino acid

sequence with its ortholog from S. lycopersicum (NM_001247297), V.

vinifera (JQ319639), N. pseudonarcissus (GQ327929), M. truncatula

(XM-003624977), N. tazetta (JQ797381), C. sinensis (DQ235259) and L.

barbarum (AY906864) using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/

Wisconsin pakage university of Wisconsin). The strictly conserved

regions are shown against a black background and differences are exposed

against white background.

112

4.14 Multiple Alignment of amino acid sequence of Hr-Psy gene with its

representative from other plant species. The names and accession numbers

of these members are: Lopomoea (AB499050), T. erecta

(AF251015), S. lycopersicum (EF534739), N. tabacum (JF461341) and

113

Tomato (M84744). The strictly conserved regions are shown against a

black background and differences are exposed against white background.

xxii

4.15 Phylogenetic analysis of Hr-Lcyb and other selected plant members.

Neighbor joining tree is constructed using MEGA 5.0 software. Values on

the nodes indicate the bootstrap replication of 1000. Phylogenetic

inference was made using 25 complete coding sequences H. rhamnoides,

S. lycopersicum (NM_001247297), C. maxima (AY217103), C. sinensis

(DQ496224), C. papaya (DQ415894), P. trichocarpa (XM_002308867),

R. communis (XM_002531452), E. japonica (JX089591), V. vinifera

(JQ319639), B. nivea (EU122344), C. moschata (JN559395), S. europaea

(AY789516), C. arietinum (XM_004493356), M. truncantula

(XM_003624977), G. max (XM_006576725), P. vulgaris (HQ199604),

A. palaestina (AF321534), L. barbarum (AY906864) Lpomoea_sp.

Kenyan (AB499055), N. tabacum (X81787),

Chrysanthemum_X_morifolium (AB205041) T. officinale (AB247456), N.

pseudonarcissus (GQ327929) and N. trzetta (JQ797381).

114

4.16. The detail and accession no of the plant species for the phytoene synthase

gene which were used for the phylogenetic analysis includes H.

rhamnoides, P,mume (AB253628), F.vesca (XM_004289519), G. max

(XM_003544910), C. arietinum (XR_189445), D.Kaki (FJ594485), C.

sinensis (EF545005), D. carota (DQ192187), A. deliciosa (FJ797304), M.

indica (JN001197), p. trichocarpa (XM_002327528), R.communis

(XM_002532929), M. esculenta (GU111719), C. papaya (DQ666828),

116

xxiii

P. sitchensis (EF676285), T.erecta (AF251015), C.melo (GU361622),

C.lanatus, M.charanita (AY494789), M. cochinchinensis (KF233991), S.

lycopersicum (M84744), O. fragrans (JQ699273), M. germanica

(AY986508), A. palaestina (AY661705), C. roseus (HQ438241), G.

jasminoides (HQ599860), C. canephora (DQ157164), B. oleracea

(JF920036), B. napus (AB454517), E. japonica (JX097048), B.

distachyon (XM_003579062), T. aestivum (BT009537), H. vulgare

(AK358888) and P. juncea (HM539711).

4.17 Conserved domains of Hr-Lycopene β-cyclase

showing main NAD_binding domain.

118

4.18 Conserved domains of Hr-Phytoene synthase gene consisting of Six main

regions.

119

ABBREVIATIONS

AA Ascorbic acid

AAC antioxidant activity coefficient

xxiv

ABA Abscisic acid

ADC Aminodeoxychorismate

Al Aluminum

AMV-RT Avian Myeloblastosis Virus Reverse Transcriptase

AOX antioxidant value

AO Ascorbate oxidase

AsA L-ascorbic acid

ATP Adenosine triphosphate

BAC Bacterial artificial chromosome

Bp Base pair

Ca Calcium

Cm Centimeters

CaMV Cauliflower mosaic virus

CCS Capsanthin–capsorubin synthase

cDNA complementary DNA

Cd Cadmium

CPTA 2-(4-chlorophenylthio)-triethylamine

Cu Cupper

DHA Dehydroascorbate

DMSO Dimethyl sulfoxide

DNTPs Deoxinuceotide Triphosphate

xxv

DXS Deoxyxylulose 5-phosphate synthase

3D 3-dimentational

E. coli Escherichia coli

EC Electrical conductivity

EDTA Ethylenediaminetetraacetic acid

ESTs Expressed sequence tag

EtBr Ethidium Bromide

EMSAs Electrophoretic mobility shift assays

Fe Ferric

Fe Iron

FPGS Folylpolyglutamate synthase

G Gram

GDC Glycine Decarboxylase Complex

GGPP Geranylgeranyl pyrophosphate

GGDP Geranylgeranyl diphosphate

GR Glutathione reductase

GSRP Gene-specific reverse primer

GPP/FPP Geranyl/farnesyl diphosphates

GSH Glutathione

GW Gateway cloning

xxvi

HPPK-DHPS Hydroxymethyldihydropterin pyrophosphokinase–

dihydropteroate synthase

Hr Hippophae rhamnoides

Hr-Lcyb Hippophae rhamnoides Lycopene beta cyclase

HYDβ) β-ring hydroxylase

HYDε ε-ring hydroxylase

IPTG Isopropyl- β -D-thiogalactopyranoside

IPPS Transisoprenyl diphosphate synthases

Kbp Kilo base pair

Kg Kilogram

K Potassium

L Litter

LB Luria-Bertani

LCYβ Lycopene beta cyclase

LCYE lycopene--ε-cyclase

Li Lithium

MDHA Monodehydroascorbate

MDHAR Monodehydroascorbate reductase

MEGA Molecular Evolutionary Genetics Analysis

MEP Methylerythritol 4-phosphate

Mg Magnesium

xxvii

MgCl2 Magnesium chloride

Mn Manganese

mRNA Messenger RNA

MTX Methotrexate

N Nitrogen

NADPH Nicotinamide adenine dinucleotide phosphate

NAOH Sodium Hydroxide

Na Sodium

NCED Epoxycarotenoid dioxygenase

NCBI National Center for Biotechnology Information

NIGAB National Institute for Genomics and Advanced Biotechnology

NSY Violaxanthin de-epoxidase

OD Optical density

ORR oxidation rate ratio

P Phosphorus

PABA p-aminobenzoate

PAGE Polyacrylamide gel electrophoresis

Pb Lead

PCR Polymerase Chain Reaction

PDB Protein Data Bank

PDS phytoene desaturase

xxviii

PEG Polyethylene glycol

PFRA Prairie Farm Rehabilitation Administration

PlF Phytochrome-interacting factor

PPP Triphosphate.

PSY phytoene synthase

PVP Polyvinylpyrrolidone

qPCR Quantitative real-time PCR

QTLs Quantitative trait loci

RACE-PCR Rapid amplification of cDNA ends

Rb Rubidium

RDA Recommended dietary allowance

ROS Reactive oxygen species

RT-PCR Reverse transcription Polymerase chain reaction

SBT Sea buckthorn

SDS Sodium Dodecyl Sulfate

SHMT Serine hydroxymethyltransferase

SL Solanum lycopersicum

SNM Species not Mentioned

Taq Thermus aquaticus

TBE Trisbuffer ethylene diamine tetra acetic acid

TE Tris ethylene diamine tetra acetic acid

xxix

THF TetrahydroFolate

TLC Thin layer chromatography

TILLING Targeting Induced Local Lesions In Genomes

µg Micro gram

µl Micro liter

USSR Union of Soviet Socialist Republics

UV Ultra violet

WT Wild-type

X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside

ZEP zeaxanthin epoxidase

Zn Zinc

xxx

ACKNOWLEDGEMENTS

First and above all, I praise Allah, the almighty for providing me this opportunity and granting

me the capability to precede my PhD studies successfully. Without Allah’s will, I would not

have been able to conduct this research. My humble gratitude to the Muhammad (S.A.W) the

Last Prophet of God, who brought the humanity under the umbrella of peace and prosperity,

whose way of life has been a continuous guidance for me

I would like to thank the following friends and family members for their support throughout the

process of completing this dissertation. First of all, to my parents, I express utmost love and

appreciation for allowing me to explore my academic and artistic interests with the freedom

necessary to grow as both a student and as an individual. Their prayer for me was what sustained

me thus far.

I would like to thank my supervisor and mentor Professor Dr. Syed Dilnawaz Ahmad Gardezi,

Vice Chancellor, AJ&K University, whose support and guidance made my thesis work possible.

He has been actively interested in my work. I am very grateful for his patience, motivation,

enthusiasm, and immense knowledge taken together, makes him a great mentor.

I would like to thank my co-advisor Professor Dr. Muhammad Ramzan Khan on the spot for

providing me support and guidance, warm encouragement, thoughtful ideas, and critical

comments, made my thesis work at NIGAB, NARC Islamabad a success. Special thanks to

Professor Dr. Ghulam Muhammad Ali for his kind behavior, knowledge and provision of Lab

facilities during Molecular work at NIGAB as an external student. I am thankful to my thesis

committee members Professor Dr. Muhammad Fareed Khan Chairman PB&MG, Professor Dr.

Abdul Hamid department of Horticulture) for their support and guidance.

xxxi

I thank Dr. Ghulam Hasnain University of Florida for his advices and help in providing foreign

acceptance and his friendly assistance with various problems all the time, especially for his help

with the paperwork, and his help outside the laboratory.

I would like to thank the Higher Education Commission (HEC), Pakistan for selecting me as a

research scholar in Indigenous PhD scheme for financial aid to my university during my PhD

studies and giving me the prospect to achieve my PhD degree. I am obliged to HEC for six

month foreign exposure at the University Of Florida (USA), under International Research

Support Initiative Program (IRSIP). Moreover, thanks are due to Prof. Dr. Rathinasabapathi,

Balasubramani for accommodating me as guest researcher in his group and allowing me to use

lab facilities at Institute of Food and Agriculture Sciences, University of Florida (USA) apart

from his scholastic discussion.

I want to express my deep thanks to my esteemed to research associate Zaheer Abbas for the

trust, the insightful discussion, offering valuable advice, for his support during the whole period

of the study. I would like to express appreciation and special thanks to Assistant Professor Dr.

Asad Hussain Shah and Dr. Shahid iqbal Awan department of PB&MG for providing assistance

and sincere guidance in research. Very special thanks to my colleagues, Saira Ishaq, Nazia

Rahman, Sajeela Ahmed and Sameera Rehman for their help and cooperation during my

research work.

I would like to express appreciation to my beloved Husband for his continuous support and

encouragement to finish this work. I do not have words to acknowledge his contribution during

the evolution of this write up.

Shazia Arif

shaziaarif_10@yahoo.com

32

32

ABSTRACT

Plants are enormously resourceful biochemical units, capable of synthesizing almost all complement of

indispensable dietetic micronutrients; though, these are disproportionately scattered among special plant parts. Sea

buckthorn (Hippophae rhamnoides L.) is a fruit berry plant known for its therapeutic and nutraceautical

exceptionality. It is enriched with storming range of nutrients in its berry, seed, leaf and bark included vitamins,

essential oils and minerals. Most of our food produce are often undersupplied with most of these nutrients.

Functional candidate’s micronutrient genes from sea buckthorn were therefore chosen from the pathway enzymes

known to be involved in vitamins biosynthesis and metabolism. Specific gene primers were designed and RT-PCR

and PCR amplification was carried out to amplify desired gene fragments. The list of cDNA cloned and sequenced

included genes coding for enzymes in the metabolism and synthesis of Ascorbate, Folate and vitamin A.

Differences and similarities were found in homology and phylogenic evaluation with genes from other plant

species.

On the first part the amplification and cloning of full length cDNA of ascorbate oxidase gene was described. A full

length coding sequence containing a unique fragment of 2158 bp as compared to tomato gene sequence was isolated

and cloned. There was a difference in length of new gene sequence as compared to reference gene sequence with

87% gene homology. The relative abundance of the total RNA coding for Hr-AO was estimated using semi-

quantitative RT-PCR with maximum transcript accumulation in green leaf and young green fruit tissues.

Second part of the study was concerned with the folate (Hydroxymethyldihydropterin pyrophosphokinase–

dihydropteroate synthase) linked in the pathway of folate biosynthesis from sea buckthorn. The target gene HPPK-

DHPS was successfully isolated and cloned and its structure was compared with other plants. The sequence

analysis revealed that this novel genomic locus is 2354bp in size. The coding region is interrupted by a single large

intron. Its length is 1539bp which is similar to its ortholog in tomato. Expression profile of HrHPPK-DHPS with

33

33

semi-quantitative RT-PCR revealed the higher accumulation of transcripts in leaf and fruits tissues. In this study

an attempt was also made to compare the 3D homology modeling structure of new protein.

Third part of the research deals with carotenoids which produces yellow colors of fruits and vegetables and are

almost universally distributed in living things. Carotenoids are a chief source of vitamin A in humans nutritional.

Basic challenges were to study two important caroteniods pathway genes Lycopene β-cyclase and Phytoene

synthase from vitamin A rich plant “sea buckthorn” (Hippophae rhamnoides). The newly isolated full length

coding sequences of Hr-Lcyb and Hr-Psy showed homology with reference gene sequence. Despite the similarities

in nucleotide gene sequences several differences in structural domains were also found. Maximum transcript

accumulation is accordingly detected in a variety of plant tissues (leaf & Fruit), even though at trace level in some

tissues like seed and root. Awareness and identification about the value of these important micronutrient genes in

sea buckthorn plant will increases its long term value for genetic engineering in future.

34

34

Chapter 1

GENERAL INTRODUCTION

1.1 Sea buckthorn (Hippophae rhamnoides)

Sea buckthorn is well-known as nature’s most impartial fruit bearing plant. It is

considered as the “Holy Fruit of the Himalayas”. It has been treasured by native

Tibetans for centuries for its extensive nutritional values. This fruit is also

recognized as Sandthorn, Sandorn, and the "Wonder Berry" all over the

world. This fruit never stops to astonish with its marvelous nutritional base due to

high amount of vitamins.

Both medicinal and nutritional values of sea buckthorn, berries, leaves and seeds are

not authenticated. This medicinal plant needed to be searched of its hidden potential

for commercial crops biofortification using modern molecular biological approach.

Many important crops are lacking nutrients and most of the nutrients can be provided

by this plant. Many developments have been made in the application of molecular

biology to improve nutritients in plants.

The micronutrients deficiency is preventing about one third of world population from

reaching their physical and intellectual potential. Many varieties of crop with

increased amounts of essential vitamins and minerals have been developed due to

genetic engineering. This technique has also improved the profiles of nutraceautical

compounds. Much of the research into vitamins and minerals has been focused to

create new varieties of food crops to improve the diet of population in developing

countries. Biofortification is an economical approach to improve food qualities that

harmonize other technological and social involvement.

35

35

1.2 Origin and History

Sea buckthorn is a universal name that is particular to the winter hardy, deciduous

and dioecious spiny shrub or small tree with yellow, red or orange berry of the genus

Hippophae (Bailey and Bailey, 1978). This genus is in Elaeagnaceae family. It

consists of six species and ten subspecies, along with the most economically

important Hippophae rhamnoides L. generally identified as sea buckthorn (Rongsen,

1992). Northern areas of Pakistan have only one subspecies known as turkestanica

(Rongsen, 1996).

Sea buckthorn (Hippophae rhamnoides L.) is a versatile plant species native to

Europe and Asia. It has been used by humans for centuries that are written by

prehistoric Greek scholars such as Dioscorid. Leaves and branches of Sea buckthorn

were used for rapid weight gain and shiny coat for the horses, therefore this plant

was considered as healthy food by ancient Greece. That’s why; in Latin this plant is

given the name “Hippo”-horse, ‘phaoas’ to shine (Rongsen, 1992).

H. rhamnoides has a very wide division; it grows well on hilly areas, in valleys and

river beds, along sea coasts and islands, in small separated or large permanent pure

stands or in mixed stands with other plant species (Yao, 1994). The remaining

species in the genus have a quite restricted allocation and found only in china and

some nearest countries alongside the Himalaya Mountains (Rousi, 1971; Liu and He,

1978; Lian, 1988; Yu et al., 1989).

The genus Hippophae is dispersed between 270-690N latitude and 7ºW to 122ºE

longitude (Rousi, 1971; Pan et al., 1989; Yu et al., 1989). H. rhamnoides L. subsp.

turkestanica occur in North areas of Pakistan usually distributed all over the

karakarum ranges at altitudes of 2,000-4,200m (Gilgit, Hunza, Skardu, Nagar,

36

36

Shigar, Khaploo etc). Northern parts of earlier state of Jammu Kashmir are the centre

of origin of ssp. turkestanica (Ahamad and Kamal, 2002). Presently the reproduction

and adaptation of sea buckthorn have been tried in Euro Asia and North America

(Yao, 1994). It has been expected that there were about 3000 hectare of sea

buckthorn forest in Pakistan, with the annual production of 12002250 tones of sea

buckthorn fruit (Rongsen, 1996).

Sea buckthorn plant is a thorny, multibranched, dioecious, spinescent shrub attaining

size of 2-4 meter in tallness with solid branches shaping frequently symmetrical

round head. It has brown or black coarse bark and a thick grayish green crown

(Rousi, 1971). A tree like shape is frequently found as merely the bud on the outer

part of the plant germinates and branch. There is tremendous variability in height

starting from a little bush less than 50cm to a tree more than

20m tall in sea buckthorn plant (Rousi, 1994; Yu et al., 1989; Yao and Tigerstedt,

1994). It is considered a first woody species that habitate in open areas such as

dumped farmland, harsh environment, and rocky islands (Rousi, 1965; Yao and

Zhu, 1985; Yao, 1994).

1.3 Chemical composition and Nutritional value

Sea buckthorn berries are considered as vitamins C and E rich and nutrients rich such

as carbohydrates, organic acids, and amino acids. The fruit has more than 100 types

of bioactive substances, nutrients and more than 22 minerals. Variety of antioxidant

chemicals such as vitamins C and E, many carotenoids such as beta carotene,

flavonoid, and certain enzymes are present in Sea buckthorn berries. The berries

carry important components which are being used in therapeutic assignations. These

37

37

components are vitamins A, B1, B2, B6, C, and E, carotene, fatty acid, palmitolein

acids, palmitin, and β-sitosterol (Bernath and Foldesi, 1992).

Berries from Uzbekistan the protein content of Sinensis press juice ranged from 1.26

to 1.40% and was also reported as 9.1 to 9.4 % . Supercritical CO2 extracted press

juice gave a compactly clouded juice of significant cloud firmness (Beveridge et al.,

2004). Sea buckthorn berries are also having plenty of several amino acids. Berries

also have low levels of the sugar, alcohols, mannitol, xylitol and sorbitol. There are

several mineral elements present in sea buckthorn seeds, juice and berries. Sea

buckthorn juice contains 24 chemical elements. A plentiful amount of proteins and

free amino acids is present in Sea buckthorn. Sea buckthorn fruit contains a total of

18 amino acids (Zhang et al., 1989; Mironov, 1989).

Major elements are phosphorus, nitrogen, iron, manganese, calcium, boron, silicon

and aluminum (Tong et al., 1989; Wolf and Wegert, 1993; Zhang, et al., 1989).

Potassium is the most plentiful of all the elements found in juice or berries (Chen,

1988; Kallio et al., 1999; Tong et al., 1989; Zhang, Yan et al., 1989).

Sea buckthorn berries are acidic in nature has exotic flavor, but have an excellent

potentiality for producing different refined products like syrup, beverage, squash,

jam and jellies. Astringent quality of sea buckthorn juice or pulp can be minimized

by blending of juice or pulp with other fruits like orange, apple and papaya in

different ratios. Many sea buckthorn products are available in the market like oil,

juice, and food additives, jellies, candies, cosmetics, and shampoos (Schroeder and

Yao, 1995).

38

38

Sea buckthorn berry oil support tissue and wound healings because it contains 35%

of the rare and valuable palmitoleic acid which is known as component of skin fat.

The seed oil is has high oleic acid content (17%), omega-3 (34%) and omega-6

(31%). Omega-3 and omega-6 are present in one to one ratio. Because of one to one

ratio the two omegas is significant because they self check each other and control

thousands of metabolic functions by prostaglandin pathways. Fatty acid composition

is different in the seed and pulp oil. Pulp oil extraction contains saturated fatty acids;

mainly palmitic acid and palmitoleic acid (Kallio et al., 2002).

Sea buckthorn berries have very important components known as berries oils. In

general, the oil from the pulp/peel portion is combined due to the complexity

concerned with taking apart. High total lipid content like tocopherols, tocotrienols,

carotenoids, and omega-3 and omega-6 fatty acid have identified both in seeds and

berry pulp. Sea buckthorn seed and pulp oils composition is different according to

the subspecies, its origin, cultivating activities, harvesting time, and the extraction

techniques of berries (Yang and Kallio, 2002).

reported that sea buckthorn oil is rich in essential fatty acids, antioxidants and

vitamins contents therefore it is being widely used as an anti bacterial,

antiinflammatory, analgesic, regeneration of tissues and to maintain women health.

Residue left from squashed seed oil and pulp juice can be used in medicine and

cosmetics. Sea buckthorn berries is rich in bioactive phytochemicals, therefore it is

widely used in the industries of Pakistani northern areas, China and Russia

cosmoceutical and nutraceautical products (Zeb, 2004).

39

39

1.4 Vitamins

1.4.1 Ascorbic Acid

Sea buckthorn is amongst the most nutritive and vitamins affluent plant. Sea

buckthorn fruit has plenty of nutrients like carbohydrates, amino acids, organic acids

and vitamins. Vitamin C in fruits usually varies from 200 to 1500 mg/ 100 g, which

is 5 to 100 times more than any other specific fruit like apple. Sea buckthorn berries

are popular for their very high levels of vitamin C which varies from 360 mg/100 g

of berries for the European subspecies rhamnoides (Plekhanova, 1988;

Rousi and Aulin, 1977; Wahlberg and Jeppsson, 1990, 1992; Yao et al., 1992) to

2500 mg/100 g of berries for the Chinese subspecies sinensis (Yanget el al., 1999;

Yao and Tigerstedt, 1994; Zhao et al., 1991). The oil composition of the seeds

(7.3% w/w dry basis), pulp (1.7% w/w), and whole berry in wild sinensis berries

(2.1% w/w) was also investigated (Yang and Kallio, 2001).

Sea buckthorn fruit from Portland contain rich vitamin C substance ranging from

114 to 1550 mg/100 g with a normal substance (695 mg/100 g) which is 12 times

more than oranges, grading fruit of sea buckthorn amongst the highest in vitamin C

content. Strawberry, kiwi, orange, tomato, carrot and hawthorn have lower

concentration of vitamin C than sea buckthorn fruit (Dharmananda, 2004). Sea

buckthorn berries pulp from india have 223.2 mg/100 g of vitamin C. Roughly 75%

of the vitamin C in the Sea buckthorn berries pulp retain in the juice throughout the

process, resulting in 168.3–184.0 mg/100 g of vitamin C in the last patent juice

(Arimboor et al., 2006). The turkestanica sea buckthorn fruit has vitamin C

substance in the range of 200 to 1500 mg/100 which is 5 to 100 times greater than

any other fruit or vegetable (Ahmad & Kamal, 2002).

40

40

1.4.2 Caroteniods and Tocopherols

Carotenoids attained significance amongst biologically active agents to a great

extent, as they have numerous actions such as anti-oxidant, anti-mutagenic and anti-

tumour (Britton et al., 2009). Earlier research on sea buckthorn berries has shown

variation in constitution and content of carotenoids (Andersson et al., 2009; Bal et

al., 2011). Forty-one different carotenoids have been found in various varieties, with

zeaxanthin, b-cryptoxanthin, and b-carotene as the major ones (Andersson et al.,

2009; Raffo et al., 2004). Alpha-Carotene, c-carotene, dihydroxy-b-carotene,

lycopene, and canthaxanthin are found to be the minor ones (Yang & Kallio, 2005).

The presence of carotenoid esters has been found in sea buckthorn berries (Giuffrida

et al., 2011; Pintea et al., 2005).

The carotene substances of berries vary from 30 to 40 mg/100 g (Bernath and

Foldesi, 1992, Wolf and Wegert, 1993). The carotenoids content generally increases

during ripening (Andersson et al., 2009). Plenty of lipoproteins and pigments are

present in tissue layers and the fleshy mesocarp of Sea buckthorn fruits.

Carotenolipoprotein compound are found mainly in fruit membranes where polar

lipids might function as link compounds among the polar (protein) and nonpolar

(carotenoids) moieties (Pintea et al., 2001). Carotenoid substance is the main factor

by which sea buckthorn oil is traded commercially (Beveridge et al., 1999).

Carotenoids differ extensively depending on the oil resource; vary from 314 to 2139

mg/100 g for Chinese grown sea buckthorn (Zhang and Xu., 1989). Fleshy tissue

and fruit oils are rich reservoir of carotenoids as can be observed by their colors, at

about 900–1000 mg/100 g for Pamirs sea buckthorn (Mironov, 1989). Berries have

Vitamin E concentration up to 160 mg/100 g (Zhang et al., 1989; Ma and Cui, 1989;

41

41

Eliseev, 1989; Schapiro, 1989, Wahlberg and Jeppsson, 1990, 1992). Sea buckthorn

is also enriched with good quantity of water and fat soluble vitamins. In sea

buckthorn vitamin E is more than that of maize, wheat embryo, soybean and

safflower (Bernath & Foldesi, 1992). Sea buckthorn is also enriched in B1, B2, K

and bioflavonoids (Bekker & Glushenkova, 2001).

The seed oil has more than 95% of the retrievable tocopherols. It is present at a high

concentration (140 mg/100 ml). 1% phytosterols and small amounts of tocotrienols

are also present (Parimelazhagan et al., 2005. Sea buckthorn seeds have Radical-

scavenging proanthocyanidins (Fan et al., 2007). Sea buckthorn is considered as a

useful medicine for many diseases because it contains considerable amounts of

vitamin E and β-carotene (Ahmad & Kamal, 2002).

The vitamin E in sea buckthorn berries is 160 mg/100 g (Eliseev, 1989; Ma & Cui,

1989; Wahlberg and Jeppsson, 1990, 1992; Zhang, et al., 1989). Juice of Chinese

varieties has 162–255 mg/100 g (Zhang, et al., 1989) while Pakistani varieties pulp

has 481 mg/100 g (Zeb, 2004a). Seeds of Chinese varieties also have 40.1–103.0

mg/100 g vitamin E (Ma et al., 1989).

Many forms of Sea buckthorn leaves and Berries showed up total carotenoid

components which range between 3.5 and 4.2 mg/100 g dry weight in leaves, and 53

and 97 mg/100 g dry weight in berries. The carotenoid di-esters characterize the key

portion among berry forms include zeaxanthin di-palmitate as main compound,

while leaves have free carotenoids only like viollaxanthin, neoxanthin, lutein, and b-

carotene. Component study showed the appropriate carotenoid biomarkers feature

for the Carpathians’ sea buckthorn from Romania with contribution to their

taxonomical catogorization and validity identification (Raluca et al., 2014).

42

42

1.4.3 Flavonoids

Sea Buckthorn’s flavonoid “quercetin,” is recognized as a natural antihistamine and

anti-inflammatory, and studies suggest that it may relieve hay fever, eczema,

sinusitis, and asthma, and may help protect against heart disease and certain cancers

(Tamara et al., 2010) 11 to 22% crude protein, 3 to 6% of crude fat and some

flavonoides are present in its leaves (Wang et al., 2000; Rongsen, 1996). The

flavoniods mg/100 g in different sea buckthorn species are listed in table 1.3. It was

found that these phenolics are either quercertin derivative or isorhamnetin

derivatives. Sea buckthorn contains quecertin, gallic acid, catechin, epicatechin and

other small phenolics in its composition (Hakkinen et al., 1999). To a great extent

the quercetin compound represent as 3 o glycosides with glucose, rutinose or

rhamnose sugars making up the glycoside (Rosch et al., 2004b). It is also found that

the flavonoids content is as maximal as 1000 mg/100 g (Tian, 1985; Wang, 1987;

Xu, 1956).

Sea buckthorn fruits are rich in total flavonoid contents. Fresh fruit has highest

flavonoids according to the ex-Soviet Union researcher, which is 854 mg/100 g,

whereas, the average flavonoids contents in fresh fruit is 354 mg/100 g according to

a Chinese researcher. Lots of study has shown that in sea buckthorn flavonoids

contents from elevated level of sea were maximum (Yuzhen and Fuheng, 1997).

1.4.4 Folate

Folate is a water-soluble vitamin B which is identified as advantageous to human

health. Folate is helpful to prevent neural tube defect in babies, improve a

cardiovascular disease that is caused by high plasma homocysteine and few types of

43

43

cancer. Sea buckthorn fruit is considered as high source of folate ranging 29 μg/100

g fresh weights (Marcus, 2005; Virendra S. 2006).

The whole folate substances of sea buckthorn fruit berries and juice analyzed ranged

from 29 up to 81 μg/100 g. In contrast sea buckthorn folate berries contents with that

of other berries, these berries including 81μg/100 g were almost more rich in folates

as rose hips, which confirmed the maximum folate contents of 96 μg/100 g amongst

berries investigated 5-Methyltetrahydrofolate is a methylated

derivate of tetrahydrofolate. (Strålsjö et al., 2003; Gutzeit et al., 2008).

It was reported that folate contents varied significantly among species and also with

the origination of the plants tissues. For instance wheat germ has higher folate levels

whereas darker greens vegetable normally comprised much folate than roots such as

carrot and fresh fruits. Amongst the fruit plants, maximum concentration was

reported in orange and some other citrus fruits (Scott et al., 2000). However

divergence found in folate pathway genes between HPPKs and DHPs from different

species effectively suggested substantial variation in the genes evolution. The

association among folic acid accumulations in photosynthetic tissues is not

emphasized until now. It was found that the photo-respiratory process necessitates

both GDC and the SHMT folate dependant enzyme, which accumulated in the

mitochondria with rejuvenation. (Douce et al., 2001). It was reported in some plants

that folate is accumulated in cotyledon and embryo during the process of

germination, although higher HPPK-DHPS contents were only noticed in embryo.

The higher capability of developing embryo and meristematics tissue for

synthesizing and accumulating folate is associated with cellular metabolic process

and higher demands for nucleotide synthesis. These most important cellular

44

44

functions involved folate coenzymes with light playing important part in folate

biosynthesis in leaves (Jabrin et al., 2003).

1.5 Amino acids

In sea buckthorn fruit out of 22 known amino acids (Mironov, 1989; Zhang et al.,

1989), half of which are very important because they play a significant role in

different functions within our bodies like cells and muscles formation, production of

energy, loss of fats, and many functions of brain. Juice of sea buckthorn is enriched

in many free amino acids. Eighteen types of free amino acids in the juice of Chinese

sea buckthorn were found (Chen, 1988). Total amino acids content of Chinese sea

buckthorn which contains more apartic acid (426.6 mg/100 g) were also discovered.

Amongst these amino acids eight amino acids are very important for human body.

These amino acids are threonine, valine, methionine, leucine, lysine, trytophan,

isoleucine, and phenylalanine (Zhang et al., 1989; Chen, 1988).

1.6 Scope

An Adequate amount of micronutrients are one of the basic requirements for human

health in the daily diet (Caballero and Black, 2003). To overcome micronutrient

deficiency problem, the an ingredient is added for the purpose of enrichment and has

demonstrated to be very effective for certain micronutrients; for instance, salt

iodination or fortification of tap water and toothpaste (Darnton and Nalubola,

2002). For each of the micronutrient fortifying procedure is different; though, it will

possibly be harder for Fe owed to its rapid oxidations (Boccio and Lyengar, 2003).

Cereals fortification requires complicated techniques. A substitute method to fortify

cereals by food processing and agricultural management is aggregation of

45

45

micronutrients directly in cereals seeds using traditional breeding or genetic

engineering (Zimmermann and Hurrel, 2002).

Vitamin C is very important for heart function, immunity, connective tissue, and iron

consumption. Although most of the animals and plants can make Vitamin C, human

being is short of L-gulono-1,4-lactone oxidoreductase, which is necessary for the

final step in Vitamin C preparation. In human being fruits and vegetables are major

nutritional resource of vitamin C. Latest studies indicate that as Vitamin C uptake

is increased (from 60 to 200 mg d-1) health benefits are increased (Carr and Frei,

1999; Levine et al., 1999). Vitamin C is required in cell division method, regulation

and expansion (Smirnoff, 1996; Pignocchi et al., 2003).

Folate is considered a crucial nutrient in the human diet. Many physiologic upsets

like anemia and neural tube defects are found in neonates due to folate deficiency

(Lucock, 2000). Folate deficiency causes mental disorders such as psychiatric

syndrome and decreased congnitive functioning in old people (Calvaresi and Bryan,

2001; Hultberg et al., 2001). Folate is also considered to protect against heart

diseases and various cancer categories (Boushey et al., 1995; Brattstrom et al., 2000;

Lucock, 2000).

It was reported that of folate level can be improved in food plants through metabolic

engineering. Lack of Folate deficiency has philosophical influence on healthiness of

human beings effecting large population. This problem can be solved through

modification of crops with high contents of folate through genetic engineering.

Plants are rich in dietetic folate so this technique may help to resolve the worldwide

folate malnutrition. Presently some advance techniques are being assessed for the

improvement of micronutrients in plants with possible application of folate increase.

46

46

It was reported that vitamin B comprised of water-soluble enzyme cofactors. In

plants as well as in animals and microorganisms various metabolic processes depend

on derivatives of vitamin B where they play important role. Seven vitamins form this

complex: B1, B2, B3, B5, B6, B8 and B9 (folate). Humans lack enzymatic system

to all these seven B vitamins required in the human diet for proper nutrition. The

principle objective was to review the current information about the synthesis of

vitamin B in plants (Sanja, 2007).

The lack of nutrient caused several physical and intellectual problems. In developing

countries genetic engineering techniques like biofortification of cereals to cover

daily folate requirements is a striking approach to address malnutrition. In this study

wheat seeds were used to isolate folate genes 6-hppk/dhps, 4-amino-

4deoxychorismate synthase and folypolyglutamate synthetase and their homologues

were identified in rice genome. Gene expression studies confirmed de novo folate

production in growing wheat seeds and exclusively in transcripts of mature seeds

with potential to refill its own pool of vital glutamated folates during whole life cycle

(Shan and Robert, 2008). It was also found in literature that iron contents in cereals

and rice crops are very low. Most of these Fe contents are lost during processing of

grains. Folate deficiency is affecting large group of people around the world. The

approaches like food fortification and folate supplement intake programs are not

always productive. A substitute to solve this problem is through biofortification of

iron. Here, some direct genetic modification and some conventional breeding

techniques for rice biofortification for iron were addressed. Here the breakthrough

of new genes and QTLs related to folate biofortification is highlighted (Raul et al.,

2012).

47

47

Folate is needed for almost all living organisms as important cofactors. Among plant

produce cereals are the most extensively used but unable to add enough folate. It was

illustrated through GTP cyclohydrolase 1 mRNAs from growing tissues of wheat

seed, roots and leaves that de novo synthesis of folate is taking place all over the

wheat plant. Folate biosynthetic pathway is constantly active in developing wheat

seeds and it is important for folate production depending upon seed viability (Shane

et al., 2008).

Folate deficiency in the developing and developed countries, where it is responsible

for serious health problems among people was also studied. Currently some

progressive food fortification and folic acid supplementation were effectively used

modern approaches established. The genes and enzymes of folate synthesis are

sufficiently understood to enable metabolic engineering of the pathway and their

study consequences from engineering studies in plants are supporting (Samir et al.,

2008).

The presence of genes for different micronutrients at one place may have extra

benefit as the same promoter elements working at sea buckthorn mesocarp are active

during fruit ripening may have joint action and can help in the transport of many

genes in one go. Gene transformation of micronutrients in cereals by genetic

engineering techniques shows best results than traditional breeding techniques. Sea

buckthorn fruits are rich in micronutrients like Vitamin A, Vitamin C, E and Iron

which shows numerous genes related to the synthesis of such phytochemicals, which

are essential for the growth and health of human being. These micronutrient genes

can be used for the cereals biofortification.

48

48

1.7. Objectives

The main objectives of this doctoral dissertation are as follows:

To identify the proper stage of fruit development for gene expression via analysis of

genes involved in vitamin A, vitamin C and folate genes in different tissues of sea

buckthorn.

Isolation of mRNA from Sea buckthorn fruit berries to synthesize cDNA of these

micronutrient genes i.e. vitamin C, folate and vitamin A using gene specific primers

in RT-PCR.

Amplification, cloning and sequence analysis of these genes for their later

comparison with other genes in different species having potential for staple food

biofortification.

49

49

Chapter 2

ASCORBATE OXIDASE

Abstract

Ascorbic acid (vitamin C) is a well-known molecule for its nutritional importance.

However the major aspects of its metabolic processes and a few aspects of its

functions in plants are poorly understood. For instance, its biosynthetic pathways

were not definitely recognized although it attains milli-molar concentration in nearly

all tissues. Human beings and some animals are dependent on ascorbate contents in

diet. A Functional candidate gene known to be involved in ascorbate metabolism

was therefore chosen. A full length cDNA sequence of Ascorbate oxidase containing

a unique fragment of the 2158 bp as compared to tomato cDNA sequence (1737 bp)

has been amplified and cloned through RT-PCR based cloning of cDNA. The amino

acid residues encoded by Hr-AO was 719aa. There was a difference in length of

new cDNA sequence as compared to cDNA with 87% gene homology. Expression

analysis of this gene sequence from six different tissues including vegetative bud,

seed, shoot apex, green leaves, green fruit and mature (orange red) fruits has showen

maximum transcript accumulation in green leaf and young green fruit tissues. This

is the first report on description of relationship among the expression of Hr-AO and

fruits development in such type of bush plant. This novel gene isolated from sea

50

50

buckthorn will help to understand the regulatory role of this enzyme in ascorbic acid

metabolism. The investigation suggested that this pathway gene could merely

contribute toward Ascorbic acid function or may be specific for further genetic

engineering of crops.

2.1 INTRODUCTION

Vitamin C or ascorbic acid (ascorbate) is an indispensable nutritive element for

living organisms. Vitamin C relates to numerous vitamers having activities of

vitamin C. Ascorbate oxidase belongs to class of multi copper enzyme catalyzing

the oxidation of ascorbic acid to dehydroascorbic acid. Ascorbate oxidase is a cell

wall localized enzyme that utilizes oxygen for oxidation of ascorbate (AA) to the

unstable radical monodehydroascorbate (MDHA) which quickly disproportionate to

give dehydroascorbate (DHA) and ascorbic acid, and hence added to regulation of

the ascorbic acid redox state (Vasileios et al., 2006). The organization of both

reduced and oxidized types of ascorbic acid is shown below (Fig. 2.1).

(a) (b)

Fig. 2.1: Structure of ascorbic acid (a) ascorbic acid (reduced form) (b)

dehydroascorbic acid (oxidized form).

51

51

Vitamin C is crucial for cardiovascular functions, immune cell development,

connective tissues, and iron consumption. However plants and most animal have the

ability to synthesize ascorbic acid whereas L-gulono-1,4-lactone oxidoreductase

enzyme is absent in humans which is required for the last stage in AsA synthesis.

Because AsA cannot store in the body, the vitamin should be attained frequently

from dietary origins. Fruits and vegetables constitute the main dietary sources of

ascorbic acid in humans and current reports suggested that better

AsA consumption (from 60 to 200 mg /day) may impart health benefit (Carr, et al.,

1999; Levine et al., 1999).

The isolation and sequencing of genes encoding AO were described in many plants.

Ascorbate oxidase is an enzyme of cell wall and their mRNA coded for a principal

signaling sequences distinctive of extra-cellular protein (Esaka et al., 1990, Ohkawa

et al., 1989). The member of Cucurbitaceae family such as pumpkin, cucumber,

squash, zucchini and melon are naturally occurring richest source of AO. The

extensive biochemical and expression studies were carried out in these species

(Carvalho et al., 1981, Esak et al., 1990, 1992; Lee and Dawson,

1973; Moser and Kanellis, 1994; Nakamura et al., 1968). Most importantly vitamin

C is an antioxidant having significant role in regenerating vitamin E from oxidize

forms (Carr and Frei, 1999; Bruno et al., 2006). AO expressions are regulated

through composite transcription and translation control (Esaka et al., 1992). The

activities and expressions level of ascorbate oxidase are tightly associated to cell

development (Kato and Esaka, 2000).

Vegetables and fruits are important constituents of the daily diet which contributed

carbohydrates especially dietetic fiber, vitamin and mineral to the body. Vitamin C

52

52

is commonly observed in several fruits and vegetables (Deman, 1973). This is water-

soluble having antioxidant property well known for health and suitable functions of

the human body (Benzie, 1999; Davey et al., 2000). It controls several syndromes

like scurvy and also has a tendency of preventing several contagious diseases,

including viral and bacterial diseases. This is also essential for curing injuries, burns

and cracked bones. This vitamin is necessary for the production of all connective

tissues (Heimann, 1980). Additionally the foods ample in fresh fruits and vegetables

are defensive against chronic, degenerative diseases (Joshipura et al., 1999; Lampe,

1999; Cox et al., 2000)

Ascorbate (AA) is the richest antioxidant found in plants and contributed mainly to

cell redox state (Smirnoff, 2000). The largest part of the AA is contained in the

cytoplasm; almost 10% of the AA contents of the total leaf is transferred and localize

in the apoplastic region, where it was present in millimolar concentrations (Noctor

and Foyer, 1998). Apoplastic ascorbic acid is supposed to characterize firstly

protection against extraneous oxidants causing potential damage. These also have a

significant function to mediate reaction to stress rendering an improved oxidative

load (Barnes et al., 2002; Pignocchi and Foyer, 2003).

In plants ascorbic acid makes a central part in the production of hydroxyprolinerich

proteins (collagen development) that are constituents of the plant cell wall.

Additionally these have important role in cell growth and divisions. Currently the

ascorbic acid biosynthetic pathway explained in plants looks quite diverse from that

in animals (Wheeler et al., 1998). The comparison of vitamin C among different

species and varieties are shown in table 2.1.

53

53

Table 2.1: Comparative list of the Vitamin C content in sea buckthorn berries, seed oil & pulp (Bal et

al., 2011).

Vitamin Species/Varieties

Contents

Berries/Juice Seed &oil Berries Pulp

Reference

Vitamin C (mg/100 g)

European subsp. rhamnoides 360–2500 – – Yao et al. (1992), Zeb (2004a)

Pakistani SBT 250–333 – – Sabir, Maqsood, Ahmed, et al. (2005)

Pakistani SBT 150–250 – – Sabir et al. (2003)

Pakistani SBT 263.05-399 – – Shazia et al. (2010)

Pakistani SBT 191-295.6 – – Asad et al. (2007)

European ssp. Rhamnoides 28–310 – – Yao et al. (1992), Rousi and Aulin (1977)

Fluviatilis ssp. 460–1330 – – Darmer (1952)

Chinese sinensis ssp. 200–2500 Zheng and Song (1992), Yao et al. (1992)

Chinese Subsp. Sinensis 460–1330 – – Yao et al. (1992)

Finnish SBT 29–176 – – Tiitinen et al. (2005)

Subsp. Sinensis 200–780 – – Zheng and Song (1992)

Subsp. Sinensis 600–2500 – – Yao et al. (1992)

Subsp. rhamnoides 165.7–293.3 – – Rousi and Aulin (1977)

Subsp. rhamnoides 150–310 – – Darmer (1952)

Subsp. Rhamnoides 27.8–201 – – Yao et al. (1992)

Subsp. mongolica 40–300 – –

Plekhanova (1988)

Indian SBT 168.3– – 223.2 Arimboor et al. (2006)

Indian SBT 509 – – Katiyar et al. (1990)

54

54

Indian SBT 422–416 – – – Chauhan et al. (2001)

SNM 360–2500 – – Li and Schroeder (1996)

Chinese SBT 513–1676 – – Zhang, Yan, et al. (1989)

Chinese SBT 780.0 – – Mingyu et al. (2001

Turkestanica SBT 200–1500 – – Ahmad and Kamal (2002)

Turkestanica SB – 35.4 – Zeb and Malook (2009)

Portland SBT 114–1550 – – Dharmananda (2004)

Chinese SBT 300–1600 – – Xu (1956), Tian (1985), Wang (1987)

*Sea buckthorn (SBT).

The mysterious enzyme ascorbate oxidase is simply found in plants and

fungi (Liso et al., 2004), related to the cell wall (Farver et al., 1994). It is well known

that fruits commonly comprises of great quantity of ascorbic acid and are an

important supply of vitamins in food utilized by human (Davey et al., 2000).

Furthermore, these studies suggested that vitamin were being pointed to have a role

in abiotic and biotic stress responses, key enzymes of the biosynthesis pathway,

modulating this regulation would seem to be a tangible approach to increase thiamin

content in plants. Biosynthesis pathway need to be manipulated in order to increase

vitamin levels for biofortification purposes in plants. Based on recent studies, it is

now becoming clear that several regulatory steps will need to be taken into account

in order to enhance the vitamin contents of staple crops.

The current study was attempted to appraise role of ascorbate oxidase gene in plant

development, to isolate and clone ascorbate oxidase gene required in the oxidation

of ascorbic acid and metabolism and study levels of expression in different plant

organs.

55

55

2.2 MATERIALS AND METHODS

Wild sea buckthorn (Hippophae rhamnoides sp. Sinensis) berries were grown at the

research station at National Institute for Genomics and Advanced Biotechnology

(NIGAB) Islamabad. For nucleic acid extraction, the tissue samples were harvested

from plants at different bud, leaf, fruit and seed developmental stages. Fruits were

harvested once or twice a week during the ripening period from sea buckthorn

nursery, frozen immediately in liquid nitrogen and placed at -80ᴼC until processed

for nucleic acid extraction and eventually expression analysis.

2.3 Designing of Primer

Nucleotide sequences of ascorbate oxidase genes were retrieved from National

Center for Biotechnology Information (NCBI) database. The gene specific primers

were designed from the conserved region of acorbate oxidase gene for the

amplification of full length coding sequence of AO cDNA. Primers for expression

analysis through RT-PCR were designed from newly isolated sequences of AO

cDNA (Table. 2.2).

Table 2.2: Detail of primers used in this study for H. rhamnoides AO cDNA cloning,

expression analysis (RT-PCR) and Gateway cloning.

56

56

2.4 RNA isolation protocol (TRIzol® Reagent)

The sea buckthorn fruits and leaves samples were homogenize in liquid Nitrogen at

room temperature. About 0.1 g of tissue was transferred in ice cold micro centrifuge

tubes. About 500 ul RNA reagent was added, vortexed. It was incubated at room

temperature for 5 min. For this period of incubation micro centrifuge tubes were kept

horizontally. The Samples were centrifuged for 2 min at 12800 rpm at room

temperature, and supernatant was transferred to the new tube. 100 ul of 5M Nacl was

added and mixed for a while, and then 300 ul of chloroform was also added and

mixed thoroughly. The samples were then centrifuged at 4oC for 10 min at 12800

rpm. The uppermost aqueous phase was transfer to new micro centrifuge tube and

equal volume of isoproponal, was added, mixed and kept at room temperature for 10

min. Centrifuged again for 10 min at 4oC at 12800 rpm. The

57

57

RNA pallet was washed with 70% ethanol. The RNA was stored at -80oC for RTPCR

experiments.

2.5 Rapid Amplification of cDNA Ends (RACE-PCR)

This good quality total RNA was utilized for the synthesis of cDNA with AMVRT

reverse transcriptase enzyme. In this case cDNA synthesis is primed using oligo (dT)

primer I, which aliquots (1 µl of a 20 µl reaction mix) of this reaction are subjected

to a PCR reaction using 5′-primer and a gene-specific reverse primer (GSRP)

designed for investigation. The reverse primer from the gene specific primer pair

AO-R 5՜ TTATAGAATTTAAGGCCTGTGGAA 3՜ was used. The next

procedure is made optimize to construct cDNA for further reactions.

Reagent Concentration

Total RNA 4 µl

Gene specific Primer(Reverse primer) 1 µl

Nuclease free water 8-9 µl 8-9 µl

These ingredients were mildly mixed and centrifuged briefly for few seconds and

incubated at 65oC for 5 minutes. Chilled with ice for 2-3 min. Then following

components were added in the specific order below.

Reagent Concentration

5x AMV RT buffer 4 µl

Ribolock TM RNAase inhibitor 0.5 ul

dNTP Mix, 10mM each 2 ul

AMV Reverse transcriptase 0.5 ul

Total volume 20 ul

58

58

It was mixed gently and centrifuged briefly. Then mixture was incubated for 60min

at 50oC. The reactions were terminated by heating up for 5 minutes at 85oC. This

cDNA was good enough for further experiments.

2.6 RT-PCR Amplification Protocol for Hr-AO cDNA

The same cDNA was applied for the amplification of PCR products of approximately

2.2 kb. I have successfully isolated and cloned enormously long fragment of AO

gene from Sea buckthorn that exactly match the cDNA of tomato. A 2.5 µl sea

buckthorn cDNA was utilized as template in RACE-PCR for amplification of full

length Hr-AO gene fragment. Total reaction of 50 µL volume was used with the

following regents added:

Reagent Concentration

10X Buffer 5 µl

25mM MgCl2 3 µl

10mM dNTPs 4 µl

5 U µL-1 Taq Polymerase 0.5 µl

10 µM Forward Primer 1.5 µl

10 µM Reverse Primer 1.5 µl

cDNA 2.5 µl

Double Distilled Water 32 µl

Total volume 50 µl

The standard RACE-PCR was completed with gene specific primers under the

following program: a primary denaturation step of 5 minute at 94oC, 35 cycles of

59

59

94oC for 60s, 59oC for 60s and 68oC of 165s, followed by last extension step of 68oC

for 10 min. Furthermore 1% agarose gel was used for the examination of amplicon

and photographs were taken. These amplified fragments were gels purify and

sequencing was carried out to validate the target sequence.

2.7 Gene purification

The total PCR products was first run on 2% high resolution agarose gel and then

purify by PCR GeneJET PCR Purification Kit (K0701). The following purification

protocol was used for Gel elution.

Gel pieces comprising the DNA fragments were excised with clear scalpels. To

reduce the gel volume the DNA was sliced as closer as feasible. Then slices were

placed in a pre weighted 1.5 ml centrifuge tube and weighed. The purified fragment

for cloning reactions was avoided from UV light damages. UV exposure was

minimized by putting the slices of gene fragment on a glass plate under UV exposure.

The binding buffer 1:1 was added to the gel slices. To melt the agarose gel fully the

mixture was incubated for 10 minutes at 50-60oC. These tubes were inverted and

shaken after few minute to dissolve it properly. When gel was completely dissolved

its color became yellow. Then 800 µl of the soluble gel mixture was poured out into

GeneJET™ purifications columns and centrifuge for one minute. The flow through

was disposed off and column was placed again into that collection tubes.

Additionally 100 µl of binding buffer was added to the purified gene fragments in

column used for sequencing purposes. Centrifuge it again for one minute and

discarded the flow through. The column was set back in the respective collection

tube.

60

60

It was mixed with 700 µl of wash buffer and was centrifuge again for one min. The

liquid buffer was discarded from the flow through and column was set back into the

same collection tube. The emptied column was centrifuged once more for one minute

to completely remove the remaining wash buffer. A new 1.5 ml microcentrifuge tube

was taken into which GenJET™ purifications column was shifted. Finally Elution

Buffer (About 50 µl) was transferred into the central membrane of the column. It

was Centrifuge for one min to elute DNA. The column was discarded and purified

DNA was stored at -20oC. The purification product was transported to MACROGEN

(Korea) intended for sequencing.

2.8 Gene Cloning protocol

2.8.1 TA cloning Vector

TA cloning is a commonly used lab technique for sub-cloning purposes without use

of restriction enzymes. It is much easy and faster as compared to conventional sub-

cloning methods. The following vector was chosen for cloning purpose (Fig.

2.2).

61

61

Fig. 2.2: Map of Vector pTZ57R/T used for TA cloning purpose.

2.8.2 Set up the ligation reaction

The Gene insert was prepared through PCR with Taq DNA polymerase. The purified

gene was ligated into the TA cloning vector pTZ57R/T using the following

components and procedure.

Components volume

Vector pTZ57R/T 3 µl

Ligation buffer (5X) 6 µl

Gene product 10 µl

Nuclease free Water 20 µl

T4 DNA Ligases 1 µl

Total volume 30 µl

62

62

The whole mix was vortexed in brief following centrifugation for 3-5s. These

ligations were incubated at 22oC for 60 minutes. For maximum number of

transformants it was incubated overnight at 4oC.

2.8.3 Host Cells

In our cloning experiments E. coli strain DH5α was used which is well-suited for

lacZ blue/white screening processes. It is quite easier to transform with recovery of

high-quality plasmids from transformed colonies. The following procedure was

applied to prepare electro-competent cells of DH5α strain.

2.8.4 Electroporation of E. coli:

LB-medium (1 L)

The E. coli cells were grown on LB liquid medium. For 1 L of LB media, following

ingredients were mixed in a Flask container with a stir bar until everything was

dissolved.

Components To make 1L

Tryptone 10 g

Yeast extract 10 g

NaCl 5 g

Water, nuclease-free 950 ml

Total 1000 ml

The pH of the medium was adjusted to 7.0 with 1N NaOH and volume was brought

up to one litter. The media was then autoclaved for twenty minutes at 15 pounds per

63

63

square inch. It was allowed to cool down to 55°C at room temperature. The

antibiotics like ampicillin (50 µg/mL) were poured if required. The media was stored

at room temperatures or +4°C.

Stock solution (Amp. 50 mg/ml)

Ampicillin (2.5 g) was dissolved in 50 ml deionize H2O. It was filter sterilized and

store in number of aliquot (50 μl) at -20°C for later use.

X-Gal (20 mg/ml)

X-Gal 200 mg was dissolved in 10 ml N,N-dimethylformamide and was stocked at

-20°C in darkness.

IPTG (100 mM)

About 1.2 grams of IPTG were dissolve in 50 ml of deionize water. It was filter

sterilized, aliquoted and stored at 4°C. About 50 μl per plate was used.

LB plate Preparation (Antibiotics)

Once the LB medium was prepared and autoclaved, it was cooled to

approximately 55°C. After that 1ml stock solution of ampicillin (50 mg/ml), 50 μl

of X-Gal (20 mg/ml) and 50 μl of IPTG 100 mM were added. The media was

smoothly mixed and pour in Petri-plates. Then plates were dried and opened

underneath UV light for thirty minutes at room temperature and stored at +4°C in

darkness.

2.8.5 E. coli cells Preparation for Electroporation.

Procedure

For preparation of electro-competent cells 5 ml LB media was poured into falcon

tube with 5 ul of ampicillin added. A single colony from freshly grown DH5α LB

64

64

plate was used to inoculate this media and cell were grown at 37oC overnight with

continuous shaking. The following procedure was followed:

• The overnight grown culture was diluted with 500 ml LB media in a 1L Flask

(OD˷0.2).

• The cells were grown for two to three hours at 37oC with vigorous shaking until the

cells reached to OD600˷0.2 to 0.4. The culture was chilled on ice and transferred to

centrifuge tube.

• The cell pallet was harvested by centrifuging at 8500 rpm at 4oC for 20 minutes in

pre-cooled sterile centrifuge tubes. For each experiment autoclaved bottles were

used.

• The pellet was resuspended with 350 ml ice cold H2O/500 ml. Pellet was dissolved

by continuous vortexing (gently) and pipetting until cells became resuspend.

• The cell suspension was centrifuged at 85,00 rpm for 20 min and supernatant was

removed cautiously as soon as possible.

• The cell pellet was resuspended/washed next time in 250 ml sterilized chilled water

and dissolved by the use of similar procedure as depicted before. The cell

suspensions were centrifuged at 7000 rpm for 20 minutes at 4oC.

• The cell pellet was resuspended again in 20 ml of cold water in falcon tubes and

centrifuged at 5000 rpm at 4oC to harvest the cells.

• The clean cell pellet was then resuspended in 800 ul 7% DMSO/500 ml culture or

70% glycerol was used for 50 ul of cells.

65

65

• The final volume of about 50 ul aliquots of cells was made in pre-cooled eppies.

These competent cells were either utilized directly or kept frozen in aliquot in icecold

vials at-80oC.

• Electroporation of AO gene (construct) into E. coli strain DH5α.

• Transformation of the resulting plasmid (pTZ57R/T) with gene insert into E. coli

DH5α strain was mad using electroporation method of transformation. The

following material in various volumes was used in the experiments.

Material volume

Vector 2 µl

LBmedia liquid 1 ml

Cuvette (chilled) 1 -2 ml

Tips (sterilized) 1 -1000 µl

LB solid plates 25 ml/plate

Electroporator 1800 volts

The required number of micro centrifuge tubes, LB liquid media and electroporation

cuvettes were marked and Placed on ice. The electroporation machine was also set

at 1800 volts. Using a micro pipette about 1-10 µl of ligation mixture was mix with

50 µl competent cell and carefully transferred into ice-cold cuvettes with no bubbles

formed. It was made sure that cell deposited around base of cuvette. It was

Electroporated at 1800 volts by pressing the button two times after the pulse is

delivered. Immediately 1 ml of LB media shifted into cuvette, gently mixed with

pipetting twice up and down. It was then transferred to sterilize micro-centrifuge

tubes. It was kept at 37°C for 1-2 hour with vigorous Shaking (250 rpm). These cells

were diluted appropriately and 200-500 μl of cells was spread onto a pre heated LB

antibiotic plates. These plates were placed overnight in incubator at 37°C.

Consequently over 90% of cell colonies comprised the vectors having gene inserts.

66

66

Blue/white colony selection was used to identify the recombinants (clones). The

white colonies with recombinant plasmids were selected marked for colony PCR and

plasmid isolation

2.8.6 Colony PCR procedure

This protocol was considered for quickly screening of plasmids with insert

immediately from colonies of E. coli cells. These techniques were successfully

applied to find out inserts length with M13 primers. The positive colonies were

marked and further propagated by short strike of individual colonies on ampicillin

plates. The following colony PCR reaction was used for AO gene insert validation,

and reagents were mix together resting on ice with enzymes added at the end.

Reagent Concentration

10X Buffer 5 µl

25mM MgCl2 4 µl

10mM dNTPs 1 µl

5 U µL-1 Taq Polymerase 0.5 µl

M13 Forward Primer (10µM) 1 µl

M 13 Reverse Primer (10µM) 1 µl

Double Distilled Water 37.5 µl

Total 50 µl

The cool PCR reactions in tube were properly mixed and a smaller amount of each

colony was added. The selected colonies were crushed with a pipette tip and mixed

by pipetting up and down. A short strike could be made over the ampicillin culture

plate to save the individual colonies for re-propagation. This type of adequate mixing

resulted in cell breakdown completely by good yield.

The following PCR profile was used for colony PCR reaction.

• 1 cycle of 5 minutes at 95°C –to denature DNA and break cells.

• 34 cycles of 30 second at 94°C, 30seconds at 52°C and 2 minutes at 68°C.

67

67

• 1 cycle of 12 min at 68°C -last extensions step to ensure fully sized product.

These PCR amplifications were run on agarose gel for presence of expected product

size. After PCR confirmation individual colonies with positive confirmation were

cultured for plasmid DNA purification before analysis.

2.8.7 Plasmid DNA extraction

General protocol

The recombinant plasmids were purified from overnight bacterial culture using a

reliable Favorprep™ plasmid DNA extraction Mini Kit. The following procedure

was used.

• 1-4 ml of well-grown bacteria cultures were transferred to a micro-centrifuge tube.

• The bacteria were descended by centrifuging for 2 min at maximum speed and

supernatant was discarded completely.

• 200 µl of FAPD1 buffer (RNase A added) was mixed with pellet. Then

resuspended the cells completely by pipetting. No cell pellet was left visible after

resuspension of the cells.

• About 200 µl of FAPD2 buffer was added up. The tubes were inverted gently 10

times to lyse cells. Incubate it at room temperature for two minutes. These tubes may

be inverted continuously until lysate became clear. This step was preceded with 5

minutes.

• 300 µl of FAPD3 buffer was added and the tube was inverted 10 times

immediately but gently.

• Centrifuged for 5-10 min at full speed at 14000rpm. During centrifugation placed

FAPD column in collecting tube.

68

68

• Supernatant was transported carefully into FAPD column. Then Centrifuge it for 30

seconds. The flow-through was discarded and the FAPD column was placed back

in the collection tube. In adding it was make sure that no white pellet was transferred

into the column.

• 400 µl of W1 buffer was Add to FAPD column. Centrifuge it again for 30 seconds

and discard the flow through. The FAPD columns were put again in the collecting

tubes.

• 600 µl of wash buffer was added into FAPD column. Then centrifuged for 30

seconds then discarded the flow-through and the FAPD column was place back in

the collection tube.

• Then Centrifuge it for three more minutes for drying the column. It will assure the

removal of the remaining liquids completely that may hinder successive enzyme

reaction.

• FAPD columns were place into clean 1.5ml micro-centrifuge tubes.

• 50 ul-100 ul Elution buffer were add to central membranes of FAPD column. The

column was left standing for 2 min.

• Centrifuge it again for one min for elution of plasmid DNA.

• The plasmid DNA was Store at 4oC or -20oC.

2.8.8 Plasmid PCR and sequencing

The purified plasmids were again confirmed through plasmid PCR with internal

short gene primers or M13 primers. For this purpose the plasmids were diluted (1µl

plasmid DNA & 4 µl of dd H2O) and used for PCR following the procedure as under

Reagent Concentration

10X Buffer 5 µl

25mM MgCl2 3 µl

69

69

10mM dNTPs 1 µl

5 U µL-1 Taq Polymerase 0.5 µl

M13 Forward Primer (10µM) 1 µl

M 13 Reverse Primer (10µM) 1 µl

Double Distilled Water 37.5 µl

Plasmid (Diluted) 1 µl

Total 50 µl

PCR Profile

The following PCR profile was used for plasmid PCR reaction with

• One cycle of five minutes at 95°C for initial denaturation.

• 34 cycle of 30 second at 94°C, 30 seconds at 52°C and 2 min at 68°C.

• 1 cycle of 12 min at 68°C for final extension step.

The PCR product were analyzed on gel and sent for sequencing to Macrogen Korea.

2.8.9 Gateway cloning

This technique was used for efficient transference of DNA fragment among plasmid

vectors. This wass accomplished by the use of recombinant sequence set of

"Gateway att" site and two enzyme mixes, named "LR and BP Clonase". We

successfully transferred gene fragment among various vectors used for cloning.

Initially the gene fragments were first inserted in plasmids having both adjoining

recombinant sequences att L 1” and att L 2” in order to create a Gateway Entry clone.

These Entry clones were made in following two steps.

70

70

2.8.10 Gateway® Entry Clone

1. Create PCR products

AO gene product was amplified by using Taq polymerase in PCR reaction with gate

way primers designed (table 2.1). The recombinant plasmid (diluted) or the purified

AO PCR products can be used for Gateway amplification.

Reagent Concentration

10X Buffer 5 µl

25mM MgCl2 3 µl

10mM dNTPs 4 µl

5 U µL-1 Taq Polymerase 0.5 µl

GW Forward Primer 1.5 µl

GW Reverse Primer 1.5 µl

Plasmid/PCR product 1 µl

Double Distilled Water 33.5 µl

Total 50 µl

PCR Profile

Gateway product were amplified with specific Gateway primers by using program:

a first denaturation cycle at 94 oC for 3min, 35 cycles at 94oC for 60s, 57oC for 75s

and 72oC for 165s, followed by last extensions step at 72oC for 10 min. Amplified

products were examined on 1% gel and photographs were taken. Low melting

agarose gel was used to purify the total PCR products following the same procedure

as above. This purified product is ready to use for BP reaction.

2. BP Cloning reaction

The following BP reactions were set up using the reagents in the order shown.

pDONAR™ 201 vector was used for this purpose. These reagents were mixed on

ice in a 1.5 ml centrifuge tube.

Reagent Chemical Txn

71

71

Fresh PCR product (purified gateway clone) 1-7 µl

pDONAR™ 201 1 µl

TE Buffer (pH 8.0) 8 µl

These components were mixed carefully and incubated at room temperature for five

min. After thawing BP Clonase™ II enzymes by ice mixed it for about 2 min.

Then 2 µl of BP Clonase™ II enzyme was added to the reaction mixture by vortexing

briefly twice and centrifuged briefly. The reactions were then incubated for 1 hour

at 25°C. These reactions may be finished by addition of 1 µl of the Proteinase K into

all samples and vortex for a short time. These mixtures were incubated for 10 min at

37°C. These samples were placed on ice before proceeding to transformed electro-

competent E. coli cells. The map of pDONAR™201 vector was constructed in Sim

Vector 4.6 software as shown in

Fig. 2.3.

Fig. 2.3: The map of pDONAR™201 vector used in gateway cloning.

72

72

3. Transformation into electro Competent E. coli cells

Single vial of E. coli cells (DH5α) were thawed resting on ice. About 2 µl of the BP

mix was poured in vial of electro-competent E. coli (50 µl) cells and was mixed

carefully. It was incubated for few min lying on ice and transferred to pre cold

cuvette. The cells were then Electroporated at 1800 volts for transformation of

pDONAR™ 201 vector into DH5α cells with no shakiness. These tubes were

transferred into ice at once. About 500 µl LB liquid media was added, mixed gently

by pipetting and transferred to sterile micro centrifuge tube. It was incubated for one

to three hours by temperature of 37°C through continuous agitating. The bacterial

cultures (250-300 µl/plate) were spread on a pre-warmed LB agar plate which

contained kanamycin (100 µg/ml). Kanamycin was used as suitable marker for

selection of donor vectors. These plates were incubated at 37°C overnight. All

transformed colonies have produced white color competently. The well grown

colonies were selected and colony PCR was performed to confirm the transformants.

Reagent Concentration

Premix X Taq 12.5 µl

AO Forward primer 1 µl

AO Reverse primer 1 µl

dd H2O 10.5 µl

Colony Single

Total 25 µl

73

73

PCR Profile

Colony PCR was carried out using following program: an initial denaturation step at

94 for 3min, 35 cycles of 94oC for 60s, 57oC for 75s and 72oC for 165s, and last

cycle of extension at 72oC for 10 minutes. Positive colonies were selected by

analyzing the PCR product on 1% agarose gel and photographed. The positive

colonies were also grown further by striking on separate kanamycin resistant LB

plate. The colonies were used to inoculate 5 ml LB liquid media (added 5 µl

kanamycin) and were grown overnight. This culture was used to purify plasmid for

further reaction and sequencing. The BP purified plasmids were also confirmed

through PCR with gene specific primers. The primers were diluted for PCR (1 µl of

plasmid DNA & 4 µl dd H2O) and same PCR conditions were used as for colony

PCR.

Reagent Concentration

Premix X Taq 12.5µl

AO Forward primer 1 µl

AO Reverse primer 1 µl

dd H2O 9.5 µl

Plasmid DNA 1 µl

Total 25 µl

The purified plasmids were sequenced from Macrogen Korea with gene specific

primers. This entry clone was now prepared for entry into destination vector.

2.8.11. LR Reaction

74

74

LR reaction was used to transfer Hr-AO gene from Gateway entry clone into

destination vector. This was easier method and components were added following

the same order as above at room temperature.

Reagent Chemical Txn

Entry clone 1-7 µl

Destination vector 1 µl

TE Buffer (pH 8.0) 8 µl

LR Clonase ™ II enzyme was thaw on top of ice and mixed for 2 minutes. LR

Clonase ™ II enzymes were vortexes and mix it shortly two times. About 2 µl of LR

Clonase ™II enzyme mix was poured into the reaction and mixed by vortexing

briefly and then centrifuged. This reaction was incubated at 25°C for 1 hour.

Additionally 1 µl of the Proteinase K mix may be added to LR reaction mixture to

finish the reaction. The sample was incubated at 37°C for 10 min. The map of

destination vector used was shown in Fig. 2.4.

75

75

Fig. 2.4: Map of the destination vector used in Gateway cloning.

2.8.12 Transformation

The same protocol was followed as designated for BP reaction for transformation,

with the exception that we used appropriate selection markers for the LB plate

suitable for our destination vectors (typically 100 µg/ml ampicillin) instead of

kanamycin. The total LR reaction was used for transformation and plating. The

transformed cells were analyzed by colony PCR and positive colonies were marked

and grown for plasmid purification. The construct was ready to use for further

sequencing, cloning and expression process.

2.9 AO gene expression analysis

2.9.1 Semi-quantitative RT-PCR

The semi-quantitative RT-PCR amplifications were used to differentiate expression

pattern of ascorbate oxidase gene from Sea buckthorn plant. Different tissues

including vegetative buds, fresh seeds, shoot apex, green leaves, young green fruits

and mature orange red fruits were collected from the plant grown in the glass house

at the NIGAB Islamabad. Samples were instantly frozen using liquid nitrogen and

were utilized for total RNA isolation with Trizol reagent. The RNA was treated with

rDNAse to remove any DNA contamination and was quantify through thermo

Scientific’s NanoDropTM Lite spectrophotometer. 1.5% agarose gel was used to

evaluate the total RNA quality.

The AO gene’s primers were designed in NCBI primer picking program. These

primers were designed based on the sequence of new gene isolated. The cDNA

76

76

synthesized from different tissues was utilized as template in RT- PCR reaction with

the subsequent program: first cycle of denaturing at 95˚C 5 of min, 37 cycles of 94˚C

for 30sec, 58˚C for 30 sec and 68˚C for 30 sec, following last extension step of 68˚C

for 10 min. Actin-1 reference gene was utilized as control gene to check equal PCR

loading. These reactions were repeatedly carried out thrice for both biological and

technical replicates. The transcript products were examined on 1% agarose gel

stained with Ethidium Bromide (EtBr). The gel documentation system was used to

photograph the amplicon. The transcript accumulation was evaluated from band

intensity.

2.9.2 ATGene (Arabidopsis thaliana AO gene) Expression Pattern

For comparision of “Arabidopsis thaliana gene” AO expression Patterns with that

of sea buckthorn Hr-AO, the bioinformatics tool AtGenExpress Visualization

(http://jsp.weigelworld.org/expviz/expviz.jsp) was used to accomplish the analysis

of data set. For data processing, standardization, and statistical analysis of these

genes Microsoft Excel software was used. The results of the statistical analysis are

presented as a mean and ± SD.

2.10 RESULTS

2.10.1 Isolation and sequence analysis of large fragment of AO cDNA

from Sea buckthorn.

RACE-PCR techniques were utilized for amplification of full length fragment of Hr-

AO cDNA. This newely isolated sequence has full size of 2158 bp as compared to

1737 bp size of reference cDNA from tomato. The distinct high molecular weight

77

77

upper band of Hr-AO (2158bp) cDNA observed on agarose gel (Fig. 2.5) was picked,

purified and cloned. The length and purity of new cDNA was determined by the gel

electrophoresis method and sequencing. The positive clones, containing AO gene

insert, were picked out from thousands of transformed cells by blue white screening.

Plasmid extraction was carried out with Favorprep™ plasmid DNA extraction Mini

Kit. The plasmid containing 2.2 kb fragment of this cDNA sequence were confirmed

through PCR and sequencing. The new sequence of

cDNA sequence was analyzed using (NCBI) Search System

(www.ncbi.nlm.nih.gov/). The sequence similarity was searched by using BLAST

program against EMBL plant DNA sequence and swissport protein database. The

identity score of Hr-AO compared to some other plant AO sequences was commonly

found in range from 60 to 87%. Comparatively the expected Hr-AO nucleotides

sequences of sea buckthorn plant with that of tomato plant AOs indicated high

conservation in sequences as shown in Fig. 2. 6. Our sequence analysis implied that

Hippophae rhamnoides AO genes encoded enzymes homological to AOs from

different plants having similarities to other multicopper oxidases genes. Here I have

reported elaborate molecular study of ascorbate oxidase gene addressing differences

in length and amino acid residues.

ClustalW alignments from Hr-AO cDNA with reference sequence at both

nucleotide and amino acid level have been created and considerable variability was

observed in the sequence and size of this gene. Differences were found in the

nucleotide sequence of Hr-AO, and all these are the source of change in protein in

comparision with reference cDNA sequence. The deduced amino acids sequences

from the nucleotide sequence indicated that product of translation was a precursor

78

78

of about 719 amino acid residues with E value of 7.49e-82. The sequence identity to

tomato sequence was 87% at amino acid level.

Fig. 2.5: (a) Isolation of high quality total RNA from sea buckthorn tissues. (b)

Amplification of Hr-AO gene using RACE technique of PCR. (c) PCR confirmation

of the clones carrying recombinant plasmids with M13 and short internal primers. M

= 1Kb DNA ladder.

79

79

Fig. 2.6: Alignment of Hr-AO and S. lycopersicum nucleotide sequences with Mac

VectorTM 7.2.3. The top sequence is that of tomato AO and the bottom that of Hr-

AO. The identical bases are shown against a black background.

80

80

2.10.2 Gate way cloning

In addition to the molecular cloning and sequencing Gateway cloning was carried

out to transfer gene to expression vector. This is a robust scheme of creating an

extensive range of expressions construct for function in manifold host system. Gate

way cloning was used to easily shuttle our targeted gene (Hr-AO) accompanying

recombination with attB PCR products and attB expression clones. AO gene specific

primers were used to analyze entry clones (Fig. 2.7) by using PCR reactions. The

Entry clones were purified and sequence verified. After creating entry clones, our

concerned gene were transferable in great collection of expressions vector by means

of Gateway® LR reactions involving entry clone and destination vector of our

interest. This clone was ready to be used for further introduction and expression into

the system of choice.

Figure 2.7: (a) Amplification of Hr-AO product by standard PCR with gateway

primers. (b). Gel showing pDONAR recombinant plasmids. (c&d) The pDEST

vector pXCG-mYFP (51delta 35s) SB512 colony and plasmid PCR confirmation

respectively. (e) Stable integration of AO-PB clones carrying the recombinant

plasmid into destination vector. (f) pDEST AO recombinant plasmid confirmation

through PCR. M: 1 kb marker.

81

81

2.10.3 Differential expression of AO gene

In order to differentiate the expression pattern of ascorbate oxidase gene in various

tissues of Sea buckthorn total RNA from six different tissues like vegetative bud,

fresh seed, shoot apex, leaf, green fruit and mature fruit were extracted. This method

involves RT-PCR amplification of gene transcripts using mRNA reverse

transcription and a second step of semi-quantative PCR amplification (PCR) of the

cDNA synthesis. Normalization was done using constitutively expressed actin-1

gene. In our expression studies we find that transcript signals of AO are strongly

detectable in the green leaf tissues (Fig. 2.8). There was no band in case of seed

tissues. These reactions were repeatedly carried out thrice for both biological and

technical replicates.

Fig. 2.8: Hr-AO transcript amplifications in vegetative bud shoot apex, green leaf,

green fruit and mature orange red fruit tissues of Sea buckthorn through semi

quantative RT-PCR in comparisons with control Actin gene. . Actin gene is used as

control, to check equal loading and PCR quality check.

To check the gene expression pattern of ascorbate oxidase gene at different

development stages, abiotic stress, hormones and light under a set of multiple

biological conditions Arabidopsis thaliana gene expression data was used as

82

82

comparision with sea buckthorn. The expectation was that AO gene regulations in

Arabidopsis may well be conserved in sea buckthorn. It was assumed from

Arabidopsis expression pattern data that AO expression pattern in sea buckthorn

behaved the same as maximum expression was observed in floral organs and leaf

tissues (Fig. 2.9a,b,c &d)

(a) (b)

(c) (d)

Fig. 2.9: Arabidopsis thaliana AO (AT5G21100) gene expression pattern from

global data set of microarray under different conditions: (a) in different plant tissues,

(b) hormonal conditions, (c) Abiotic stress, and (d) light exposures respectively.

83

83

The transcript signals were also significant in case of green fruit tissues. However

weak band intensity was found in case of vegetative buds and shoot apex with

insignificant band intensity. More interestingly no amplicon were detected in case

of fresh seeds tissues.

I can imagine that ascorbic acid contents in matured fruit are less which can be due

to over-ripening of fruit with some degradation by enzyme then the activity growing

leaf and green tissues. Moreover the transcript intensity was higher in green fruit

tissues than the ripened fruit tissues. Leaf tissues showed the maximum transcript

accumulation which showed maximum ascrobate oxidase accumulation and

expression in apoplastic region. Gene expression changes are highly dynamic, and

gene expression pattern vary and often more complex. Numerous reports showed

that it is possible to improve ascorbate accumulation in plant cells via regulating the

ascorbate recycling process.

I was already reported that ascorbate oxidase transcript levels are highest in the

actively growing tissues. The ascorbate content in plants varies with different tissues

and plant species. Photosynthetically active tissues in addition to fruit and other

storage organs usually contain relatively higher concentration of ascorbate (Loewus

and Loewus, 1987).

The overview of different AO genes, function and expression in specific tissues with

their reference source are showen in table 2.3.

84

84

Table 2.3: Overview of different AO genes, function and expression in specific tissues

with their reference source.

Lf=leaf, Fl=flower, Sp=sepal, Pt=petal, St=stem, Fr=fruit, Rt=root, += expression and /= no

expression.

2.10.4 Phylogenetic analysis

Phylogenetic analysis revealed that the Hr-AO is the member of the copper ion

binding, oxidoreductase, family and it was assigned the unique name Hr-AO.

In order to invoke an evolutionary model between newly isolated sequence and those

in the database, phylogenetic reconstruction was carried out. Multiple sequence

alignments were completed with Clustal W alignments using Mega 5.0 program and

homology searches were done with BLAST programs in NCBI databases. For this

85

85

purpose the coding cDNA sequences of AO homologue were collected from

various plants species including L. esculentum, R. communis G. max, M. truncatula,

M. truncatula, P. sativum, G. max, N. tabacum, P. trichocarpa, G. max, O. sativa,

A. thaliana, A. thaliana, A. thaliana, A. thaliana, P. graminis, M. oryzae, L. bicolor,

B. juncea, C. maxima, Pumpkin, C. melo, Cucumber, C. sativus, C. melo, A.

thaliana, I. pine, F.ananassa, M. domestica, M. pumila were used. The tree was built

by majority decree and strict consensus. Terminal gaps were eliminated before

analyzing the sequences. Whereas the inner alignments gaps were left and analyzed

using scoring gap as character or as missing character. A tree was created using

neighbor-joining method as shown in figure 2.10. 1000 bootstrap replicate were used

for bootstrap analysis.

This tree displayed that sequences are evidently differentiated into different clades

with five different clusters. Higher bootstrap values are indicative of increased

reliability of the tree. Fascinatingly divergence in sequences was found with H.

rhamnoides sequence lay close to L. esculentum, then close to G. max, R. communis

and some other members of the Fabaceae family. The list of the organisms and

accession used in phylogenetic tree construction along with their evalue are shown

in table 2.4.

Table 2.4: List showing organisms and accessions used in phylogenetic tree

construction.

86

86

This is very outstanding discovery that Hr-AO along with Solanaceae member

showed close relation with Fabaceae member where AOs were strongly associated

in a cluster. The other members of the cucurbitaceae AO, brassicaceae and poaceae

were more distantly related. The members of the pine and Malus seem to be the

progenitors.

87

87

Fig 2.10: Phylogenetic reconstruction of ascorbate oxidase gene from different

species. Neighbor joining tree was made by means of MEGA5 software. The Value

on each node indicated bootstraps replication of 1000. This species along with

accession used in tree includes AY971876-L.esculentum-AO, XM_002528929-

R.communis-AO,XM_003532792-G.max-L-AO, XM_003638399M.truncatula-AO,

Y15295-M. truncatula-L-AO, AB457618-P.sativum-AO, AF529300-G.max-AO,

D43624-N.tabacum-AO, XM_002312802-P.trichocarpaAO, XM_003555611-

G.max-AO, NM_197271-O.sativa-AO, NM_147871A.thaliana-AO,

NM_001203424-A.thaliana-AO, AY099586-A.thaliana-AO,

BT003407-A.thaliana-AO, XM_003336029-P.graminis-AO, XM_003713188-

M.oryzae-AO, XM_001875289-L.bicolor-AO, AF206722-B.juncea-AO,

D55677C.maxima-AO, X55779-Pumpkin-AO, AF233594- C.melo-AO,

J04494Cucumber-AO, FR750377-C.sativus-AO, Y10226-C.melo-AO, AB004798-

A.thaliana-AO, B1698178-I.pine-AO, FJ896040-F.ananassa-AO, EF528482-

M.domestica-AO and Gu321223-M.pumila-AO

88

88

2.11 DISCUSSION

Sea-buckthorn is one of nature’s true super foods, as it packs a powerful nutritional

punch with a broad spectrum of health-promoting vitamins, minerals,

phytonutrients, and essential fatty acids. Whether you use it for a specific issue or to

promote overall health, give this little super food a try!

Vitamin C or ascorbic acid is a water-soluble vitamin most commonly found in

mammals and other animals. While humans are unable to synthesize ascorbic acid

and dependent on diet for their vitamin C contents. However the chemistry of

synthetic and food originated vitamin C is similar. The most fruit and vegetable are

abundant in several micronutrients and photochemical contents that could affect

bioavailability of vitamin C.

The fruits berry is the richest source of nutrient in diet proportional to energy

contents. Wild sea buckthorn berries are also good source of vitamin C. During our

study we successfully find coding fragment of AO ortholog from sea buckthorn

which is involved in ascorbic acid metabolism and biosynthesis. However reliable

and sensitive amplification of AO fragment (2158bp) was most important discovery

achieved through RT-PCR reaction with difference of about 421 bp between length

of the new amplicon and tomato gene. The non-synonymous differences were

randomly distributed among the whole sequence making difference with tomato

gene. Allignments at both nucleotide and amino acid levels showed conservation and

differences, which provide new tool for determining the function of proteins and

domains. In addition to examine gene functions it is essential to clone the target gene

into various types of plasmids. In case of plant biological methods the targeted gene

is commonly cloned in binary-vector for the purpose of Agrobacterium

89

89

transformations (Chakrabarty et al., 2007). The Hrascorbate oxidase was cloned

both through TA cloning and gate way cloning techniques to further study its level

of expression and function.

The capability of direct cloning and selecting recombination products in Gateway

cloning system is less time consuming non-laborious, and decreased possible

contaminant associated with handling of transformants. In our transformation system

the desired construct was firstly cloned in Entry vector (pENTR201) and was then

transfered into Destination vector pXCG-mYFP (51delta 35s) SB512 by site-specific

recombination. BP products (containing AO gene) were verified by sequencing.

Colony PCR was used to substantiate Gateway LR products, because there was no

change in sequence outside the recombination taking place at the Att site. A variety

of recombinant pDEST vectors obtained could also be utilized for the transformation

of Arabidopsis plants by floral dip system of transformation (Clough and Bent,

1998). This Hr-AO gene construct could potentially be used to simplify and improve

the efficiencies of gene cloning in A. tumefaciens for transformations studies in

plants or protein expression vectors and can possibly be adapted for high- throughput

applications.

However extensive expression and enzyme structural studies of AO gene have been

carried out but its exact function in higher plant species left unidentified. Current

investigation was centered on modifications in the Hr-AO expression pattern in

different tissues of sea buckthorn. Hence, differences in expression pattern in

different tissues are quite outstanding. The comparison of Arabidopsis thaliana AO

microarray data on gene expression pattern in different tissues and under different

conditions was also found consistent with that of sea buckthorn AO expression

90

90

profile. Ascorbate content in rapidly-growing tissues is higher than that of aging

tissues, as ascorbate is generally accumulated in the tissues with active growth such

as the meristem (Luwe, 1993). The ripening fruits in tomato accumulate more

ascorbate than immature fruits (Smirnoff, 1996).

In our work ascorbate oxidase gene transcript accumulation in sea buckthorn was

compared among different tissue, which corresponds to gene expression studies in

melon. Gene-specific expressions work in melon plant indicated that simply CmAO1

and CmAO4 genes showed transcriptional activity and differential regulation

depending upon tissues, development stages in addition to stimulus by outside.

Further they found CmAO1 gene transcript in floral and fruits tissue, while CmAO4

transcripts preferably accumulated in vegetative tissue without any expression of

CmAO genes in seeds of melon. Expression activity of CmAO4 gene was observed

during germination. Moreover regulation in activity of CmAO4 as a result of stresses

by heating, hormones and wound were also noticed (Sanmartin et al., 2007). These

results corresponded to our expression studies in sea buckthorn plant where I have

found AO expression activities in actively growing fruit and vegetative tissues.

Further reports of maximum expression of AO were found in different active

growing parts of plant with considerable increase in activities and expression level

of melon AO transcripts through the particular developmental stage of fruits (Esaka

et al. 1992; Moser and Kanellis 1994; Diallinas et al., 1997; Al-Madhoun et al.,

2003). Our results are also in coincidence with expression work in strawberry

(Fragaria×ananassa) where high expression level of FaAO was found in more

young parts (young fruits) with low expression in late maturing stages. It could be

linked to the facts of active growth in young fruit tissues with important effects of

91

91

FaAO on increasing fruits development (Yuanxiu et al., 2013).

Gene expression in sea buckthorn tissues followed divergent profile. The increase in

ascorbate level in actively growing tissues and fruits possibly will be the effect of

combine actions of oxidized and recycled enzyme. It was reported already that

during the process of earlier fruit growth there is an increase in transcript of AO

showing function of the enzyme in fruit development. Ascorbate oxidase enzymes

have also been suggested to participate in regulation of cell divisions and expansions

by control of ascorbate redox reactions (Davey et al., 2000; Potters et al., 2000;

Tabata et al., 2001; Sanmartin et al., 2007). There was a massive decrease in

transcript level on ripening of fruits. In melon fruit developmental process a

considerable gain in ascorbate oxidase contents during ripening of fruits having

significant part in metabolic process of cell wall (Moser and Kanellis, 1994). Some

results established differential regulation in expression of ascorbate oxidase gene at

the levels of transcripts increase (George et al., 1997).

However diverse biosynthesis pathways were connected with specific tissue,

development stage, or peripheral pressure and environmental conditions.

Appreciative effort about ascorbic acid metabolisms and biosynthetic processes in

fruit tissue is entailed with the purpose of regulating food plants with high ascorbic

acid contents. The scrutinization of cloning and expressions of ascorbate

biosynthetic enzyme included is useful approaches of this study. The assessment of

cumulative data from cDNA sequence, amino acid sequence, phylogenetic

reconstruction and expression pattern demonstrated that there is a considerable

variability in the gene constitution and evolutionary association of ascorbate oxidase

gene with other homolog.

92

92

2.12 CONCLUSIONS

The manifold roles of ascorbate oxidase in various plant physiological process and

ascorbic acid biosynthesis and recycling may bequeath with a more effectual

approach to improve ascorbate content of food crops. The current study exhibited

isolation, cloning and sequencing of ascorbate oxidase gene from sea buckthorn. The

expression studies showed that AO is vigorously expressed in dynamic fraction of

the plant tissues. Identification of genes controlling ascorbic acid buildup is

promising. The increasing knowledge about ascorbic acid genes should facilitate

engineering or modulating its accumulation.

Chapter 3

93

93

FOLATE (HPPK-DHPS) GENE

Abstract

Sea buckthorn (Hippophae rhamnoides L.) is a hardy, fruits growing plant. Well

recognized for its value in medicines and nutraceautical products, it is enriched with

astounding array of nutrient in its fruit, seed, leaf and bark contains vitamins,

essential oils and minerals. Most of the nutrients are lacking in our food crops. This

study was envisaged to isolate the folate (HPPK-DHPS) ortholog

from sea buckthorn. The target gene Hydroxymethyldihydropterin

pyrophosphokinase–dihydropteroate synthase linked in the folate biosynthesis

pathway was successfully isolated and cloned. The sequences analysis revealed that

this novel genomic locus is 2354bp in size. The coding region is interrupted by a

single large intron. Its length is 1539bp which is similar to its ortholog in tomato.

The newly isolated gene has prominent nucleotide differences compared to tomato

sequence, randomly distributed throughout the full sequence length. Expression

profile of HrHPPK-DHPS with semiquantitative RT-PCR revealed the higher

transcripts accumulation in leaf and fruits tissues. Phylogentic reconstruction

revealed its association with other plant species. In this study an attempt was also

made to compare the 3D homology modeling structure of new protein, though

considerable conservation in 3dimensional structure of folate proteins was observed;

however, notable differences in substrate binding pockets were also visible. This

study has future implications in utilizing the potential of wild medicinal plants for

genetic improvement of folate deficient staple food crops.

94

94

3.1 INTRODUCTION

Sea buckthorn fruit is considered as vitamins and other much important bioactive

substance repository (Xurong et al., 2001). Sinensis a subspecies of sea buckthorn

fruits have large amount of vitamins A, B2, C as compared to carrot, tomato and

orange. Sea buckthorn berries also have vitamin B1, P and K (Lu, 1992) and folate

vitamers (Gutzeit et al., 2008) to a very great extent.

It was also reported that total folate contents in sea buckthorn berries in the range of

about 39 μg/100 g and 5-methyltetrohydrofolate was illustrated as the principal

folate vitamers found in sea buckthorn berry. Tracings of tetrahydrofolate were

noticed although were distantly lower than the detecting point (Strålsjö et al.,

2003). The structure of folate and 5-Methyltetrahydrofolate are shown in fig. 3.1.

(a) Folate

(b) 5-Methyltetrahydrofolate

Fig. 3.1: Structure of Folate (a) and 5-methyltetrahydrofolate(b) found in sea

buckthorn.

Folate belongs to B-group vitamin that is important for cells function as well as cell

division. Human diet contains important nutrients such as vitamins and minerals.

95

95

One third of the world population cannot reach their intellectual and physical

potentiality due to deficiency. Many severe diseases such as blood anemia and neural

tube defects in newborns (Lucock, 2000), psychiatric syndromes in the elders and

reduce cognitive functioning (Calvaresi and Bryan, 2001; Hultberg et al., 2001) are

caused due to folate deficiency.

There are a number of genes that codes for vitamins such as folate in this

nutraceautical plant. The plant bifunctional HPPK-DHPS is an important enzyme of

the folate biosynthetic pathway. Tetrahydrofolate and its one-carbon derivative,

conjointly named folate, are important cofactors for one-carbon reactions in the

biosynthesis of amino acids such as purines, pantothenate, and thymidylate (Hanson

et al., 2000; Ravanel et al., 2004).

Folate is a molecule consisting of p-aminobenzoate condensed with pterin ring and

glutamate moieties. Their biosynthetic pathways in plant are individually separated in

three sub-cellular sections as showen in fig 3.2. The initial committing stage in folate

synthesis provided the pteridine by the catalytic function of GTP cyclohydrolase in

cytosolic region (Hossain et al., 2004; Schoedon et al., 1992; Yoneyama et al., 2001).

The synthesis of p-aminobenzoate occurred in plastid from chorismate in two steps

originated by aminodeoxychorismate synthase (Basset et al., 2004a). The

condensation of pABA and pteridine moieties take place in mitochondria

catalyzed by 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase, and

7,8-dihydropteroate synthase. These two are specific to plants and microorganisms,

permitting for de novo folate synthesis (Re´ beille´ et al., 1997).

96

96

Fig. 3.2: The systematic presentation of plant folate biosynthesis pathway redrawn

from source (Rébeillé and Douce, 1999; Rocío I et al., 2007). The main pathway

enzymes includes 1. GTP cyclohydrolases I; 2. nudix hydrolase; 3. non-specific

phosphatase; 4. DHN aldolase; 5. ADC synthase; 6. ADC lyase; 7.

HPPKpyrophosphokinase; 8. dihydropteroate synthase; 9. dihydrofolate synthase;

10. dihydrofolate reductase; 11. folylpolyglutamate synthase. 12. DHN,

dihydroneopterin; 13. ADC, aminodeoxychorismate; 14. PABA, p-aminobenzoate,

15. PPP triphosphate.

97

97

Our study was mainly focused to obtain full length gene fragment of HPPK-DHPS

from genomic DNA of sea buckthorn. It is well known that there is correlation

between number of introns found and gene expression in higher organisms. Several

new studies indicate that rapidly cycling cells constrain gene-architecture toward

short genes with a few introns, allowing efficient expression during short cell cycles.

In contrast, longer genes with long introns exhibit delayed expression, which can

serve as timing mechanisms for patterning processes (Heyn et al., 2015) Earlier

investigations on genome DNA sequencing in a wide variety of organism

demonstrated great variability in intron-exon structures of homologous genes in

various organisms (Rodríguez-Trelles et al., 2006). Recently much research on

complete genome of eukaryote has depicted the introns length and densities varied

substantially among related groups. The value and cost of spliceosom intron in

eukaryotic organisms was not demonstrated. The most documented effects of introns

splicing is to enhance the genes expression but their regulatory mechanism is still

undefined. Some earlier study revealed that intron splicing is a lengthy process. It

indicated that splicing cannot decrease the time needed in transcriptional activities

and spliced pre-mRNA processing. Alternatively it may be facilitating the afterward

cycles of transcriptions (Deng-ke and Yu-Fei, 2011).

The folate synthesis was reported to occur preferably in tissues with higher division

and photosynthetic activity during the process of cellular differentiation.

Additionally the folate contents in fruit could change during the maturing processes,

such as in tomato it was decreased with fruits ripening from mature green to red

ripening phase (Basset et al., 2004a).

98

98

The divergence detected between HPPKs and DHPSs from various species

powerfully suggested the substantial variation in genes progressions. However the

functions of these evolutions are poorly interpreted, a potential benefit of the

bifunctional property of HPPK/DHPS may possibly take both catalytic sites close;

as such actions are sequential in folate biosynthesis.

Sea buckthorn has a great nutraceautical potential for genetic improvement of

cereal crops through genetic engineering, hitherto little efforts has been made in

isolating folate gene from this plants. But before this application, it is very important

to isolate and analyze these genes and to study their expression patterns using

molecular techniques. Therefore we set out, 1) to isolate and clone HPPKDHPS

gene, 2) to analyze the sequence of this gene using bioinformatics tools, 3) to analyze

expression patterns of this genes in different tissues at various developmental stages

and, 4) Comparative homology modeling for deciphering the 3D structure of HPPK-

DHPS gene.

Based on experimental and sequences analysis I hypothesized that there existed a

novel HPPK-DHPS gene in sea buckthorn, recruited in folate synthesis pathway. No

deletion or insertions were detected but non-synonymous substitutions in

comparision with tomato sequence were found in the entire sequence.

Phylogenetic reconstruction revealed that HPPK-DHPS from sea buckthorn is

sister to tomato ortholog. Expression profile of HrHPPKDHPS with

quantitative RT-PCR indicated the higher accumulation of transcripts in leaf

and fruits tissues.

99

99

3.2 MATERIAL AND METHODS

3.2.1 Plant material

Sea buckthorn (Hippophae rhamnoides ssp. Sinensis) plants were grown in glass

house as well as in the field of National Institute for Genomics and Advanced

Biotechnology. For DNA/RNA extraction, the leaf, berries, bud and seed samples

were harvested from plants at various stage of development. Fruits harvesting was

carried out once or twice a week during the ripening period from sea buckthorn

nursery. The samples were frozen in liquid nitrogen and stored at -

80ᴼC until processed for further nucleic acid extraction and expression analysis.

3.2.2 Designing of primers

Nucleotide sequences of HPPK-DHPS genes were retrieved from

National Center for Biotechnology Information (NCBI) databases. The gene

specific primers were designed from conserved region of HPPK-DHPS gene

sequence of S. lycopersicum (accession No. FJ972198) was utilized for

amplifications of full length coding region of HrHPPK-DHPS gene. Primers for

expression analysis through RT-PCR were designed from newly isolated gene

sequences of HrHPPK-DHPS gene (table 3.1) .

100

100

Table 3.1: Primers used for HrHPPK-DHPS gene amplification and

expression. studies

3.2.3 DNA extraction

A CTAB method of DNA extraction was set out to isolate the HrHPPK-DHPS gene

from sea buckthorn plant instead of cDNA. DNA was extracted using the leaf

samples of sea buckthorn with a standard CTAB method (Doyle and Doyle, 1987).

The samples were grind with liquid nitrogen and homogenize in

1ml of 2×CTAB buffer (2% cetyltrimethylammonium bromide (CTAB); 100mM

Tris HCl with pH 8.0, 1.4M NaCl; 20mM EDTA; 1% PVP; 0.2% β-

mercaptoethanol). Incubate it at 65°C for 40 minutes. Each lysate was extracted two

times by equivalent volumes of chlorophorm: isoamyl alcohol (24:1). Then

101

101

precipitate DNA by 100% isopropanol followed by centrifugation at 13,000 rpm for

10 min). Each DNA pellet was washed using cold 70% ethanol, then dry it and was

suspended in 100 μl of TE buffer. Add 4 μl RNaseA (10 μg/ml) to the dissolved

DNA and incubated for removing traces of total RNA. The DNA was run on agarose

gel and photographed as shown in fig. 3.3a.

3.2.4 PCR amplification and molecular cloning

Diluted DNA was utilized as template in standard PCR reaction for HrHPPKDHPS

gene amplification using the Takara Ex Taq™ polymerase. PCR

amplifications were carried out in a reaction volume of total 50 μl by the use of gene

specific primers with initial denaturation at 94ᴼC for 3 min, amplification with 35

cycles at 94ᴼC for 60s, annealing at 57ᴼC for 75s, elongation at 72ᴼC for 145s,

followed by final extensions step of 72ᴼC for 10 min. The amplification products of

HPPK-DHPS gene were purified from gel by the use of “Gene JET™ gel extraction

kit” following cloning into pTZ57R/T vector for sequencing to MACROGEN

(Korea).

3.2.5 Isolation of RNA and expression analysis

Different tissues from sea buckthorn were used for total RNA extraction by means

of the TRIZOL® Reagent (Invitrogen). The quantification of RNA was

accomplished with thermo Scientific’s NanoDropTM Lite. 1.5% agarose gel was

used to evaluate the quality of total RNA extracted. Fermentas AMV-RT reverse

transcriptase enzyme was used for first strand cDNA synthesis. A 2µg sample of

total RNA with oligo (dt) primer was incubated at 65ᴼC for 5min, chilled on ice and

mixed briefly. The AMV-RT enzyme, buffer and deoxyribonucleotides were added

102

102

and incubate the reactions for 60min at 50ᴼC. Then terminate the reaction at 85ᴼC

for 5 minutes. Multiplex semi-qualitative RT-PCR was followed up to differentiate

the expressions pattern of freshly amplified HrHPPK-DHPS gene transcript in leaf,

fruits bud and seed of sea buckthorn as described in Khan et al., (2012a). First strand

cDNA synthesized using the oligo (dT) primers from various tissues were utilized

as templates in a reaction volume of total 20µl by Fermentas Taq polymerase.

The following PCR profile was used with an initial denaturation of 5 min at 95oC

following 35 cycles at 94oC for 30 sec,

58oC for 30 sec and 68oC for 30 sec, and a final extension of 68oC for 7 min. The

18SrRNA gene was applied as an internal control. The reactions were repeated three

times for each of the biological and technical replicate. The products amplified were

resolved using 2% agarose gel and photographs were taken.

3.2.6 ATGene (Arabidopsis thaliana gene) expression evaluation for

HPPK-DHPS

The Arabidopsis thaliana gene Hydroxymethyldihydropterin pyrophosphokinase

dihydropteroate (HPPK-DHPS) expression pattern under a set of multiple

biological conditions (different tissues, hormones, abiotic stress and light) was also

compared with sea buckthorn. The tool in bioinformatics such as AtGenExpress

(http://jsp.weigelworld.org/expviz/expviz.jsp) was used to accomplish the analysis

of data set from HPPK-DHPS model system. For further statistical analysis, data

normalization, and processing of these genes Microsoft Excel software was used.

The results of the statistical analysis were obtained as a mean and ± SD.

103

103

3.2.7 Sequence analysis and phylogenetic reconstruction

After the sequences were retrieved for each gene family, the sequence and

phylogenetic analysis was completed with Mac Vector version 7.2 and MEGA 5

(Kumar et al., 2008). Clustal W (Thompson et al., 1994) in Mac Vector 7.2 was used

as a multiple alignment tool for aligning the amino acids. HPPK-DHPs Nucleotide

and protein sequences were retrieved from NCBI data base from different species.

The Fasta formate of different protein sequences were aligned in Mac Vector 7.2

software to see the difference in newly isolated amino acids sequence with

previously isolated sequences.

The nucleotide sequences were translated in the Mac Vector program. The default

parameters were used. Sequences which were too diverged disturbed the alignments

so they were removed manually while performing the multiple alignment procedure.

Using the alignment file phylogenetic tree was constructed following Neighbor

Joining methods (Russo et al., 1996; Saitou and Nei, 1987) implemented in MEGA5.

The total deletions options were utilized for omitting any position which postulates

gaps in sequence. As amino acids substitution models, un-corrected proportions (p)

of amino acid variations and distances were utilized. MEGA 5.0 software was used

to construct the Phylogenetic tree. The bootstrap method (Felsenstein, 1985) was

used to test the authenticity of the generated tree topologies. The method (at 1000

pseudo replicates) gave the bootstraps probabilities of all inner branches in tree.

104

104

3.2.8 Homology modeling and protein structure prediction

The three dimensional (3D) structural modeling of Folate protein (HrHPPKDHPS)

was performed by MODELLAR 9V10 homology modeling program. The amino

acid sequence of HrHPPK-DHPS amino acid residues (512) retrieved in FASTA

format were submitted to protein-protein blast (Blastp) searches adjacent to protein

data bank (PDB) for identification of an appropriate templates structure for relative

modeling. The 2BMB_A was preferred as a proper template structure by query

sequences making 33% identities and query coverage of 89% and have E-value of

7e-70. The modeler quality was assessed based on sequence alignment by blast and

template structure used. These structures were predicted using MODELLAR having

alpha helice and beta-pleated sheet envisioned by Chimera 1.6.

105

105

3.3 RESULTS

3.3.1 Amplification of HrHPPK-DHPS gene from sea buckthorn

In order to screen for the candidate gene linked in the pathway of folate biosynthesis

gene specific primer pair HPPK-F and HPPK-R were used for amplifying HPPK-

DHPS gene from sea buckthorn. A full length 2354 bp target genomic fragment was

amplified which was interrupted by single introns. The distinct high molecular

weight band of HPPK-DHPS observed on agarose gel (Fig. 3.3b) was purified and

cloned. E. coli strain DH5α was used as host for plasmid PTZ57R/T which carries a

gene for ampicillin resistance. Four positive clones, containing HPPK-DHPS gene

insert, were picked out from thousands of transformed cells (Fig. 3.4a) Extraction of

these plasmids for nucleotide sequence analysis was carried out with Favorprep™

plasmid DNA extraction Mini Kit. The plasmid containing 2.3 kb fragment of this

gene were confirmed through PCR and sequencing (Fig. 3.4 b&c).

(a) (b)

Fig. 3.3: Amplification of HrHPPK-DHPS gene. (a) Image of Genomic DNA

isolated from three different sea buckthorn samples (S1, S2, S3) run along 1kb DNA

ladder. (b), PCR amplification of full length sequence 2354bp of folate gene (HPPK-

DHPS) from sea buckthorn genomic DNA. M stand for 1kb DNA

ledder.

106

106

Fig. 3.4: Cloning of HrHPPK-DHPS gene. (a) Positive colony PCR confirmation

with M13 primers. (b) purified recombinant plasmids HrHPPK-DHPS gene. (c)

PCR confirmation of recombinant plasmid with internal short gene specific primers.

3.3.2 HPPK-DHPS is differentially expressed in sea buckthorn

tissues

The comparative analysis of total RNA abundance coding for HrHPPK-DHPS was

determined by semi-quantitative RT-PCR. In order to differentiate the expression

pattern of HPPK-DHPS gene in various tissues of sea buckthorn total RNA from

four different tissues like leaf, fruit bud and seed were extracted (Fig 3.5a).

Constitutively expressed 18S rRNA was used for normalization purposes. The

cDNA was synthesized from equal amount of total RNA. The transcript signals of

HrHPPK-DHPS are strongly detectable in the fruit and leaf tissues (Fig. 3.5b). The

transcriptional signals were not detectable in fruit bud while the week expression of

107

107

this gene was found in seed. Hence, differences in expression pattern in different

tissues are quite outstanding. The present study exhibited that HrHPPK-DHPS genes

are strongly expressed in active part of the sea buckthorn plant tissues comparatively.

Fig. 3.5: (a) RNA isolation from different tissues of sea buckthorn shown against λ

DNA/ HindIII Marker. (b) RT-PCR analysis of HPPK-DHPS gene transcripts (270

bp) in different tissues (leaf, Fruit, Bud, Seed) of sea buckthorn as shown against

50bp ladder. 18S rRNA was used as internal control.

The Arabidopsis thaliana gene Hydroxymethyldihydropterin pyrophosphokinase

dihydropteroate (HPPK-DHPS) expression pattern under a set of multiple

biological conditions (different tissues, hormones, abiotic stress and light) was also

compared with sea buckthorn as shown in fig 3.6a,b,c&d.

108

108

(a) Tissue type (b) Hormonal conditions

(d) Light conditions

(c) Abiotic stress

Fig. 3.6: AtGene Expression pattern for HPPK-DHPS gene (AT4G30000) from

global data set of microarray in: (a) different plant tissues, (b) under different

hormonal conditions, (c) abiotic stress conditions and (d) response to different light

conditions.

109

109

3.3.3 Sequence analysis of HPPK-DHPS identified from Sea buckthorn

The newly isolated sequence was edited using Mac Vector™ 7.2.3 software. Blasts

result presented maximum hit with HPPK-DHPS gene of S. lycopersicom followed

by P. sativum, M. truncatula, C. arietinum, G. max, A. thaliana, A. lyrata T.

aestivum, B. distachyo and O. sativa etc. thereby confirming the presence of new

sequence of HPPK-DHPS gene in sea buckthorn. All positions of codon comprising

gaps and missed data were removed. The length of sequenced clone was 2.3 kb due

to the presence of a single large intron. The 1539 bp coding sequence was extracted

and it was found to be exactly equal in length to tomato gene coding sequence. Thus,

HrHPPK-DHPS gene sequence revealed no variation in the length of the nucleotide

sequence. ClustalW alignments of HPPK-DHPS gene with the tomato gene

sequence were generated and considerable variability was observed in the sequence

of this novel gene. Alignments of newly translated amino acid with the tomato

sequence were also made and shown in fig. 3.7. A total of 35 nucleotide differences

were observed in sequence in the final dataset as shown in Fig. 3.8 as compared to

tomato ortholog sequence. These differences were simply of substitutions type, and

no deletion and insertion were detected. These were randomly distributed in the

entire sequence without specific domain and resulted in a change in the protein

structure (non-synonymous type). The amino acids sequences inferred from the

nucleotides sequences indicated that product of translation was a precursor of about

512 amino acid residues. The sequence identity was 97% at amino acid level

compared to tomato sequence.

110

110

HPPK-DHPs protein sequences were retrieved from NCBI protein data base from

different species. Multiple sequence alignment has shown the high sequence

similarity of HrHPPK-DHPS translated amino acid sequence with different proteins

from number of plant species including tomato, arabidopsis, soya bean and wheat.

However considerable differences were observed at the N-terminus and C-terminus

regions of these proteins. Sequence similarities and difference among selected

protein homologue sequences are shown in Fig. 3.9.

Figure 3.7: Alignment of newly isolated HrHPPK-DHPS amino acid sequence with

its ortholog from S. lycopersicum (FJ972198) using Mac VectorTM7.2.3. (Accerlrys

Inc.) gcg/ Wisconsin pakage university of Wisconsin). The similar regions are shown

against a black background and differences are exposed against white background.

111

111

Figure 3.8: Alignment of newly isolated HrHPPK-DHPS nucleotide sequence with

its ortholog from S. lycopersicum (FJ972198) using MaVectorTM7.2.3. (Accerlrys

Inc.) gcg/ Wisconsin pakage university of Wisconsin). The identical regions are

shown against a black background and differences are exposed against white

background.

112

112

Fig. 3.9: Multiple sequence alignment of newly isolated HrHPPK-DHPS amino acid

sequence with Mac VectorTM7.2.3. (Accerlrys Inc.) gcg/ Wisconsin pakage

university of Wisconsin) from sea buckthorn and its ortholog from S. lycopersicum,

G. max, A. thaliana and T. aestivum amino acid in blocks highlight similarity. The

strictly conserved regions are shown against black background.

113

113

3.3.4 Phylogenetic reconstruction of HPPK-DHPS gene

To search the evolutionary relationships among newly isolated sequence and those

in the database, phylogenetic reconstructions were completed. The coding sequences

of HPPK-DHPS homologue from different plant species including S .

lycopersicum, T. aestivum, B. distachyon, C. arietinum, O. sativa, A. thaliana, P.

sativum, M. truncatula, G. max, and A. lyrata were used. A neighbour-joining tree

shown in figure 3.10 demonstrated that sequences were clearly separated into various

clades. Four groups containing brassicaceous HPPK-DHPS, cereals, pea family and

tomato as a member of Solanaceae were observed. The un-rooted tree clearly

separates out HPPK-DHPS of sea buckthorn and establishes its relationship with

tomato. This indicates divergence in sequences. The monocots i.e. T. aestivum B.

distachyon, O. sativa, appeared to be the progenitor because these were present at

the base. The increase in reliability of the tree was indicated by highest bootstraps

values.

All the result established that HPPK-DHPS genes were substantially differentiated

in various clusters. The isolated new HrHPPK-DHPS sequence however

presented clustering with tomato gene, therefore divergence was subsisted. To

what extent variations in HrHPPK-DHPS contribute to functional divergence,

characterization during site directed mutagenesis and transformation is needed.

Although earlier to transformation it is preponderating to perform the expression

studies of the HrHPPK-DHPS in the different tissue of the sea buckthorn. The

amino acid composition was calculated in BioEdit software

114

114

Fig. 3.10: Phylogenetic reconstruction of HrHPPK-DHPS gene. Neighbor joining

tree is constructed using MEGA 5.0 software. Values on the nodes indicate the

bootstrap replication of 1000. Phylogenetic inferences of enzyme comprising both

Domains HPPK and DHPS were accomplished utilizing complete 15 coding

sequences of H. rhamnoides, S. lycopersicum (GenBank accession No. FJ972198)

T. aestivum (EF208803), B. distachyon

(XM003562616), O. sativa (NM001066822), O. sativa (AK068210), P. sativum

(Y08611), M. truncatula (XM003614065), C. arietinum (XM004490156) G. max

(XM003518734), G. max (XM003517802), A. thaliana (NM105586), A. thaliana

(NM001203939), A. lyrata (XM002888660) and A. thaliana (BT033093) were

included in the alignment. Four clusters are enclosed by brackets. A scale is given at

the bottom.

115

115

3.3.5 Tertiary structure of folate protein

HPPK-DHPs belong to the Pterin-binding superfamily. There have been a no of

techniques in molecular structural modeling. 3D structure of H. rhamnoides, S.

lycopersicum T. aestivum, A. thaliana and G. max HPPK-DHPS protein was

constructed and visualized using the MODELLER 9v10 and Chimera 6.1 software.

The 3D structure of the selected original saccharomyces cerevisiae gene templates

(Lawrence et al., 2005) were used as starting point for homology modeling. The

domain architecture consisting of Pterin domain from 230-498 residues and HPPK

domain from 47-172 amino acid residues was evaluated using the chimera program

for sea buckthorn protein. The HrHPPKDHPS has e-value of 5.77e-118 DHPS and

2.94e-52 for HPPK. The two consreved domains of HrHPPK-DHPS genes were searched

from NCBI data base conserve

domain search as shown in fig. 3. 11.

Fig. 3.11: Conserved domain of newly isolated HrHPPK-DHPS gene obtained from

domain search data base showed hppk superfamily and pterin_binding domain.

All the 3D structures of 5 different protein fold classes ranging in size from

512-561 amino acid residues. The ~ 250-residue pterin-binding (DHPS) domains

were found to have (beta/alpha) 8 barrel fold, which adopted shape of a distorted

116

116

cylinder. It has eight alpha-helices gathered around the outside of an inner cylinder of

parallel beta-strands. The pterin ring binds at the bottom of the (beta/alpha;) The

pterin ring was partly hidden inside the (beta/alpha) 8 barrels. The pterins bonding

residuals depicted higher conservation among five species. Modeled tertiary protein

structure of different plant species were shown in (Fig 3.12). HPPK was the upstream

and the adjoining enzyme to DHPS in the folate biosynthetic pathways. The 3D

structure of the target protein was also sought out from protein data bank (PDB) but

no 3D structure of folate protein from plant folate synthesis pathway had been

reported to date.

Fig. 3.12. Predicted 3D structure of HrHPPK-DHPS proteins from different plant

species shown at the same scale. A, X-ray structure of the template bifunctional

enzyme HPPK-DHPS from S. Cerevisiae (Lawrence et al., 2005) B, 3D structure of

sea buckthorn HPPK-DHPS produced using MODELER

9v10, C, 3D model of S. lycopersicum, D, 3D model of A. thaliana, E, 3D Model

117

117

of G. max. F, Model of T. aestivum. Models in different protein structure were

colored according to different domains. Pterin binding domain DHPS was given

Blue color, HPPK domain was shown by red color. Inter-domain linker

was given grey color.

3.4 DISCUSSION

The berries of sea buckthorn are enriched with great array of substances possessing

substantial biological activities. There is possibly an enormous accumulation of

nutritionally valuable photochemicals waiting to be discovered. Sea buckthorn fruit

comprises solid carotenoids substances, amino acid, vitamin B (Folic Acid), B1, B2,

B6, B12, B15, and K, dietary minerals, polyphenolicacids and βsitosterol. The

problems of micro-nutrients insufficiency can be solved by fortifying staple crops,

which is an established practice and found to be more effective for several

micronutrients.

The isolation and cloning of a single gene (HPPK-DHPS) encoding key enzyme

in folate biosynthesis pathway was successfully carried out for the first time from

sea buckthorn in this study. A full length fragment of HPPK-DHPS gene containing

large single intron was obtained using standard PCR amplification. The HPPK-

DHPS genes were already cloned from numerous plants included Arabidopsis, dicots

and monocots. As there were no deletions and insertions in the extracted coding

sequence, the size of newly isolated sequence remain conserved. The length of

coding sequence was restricted to 1539 bp for this gene. The amino acids sequences

derived from the nucleotides sequences indicated that product of translation was a

precursor of about 512 amino acid residues. In pea leaf the synthesis of a HPPK-

DHPS enzyme, having open reading frame of 1545 bp and inferred amino

118

118

acids sequences corresponding to polypeptides of 515 residuals was reported, which

match our results (Fabrice et al., 1997). The homology analysis using ClustalW

alignments showed that the HrHPPK-DHPS sequence was 97% identical to the

sequence of S. lycopersicum cultivar (SlHPPK-DHPS).

The HrHPPK-DHPS fragment cloned in this study contained a large single intron. It

is well established that introns results in increased stability and expression of genes

(Buchman and Berg, 1988; Chung and Perry, 1989; Okkema et al., 1993). The gene

expression in plants and in several eukaryotes can be affected importantly by introns

in different ways. An enhancer element or alternative promoters are found in few

introns whereas a large number raise mRNA accumulation by various procedures.

It is obvious from expression study that there were differences remarkably in the

accumulation patterns of HPPK-DHPS among different stages of development. The

expression was not detectable in bud while its accumulation gradually lowered in

seed but in the fruit and leaf tissues transcript expression was rather similar and was

considerably higher than other tissues (Fig. 4.8). Our results are in corroboration

with already reported expression studies of HPPK-DHPS gene in tomato,

Arabidopsis and pea in dissimilar tissues and at different developmental stages

(Fabrice et al., 1997). The expression profile of HPPK-DHPS gene in different

tissues of the sea buckthorn has shown same behavior as observed by Arabidopsis

thaliana HPPK-DHPS microarray gene data.

The proteins that synthesize folate are different from species to species. The

phylogenetic analysis differentiated the HPPK-DHPS genes from different

species into 4 different groups. HPPK-DHPS from sea buckthorn conglomerated

with S. lycopersicum gene. It can be inferred that these two proteins might have

119

119

the same properties. But functional characterization of these two proteins through

ectopic expression or knocking down is required to validate this hypothesis.

Nevertheless, the divergence among different species exists to their clustering.

It is obvious from expression study that there was significant divergence in

accumulating profile of HPPK-DHPS involving different stages of development.

The expression was not detectable in bud while its accumulation gradually lowered

in seed but in the fruit and leaf tissues transcript expression was rather similar and

was considerably higher than other tissues. Our results are in corroboration with

already reported expression studies of HPPK-DHPS gene in tomato, Arabidopsis

and pea in dissimilar tissues and at different developmental stages.

In general all these investigations effectively suggested that synthesis of folate is

under strong control. These premises also implicated differences in requirements

among tissues and are fluctuating with plant developmental processes. The entire

folate content is different from one plant to another. Folate content also varies with

the type of the organ or tissue as the folate contents shows fluctuation throughout the

developmental process of plant, suggests that folate synthesis is strongly managed

and changed as a role of the metabolic necessity (Basset et al., 2004a; Jabrin et al.,

2003). It is found that tissues like cotyledons, roots and stems with decreased

metabolic activities have fixed quantity in pea seedlings during development (jabrin

et al., 2003; R beill et al., 2006).

This investigation demonstrated that sea buckthorn has an ortholog of HPPKDHPS

gene therefore it is a different gene. This sequence was equated with the sequences

present in gene pools, which predict that this novel gene sequence, belong to HPPK-

DHPS. The HrHPPK-DHPS fragment cloned in this study

120

120

contained a large single intron. This was further cloned in expression vector for

maximum expression. It is found that there is big difference of sequences among a

specified intron and exon into newly isolated sequence. There is a single intron in

the full length DNA sequence of HPPK-DHPD gene. The exon sequence is greatly

more preserved which suggest that the factual sequences of the intron was not

extremely very significant. The intron was spliced out and coding region sequence

encodes a putative protein which is conserved among tomato pea and sea buckthorn.

Intron can considerably have an effect on genes expression in plant as well as in

number of eukaryote in different manners. It is well established that introns results

in increased stability and expression of genes (Buchman and Berg, 1988; Chung and

Perry, 1989; Okkema et al., 1993).

Our study was mainly focused to obtain full length gene fragment of HPPK-DHPS

from genomic DNA of sea buckthorn. It is well known that there is positive

correlation between number of introns found and gene expression and that introns

containing transgenes showed enhancements of gene expression both transcription

and translation than the same gene lacking introns (Brinster et al., 1988). Earlier

investigations on genome DNA sequencing in a wide variety of organism

demonstrated great variability in intron-exon structures of homologous genes in

various organisms (Rodríguez-Trelles et al., 2006).

Phylogenetic analysis differentiated the HPPK-DHPS genes from different species

into 4 different groups. HPPK-DHPS from sea buckthorn conglomerated with S.

lycopersicum gene. It can be inferred that these two proteins might have the same

properties. But functional characterization of these two proteins through ectopic

expression or knocking down is required to validate this hypothesis. However, the

121

121

divergence among different species exists due to their clustering. This might provide

the evolutionary advantage to this family for proteins.

However in our study homology modeling of 3D structure of HPPK-DHPS gene

from sea buckthorn plant in comparison with other plant species was also reported.

HPPK-DHPS proteins are found in them Mitochondria, chloroplast and cytosol of

higher plants. The evolutionary trajectory of a protein through sequence analysis is

constrained by its function. Polypeptide consists of both HPPK and DHPs structural

domains that are relevant mono-functional domains (Sandeep et al., 2012). These

domains allowed us to construct a 3D protein structure of H. rhamnoides by applying

Homology modeling approach. The rationale behind this method is the observation

that proteins with similar sequence usually share the same overall 3D folding

patterns. Therefore experimentally determined protein structures were usually used

as template for predicting the confirmation of an additional protein with identical

amino acids sequences (Havel and Snow, 1991; David, 1997).

This work also described the significant structural variation in petering binding

domain among the various orthologus proteins. We have found slight but notable

difference with respect to the substrate binding pockets opening. There might be a

clue about functional attributes regarding the 3D structure of different binding

proteins that is triggering the function. The eminence of homology modeling

completed using MODELLER and Chimera program

depends upon the excellence of the sequence alignments by Blast and protein

structure used as template. The structural analysis and figures generated with

MODELLER software were presented in Fig. 3.11. These structures provide a good

foundation for functional analysis of the gene. The comparison of data from DNA

122

122

sequence, amino acid sequence, phylogenetic reconstruction, homology modeling

and expression pattern demonstrated that there is a considerable variability in the

gene structure and evolutionary relationship of HrHPPK-DHPS with other

homologs.

3.5. CONCLUSIONS

In a nutshell, the current investigation presents lines of evidences for varying

expression level of the bifunctional HPPK-DHPS on the folate status in plants.

Based on sequence similarity, clustering and phylogenetic differentiation of genes

it is concluded that HPPK-DHPS isolated from sea buckthorn is a novel gene.

In this study we predict and compare three dimensional structure of HPPK-DHPS

protein which was not available in plant species This study has future implications

in exploring the potential of wild medicinal plants for genetic improvement of staple

food crops to meet the nutrients deficiency in human diet.

Chapter 4

123

123

CAROTENIODS BIOSYNTHESIS GENES (LCY-β AND PSY)

Abstract

Caroteniods are organic pigments that are dispersed almost everywhere in living

things. These are important for the growth of plants and photosynthesis. These are

main nutritional source of vitamin A for humans being. Basic challenges were to

study two important caroteniods pathway genes, lycopene β-cyclase and phytoene

synthase from vitamin A rich plant sea buckthorn. The newly isolated full length

cDNAs sequence of Hr-Lcyb has a complete open reading frame of 1503 bp and Hr-

Psy has an open reading of 1238 bp in length. The length of the coding sequences of

Hr-Lcyb and Hr-Psy showed homology with tomato gene sequences. RT-PCR

analysis was carried out to show maximum transcript accumulation in different

tissues of sea buckthorn plant. In case of lycopene beta cyclase maximum transcript

signals were observed in case of fruit and leaf tissues. Significant level of expression

was also found in shoot apex and newly growing bud tissues. Whereas very minute

traces were found in root and seed tissues. In case of phytoene synthase maximum

transcript abundance was found in fruit, leaf and apex. Some expression was also

found in bud and seed tissues. In contrast to Lcy gene no transcripts signals were

found in root tissues. In this assessment we recapitulated the existing knowledge of

the carotenoid transcript signals and discussed about the knowledge of their

biosynthesis regulation in bud, shoot apex, roots, seeds and fruits. This work

recommends that the study of different genes encoding caroteniods with diverse

activity will also help to meet the problem associated with vitamin A deficiency.

124

124

4.1 INTRODUCTION

Carotenoids are one of the major groups of pigments that are widely spread in plants.

They are responsible for the red, orange and yellow, coloration of tissues. They are

biologically important in many organisms from bacteria and fungi to higher plants

(Goodwin, 1980). These are concerned in photo protection, lightharvesting, and

pollination in plants (Tracewell et al., 2001; Szabo et al., 2005; Dong et al., 2007).

Forty-one different carotenoids have been found in various varieties of sea buckthorn

berries (Bekker and Glushenkova, 2001); the main carotenoid’s types are β -

cryptoxanthin, β-carotene and zeaxanthin, while canthaxanthin, alphacarotene,

dihydroxy-β-carotene, γ-carotene and lycopene are known as the minor ones (Yang

and Kallio, 2005).

As b-carotene, carotenoids, and cantaxanthin work as anti-mutagenic and

anticancerogenic and anti-swelling therefore these compounds act as safeguard from

some kinds of skin cancer (Mashkovski, 1997). Enzymes have genetic code which

is responsible to catalyze major steps in the biosynthetic pathway of carotenoid have

been replicated and their expression have been analyzed in various species (Zar et

al., 2009; Charles et al., 2009; Ha et al., 2007).

Carotenoids oil contents have found to be valuable remedies against burn, ulcers,

cryopathies, skin cancers and many gynecological disorders (Akulinin, 1958;

Chugaeva et al., 1964; Gatin, 1963; Goodwin, 1980; Mashkovski, 1997; Rahimv et

al., 1983). The structure of α-carotene and lycopene were shown in Fig. 4.1.

125

125

(a) (b)

Fig. 4.1: Structure of important caroteniods reported in Sea buckthorn. (a) αcarotene,

(b) Lycopene (Staffan, 2009).

Beveridge et al., (1999) showed that sea buckthorn oil have 314-2139 mg/100 g

carotenoid while Oomah (2003) found pulp oil have 5-10 g/Kg and seed oil have

little grade at 20-85 mg/100 g. In sea buckthorn presence of β-carotene, γ-carotene,

δ-carotene, β-cryptoxanthin and zeaxanthin has been affirmed by TLC, HPLC, and

mass spectrometry (Oomah, 2003). Their structures were given in figure 4.2.

126

126

Fig 4.2: Structures of different forms of carotenoids reported to be present in the sea

buckthorn (Staffan, 2009).

The carotenoid biosynthesis pathway in plants begins with the formation of phytoene

from geranylgeranyl pyrophosphate, by the enzyme phytoene synthase

“PSY” (Fraser & Bramley, 2004; Gallagher et al., 2004). With two isomerization

and four desaturation reactions phytoene is then transformed to all-translycopene

(Chen et al., 2010). Two branches, the β,ε branch and the β,β branch, in the pathway

are formed by the cyclization of lycopene. The formation of α-carotene from the β,ε

branch depend on enzymes like lycopene epsilon cyclase and lycopene beta cyclase;

the formation of β-carotene from the β,β branch depends on LCYβ (Fig. 4.3). In β-

carotene hydroxylation of the two β-ionone rings is the most powerful nutritional

source of vitamin A, (Rafael et al., 2014).

127

127

Figure 4.3: Systematic presentation of carotenoid biosynthetic pathway in plant

(Clotault et al., 2008).

High amount of phytochemicals like carotenoids, ascorbic acid, tocopherols and

phenolic compounds are present in the Sea buckthorn berries (Zadernowski et al.,

1997; Andersson et al., 2008; Zadernowski et al., 2005). Skin, mucosa,

cardiovascular and immune system disorders are being treated by sea buckthorn

berries (Yang and Kallio, 2002; Raffo et al., 2004). Earlier studies have shown that

128

128

red and orange-red fruits of sea buckthorn have more carotenoids than yellow and

orange-yellow (Lian et al., 2000). As fruit matures the carotenoid content is

increased (Zhang et al., 1989).

For nutritional and health products preparation, it is significant to have access to raw

material that has high content of carotenoids (Deli and Molnar, 2002; Maoka et al.,

2001). Earlier studies have shown that sea buckthorn berries have differences in the

contents and composition of carotenoids (Yang and Kallio, 2002; Beveridge et al.,

1999) which may be due to many reasons like environment and growing conditions,

berry parts study, genetic variation, and variation between years, storage

environment, and methods of examination. The constituents of sea buckthorn fruit

are showen in table. 4.1.

Table. 4.1: Constituents of Sea buckthorn Fruit (Alam, Dharmananda, 2004).

Sr. No. Sea buckthorn fruit constituents (Per 100 grams fresh berries)

1 The major unsaturated fatty acids are linolenic acid(omega-

3) , palmitic acid and linoleic acid (omega-6),, palmitoleic

acid (omega-7), oleic acid (omega-9),; there are also

saturated oils and sterols (mainly β-sitosterol)

6–11% (3–5% in fruit pulp, 8–18% in

seed) fatty acid composition and total oil

content vary with subspecies

2 Vitamin C 28–310 mg (typical amount: 600 mg)

3 Carotenoids, including beta carotene, lycopene, and

zeaxanthin; these contribute to the yellow-orange-red colors of the fruit

Total caroteniods

32–45 mg fatty acids (oils)

(432.4 IU 100 g-1) (Stobdan et al.,

2010). 527.8 mg/100g (Beveridge et al.,

1999; Cenkowski et al., 2006; Lian et

al., 2000).10- 1,200 mg/kg (yang et al.,

2002)

4 Vitamin E (mixed tocopherols) Up to 180 mg (equal to about 270 IU)

5 Folic acid Up to 80 mg

6 Organic acids for example, quinic acid, malic acid;

ingredients similar to those found in cranberries Quantity not determined, expressed juice

has pH of 2.7–3.3

7 Flavonoids (e.g., mainly isorhamnetin, quercetin glycosides,

and kaempferol) 50–500 mg (0.05% to 0.5%)

129

129

Despite several studies on caroteniods contents in sea buckthorn no attempt was

made to exploit important vitamin genes to alleviate micronutrient deficiencies:

micronutrient supplementation, food fortification, and biofortification. Biosynthesis

of carotenoid has been studied in plants like pepper, tomato and Arabidopsis

(Hirschberg et al., 2001).

Sea buckthorn gives nearly all nutrition contents which are necessary for human

being, because main cereals usually have poor dietary products. Basic challenges of

this study were the identification of caroteniods biosynthetic pathway genes. Here

we report molecular cloning of carotenoid biosynthesis genes (Lcy & Psy) and have

analyzed the sequence identity with same genes from different species.

4.2 MATERIAL AND METHOD

4.2.1 Plant Material

Sea buckthorn (Hippophae rhamnoides subsp. Sinensis) plants were grown both in

the green house and in the field of National Institute for Genomics and Advanced

Biotechnology. The plant samples including buds, root, shoot apex, leaves, seed and

fruit tissues were collected at different growth points. Fruits were harvested once or

twice a week during the ripening period from sea buckthorn nursery, all these

samples were put in liquid nitrogen to freeze the samples which were stored at -80ᴼC

till it is processed to extract nucleic acid.

4.2.2 Designing of Primers

Nucleotide sequence of Lcyb and Psy genes were collected from NCBI

(www.ncbi.nlm.nih.gov). Primers were utilized for both genes with the known

sequences of S. lycopersicum cDNAs. These were use to synthesize the cDNAs made

130

130

from RNAs of the sea buckthorn (Hippophae rhamnoides) fruit. The primers for

gene expression studies were designed from newly isolated cDNA sequences. The

detail and accession number and sequence of the gene specific primers used in the

study are given in Table 4.2.

Table 4.2: Detail of Primers used in this study for H. rhamnoides Lcy and Psy cDNA

cloning and expression analysis (RT-PCR).

4.2.3 RNA extraction and PCR Amplification

The roots, leaves, buds, shoot apex, seed and fruits of sea buckthorn were used to

extract RNA with the help of a reagent known as TRIZOL. To extract RNAs

instructions of “InvitrogenTM Life Technologies Corporation” were used. Extracted

RNA was evaluated qualitatively on 1.5% agarose gel. The cDNA was synthesized

using Fermentas AMV-RT reverse transcriptase (#EP0641) kit. A 2µg sample of

131

131

total extracted RNA with gene-specific primer was incubated at 65ᴼC for 5min,

chilled on ice, mix briefly. The AMV-RT enzyme, buffer and

deoxyribonucleotides were added. At 50ᴼC reaction was incubated for 60 minutes

followed by 85ᴼC for 5 minutes.

For gene amplification of Hr-Lcyb and Hr-Psy, fruit cDNA of sea buckthorn were

utilized as template in RT-PCR which was performed using Takara Ex Taq™

polymerase amplification kit under the following program with initial denaturation

step of 94ᴼC for 5 minutes, amplification with 35 cycles of 94ᴼC for 60s, annealing

at 58ᴼC for Hr-Lcyb and 59ᴼC for Hr-Psy for 60s elongation at 68ᴼC for 150s,

accompanied by final extension at 68ᴼC for 10 minutes.

4.2.4 Expression analysis of Genes

To recognize the expression forms of newly separated Hr-LCY and Hr-Psy genes in

different tissues semi quantitative RT-PCR was done. For this purpose the roots,

leaves, buds, shoot apex, seed and fruits of sea buckthorn were used to extract RNA

using TRIZOL reagent according to manufacturer instructions as previously

described in gene isolation procedure (Fig. 4.4a). As far as RNA concentration in

different tissues and yield is concerned high RNA yield was found in leaf, apex and

fruit tissues which showed maximum transcript accumulation. RNA yield from bud

root and seed tissue was low which showed very low transcript accumulation. From

newly isolated gene sequence all the short primers for RT-PCR analysis were

designed in Bio-Edit program (Table 4.2). Then, the standardized RNA from various

tissues was used as templates for cDNA synthesis with oligo (dt) primers using

AMV-RT enzyme (#EP0641). The transcripts amplification of Lcy and Psy gene was

carried out with short gene specific expression primers by RT-PCR in total reaction

132

132

volume of 20 µL using Takara Ex Taq™ polymerase kit. The following PCR profile

was run with first denaturizing cycle for 5 min at 95˚C, follow by 34 cycles at 94˚C

for 30 sec, 58˚C for 30 sec and 68˚C for 30 sec, and a last extension step of 68˚C for

7 min. Actin-1 gene which express in all eukaryotic tissues was selected as control

to check equal loading and PCR quality check. . These qRT-PCR reactions were

performed thrice involving both technical as well as biological replicate.

After that, gene expression pattern was examined electrophoretically using 2%

agarose gel with ethidium bromides staining and then photographs were taken.

Cumulative data of transcript signals were evaluated according to the band intensity,

which was translated into relative quantity and compared with the reference band.

4.2.5 AtGene (Arabidopsis thaliana Gene) expression analysis of LCY

and PSY.

AtGenExpress is a tool to analyze the transcript abundance changes of gene under

study in Arabidopsis using global microarray data collection. Here the focus was on

differential expression estimates computation of caroteniods gene (Lcyb &Psy) in

different tissues and different set of particular biological conditions. This

AtGenExpress data site (http://jsp.weigelworld.org/expviz/expviz.jsp) was used to

accomplish the analysis of data set. The Arabidopsis thaliana caroteniods gene for

lycopene β-cyclase (AT3G10230) and phytoene synthase (AT5G17230) were

therefore selected to compare its expression pattern with sea buckthorn. For data

normalization, processing and statistical analysis of these genes Microsoft Excel

software was used. The results of the statistical analysis are presented as a mean and

± SD.

133

133

4.2.6 Molecular Cloning and Sequence analysis

The targeted products of both genes were purified from agarose gel by means of the

Gene JET™ Gel extraction kits. The genes of interest were ligated into the

pTZ57R/T vector, which is then transformed into DH5α strain of E.coli cells. Blue-

white screening was used to choose colonies with desired insert (white colonies).

Recombinant plasmids comprising DNA inserts of both genes were therefore

purified from transformed cells. Plasmid purification was carried out with

Favorprep™ plasmid DNA extraction Mini Kit and sequencing was done from

MACROGEN (Korea). The BioEdit and Mac Vector™ 7.2.3 software were used to

edit the nucleotide sequences of amplified gene. In addition to nucleotide alignment

amino acids formatted alignment was also completed using Mac Vector™ 7.2.3

program. ClustalW alignments have been made to compare these newly isolated

sequences with previously isolated tomato sequences. Phylogenetic relationships

among different plant species were also analyzed. A neighbor joining methodology

was utilized for constructing the Lcyb and Psy gene sequence tree via MEGA 5.0

software. A bootstrap test based on 1,000 replicates was completed to verify the

reliability of the phylogenetic tree.

134

134

4.3 RESULTS

4.3.1 Isolation of Hr-Lcyb and Hr-Psy Genes

The Fig. 4.4 b&c showed the targeted size products of Hr-Lcyb and Hr-Psy amplicons

from sea buckthorn plant respectively. These cDNA amplifications were purified

and inserted into fast cloning vector pTZ57R/T for transformation into E. coli strains

DH5α as shown in Fig. 4.5 A&B. The recombinant plasmids were purified and

sequenced. The newly isolated full length cDNAs confirm that the Hr-Lcyb has a

complete open reading frame of 1503 bp and Hr-Psy has an open reading of 1238

bp in length. Hr-lcyb encoded proteins of 501aa with e-value of

2.69e-175 and Hr-Psy encodes 412aa amino acids residues with e-value of 2.45e90.

The length of the cDNA remains the same as compared to tomato sequence. By

contrast with tomato gene sequence only substitutions were found and no insertions

or deletions were found in the new gene sequences.

All these nucleotide differences were of non-synonymous type that does not lead to

appreciable protein change. In any part of protein, substitution of amino acid can

occur that does not affect secondary structure or function of protein in a significant

way. A replacement of an amino acid may occur by another amino acid of same

chemical property and protein still has normal functions. These non-synonymous

types are actually favoring novel expressions of the genetic material leading to the

development of more improved functions.

135

135

Figure 4.4: (a) Comparison of RNA band intensity from different tissues including bud,

root, apex, leaves, seed and fruits. (b) Amplification of full length cDNA of Hr-

Lcyb (c) Hr-Psy cDNA amplification through RT-PCR. M stand for 1kb DNA ladder.

(A) (B)

Figure 4.5: (A) a. Positive colony PCR of Hr-Lcyb with M13 primers. b. Purified

selected recombinant plasmid with target gene inserts. c. Recombinant Hr-LCYβ

plasmid PCR confirmation. (B) a. positive colony of Hr-Psy confirmed by PCR with

M13 primers. b. Recombinant purified plasmid of Hr-psy gene. c. Recombinant Hr-

Psy plasmid PCR confirmation. M stand for 1kb DNA ladder.

136

136

4.3.2 Differential Gene Expression Analysis

To substantiate further the quantitative nature of PCR Semi quantitative PCR was

used for Gene expression analysis. Gene expression levels varied in different plant

tissues (bud, apex, root, leaf, seed and fruit tissues) which potentially effect

caroteniods accumulation. The differential expression in different tissues was

explained in part by the presence of two active forms of caroteniod biosynthesis

genes (Lcyb & Psy) in comparison with house-keeping gene Actin-1 which is used

as control, to check equal loading and PCR quality check. Relative amplifications

were used to find out divergence in expressions of the targeted gene. Lycopene beta

cyclase showed maximum transcript signals in case of fruit and leaf tissues (Fig.4.6).

Significant level of expression was also found in shoot apex and newly growing bud

tissues. Whereas very minute traces were found in root and seed

tissues.

Figure 4.6: Photograph showing different tissues of sea buckthorn a. bud, b. apex,

c. root. d. leaf, e. seed, f. fruit. RT-PCR analysis of Hr-lcyb and Hr-Psy gene

transcripts in above mentioned tissues of sea buckthorn in comparison with internal

control actin-1. M stand for 1kb DNA ladder.

137

137

In case of phytoene synthase maximum transcript abundance was found in fruit, leaf

and apex. Some expression was also found in bud and seed tissues. In contrast to

Lcy gene no traces of transcripts were found in root tissues (Fig.4.6).

It can be recommended that these differences in gene expression level may be due

to environmental factors (growth stage, light), relatively low abundant RNAs all

factors contribute to variability. However, it was reported already that endogenous

and environmental factors, for example the type and the stage of the tissue

development, the mutations and the ultraviolet light, could also be the causes of

increased or reduced gene and protein expressions (Giuliano et al., 1993; Namitra et

al., 2011; Gady et al., 2012; Lazzeri et al., 2012).

The computational technique of AtGene express was considered to identify selective

expression using Arabidopsis thaliana microarrays data to monitor genome-wide

gene expression in sea buckthorn plant. It was assumed from Arabidopsis expression

pattern that lycopene beta cyclase gene expression in sea buckthorn would behave

the same as shown in fig. 4.7 a, b, c&d.

This was an indirect approach to estimate the protein abundance by examining the

gene expression level. Therefore, it is reasonable to explain that elevated levels of

gene expression observed in the leaf and fruit leads to the higher activity of these

enzymes in converting phytoene to carotene and lycopene in these tissues. This

observation was consistent with the high amount of carotenoid, especially Lycopene

accumulation in the petal and fruit tissues of tomato from high lycopene tomato

cultivar, Solanum lycopersicum KKU-T34003 (Krittaya and Klanrit, 2013). They

reported that Psy1 gene fragment have open reading frame of 1,239 base pair length,

which corresponds to our results (Krittaya and Klanrit, 2013). Similar sequence

138

138

characteristics and expression differences were found in fruit tissues of sea

buckthorn as found in literature.

(a) (b)

(c) (d)

Fig. 4.7: Relative Gene Expression pattern for lycopene β-cyclase gene

(AT3G10230) from global data set of microarray: (a) in different plant tissues, (b)

hormonal conditions, (c) abiotic stress and (c) light exposures respectively.

In the same way comparability of phytoene synthase gene (AT5G17230)

microarrays data from Arabidopsis was used to observe variation in gene expression

139

139

in sea buckthorn (Fig.4.8 a,b,c&d). The expression profile of candidate PSY gene in

different part of the sea buckthorn plant have showen same expression pattern like

Arabidopsis.

(a) (b)

(c) (d)

Fig.4.8: Relative Gene Expression pattern for Phytoene synthase gene (AT5G17230)

from global data set of microarray: (a) in different plant tissues, (b) hormonal

conditions, (c) abiotic stress and (d) light exposures respectively.

Phytoene synthase genes and cDNAs have been cloned from many plants and

bacteria; for example, A. thaliana (Scolnik and Bartley, 1994), Cucumis melo

140

140

(Karvouni et al., 1995), Narcissus pseudonarcissus (Schledz et al., 1996), Solanum

lycopersicum (Giuliano et al., 1993; Giorio et al., 2008) and Nicotiana tabacum

(Busch et al., 2002). Because of this rate-limiting feature, PSY has expanded much

interest to be cloned and targeted for transformation to boost carotenoid levels of food

crops.

4.3.3 Sequence analysis

The cDNA sequences of Hr-Lcyb &Hr-Psy were edited with Mac Vector™ 7.2.3

software. Both pairwise and multiple Sequence alignments tool were utilized to

identify region of similarities that may indicate functional, structural and/or

evolutionary relationships between two and multiple biological sequences. Pairwise

alignments were made on both nucleotide and amino acid levels respectively.

Pairwise alignment of new Hr-Lcyb sequence with the tomato gene sequence showed

considerable nucleotide variation randomly distributed throughout the whole

sequence as shown in fig. 4.9. The nucleotide sequences were translated in the

MacVector program. The default parameters were used. The fasta formate of new

Hr-Lcyb protein sequences were aligned in Mac-Vector 7.2 software to see the

difference in newly isolated amino acids sequence with previously isolated

sequences as shown in fig.4.10. Sequences which were too diverged disturbed the

alignments so they were removed manually while performing the multiple alignment

procedure. Similarly in case of Hr-Psy Pairwise alignments of new cDNA sequences

with the target tomato cDNA sequence show considerable variability in the new

sequence (Fig.4.11). The Hr-Psy nucleotide sequence were translated and aligned

with the tomato protein sequence to see the conservation in new sequence as shown

in fig. 4.12. Analysis of the homology of the deduced amino acid sequence of Hr-

141

141

Lcyb and Hr-Psy reveal various degrees of similarities and variations. Sequence

alignments revealed that the newly isolated sequences were not 100% identical to

other plant sequences; there are differences in the underlying coding sequences. The

conservation in regions of Hr-Lcyb were analyzed by comparing with the amino acid

sequence of S. lycopersicum,V. vinifera, N, pseudonarcissus, M. truncatula, N.taetta,

C. sinensis, L. barbarum which belongs to species that present caroteniods

accumulation. The strictly conserved amino acid residues are shown against a black

background as shown in Fig. 4.13. The possible amino acid changes found do not

alter the function of HrLcyb sequence isolated from sea buckthorn. The translated

amino acid sequence of Hr-Psy was aligned with other sequences from different

plant species including some member of family solanaceae, family convolvulaceae,

and asteraceae. The detail and accession no of the amino acid sequence uniqueness

and similarities for multiple sequence alignments of new and other phytoene

synthase enzymes, degree of sequence similarity and the locations of the more highly

conserved regions were compared and illustrated in Fig. 4.14. Differences were

found at both N-terminus and C-terminus domains of LCY and PSY proteins as

shown in case of multiple sequence alignments.

142

142

Fig. 4.9: Alignment of newly isolated Hr-Lcyb nucleotide sequence with its ortholog

from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/

Wisconsin pakage university of Wisconsin). The similar regions are shown

against a black background and differences are exposed against white

background.

143

143

Fig 4.10: Alignment of newly isolated Hr-Lcyb amino acid sequence with its ortholog

from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/ Wisconsin

pakage university of Wisconsin). The conservations in sequence are shown against

a black background and differences are exposed against white background.

144

144

Fig. 4.11: Alignment of newly isolated Hr-Psy nucleotide sequence with its ortholog

from S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/ Wisconsin

pakage university of Wisconsin). The similar regions are shown against a black

background and differences are exposed against white background.

145

145

Fig. 4.12: Alignment of newly isolated Hr-Psy amino acid sequence with its ortholog from

S. lycopersicum using MaVectorTM7.2.3. (Accerlrys Inc.) gcg/ Wisconsin pakage

university of Wisconsin) software. The similarities are shown against a black

background and differences are exposed against white background.

146

146

Figure 4.13: Multiple sequence Alignment of newly isolated Hr-Lcyb amino acid sequence

with its ortholog from S. lycopersicum (NM_001247297), V. vinifera (JQ319639),

N. pseudonarcissus (GQ327929), M. truncatula (XM-003624977), N. tazetta

(JQ797381), C. sinensis (DQ235259) and L. barbarum (AY906864) using

MaVectorTM7.2.3. (Accerlrys Inc.) gcg/ Wisconsin pakage university of

Wisconsin). The strictly conserved regions are shown against a black background

and differences are exposed against white background.

147

147

Figure 4.14: Multiple Alignment of amino acid sequence of Hr-Psy gene with its

representative from other plant species. The names and accession numbers of these

members are: Lopomoea (AB499050), T. erecta (AF251015), S. lycopersicum

(EF534739), N. tabacum (JF461341) and Tomato (M84744). The strictly conserved

regions are shown against a black background and differences are exposed against

white background.

148

148

4.3.4 Phylogenetic Analysis

In order to show the inferred evolutionary relationships phylogenetic reconstruction

was carried out. The evolutionary history was inferred using the Neighbor-Joining

method (Saitou and Nei, 1987). The evolutionary distances were computed using the

Maximum Composite Likelihood method (Tamura et al., 2004). Evolutionary

analyses were conducted in MEGA5 (Tamura et al., 2011).

Figure 4.15: Phylogenetic analysis of Hr-Lcyb and other selected plant members. Neighbor

joining tree is constructed using MEGA 5.0 software. Values on the nodes indicate

the bootstrap replication of 1000. Phylogenetic inference was made using 25

complete coding sequences H. rhamnoides, S. lycopersicum (NM_001247297), C.

maxima (AY217103), C. sinensis (DQ496224), C. papaya

(DQ415894), P. trichocarpa (XM_002308867), R. communis (XM_002531452),

149

149

E. japonica (JX089591), V. vinifera (JQ319639), B. nivea (EU122344), C. moschata

(JN559395), S. europaea (AY789516), C. arietinum (XM_004493356),

M. truncantula (XM_003624977), G. max (XM_006576725), P. vulgaris

(HQ199604), A. palaestina (AF321534), L. barbarum (AY906864) Lpomoea_sp.

Kenyan (AB499055), N. tabacum (X81787), Chrysanthemum_X_morifolium

(AB205041) T. officinale (AB247456), N. pseudonarcissus (GQ327929) and N.

trzetta (JQ797381).

For this purpose the coding sequences of lycopene beta cyclase homologue from

diverse plant species H. rhamnoides, C. maxima, C. sinensis, C. papaya, P.

trichocarpa, R. communis, E. japonica, V. vinifera, B. nivea, C.moschata, S.

europaea, C. arietinum, M. truncantula, G. max, P. vulgaris, A. palaestina, L.

barbarum, Lpomoea_sp. Kenyan, N. tabacum, S. lycopersicum,

Chrysanthemum_X_morifolium, T.officinale, N. pseudonarcissus and N. trzetta were

used and tree was built as shown in Fig. 4.15

The detail of the plant species used for the Psy tree includes H. rhamnoides, P,mume,

F.vesca, G. max, C. arietinum, D.Kaki, C. sinensis, D. carota, A. deliciosa, M.

indica, p. trichocarpa, R.communis, M. esculenta, C. papaya, P. sitchensis, T.erecta,

C.melo,C.lanatus, M.charanita, M. cochinchinensis, S. lycopersicum, O. fragrans,

M. germanica, A. palaestina, C. roseus, G.jasminoides, C. canephora, B. oleracea,

B. napus, E. japonica, B. distachyon, T. aestivum, H. vulgare, P. juncea. The

sequences were edited alligned, analyze and neighbor joining tree in MEGA 5.0

software was constructed and displayed with tree view in Fig. 4.16. All positions

containing gaps and missing data were eliminated. To postulate a possible

phylogenetic relationship among this group of enzymes, we have used the maximum

likelihood method of sequence analysis.

150

150

Figure 4.16: The detail and accession no of the plant species for the phytoene synthase gene

which were used for the phylogenetic analysis includes H. rhamnoides, P,mume

(AB253628), F.vesca (XM_004289519), G. max (XM_003544910), C. arietinum

(XR_189445), D.Kaki (FJ594485), C. sinensis (EF545005), D. carota (DQ192187),

A. deliciosa (FJ797304), M. indica (JN001197), p. trichocarpa (XM_002327528),

R.communis (XM_002532929), M. esculenta (GU111719), C. papaya (DQ666828),

P. sitchensis (EF676285), T.erecta (AF251015), C.melo (GU361622), C.lanatus,

M.charanita (AY494789), M. cochinchinensis (KF233991), S. lycopersicum

(M84744), O. fragrans (JQ699273), M. germanica

151

151

(AY986508), A. palaestina (AY661705), C. roseus (HQ438241), G. jasminoides

(HQ599860), C. canephora (DQ157164), B. oleracea (JF920036), B. napus

(AB454517), E. japonica (JX097048), B. distachyon (XM_003579062), T. aestivum

(BT009537), H. vulgare (AK358888) and P. juncea (HM539711).

4.4 DISCUSSION

Sea buckthorn berries contain high levels of vitamin, carotenoid, tocopherol,

chlorophyll, flavonoid, and fatty acid. All the bioactive compounds have potentiality

of useful effects on human health (Singh, 2005; Suryakumar and Gupta, 2011).

Amongst all bioactive compounds carotenoids are the major compounds they have

several actions like anti-oxidant, anti-tumour and antimutagenic (Britton et al.,

2009). Earlier studies have shown that sea buckthorn berry has many difference in

the contents and composition of carotenoids (Andersson et al., 2009; Bal et al.,

2011). Despite of these investigation still there is no data reported on caroteniods

biosynthesis gene isolation from this wild medicinal entity.

In order to investigate the active genes that correlate with caroteniods accumulation

and biosynthesis full length coding sequences of Hr-Lcyb and HrPsy were isolated,

cloned and their sequences were analyzed by both pair wise and multiple sequence

alignments. The of Hr-Lcyb cDNAs has a complete ORF of 1503 bp and Hr-Psy

cDNA has an ORF of 1238 bp in length encoding proteins of 501aa and 412aa amino

acids residues respectively. The length of the cDNA remains the same as compared

to tomato sequence.The expected amino acid sequence of the sea buckthorn lycopene

beta cyclase (EC 5.5.1.19) is rather similar to those of the other recognized plant beta

cyclase from tomato, pepper, (Hugueney et al., 1995); and from tobacco and tomato

(Pecker et al., 1996). It also resembles the B cyclase from the V. vinifera, M.

152

152

truncatula, N. tazetta, C. sinensis, L. barbarum, and N. pseudonarcissus, as was

found in our multiple amino acid sequence alignments of these species. Multiple

sequence alignments make it possible to examine and find out relationships from an

evolutionary point of view by homological sequence. These finding implied that this

enzyme is of relatively same origin compared with the β cyclase of divergent species,

and that it may have come to pass by slight modification of a duplicated β cyclase

gene in tomato (Giuliano et al., 1993).

We have found a copy of this lycopene beta cyclase cDNA in Sea buckthorn. The

conserved domain of Hr-lycopene β-cyclase were also searched from NCBI

conserved domain search which appear to have evolved from the plant lycopene

cyclases consisting of NAD(P)-like binding domain (Fig.4.17).

Fig. 4.17: Conserved domains of Hr-Lycopene β-cyclase showing main

NAD_binding domain.

Comparison was done between predicted amino acid sequence of Hr-Psy and amino

acid sequence of different plant species. Protein alignments study revealed that the

protein encoded by Hr-Psy gene can be grouped in the class called terpene cyclase

that synthesize geranyl/farnesyl diphosphates and superfamily of transisoprenyl

diphosphate synthases. Further study of conserved domains and motifs showed that

Psy gene consist of six regions as follows, substrate binding pocket, substrate Mg2+

153

153

binding site, active site lid residue, aspartate-rich region-1 and aspartate-rich region-

2 (Fig. 4.18) which corresponds to findings of Lao et al.,

(2011). Although all of the homolog’s aligned varied considerably in their Ntermini.

Fig. 4.18: Conserved domains of Hr-Phytoene synthase gene consisting of six main

regions

The protein sequence alignments were used to identify the homologous sequences

and to employ conservation in sequence and structure which will be useful to

visualize the biochemical activities and biological function of these proteins.

Alignment at the protein level also indicated the difference of sequences among

different plant species. To look at the result in an evolutionary context we compared

the subsets of clusters representing four clusters for lycopene gene and five clusters

for phytoene synthase gene. It is demonstrated by this phylogenic tree that Hr-Lcyb

as well as Hr-Psy belongs to the correspondent subfamilies as anticipated, signifying

that our cDNA clones actually codes for the related enzyme. Phylogenetic analysis

showed considerable homology of our genes in all known carotenoid-producing

organisms.

RT-PCR was used to analyze Hr-Lcyb & Hr-Psy for their level of expression to

evaluate maximum accumulation of these gene transcripts in buds, apex, fruit, leaf,

and seed tissues of sea buckthorn. Normalization was done using constitutively

154

154

expressed actin-1 as internal control. The transcript signals of both Hr-Lcy and Hr-

Psy were strongly detectable in the fruit and leaf tissues. Although, a large variation

was noticed between different plants tissues positioned in the carotenoid

accumulation, we found that Lycopene is produced at low quantity in seed and root

tissues. It is reported in literature that ripening-specific genes are involve to activate

carotenoid pathway during ripening stage (Ronen et al., 1999; Ronen et al., 2000;

Alba et al., 2005).

Our results indicated that the comparative amount of corresponding carotenoids

biosynthesis enzymes mRNA changed considerably during different

developmental stages. It could be concluded from the Arabidopsis expression pattern

that caroteniods biosynthesis genes in different part of the sea buckthorn plant have

depicted the same expression pattern.

The accumulation of carotenoids is reported in the majority of plants tissue, such as

green shoot, flower, fruit, and seed and root tissues. Even though the content as well

as type of carotenoid in green tissues showed comparative conservation among most

of the plant species. whereas the level of carotenoid and its profiles in non green

parts, including flower, fruit and seed tissues, showed considerable variability under

the influence of main factors such as stage of development, environmental

conditions, stresses or a grouping of these factors (Howitt and Pogson, 2006).

Beta-carotene concentration usually enhanced with the stages of development. As

fruit matures, carotenoid contents were increased to larger concentration. These

caroteniods are responsible for orange red color in sea buckthorn berries that are

solely synthesized and accumulate during fruit ripening. The ripened fruit berries of

sea buckthorn were preferably chosen for our current gene study as there is much

155

155

caroteniods accumulation at this peak point which is steady with the perceptual

structure found in other plants like pepper, mango, and papaya. (Fabi et al., 2007;

Ha et al., 2007). Now it is fully recognized that transcriptional regulation of genes

that encodes phytoene synthase (PSY), is the major force that triggers the production

of carotenoids in different plant species. Phytoene synthase (PSY) is considered as

the first enzyme of the pathway that determines the rate at which the overall reaction

proceeds.

Considerable enhancement in carotenoids contents were reached through genetic

modification of carotenoids biosynthetic pathways in canola, rice, potato and maize

(Aluru et al., 2008; Shewmaker, 1999).

Wild fruits and berries formed one of the most important food sources of the people.

Gene reserve of these wild species can be used productively for genetic engineering

of food crops for better nutrition. Sea buckthorn plants are remarkable in their

capacity to synthesize a variety of macro and micro nutrients significant to human

health. The targeted expression of these important micro-nutrients gene can be

utilized to channeled metabolic flux in new pathway in grain crops with

micronutrient malnutrition. The lack of micronutrients is due to the deficiency of

vitamin and mineral elements in food. People in poor countries especially have to

face the danger of nutrient deficiency because their diet comprised chiefly on grain

and does not included most important fruits, vegetables and animal products.

Proteins obtained from plants make available amino acids essential to human health.

Staple crops can express proteins with much beneficial amino acids as a result of

modification. The valuable affects of berry and berry fraction on health of human

were widely examined and supported by investigation, which suggested a enormous

156

156

prospective for berry to maintain and promote humans health (Cheng et al., 2007;

Gao et al., 2000; Johansson et al., 2000; Rösch et al., 2003; Suleyman et al., 2002;

Shukla et al., 2006; Vijayaraghavan et al., 2006; Yang and Kallio, 2002; Yang and

Kallio, 2005).

The biosynthetic pathways can be functionally altered with the prospective for

improving the nutrition and survival properties of plants. This is of substantial value

to address food security in the face of adverse climatic changes. Our finding showed

that analyses of both Hr-Lcyb and Hr-Psy gene from sea buckthorn (Hippophae

rhamnoides) have identical structures and biological functions to the subsequent

genes from other plants species. The genetic diversity and wild gene pool of sea

buckthorn plant can be used for meeting current and future demands. The

identification and indispensable use of these berries and important molecules studied

generate baseline data for biotechnological interest in the plants. Many attempts to

improve vitamin A malnutrition were concentrated on manipulations of carotenoids

biosynthesis pathway enzymes for increasing the nutritional contents and functional

attributes of food grains. The activity of these genes and their encoded products can

be regulated and characterized in numerous ways.

4.5 CONCLUSIONS

Our study effort was to contribute to caroteniods gene identification, isolation and

analysis to provide important knowledge to caroteniods synthesis in this medicinal

plant. In this assessment I have summarized the existing knowledge of the carotenoid

transcript signals (LCYβ & PSY) and discussed about the knowledge of their

biosynthesis regulation in bud, shoot apex, roots, seeds and fruits. The importance

of these micro nutrients and protective effect conferred by sea buckthorn deserves

157

157

further investigation. This work on wild fruit berries will provide an advantage to

access all these compounds to combat micronutrient malnutrition in the developing

world, additionally one might argue that the quantities are generally higher, but use

of these is not sizable

4.6 GENERAL SUMMARY

This investigation symbolizes a novel and unique approach through an evaluation of

the nutritional use of traditional medicinal plants sea buckthorn by examining

essential micronutrients genes. Plants are well known for their biochemical

versatility, proficient with synthesis of almost all complements of dietary

micronutrient requirements; although having uneven distribution amongst various

plant portions. Sea buckthorn (Hippophae rhamnoides L.) is fruit-bearing plant

identified for therapeutic and nutraceutical potential. The biologically active

compounds found in sea buckthorn berries have fascinated major research interests

equally for their antioxidants and for central enzyme of metabolism. Its fruit, seed,

leaf and bark comprised of astounding range of nutrient elements like vitamins,

substantial oils and minerals. The majority of our regular staples crops are poor in

most of these nutritious elements.

Functional candidate’s genes from sea buckthorn were therefore chosen from the

pathway enzymes known to be involved in vitamins biosynthesis and metabolism.

Specific gene primers were designed and RT-PCR and PCR amplification was used

to amplify desired gene products. The products were sequenced to check the desired

gene amplification from sea buckthorn plant. The list of cDNA cloned and

sequenced included Ascorbate oxidase (AO), Folate (HPPK-DHPS), vitamin A

(LCYβ and PSY). Differences and similarities were found in homology and

158

158

phylogenic evaluation with other plant species. The first amplification was

concerned about full length cDNA of ascorbate oxidase (Ascorbic acid) gene.

Ascorbic acid (vitamin C) is a well-known for its dietetic significance; most

attributes of its metabolism and some attributes of its function in plants are feebly

understood similarly biosynthetic pathway has not been definitely recognized

nevertheless in the majority of tissues it attained millimolar concentration. We

carried out successful amplification of full length coding sequence of AO gene

(2158 bp) with reference to reference gene sequence with an open reading frame of

1737 bp. The total amino acid residues of Hr-AO were 719aa. Moreover differences

were found in length of new gene sequence in comparison with tomato gene

sequence shearing 87% gene homology. The relative abundance of the total RNA

coding for Hr-AO was estimated using semi-quantitative RT-PCR amplification

with maximum transcript accumulation in green leaf and young green fruit tissues.

This was the first report to differentiate the association involving the expression of

Hr-AO and fruit growth in such type of bush plant. This novel gene isolated from

sea buckthorn will help to understand the regulatory role of this enzyme in ascorbic

acid metabolism.

The second gene isolated was Folate (Hydroxymethyldihydropterin

pyrophosphokinase–dihydropteroate synthase) involved in the folate biosynthesis

pathway. The target gene HPPK-DHPS was successfully isolated and cloned from

sea buckthorn and its protein structure was compared with other plants. The

sequence analysis exposed that this novel gene was 2354 bp in size. The coding

region was interrupted by a single large intron. The length of the ORF was found to

be 1539 bp which was similar to its ortholog in tomato.

159

159

Prominent nucleotide differences found were randomly distributed throughout the

full sequence length. Semi-quantitative RT-PCR Expression analysis revealed

higher HrHPPK-DHPS transcripts accumulation in leaf and fruits tissues.

Phylogenetic reconstruction exposed gene duplication in soybean and Arabidopsis.

In this study an attempt was also made to compare the 3D homology modeling

structure of new protein, though considerable conservation in 3dimensional structure

of folate proteins was observed; however, notable differences in substrate binding

pockets were also visible. The study will have future implications in utilizing the

potential of wild medicinal plants for genetic improvement of folate deficient staple

food crops.

Third part of the research deals with carotenoids which produces yellow colors of

fruits and vegetables and are almost universally distributed in living things.

Carotenoids are well-known for its role in plant development and photosynthesis,

and are a chief source of vitamin A in humans nutritional. Among these caroteniods

lycopene is the carotene most commonly found in ripened fruit tissues. Lycopene

βcyclase catalyzed the conversion of Lycopene into β-carotene which is the major

dietary predecessor of vitamin A. The colored carotenoids are derived from

Phytoene. Phytoene synthase converts (GGDP) geranylgeranyl diphosphate to

Phytoene in the first stage of carotenoid biosynthesis pathway. Basic challenges were

to study two important caroteniods pathway genes Lycopene β-cyclase and phytoene

synthase from vitamin A rich plant “sea buckthorn” (Hippophae rhamnoides). The

newly isolated full length coding sequences of Hr-Lcyb and Hr-Psy showed

homology with original gene sequence. Despite the similarities in nucleotide gene

sequences several differences in structural domains were also found. These novel

160

160

genes sequence from wild plant sea buckthorn are closely linked with other

carotenoids biosynthetic genes and can therefore be useful in identifying novel

protein accumulation and function. Maximum transcript accumulation is accordingly

detected in a variety of plant tissues (leaf & Fruit), even though at trace level in some

tissues like seed and root. In this assessment we recapitulated the existing knowledge

of the carotenoid transcript signals and discussed what is acknowledged regarding

the regulation of their biosynthesis in bud, shoot apex, root, seed and fruit tissues.

This work recommends that the study of different genes encoding caroteniods with

diverse activity will also help to meet the problem associated with vitamin A

deficiency. The likelihood of intensifying the vitamins content of plants to recuperate

their nutritive significance is promising. However exploitation of natural usable gene

pool is worthwhile approach that should receive considerable attention in research.

Our effort added important knowledge after searching genes useful for future

improvement of food crops through biofortification.

The availability of biosynthetic genes from different species that can function

cooperatively to produce visually detectable products makes carotenoids

biosynthesis an ideal model system to explore engineering strategies. In addition to

the inherent value of carotenoids as chemicals for medicine and industry, carotenoids

biosynthesis is an excellent model system to develop and test tools for the creation

of novel multienzyme pathways in recombinant organisms using combinatorial and

directed evolution tool.Awareness and identification about the value of these

important micronutrient genes in sea buckthorn plant will increases its long term

value for genetic engineering in future. These genes will be further functionally

161

161

characterized and transformed to plants lacking such genes. Cereals are staple foods,

widely consumed and are deficient in essential micronutrients.

4.7 GENERAL CONCLUSIONS AND RECOMMENDATIONS

• Recent interests for investigating sea buckthorn plant and their fruit berries

were depended intimately on their reported health benefits and their valuable

bioactive compound to a certain extent. It necessitated an increase in the

understanding of these important contents of vitamins in the fruits, leaves and

berry raw material etc.

• The Micronutrients genes like ascorbic acid, folate and caroteniods pathway

genes rich in sea buckthorn leaves and fruits showed the presence of multiple

genes for such bio-chemicals, which have much significance for human

growth and health. These micronutrient genes can successfully be used for the

biofortification of staple food crops on large scale.

• In this thesis work the genes of vitamin C, folate and caroteniods were

investigated and compared with other plant species with remarkable

differences in sequence analysis and protein configuration. The functional

role of ascorbate oxidase has never been fully elucidated before, owing to the

complexity in discerning the existence of an enzyme specially oxidizing

ascorbate without any apparent benefit as a result of consumption of

ascorbate. The isolation and expression studies of ascorbate oxidase gene

from sea buckthorn will generate sufficient date in understanding their role.

• Futher more the identification of folate biosynthetic gene and dominant

carotenoids genes from sea buckthorn are promising for future biofortification

162

162

of staple food crops. The levels of these different biologically active

substances are relatively higher in comparision with other fruit and berries.

• The assessment of cumulative data from cDNA sequence, amino acid

sequence, phylogenetic reconstruction and expression pattern demonstrated

that there is a considerable variability in the genes constitution and

evolutionary association with other ortholog.

• The Cereals are staple foods with wider consumptions and are mostly

deficient in important micro-nutrients. The ortologues genes isolated in the

study will possibly be characterized functionally by transformation into

cereals crop (wheat, rice) to meet the problem of micronutrient malnutrition.

Ascorbic acid cannot be stored in the body; therefore this vitamin must be

acquired regularly from dietary sources.

• These studies approach entails genetic modification of plant folate

metabolism for improved bio-availability. The most evident and simple

approaches toward an increase in folate level is through engineering the folate

biosynthetic pathway genes.

• This work also recommends that the caroteniods genes with diverse activities

will also help to meet the problem associated with vitamin A deficiency. Most

efforts to alleviate vitamin A deficiency have focused on the manipulation of

carotenoids biosynthetic pathway enzymes to improve the nutritional content

or functional properties of grains.

• The identification and indispensable use of these berries and important

molecules studied generate baseline data for biotechnological interest in the

plants.

163

163

• This study has future implications in exploring the potential of wild medicinal

plant for genetic improvement of staple food crops for nutrients.

• In future investigations these genes will be cloned into expression vector

through Gateway cloning technology for functional characterization. The

activity of these genes and their encoded products can be regulated and

characterized in numerous ways.

4.8 LIST OF PUBLISHED PAPERS AND BOOKS

Asad Hussain Shah, S Dilnawaz A, Mubasher S, Shazia A, Ishtiaque K and Farhat B.

2007. Biochemical and nutritional evaluations of sea buckthorn (hippophae

rhamoides L. ssp. turkestanica from different locations of Pakistan. Pak. J. Bot.,

39 (6): 2059-2065.

Shazia arif, S Dilnawaz A, Asad H S, Lutful H, Shahid I A, Abdul H and Farhat B. 2010.

Determination of optimum harvesting time for vitamin C, Oil and mineral elements

in berries of sea buckthorn (hippophae rhamnoides) Pak. J. Bot., 42 (5): 3561-

3568.

Aurangzeb Rao, S Dilnawaz A, Mubashar S, Shahid I A, Asad H S, M. Fareed K, Sardar

A K, Saima S, Shazia A, Rizwan A and Maria G. 2013.. Antioxidant activity and

lipid peroxidation of selected wheat cultivars under salt stress.

Journal of Medicinal Plants Research Vol. 7(4), pp. 155-164.

Aurangzeb Rao, S Dilnawaz A, Mubashar S, Shahid I A, Asad H S, M. Fareed K, Saima

S, Shazia A and Rizwan A. 2013. Potential biochemical indicators improve salt

tolerance in fifteen cultivars of wheat (Triticum aestivum L.) from Pakistan

International Journal of Scientific & Engineering Research. Volume 4(6): ISSN

2229-5518.

164

164

Shazia Arif, M Ramzan K, S Dilnawaz A, Zaheer A and G Muhammad A. 2014. novel

hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase

(HHPK-DHPS) gene from a nutraceutical plant sea buckthorn, involved in folate

pathway is predominantly expressed in fruit tissue. Journal of BMC molecular

biology (accepted).

Books

Syed Dilnawaz Ahmed and Shazia A. 2010. A Book entitled “Comparisons of few

important bio-chemicals from Sea buckthorn: Bio-chemicals from Sea buckthorn

expressed at three stages of fruit development and folate genes for

biofortification”. ISBN-13: 978-3838383378 ISBN-10: 3838383370.

Shazia Arif, Syed Dilnawaz A and Asad HS. 2012. A Book entitled “ Sea Buckthorn A

Magic plant in Azad Kashmir” subtitle Modified Methods for the Isolation of High

quality RNA from Sea buckthorn rich in Polyphenols & secondary metabolites, by

LAMBERT Academic publishing. ISBN-13: 978-3-659-27183-0

ISBN-10: 3659271837

165

165

Chapter 5

LITERATURE CITED

Ahmad, S.D. and M. Kamal. 2002. Morpho-molecular characterization of local

genotypes of Hippophaė rhamnoides L. ssp. turkestanica a multi-purpose plant

from northern areas of Pakistan. Online J. Biol Sci., 2: 351-354.

Akulinin, I.A. 1958. Using sea buckthorn oil in treating burns. Sov. Med. 11: 137-

138.

Alam, Z. 2004. Chemical and Nutritional Constituents of Sea Buckthorn Juice. Pak.

J. Nutr., 3: 99-106.

Alba, R., P. Payton, Z. Fei, R. McQuinn, P. Debbie, G.B. Martin, S.D. Tanksley and

J.J. Giovannoni. 2005. Transcriptome and selected metabolite analyses reveal

multiple points of ethylene control during tomato fruit

development. Plant Cell, 17: 2954-2965.

Al-Madhoun, A., M. Sanmartin and A.K. Kanellis. 2003. Expression of ascorbate

oxidase isoenzymes in cucurbits and during development and ripening of

melon fruit. Postharvest Biol. Technol., 27: 137-146.

Aluru, M, Y. Xu, R. Guo, Z. Wang, S. Li, W. White, K. Wang and S. Rodermel.

2008. Generation of transgenic maize with enhanced provitamin A content. J.

Exp. Bot., 59: 3551-3562.

166

166

Andersson, S.C., K. Rumpunen, E. Johansson and M.E. Olsson. 2008. Tocopherols

and tocotrienols in sea buckthorn (Hippophae rhamnoides L.) berries during

ripening. J. Agric. Food Chem., 56: 6701-6706.

Andersson, S.C., M.E. Olsson, E. Johansson and K. Rumpunen. 2009. Carotenoids

in sea buckthorn (Hippophae rhamnoides L.) berries during ripening and use

of pheophytin a as a maturity marker. J. Agric. Food Chem., 57: 250-258.

Arimboor, R., V.V. Venugopalan, K. Sarinkumar, C. Arumughan and R.C.

Sawhney. 2006. Integrated processing of fresh Indian sea buckthorn

(Hippophaė rhamnoides) berries and chemical evaluation of products. J. Sci.

Food Agr., 86: 2345-2353.

Asad, H.S., S.D. Ahmed, M. Sabir, S. Arif, I. khaliq and F. batool. 2007.

Biochemical and nutritional evaluations of sea buckthorn (Hyppophae

rhamnoides L. spp. turkestanica) from different locations of Pakistan. Pak. J.

Bot., 39: 2059-2065.

Bailey, L.H. and E.Z. Bailey. 1978. Hortus Third. A concise dictionary of plants

cultivated in the United States and Canada. MacMillan Pub. Co. Inc. 1290 pp.

Bal, L.M., V. Meda, S.N. Naik and S. Satya. 2011. Sea buckthorn berries: A potential

source of valuable nutrients for nutraceuticals and cosmoceuticals.

Food Res. Int., 44: 1718-1727.

Barbehenn, R.V., A. Jaros, L. Yip, L. Tran, A.K. Kanellis and C.P. Constabel. 2008.

Evaluating ascorbate oxidase as a plant defense against leaf-chewing insect

using transgenic Poplar. J. Chem. Ecol., 34: 1331-1340.

167

167

Barnes, J., Y. Zheng and T. Lyons. 2002. Plant resistance to ozone: the role of

ascorbate. In: Omasa K, Saji H, Youssefian S, Kondo N, eds. Air pollution

and plant biochemistry: prospects for phytomonitoring and phytoremediation.

Berlin, Heidelberg, New York: Springer, 235-252 pp.

Basset, G.J., E.P. Quinlivan, S. Ravanel, F. Rébeillé, B.P. Nichols, K. Shinozaki,

M. Seki, L.C. Adams-Phillips, J.J. Giovannoni, III. J.F. Gregory and A.D.

Hanson. 2004. Folate synthesis in plants: the p-aminobenzoate branch is

initiated by a bifunctional PabA–PabB protein that is targeted to plastids. Proc.

Natl. Acad. Sci. USA, 101: 1496-1501.

Bekker, N.P. and A.I. Glushenkova. 2001. Components of certain species of the

Elagnaceae family. Chem. Nat. Comp., 37: 97-116.

Benzie, I.F.F. 1999. Prospective functional markers for defining optimal nutritional

status: Vitamin C. Proc. Nutr. Soc., 58: 1-8.

Bernath, J. and D. Foldesi. 1992. Sea buckthorn (Hippophaė rhamnoides L.): A

promising new medicinal and food crop. J Herbs Spices Med. Plants, 1: 27-

35.

Beveridge, T., T.S.C. Li, B.D. Oomah and A. Smith. 1999. Sea buckthorn products:

Manufacture and composition. J. Agric. Food Chem., 47: 34803488.

Beveridge, T.H.J. 2002. Opalescent and cloudy fruit juices: formation and particle

stability. Crit. Rev. Food Sci. Nutr., 42: 317-37.

Beveridge, T.H.J., M. Cliff and P. Sigmind. 2004. Supercritical carbon dioxide

percolation of sea buckthorn press juice. J. Food Qual., 27: 41-54.

168

168

Birghila, S., S. Dobrinas, N. Matei, V. Magearu, V. Popescu and A. Soceanu.

2004. Distribution of Cd, Zn and ascorbic acid in different stages of tomato

(Lycopersicum esculentum Solanaceae) plant growing. Rev. Chim-

Bucharest., 55: 683-685.

Boccio, J.R. and V. Lyengar. 2003. Iron deficiency – causes, consequences, and

strategies to overcome this nutritional problem. Biol. Trace Elem. Res., 94: 1-

31.

Boushey, C.J., S.A. Beresford, G.S. Omenn and A.G. Motulsky. 1995. A quantitative

assessment of plasma homocysteine as a risk factor for vascular disease.

Probable benefits of increasing folic acid intakes. JAMA., 274:

1049-1057.

Brattstrom, L. and D.E. Wilcken. 2000. Homocysteine and cardiobascular disease:

cause or effect? Am. J. Clin. Nutr., 72: 315-323.

Bruno, R.S., S.W. Leonard, J. Atkinson, T.J. Montine, R. Ramakrishnan, T.M.

Bray and M.G. Traber. 2006. Faster plasma vitamin E disappearance in

smokers is normalized by vitamin C supplementation. Free Radic Biol. Med.,

40: 689-697.

Britton, G., S. Liaaen-Jensen and H. Pfander. 2009. Carotenoids. Volume 5:

Nutrition and Health. Basel, Switzerland: Birkhauser Verlag. 8pp.

Brinster, R.L, J.M. Allen, R.R. Behringer, R.E. Gelinas and R.D. Palmiter. 1988.

Introns increase transcriptional efficiency in transgenic mice. Proc. Natl.

Acad. Sci. USA, 85: 836-840.

169

169

Buchman, A.R. and P. Berg. 1988. Comparison of intron-dependent and

intronindependent gene expression. Mol. Cell Biol., 8: 4395-4405.

Busch, M., A. Seuter and R. Hain. 2002. Functional analysis of the early steps of

carotenoid biosynthesis in tobacco. Plant Physiol., 128: 439-453.

Caballero, B., 2003. Fortification, supplementation, and nutrient balance. Eur. J.

Clin. Nutr., 57: S76-S78.

Calvaresi, E., J. Bryan. 2001. B vitamins, cognition, and aging: a review. J. Gerontol.

B. Psychol. Sci Soc Sci., 56: 327-339.

Carr, A.C. and B. Frei. 1999. Toward a new recommended dietary allowance for

vitamin C based on antioxidant and health effects in humans. Am. J. Clin.

Nutr., 69: 1086-1107.

Carvalho, J. L.B., C.J. Lima and P.H. Medeiros. 1981. Ascorbate oxidase from

Cucurbita maxima. Phytochem., 20: 2423-2424.

Cenkowski, S., R. Yakimishen, R. Przybylski and W.E. Muir. 2006. Quality of

extracted sea buckthorn (Hippophae rhamnoides L.) seed and pulp oil.

Can. Biosyst. Eng., 48: 9-16.

Chakrabarty, R., R. Banerjee, S.M. Chung, M. Farman, V. Citovsky, S.A.

Hogenhout, T. Tzfira and M. Goodin. 2007. pSITE vectors for stable

integration or transient expression of autofluorescent protein fusions in plants:

probing Nicotiana benthamiana-virus interactions. Mol. Plant-

Microbe Interact., 20: 740-750.

170

170

Charles, A.D., T. McGhie, R. Wibisono, M. Montefiori, R.P. Hellens and A.C. Allan.

2009. The kiwifruit lycopene beta-cyclase plays a significant role in carotenoid

accumulation in fruit. J. Exp. Bot., 60: 3765-3779.

Chauhan, A.S., M.N. Rekha, R.S. Ramteke and W.E. Eipeson. 2001. Preparation and

quality evaluation of processed products from sea buckthorn (Hippophaė

rhamnoides L.) berries. Beverage Food World, 27: 31-34.

Cheng, J.Y., K. Kondo, Y. Suzuki, Y. Ikeda, X. Meng and K. Umemura. 2007.

Inhibitory effects of total flavones of Hippophaë rhamnoides L. on thrombosis

in mouse femoral artery and in vitro platelet aggregation. Life Sci., 72: 2263-

2271.

Chen, T. 1988. Studies of the biochemical composition of Hippophaė and its quality

assessment in Gansu Province. Hippophaė, 1: 19-26.

Chen, Y., F. Li and E.T. Wurtzel. 2010. Isolation and characterization of the Z-ISO

gene encoding a missing component of carotenoid biosynthesis in plants.

Plant Physiol., 153: 66-79.

Chou, W.M., T.Shigaki, C. Dammann, Y.Q. Liu and M.K. Bhattacharyya. 2004.

Inhibition of phosphoinositide-specific phospholipase C results in the

induction of pathogenesis related genes in soybean. Plant Biol., 6: 664-672.

Chugaeva, V.N., A.I. Gurvich and M.G.Ushakova. 1964. Mater. Conf. on Vitamins

from Natural Raw Mat. Kuybushev., 172-177pp

Chung, S. and R. Perry. 1989. Importance of introns for expression of mouse

ribosomal protein gene rpL32. Mol. Cell Biol., 9: 2075-2082.

171

171

Clotault, J., D. Peltier, R. Berruyer, M. Thomas, M. Briard and E. Geoffriau. 2008.

Expression of carotenoids biosynthesis genes during carrot root development.

J. Exp. Bot., 59: 3563-73.

Clough, S.J. and A.F. Bent. 1998. Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J., 16:

735-743.

Cox, B.D., M.J. Wlichelow and A.T. Prevost. 2000. Seasonal consumption of salad

vegetables and fresh fruit in relation to the development of cardiovascular

disease and cancer. Public Health Nutr., 3: 19-29.

Cunningham, F.X., Z.J. Sun, D. Chamovitz, J. Hirschberg and E.

Gantt. 1994. Molecular structure and enzymatic function of lycopene cyclase

from the cyanobacterium Synechococcus sp. strain PCC7942. Plant Cell, 6:

1107-1121.

Darmer, G. 1952. Der Sanddornals Wild-und Kulturepflaze. Leipzig, Germany: S.

Hirzel Verlag – Publisher. 89 pp.

Darnton, H.I. and R. Nalubola. 2002. Fortification strategies to meet micronutrient

needs: successes and failures. Proc. Nutr. Soc., 61: 231-241.

Davey, M.W., M.V. Montagu, D. Inze, M. Sanmartin, A. Kanellis, N. Smirnoff,

I.F.F. Benzie, J.J. Strain, D. Favell and J. Fletcher. 2000. Plant L-ascorbic acid:

chemistry, function, metabolism, bioavailability and effects of processing. J.

Sci. Food Agr., 80: 825-860.

David, T.J. 1997. Progression in protein structure prediction. Curr. Optn Struc.

172

172

Btol., 7: 377-387.

Deli J, P.P. Molnar. 2002. Carotenoids: analysis, isolation, structure elucidation.

Curr. Org. Chem., 6: 1197-1219.

Deman, J.M. 1973. Principle of Food Chem. Oxford University Press, London. 311-

320 pp.

Deng-Ke, N. and Y. Yu-Fei. 2011. Why eukaryotic cells use introns to enhance gene

expression: Splicing reduces transcription-associated mutagenesis by

inhibiting topoisomerase I cutting activity. Biol. Direct., 6: 24.

De-Tullio, M.C., S. Ciraci, R. Liso and O. Arrigoni. 2007. Ascorbic acid oxidase is

dynamically regulated by light and oxygen. A tool for oxygen management in

plants. J. Plant Physiol., 164: 39-46.

Dharmananda, S. 2004. Sea buckthorn, Institute of Traditional Medicine, Portland,

Oregon. http://www.itmonline.org/arts/sea buckthorn.htm.

Diallinas, G., I. Pateraki, M. Sanmartin, A. Scossa, E. Stilianou, N.J. Panopoulos and

A.K. Kanellis. 1997. Melon ascorbate oxidase: cloning of a multigene family,

induction during fruit development and repression by wounding.

Plant Mol. Biol. 34: 759- 770.

Dong, H., Y. Deng, J. Mu, Q. Lu, Y. Wang, Y. Xu, C. Chu, K. Chong, C. Lu, J. Zuo.

2007. The Arabidopsis Spontaneous Cell Death1 gene, encoding a

zetacarotene desaturase essential for carotenoid biosynthesis, is involved in

chloroplast development, photoprotection and retrograde signalling. Cell Res.,

17: 458-470.

173

173

Douce, R., J. Bourguignon, M. Neuburger and F. Rébeillé. 2001. The glycine

decarboxylase system: a fascinating complex. Trends Plant Sci., 6: 167-176.

Doyle, J.J. and J.L. Doyle. 1987. A rapid DNA isolation procedure for small

quantities of fresh leaf tissue. Phytochem. Bull., 19: 11-15.

Eleonora, N.,A.D. Venere, N. Rosato, A. Rossi, A.F. Agro and G. Mei. 2006.

physico-chemical properties of molten dimer Ascobate oxidase. The FEBS J.,

273: 5194-5204.

Eliseeve, I.P. 1989. Evolutionary genetic aspects in assessment of achievements and

perspectives of sea buckthorn selection in USSR. Proc. Int. Symp. Sea

buckthorn (Hippophae rhamnoides L.), Xian, China. 184-193 pp.

Esaka, M., H. Fukui, K. Suzuki and K. Kubota. 1989. Secretion of ascorbate oxidase

by suspension-cultured pumpkin cells. Phytochem., 28: 117-119.

Esaka, M., K. Fujisawa, M. Goto and Y. Kisu. 1992. Regulation of ascorbate oxidase

expression in pumpkin by auxin and copper. Plant Physiol., 100: 231-237.

Esaka, M., T. Hattori, K. Fujisawa, S. Sakajo and T. Asahi. 1990. Molecular cloning

and nucleotide sequence of full-length cDNA for ascorbate oxidase from

cultured pumpkin cells. Eur. J. Biochem., 191: 537-541.

Fabi, J.P., B.R. Cordenunsi, G.P. de Mattos Barreto, A.Z. Mercadante, F.M. Lajolo,

J.R. Oliveira do Nascimento. 2007. Papaya fruit ripening: response to ethylene

and 1-methylcyclopropene (1-MCP). J. Agric. Food Chem., 55:

6118-6123.

Fabrice, R., D. Macherel, J.M. Mouillon, J.R. Garin and D. Roland. 1997. Folate

biosynthesis in higher plants: purification and molecular cloning of a

174

174

bifunctional 6-hydroxymethyl 7,8- dihydropterin

pyrophosphokinase/7,8dihydropteroate synthase Localized in mitochondria.

The EMBO J., 16: 947957.

Fan, J., X. Ding and W. Gu. 2007. Radical-scavenging proanthocyanidins from sea

buckthorn seed. Food Chem., 102: 168-177.

Farver, O., S. Wherland and I. Pecht. 1994. Intramolecular electron transfer in

ascorbate oxidase is enhanced in the presence of oxygen. J. Biol. Chem., 269:

22933-6.

Felsenstein, J. 1985. Confidence limits on Phylogenies: An approach using the

Bootstrap. Evolution, 39: 783-791.

Fotopoulos, V., M. Sanmartin and A.K. Kanellis. 2006. Effect of ascorbate oxidase

over-expression on ascorbate recycling gene expression in response to agents

imposing oxidative stress. J. Exp. Bot., 57: 3933-3943.

Foyer, C.H., P. Descourvieres and K.J. Kunert. 1994. Protection against oxygen

radicals: an improved defence mechanism study in transgenic plants. Plant Cell

Environm., 17: 507-523.

Fraser, P.D. and P.M. Bramley. 2004. The biosynthesis and nutritional uses of

carotenoids. Prog Lipid Res., 43: 228-265.

Gady, A.L.F., W.H. Vriezen, M.H.B.J. Van de Wa, P. Huang, A.G. Bovy and

R.G.F. Visser. 2012. Induced point mutations in the phytoene synthase 1 gene

cause differences in carotenoid content during tomato fruit ripening. Mol.

Breeding, 29: 801-812.

175

175

Gallagher, C.E., P.D. Matthews, L. Faqiang and E.T. Wurtzel. 2004. Gene

duplication in the carotenoid biosynthetic pathway preceded evolution of the

grasses. Plant Physiol., 135: 1776-1783.

Gamas, P., C. Niebel Fde, N. Lescure and J. Cullimore. 1996. Use of a subtractive

hybridization approach to identify new Medicago truncatula genes induced

during root nodule development. Mol. Plant Microbe Interact., 9: 233-42.

Gao, X.Q., M. Ohlander, N. Jeppsson, L. Bjork and V. Trajkovski. 2000. Changes

in antioxidant effects and their relationship to phytonutrients in fruits of sea

buckthorn (Hippophae rhamnoides L.) during maturation. J. Agric. Food

Chem., 48: 1485-1490.

Garcia-Pineda, E., E. Castro-Mercado and E. Lozoya-Gloria. 2004. Gene expression

and enzyme activity of pepper (Capsicum annuum L.) ascorbate oxidase during

elicitor and wounding stress. Plant Sci., 166: 237–243

Gatin, J.I. 1963. Sea buckthorn, Moscow. 159 pp.

George, D.P., M. Sanmartin, A. Scossa, E. Stilianou, N.J. Panopoulos and A.K.

Kanellis. 1997. Melon ascorbate oxidase: cloning of a multigen family,

induction during fruit development and repression by wounding. Plant Mol.

Biol., 34: 759-770.

Giuffrida, D., A. Pintea, P. Dugo, G. Torre, R.M. Pop and L. Mondello. 2011.

Determination of carotenoids and their esters in fruits of sea buckthorn (Hippophae rhamnoides

L.) by HPLC-DAD-APCI-MS. Phytochem. Anal., 23: 267-273.

176

176

Giuliano, G., G.E. Bartley and P. Scolnik. 1993. Regulation of caroteniods

biosynthesis during tomato development. Plant Cell, 5: 379-387.

Goodwin, T.W. 1980. The biochemistry of the carotenoids, 2nd edition volume 1.

Landon. Chapman and Hall 19, London, NY.

Gorbatsova, J., T. Lõugas, R. Vokk, and M. Kaljurand. 2007. Comparison of the

contents of various antioxidants of sea buckthorn berries using CE.

Electrophoresis, 28: 4136-4142.

Goyer, A., V. Illarionova, S. Roje, M. Fischer, A. Bacher and A.D. Hanson. 2004.

Folate biosynthesis in higher plants. cDNA cloning, heterologous expression,

and characterization of dihydroneopterin aldolases. Plant Physiol., 135: 103111.

Gutzeit, D., M. Sabine, J. Gerold, W. Peter and R. Michael. 2008. Folate content in

sea buckthorn berries and related products (Hippophaë rhamnoides L. ssp.

rhamnoides): LC-MS/MS determination of folate vitamer stability influenced

by processing and storage assessed by stable isotope dilution assay. Anal.

Bioanal. Chem., 391: 211-219.

Hampele, I.C., A. D'Arcy, G.E. Dale, D. Kostrewa, J. Nielsen, C. Oefner, M.G. Page,

H.J. Schönfeld , D. Stüber and R.L. Then. 1997. Structure and Function of the

dihydropteroate Synthase from Staphylococcus aureus. J. Mol. Biol.

268: 21-30.

Hanson, A.D. 2010. Developmental and feedforward control of the expression of

folate biosynthesis genes in tomato fruit. Mol. Plant., 3: 66-77.

177

177

Hagihara, T., M. Hashi, Y. Takeuchi and N. Yamaoka. 2004. Cloning of soybean

genes induced during hypersensitive cell death caused by syringolide elicitor.

Planta, 218: 606–614

Hakkinen, S.H., S.O. Karenlampi, I.M. Heinonen, H.M. Mykkanen and A.R.

Torronen. 1999. Content of the flavonols quercetin, myricetin, and kaempferol

in 25 edible berries. J. Agric. Food Chem., 47: 2274-9.

Hanson, A.D., D.A. Gage and Y. Shachar-Hill. 2000. Plant one carbon

metabolism and its engineering. Trends Plant Sci., 5: 206-213.

Hanson, A.D. and S. Roje. 2001. One-carbon metabolism in higher plants. Annu.

Rev. Plant Physiol. Plant Mol. Biol., 52: 119-137.

Havel, T.F. and M.E. Snow. 1991. A new method for building protein conformations

from sequence alignments with homologous of known

structures. J. Mol. Btol., 217: 1-7.

Ha, S.H., J.B. Kim, J.S. Park, S.W. Lee and K.J. Cho. 2007. A comparison of the

carotenoid accumulation in capsicum varieties that show different ripening

colours: deletion of the capsanthin-capsorubin synthase gene is not a

prerequisite for the formation of a yellow pepper. J. Exp. Bot., 58: 31353144.

Heimann, W. 1980. Fundamentals of Food Chemistry 1st Edn., Ellis Horwood

Limited.

Heyn, P., T.K. Alex, T. Pavel and M.N. Karla. 2015. Introns and gene expression:

Cellular constraints, transcriptional regulation, and evolutionary consequences.

BioEssays, 37: 148-154.

Hirschberg, J. 2001. Carotenoid biosynthesis in flowering plants. Curr. Opin. Plant

178

178

Biol., 4: 210-218.

Hong, Y.L., P.A. Hossler, D.H. Calhoun and S.R. Meshnick. 1995. Inhibition of

recombinant Pneumocystis carinii dihydropteroate synthetase by sulfa drugs.

J. Antimicrob. Chemother., 39: 1756-1763.

Hossain, T., I. Rosenberg, J. Selhub, G. Kishore, R. Beachy and K. Schubert. 2004.

Enhancement of folates in plants through metabolic engineering. Proc. Natl.

Acad. Sci. USA, 101: 5158-5163.

Howitt, C.A. and B.J. Pogson. 2006. Carotenoid accumulation and function in seeds

and non-green tissues. Plant Cell Environ., 29: 435-445.

Hugueney, P., A. Badillo, H.C. Chen, A. Klein, J. Hirschberg, B. Camara and M.

Kuntz. 1995. Metabolism of cyclic carotenoids: a model for the alteration of

this biosynthetic pathway in Capsicum annuum chromoplasts. Plant J., 8: 417-

424.

Hultberg, B., K.N. Isaksson and L. Gustafson. 2001. Markers for the functional

availability of obalamin/folate and their association with neuropsychiatric

symptoms in the elderly. Int. J. Geriatr Psych., 16: 873-878.

Ioannidi E., M.S. Kalamaki, C. Engineer , I. Pateraki , D. Alexandrou , I.

Mellidou, J. Giovannonni and A.K. Kanellis. 2009. Expression profiling of ascorbic acid-related

genes during tomato fruit development and ripening and in response to stress conditions. J. Exp.

Bot., 60: 663-78.

179

179

Jabrin, S., S. Ravanel, B. Gambonnet, R. Douce and F. Rébeillé. 2003. One-carbon

metabolism in plants. Regulation of tetrahydrofolate synthesis during

germination and seedling development. Plant Physiol., 131: 1431-1439.

Jeppsson, N. and X.Q. Gao. 2000. Changes in the contents of kaempherol, quercetin

and L-ascorbic acid in sea buckthorn berries during maturation. Agri. Food Sci.

Finland, 9: 17-22.

Johansson, A., H. Korte, B. Yang, J. Stanley and H. Kallio. 2000. Sea buckthorn

berry oil inhibits platelet aggregation. J. Nutr. Biochem., 11: 491-495.

Joshipura, K., A. Ascherio, A.E. Manson, M.J. Stampfer, E.B. Rimm, F.E Speizer,

C.H. Hennekens, D. Spiegeleman and W.C. Willett. 1999. Fruit and vegetable

intake in relation to risk of ischaemic stroke. J. Am. Med. Assoc., 282: 1233-

1239.

Kallio, H., B. Yang and P. Peippo. 2002. Effects of different origins and harvesting

time on vitamin C, tocopherols, and tocotrienols in sea buckthorn (Hippophaë

rhamnoides) berries. J. Agric. Food Chem., 50: 6136-6142.

Kallio, H., B. Yang, P. Peippo, R. Tahvonen and R. Pan. 2002. Triacylglycerols,

glycerophospholipids, tocopherols, tocotrienols in berries and seeds of two

species (ssp. sinensis and mongolica) of sea buckthorn (Hippophaė

rhaminoides). J. Agric. Food Chem., 50: 3004-3009.

Kallio, K., B.R Yang, R. Tahvonen and M. Hakala. 1999. Composition of sea

buckthorn berries of various origins. Proc. of Int. Symp. on Sea Buckthorn

(Hippophaė rhamnoids L.), Beijing, China.

180

180

Karvouni, Z., I. John, J.E. Taylor, C.F. Watson, A.J. Turner and D. Grierson. 1995.

Isolation and characterization of a melon cDNA clone encoding phytoene

synthase. Plant Mol. Biol., 27: 1153-1162.

Kato, N. and Esaka M. 2000. Expansion of transgenic tobacco protoplasts expressing

pumpkin ascorbate oxidase is more rapid than that of wild-type protoplasts.

Planta. 210: 1018-1022.

Katiyar, S.K., K. Sharma, N. Kumar and A.K. Bhatia. 1990. Composition of some

unconventional Himalayan wild fruits. J. Food Sci. Technol., 27: 309-310.

Khan, M.I. and M. Kamran. 2004. “Cost analysis of sea buckthorn berries picking

techniques and food products preparation at domestic level: A study conducted

in Ghulkin, Upper Hunza, Northern Areas of Pakistan”. WWF-

Pakistan, Jutial, Gilgit.

Khan, M.R., I. Khan and G.M. Ali. 2013. MPF2-like MADS-box genes affecting

SOC1 and MAF1 expression are implicated in flowering time control. Mol.

Biotechnol., 54: 25-36.

Krittaya, S. and P. Klanrit. 2013. cDNA cloning and expression analyses of phytoene

synthase 1, phytoene desaturase and ζ-carotene desaturase genes from

Solanum lycopersicum KKU-T34003. Songklanakarin. J. Sci. Technol.,

35: 517-527.

Kumar, S., J. Dudley, M. Nei and K. Tamura. 2008. MEGA: a biologist-centric

software for evolutionary analysis of DNA and protein sequences. Brief

Bioinform., 9: 299-306.

181

181

Lampe, J.W. 1999. Health effects of vegetables and fruit: assessing mechanism of

action in human experimental studies. Am. J. Clin. Nutr., 70: 475S-490S.

Lao, Y.M.1., L. Xiao, Z.W. Ye, J.G. Jiang and S.S. Zhou. 2011. In silico analysis of

phytoene synthase and its promoter reveals hints for regulation mechanisms of

carotenogenesis in Duanliella bardawil, Bioinformatics, 27:

2201-8.

Lawrence, M.C., P. Iliades, R.T. Fernley, J. Berglez, P.A. Pilling and I.G. Macreadie.

2005. The three-dimensional structure of the bifunctional 6hydroxymethyl-7,8-

dihydropterin pyrophosphokinase/dihydropteroate synthase of Saccharomyces

cerevisiae. J. Mol. Biol., 348: 655-70.

Lazzeri, V., V. Calvenzani, K. Petroni, C. Tonelli, A. Castagna and A. Ranieri. 2012.

Carotenoid profiling and biosynthetic gene expression in flesh and peel of wild

type and hp-1 tomato fruit under UV-B depletion. J. Agric. Food Chem., 60:

4960-4969.

Levine, M., S.C. Rumsey, R. Daruwala, J.B. Park and Y.H. Wang. 1999. Criteria

and recommendations for vitamin C intake, Journal of American Med. Assn.,

281: 1415-1423.

Lee, M.H. and C.R. Dawson. 1973. Ascorbate oxidase. Spectral characteristics of

the enzyme. J. Biol. Chem., 248: 6603-6609.

Lian, Lu T.S.G., S.K. Xue and X.L. Chen. 2000. Biology and chemistry of the genus

Hyppophae. Dansu Scientific and Technological publishing House, Lanzhou,

China. 88-91 pp.

182

182

Lian, Y.S., S.G. Lu, S.K. Xue and X.L. Chen. 2000. Biology and Chemistry of the

Genus Hippophae. Lanzhou Gansu Science Technology Press. 1-226 pp.

Li, M., F. Ma, D. Liang, J.Li and Y. Wang. 2010. Ascorbate biosynthesis during

early fruit development is the main reason for its accumulation in Kiwi. PLos

ONE, 5: e14281.

Lisiewska, Z., W. Kmiecik and A. Korus. 2006. Content of vitamin C, carotenoids,

chlorophylls and polyphenols in green parts of dill (Anethum graveolens L.)

depending on plant height. J. Food Compos. Anal., 19: 134-140.

Liso, R.1., M.C. D. Tullio, S. Ciraci, R. Balestrini, N. L. Rocca, L. Bruno, A.

Chiappetta, M.B. Bitonti, P. Bonfante and O. Arrigoni. 2004. Localization of

ascorbic acid, ascorbic acid oxidase, and glutathione in roots of Cucurbita

maxima L. J. Exp. Bot., 55: 2589-97.

Li, T.S.C. 1999. Sea buckthorn: New crop opportunity. In J. Janick (Ed.),

Perspectives on new crops and new uses. Alexandria, VA: ASHS Press.

335337 pp.

Liu, S.W. and T.N. He. 1978. The genus Hippophae from Qing-Zang Plateau. Acta

Phytotax. Sinic. 16: 106-108. (in Chinese).

Loewus, F.A. and M.W. Loewus. 1987. Biosynthesis and metabolism of

ascorbicacid in plants. Crit. Rev. Plant Sci., 5: 101-119.

Lucock, M. 2000. Folic acid: nutritional biochemistry, molecular biology, and role

in disease processes. Mol. Genet. Metab., 71: 121-38.

Lu, R. 1992. Sea buckthorn-A multipurpose plant species for fragile mountains,

ICIMOD Occasional Paper No. 20. Katmandu, Nepal. 62 pp.

183

183

Luwe, M.W.F., U. Takahama and U. Heber. 1993. Role of ascorbate in detoxifying

ozone in the apoplast of spinach (Spinacia oleracea L) leaves. Plant Physiol.,

101: 969-976.

Maite, S. I. Pateraki, F. Chatzopoulou and A.K. Kanellis. 2007. Diferential

expression of the ascorbate oxidase multigene family during fruit development

and in response to stress. Planta, 225: 873-885.

Maoka, T., K. Mochida, M. Kozuka, Y. Ito, Y. Fujiwara, K. Hashimoto, F. Enjo, M.

Ogata, Y. Nobukuni, H. Tokuda and H. Nishino. 2001. Cancer

chemopreventive activity of carotenoids in the fruits of red paprika Capsicum

annuum L. Cancer Lett., 172: 103-109.

Marcus, C.C.W.E. 2005. Sea buckthorn - Hippophae rhamnoides L. A Whole Food

Answer to Better Nutrition. riyasilver.trdinfotech.com/sea buckthorn.htm

Mashkovski, A.D. 1997. Lecarstvennaye Sredstv., Moscow. 625 pp.

Ma, Z., Y. Cui and G. Feng, 1989. Studies on the fruit character and biochemical

compositions of some forms within Chinese sea buckthorn (Hippophaė

rhamnoides subsp. sinensis) in Shanxi, China. Proc. Of int. symp. on sea

buckthorn (H. rhamnoids L.), Xian, China. 106-113 pp.

Mingyu, X., S. Xiaoxuan and C. Jinhua. 2001. The medicinal research on sea

buckthorn. International workshop on sea buckthorn. 18-21 pp.

Mironov, V.A., T.N. Guseva-Denskaya, Y. Dubrovina, G.A. Osipov, E.A.

Shabanova, A.A. Nikulin, N.S. Amirov and I.G. Trubitsina. 1989. Chemical

184

184

composition and biological activity of extracts from sea buckthorn fruit

components. Khim-Farm. Zh., 23: 1357-64. (In Russian).

Moser, O. and A.K. Kanellis. 1994. Ascorbate oxidase of Cucumis melo L. var.

reticulatus: purification, characterization and antibody production. J. Exp. Bot.

45: 717–724.

Nakamura, T., N. Makino and Y. Ogura. 1968. Purification and properties of

ascorbate oxidase from cucumber. J. Biochem. 64: 189-95.

Namitra, K.K., S.N. Archana and P.S. Negi. 2011. Expression of carotenoid

biosynthetic pathway genes and changes in carotenoids during ripening in

tomato (Lycopersiconm esculentum). Food Funct., 2: 168-173.

Naohiro, K. and E. Muneharu. 1996. cDNA cloning and gene expression of ascorbate

oxidase in tobacco. Plant Mol. Biol., 30: 833-837.

Noctor, G. and C.H. Foyer 1998. Ascorbate and glutathione: keeping active oxygen

under control. Annu. Rev. Plant Physiol. Plant Mol. Biol., 49: 249-

279.

Ohkawa, J., N. Okada, A. Shinmyo and M. Takano. 1989. Primary structure of

cucumber (Cucumis sativus) ascorbate oxidase deduced from cDNA sequence:

Homology with blue copper proteins and tissue-specific expression. Proc. Natl.

Acad. Sci. USA, 86: 1239-1243.

Okkema, P.G., S.W. Harrison, V. Plunger, A. Aryana and A. Fire. 1993. Sequence

requirements for myosin gene expression and regulation in Caenorhabditis

elegans. Genetics, 135: 385-404.

185

185

Oomah, B. D. 2003. Sea buckthorn lipids. Li T. S. C., Beveridge T. (Eds). Sea

buckthorn (Hippophaė rhamnoides): Production and utilization. NRC

Research Press, Ottawa, ON. 51-68 pp.

Pan, R., Z. Zhang, Y. Ma, Z. Sun and B. Deng. 1989. The distribution characters of

sea-buckthorn (H. rhamnoides L.) and its research progress in China. Proc. Int.

Symp. Sea-buckthorn (H. rhamnoides L.) Xian, China. 1-16 pp.

Parimelazhagan, T., O.P. Chaurasia, and Z. Ahmed. 2005. Sea buckthorn: Oil with

promising medicinal value. Curr. Sci., 88: 8-9.

Pecker, I., R. Gabbay, F.X. Cunningham and J. Hirschberg. 1996. Cloning and

characterization of the cDNA for lycopene beta-cyclase from tomato reveals

decrease in its expression during fruit ripening. Plant Mol. Biol., 30: 807-819.

Pignocchi, C., J.M. Fletcher, J.E. Wilkinson, J. Barnes and C.H. Foyer. 2003. The

function of ascorbate oxidase in tobacco (Nicotiana tabacum L.). Plant

Physiol., 132: 1631-1641.

Pignocchi, C. and C.H. Foyer. 2003. Apoplastic ascorbate metabolism and its role in

the regulation of cell signalling. Curr. Opin. Plant Biol., 6: 379-389.

Pintea, A., A. Marpeau, M. Faye, C. Socaciu and M. Gleizes. 2001. Polar lipid and

fatty acid distribution in carotenolipoprotein complexes extracted from sea

buckthorn fruits. Phytochem. Anal., 12: 293-298.

Pintea, A., A. Varga, P. Stepnowski, C. Socaciu, M. Culea and H.A. Diehl. 2005.

Chromatographic analysis of carotenol fatty acid esters in Physalis alkekengi

and Hippophae rhamnoides. Phytochem. Anal., 16: 188-195.

186

186

Plekhanova, M.N. 1988. A report on Sea buckthorn in Russia. 77 pp.

Potters, G., N. Horemans, R.J. Caubergs and H. Asard. 2000. Ascorbate and

dehydroascorbate influence cell cycle progression in tobacco cell suspension.

Plant Physiol., 124: 17-20.

Raffo, A., F. Paoletti and M. Antonelli. 2004. Changes in sugar, organic acid,

flavonol and carotenoid composition during ripening of berries of three sea

buckthorn (Hippophae rhamnoides L.) cultivars. Eur. Food Res. Technol., 219:

360-368.

Rafael, da Silva M., V. Galli, S.D. Dos Anjos E Silva and C.V. Rombaldi. 2014.

Carotenoid biosynthetic and catabolic pathways: Gene expression and

carotenoid content in grains of maize landraces. Nutrients, 6: 546-563.

Rahimv, I.F., L.D. Lebedeva and N.D. Khasanshina. 1983. In: Biol. Chem. Pharm.

of Sea buckthorn Novosibirsk. 109-120 pp.

Raluca, P.M, Y. Weesepoel, C. Socaciu, A. Pintea, J.P. Vincken and H. Gruppen.

2014. Carotenoid composition of berries and leaves from six Romanian sea

buckthorn (Hippophae rhamnoides L.) varieties. Food Chem., 147: 1-9.

Ranjith, A., K.S. Kumar, V.V. Venugopalan, C. Arumughan, R.C. Sawhney and V.

Singh. 2006. Fatty acids, tocols, and carotenoids in pulp oil of three sea

buckthorn species (Hippophae rhamnoides, H. salicifolia, and H. tibetana)

grown in the Indian Himalayas. Am. Oil Chem. Soc., 83: 359-364.

Ravanel, S., H. Cherest, S. Jabrin, D. Grunwald, Y. Surdin-Keran, R. Douce and F.

Re’beille. 2001. Tetrahydrofolate biosynthesis in plants; molecular and

functional characterization of dihydrofolate synthetase and three isoforms

187

187

of folylpolyglutamate synthetase in Arabidopsis thaliana. Proc. Natl. Acad.

Sci. USA, 98: 1560-15365.

Ravanel, S., R. Douce and F. Re’beille 2004. The uniqueness of tetrahydrofolate

synthesis and one-carbon metabolism in plants. In Plant Mitochondria: From

Genome to Function, Day, D.A. Millar, H. and Whelan, J. eds. (Great Britain:

Kluwer). 277-292 pp.

R beill , F., S. Ravanel, S. Jabrin, R. Douce, S. Storozhenko and D. Van Der

Straeten. 2006. Folate in plants: Biosynthesis, distribution and enhancement.

Physiol. Plant, 126: 330-342

Re’beille, F., D. Macherel, J.M. Mouillon, J. Garin and R. Douce. 1997. Folate

biosynthesis in higher plants: purifcation and molecular cloning of a

bifunctional 6-hydroxymethyl-7,8-dihydropterin

pyrophosphokinase/7,8dihydropteroate synthase localized in mitochondria.

EMBO J., 16: 947-957.

Rébeillé, F. and R. Douce. 1999. Folate synthesis and compartmentation in higher

plants. In: Regulation of Primary Metabolic Pathways in Plants. Kruger NJ,

Hill SA, Ratcliffe RG, eds. Dordrecht, Kluwer. 53-99 pp.

Ren, J., H. Gao, J. Zhou, X. Hou and Y. Li. 2013. Molecular cloning and

characterization of ascorbate oxidase gene in non-heading Chinese cabbage.

Russ. J. Plant Physiol., 60: 756-763.

Rodríguez-Trelles F., R. Tarrío and F.J. Ayala. 2006. "Origins and evolution of

spliceosomal introns". Annu. Rev. Genet. 40: 47-76.

188

188

Ronen, G., M. Cohen, D. Zamir, J. Hirschberg. 1999. Regulation of carotenoid

biosynthesis during tomato fruit development: expression of the genes for

Lycopene-epsilon-cyclase is down-regulated during ripening and is elevated in

the mutant Delta. Plant j., 17: 341-51.

Rongsen, L. 1992. Sea buckthorn a multipurpose plant species for Fragile

Mountains. ICIMOD, Khathmando, Nepal. 20: 5-20.

Rongsen, L. 1996. Feasibility study on sea buckthorn development in Pakistan.

ICIMOD, Kathmandu, Nepal.

Ronen, G., L. Carmel-Goren, D. Zamir and J. Hirschberg. 2000. An alternative

pathway to B-formation in plant chromoplasts discovered by map-based

cloning of beta and old-gold color mutations in tomato. Proc. Natl. Acad. Sci.

USA, 97: 11102-11107.

Ronen, G., M. Cohen, D. Zamir and J. Hirschberg. 1999. Regulation of carotenoids

biosynthesis during tomato fruit development: expression gene for Lycopene

epsilon-cyclase is down-regulated during ripening and is elevated in the mutant

delta. The Plant J., 17: 341-351.

Rosch, D., C. Mugge, V. Fogliano and L.W. Kroh. 2004b. Antioxidant oligomeric

proanthocyanidins from sea buckthorn (Hippophae rhamnoides L.) Pomace. J.

Agric. Food Chem., 52: 6712-8.

Rösch, R., M. Bergmann, D. Knorr and L.W. Kroh. 2003. Structure–antioxidant

efficiency relationships of phenolic compounds and their contribution to the

189

189

antioxidant activity of sea buckthorn juice. J. Agric. Food Chem., 51:

42334239.

Rousi, A. and H. Aaulin. 1977. Ascorbic acid content in relation to ripeness in fruit

of six H. rhamnoides clones form pyharanta, SW. Finland. Ann. Agric. Fenn.,

16: 80-87.

Rousi, A. 1965. Observation on the cytology and variation of European and Asiatic

populations of Hippophae rhamnoides. Ann. Bot. Fenn. 2: 1-18.

Rousi, A. 1971. The genus Hippophae L. A taxonomic study. Annales Botanici.

Fennici., 8: 177-227.

Rupert, G.F., A. Wallace, P.D. Fraser, D. Valero, P. Hedden, P.M. Bramley and D.

Grierson. 2002. Constitutive expression of a fruit phytoene synthase gene in

transgenic tomatoes causes dwarfism by redirecting metabolites from the

gibberellin pathway. The Plant J., 8: 693-701.

Russo, C.A.M., N. Takezaki and M. Nei. 1996. Efficiencies of different genes and

tree-building methods in recovering a known vertebrate phylogeny.

Mol. Biol. Evol., 13: 525-536.

Sabir, S.M., H. Maqsood, S.D. Ahmed, A.H. Shah and M.Q. Khan. 2005. Chemical

and nutritional constituents of sea buckthorn (Hipophae rhamnoides ssp.

turkestanica) berries from Pakistan. Ital. J. Food Sci., 17: 455-462.

Sabir, S.M., H. Maqsood, I. Hayat, M.Q. Khan and A. Khaliq. 2005. Elemental and

nutritional analysis of sea buckthorn (Hippophaė rhamnoides spp.

turkestanica) berries of Pakistani origin. J. Med. Food, 8: 518-522.

190

190

Sabir, S.M., S.D. Ahmed and N. Lodhi. 2003. Morphological and biochemical

variation in Hippophaė rhammnoides ssp. turketanica, a multipurpose plant

for fragile mountains of Pakistan. S. Afr. J. Bot., 69: 587-592.

Sabot, I., E. Bergantino and G.M. Giacometti. 2005. Light and oxygenic

photosynthesis: energy dissipation as a protection mechanism against

photooxidation. EMBO Rep., 6: 629-634.

Saitou, N. and M. Nei. 1987. The neighbor-joining method: A new method for

reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425.

Samir, B., S. Storozhenko, P. Mehrshahi, M.J. Bennett, W. Lambert, J.F. Gregory,

K. Schubert, J. Hugenholtz, D. Van Der Straeten and A.D. Hanson. 2008.

Folate biofortification in food plants. Trends Plant Sci., 13: 28-35.

Sandeep, C., D. Olan, M.C. Brett, N. Janet, S.S. Jamie, G.M. Ian, F. Ross, S.P.

Thomas and D.S. James. 2012. Structure of S. aureus HPPK and the

Discovery of a New Substrate Site Inhibitor. PLoS ONE, 7: e29444.

Sanmartin, M., P.D. Drogoudi, T. Lyons, I. Pateraki, J. Barnes and A.K. Kanellis.

2003. Over-expression of ascorbate oxidase in the apoplast of transgenic

tobacco results in altered ascorbate and glutathione redox states and increased

sensitivity to ozone. Planta, 216: 918-928.

Sanmartin, M., I. Pateraki, F. Chatzopoulou and A.K. Kanellis. 2007. Diferential

expression of the ascorbate oxidase multigene family during fruit development

and in response to stress. Planta, 225: 873-885.

Sanja, R. 2007. Vitamin B biosynthesis in plant. Phytochemistry, 68: 1904-1921.

191

191

Schledz, M., S. al-Babili, J. von Lintig, H. Haubruck, S. Rabbani, H. Kleinig and P.

Beyer. 1996. Phytoene synthase from Narcissus pseudonarcissus: functional

expression, galactolipid requirement, topological distribution in chromoplasts

and induction during flowering. Plant J., 10: 781-792.

Schapiro, D.C. 1989. Biochemical studies on some hopeful forms and species of sea

buckthorn in USSR. In: Proceedings first International Symposium on Sea

Buckthorn, Xi’an, china. 64-66 pp.

Schroeder, W.R. and Y. Yao. 1995. Sea buckthorn: A promising multipurpose crop

for Saskatchewan; PFRA Shelterbelt Center, supplementary report. 95-102 pp.

Schroeder, W.R. 1995. Improvement of conservation trees and shrubs. PFRA

Shelterbelt Centre Supp. Rpt., 42: 95-1.

Schoedon, G., U. Redweik, G. Frank, R. Cotton and N. Blau. 1992. Allosteric

characteristics of GTP cyclohydrolase I from Escherichia coli. Eur. J.

Biochem., 210: 561-568.

Scolnik, P.A. and G.E. Bartley. 1994. Nucleotide sequence of an Arabidopsis cDNA

for phytoene synthase. Plant Physiol., 104: 1471-1472.

Scott, J.M., F. Rbeille and J. Fletcher. 2000. Folic acid and folates the feasibility of

nutritional enhancement in plant foods. J. Sci. Food Agric., 80: 795-824.

Shane, R.M. and R.J. Henry. 2008. Genes of folate biosynthesis in wheat. J. Cereal

Sci. 48: 632-638

Shane, R.M., D. Brushett and R.J. Henry. 2008. GTP cyclohydrolase 1 expression

and folate accumulation in the developing wheat seed. J. Cereal Sci. 48:

503512.

192

192

Shane, R.M. and R.J. Henry. 2008. Genes of folate biosynthesis in wheat. J. Cereal

Sci., 48: 632-638

Shazia, A., S.D. Ahmed, A.H. Shah, L. Hassan, S.I. Awan, A. Hamid and F. batool.

2010. Determination of optimum harvesting time for vitamin C, oil and mineral

elements in berries Sea buckthorn (Hippophae rhamnoides). Pak. J. Bot., 42:

3561-3568.

Shukla, S.K., P. Chaudhary, I.P. Kumar, N. Samanta, F. Afrin and M.L. Gupta. 2006.

Protection from radiation-induced mitochondrial and genomic DNA damage

by an extract of Hippophaë rhamnoides. Environ. Mol. Mutagen.,

47: 647-656.

Simrnoff, N. 1996. The function and metabolism of ascorbic acid in plants. Annales

Botanici., 78: 661-669.

Singh, V. 2005. Free radicals diseases anti-oxidants and anti-oxidant properties of

sea buckthorn (Hippophae rhamnoides L.) V. Singh (Ed.), Sea buckthorn

(Hippophae L). A Multipurpose Wonder Plant. Daya Publishing House, India.

3-69 pp.

Smirnoff, N. 1996. The function and metabolism of ascorbic acid in plants. Ann.

Bot., 78: 661-669.

Smirnoff, N. 2000. Ascorbic acid: metabolism and functions of a multi-facetted

molecule. Curr. Opin. Plant Biol., 3: 229-235.

Sperotto, R.A., F.K. Ricachenevsky, A. Waldow Vde and J.P. Fett. 2012. Iron

biofortification in rice: It’s a long way to the top. Plant Sci., 190: 24-39.

193

193

Staffan, C.A. 2009. Carotenoids, Tocochromanols and Chlorophylls in Sea

Buckthorn Berries (Hippophae rhamnoides) and Rose Hips (Rosa sp.)

(Doctoral Thesis report). ISSN: 1652-6880.

Stobdan, T, O.P. Chaurasia, G. Korekar, S. Mundra, Z. Ali, A. Yadav and S.B. Singh.

2010. Attributes of sea buckthorn (Hippophae rhamnoides L.) to meet

nutritional requirements in high altitude. Defence Sci. J., 60: 226-230.

Storozhenko, S., O. Navarrete, S. Ravanel, V. De Brouwer, P. Chaerle, G.F. Zhang,

O. Bastien, W. Lambert, F. Rébeillé and D. Van Der Straeten. 2007.

Cytosolic Hydroxymethyldihydropterin Pyrophosphokinase/Dihydropteroate Synthase from

Arabidopsis thaliana: a specific role in early development and stress response. J Biol. Chem.,

282: 10749-10761.

Stover, P.J. 2004. Physiology of folate and vitamin B12 in health and disease. Nutr.

Rev., 62: S3-12.

Stralsjo, L., H. Ahlin, C.M. Witthoft and J. Jastrebova. 2003. Folate determination

in Swedish berries by radioprotein-binding assay (RPBA) and high

performance liquid chromatography (HPLC). Eur. Food Res. Technol., 216:

264-269.

Suleyman, H., K. Gumustekin, S. Taysi, S. Keles, N. Oztasan and O. Aktas. 2002.

Beneficial effects of Hippophae rhamnoides Lon nicotine induced oxidative

stress in rat blood compared with vitamin E. Biol Pharm. Bull., 25: 11331136.

Suryakumar, G. and A. Gupta. 2011. Medicinal and therapeutic potential of Sea

buckthorn (Hippophae rhamnoides L.). J. Ethnopharmacol., 138: 268-278.

194

194

Tabata, K., K. Oba, K. Suzyki and M. Esaka. 2001. Generation and properties of

ascorbic acid-deficient transgenic tobacco cells expressing antisense RNA for

L-galactono-1,4-lactone dehydrogenase. The Plant J., 27: 139-148.

Tamura, K., M. Nei and S. Kumar. 2004. Prospects for inferring very large

phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci.

USA, 101: 11030-11035.

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar. 2011.

MEGA5: Molecular Evolutionary Genetics Analysis using Maximum

Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol.

Biol. Evol., 28: 2731-9.

Tamara, E. 2010. What’s in Sea Buckthorn: Flavonoids! http://www.mont-

echo.com.

Thompson, J.D.1., D.G. Higgins and T.J. Gibson. 1994. CLUSTAL W: improving

the sensitivity of progressive multiple sequence alignment through sequence

weighting, position-specific gap penalties and weight matrix choice. Nucleic

Acids Res., 22: 4673-80.

Tian, H. 1985. Sea buckthorn. Water and soil conserve. Commun., 2: 5-32.

Tong, Z.J.C., Z. Zhao, Y. Yang and K. Tian. 1989. The determination of the

physical-chemical constants and sixteen mineral elements in raw sea buckthorn

juice. Proc. of Int. Symp. Sea buckthorn (H. rhamnoides L.), Xian, China. 132-

137 pp.

195

195

Tracewell, C.A., A. Cua, D.H. Stewart, D.F. Bocian and G.W. Brudvig. 2001.

Characterization of carotenoid and chlorophyll photooxidation in photosystem

II. Biochem. J., 40: 193-203.

Tuskan, G.A., S. Difazio and S. Jansson et al. 2006. The genome of black

cottonwood, populous trichocarpa (Torr. & Gray). Science, 313: 1596-1604.

Vasileios, F., S. Maite and K.K. Angelos. 2006. Effect of ascorbate oxidase

overexpression on ascorbate recycling gene expression in response to agents

imposing oxidative stress. J. Exp. Bot., 57: 3933-3943.

Velioglu, Y.S., G. Mazza, L. Gao and B.D. Oomah. 1998. Antioxidant activity and

total phenolics in selected fruits, vegetables and grain products. J. Agric.

Food Chem., 46: 4113-4117.

Vijayaraghavan, R., A. Gautam, O. Kumar, S.C. Pant, M. Sharma and S. Singh.

2006. Protective effect of ethanolic and water extracts of sea buckthorn against

the toxic effects of mustard gas. Indian J. Exp. Biol., 44: 821-831.

Virendra, S. 2006. Sea buckthorn (Hippophae L.) a multipurpose wonder plant

Vol. II: Biochem. and Pharmacol.

Wahlberg, K. and N. Jeppsson. 1990. Development of cultivars and growing

techniques for sea-buckthorn, black chokeberry, Lonicera and Sorbus.

Sverigges Lantbruksuniversitedt Balsgård-Avdelningenför Hortikulturell

Växförädling Verksamhetsberättelse. 80-93 pp. (in Swedish, summary in

English).

Waller, J.C., T.A. Akhtar, A. Lara-Núñez, J.F. Gregory, R.P. McQuinn, J.J.

196

196

Giovannoni, A.D. Luciana, C.C., T.M. de Oliveira, A.F. Mendes, A.F.

Macedo, E.I. Floh , A.S. Gesteira, W.S. Soares-Filho and M.G. Costa. 2012.

Ectopic expression of a fruit phytoene synthase from Citrus paradisi Macf.

promotes abiotic stress tolerance in transgenic tobacco. Plant Mol. Biol. Rep.,

39: 10201-10209.

Wang, G., 1987. Comparative study of sea buckthorn oil in the Northern Zone of

China. Journal of Northwest Forest college, 2: 55-60.

Wang, Z.R., L. Wang, H.H. Yin, F.J. Yang, Y.O. Gao and Z.J. Zhang. 2000. Effect

of total flavonoids of Hippophae rhamnoides on contractile mechanics and

calcium transfer in stretched myocyte. Space Med. Med. Eng., 13: 6-9.

Wheeler, G.L., M.A. Jones, N. Smirnoff. 1998. The biosynthetic pathway of vitamin

C in higher plants. Nature, 393: 365-369.

Wolf, D. and F. Wegert. 1993. Experience gained in the cultivation, harvesting and

utilization of sea-buckthorn. In: Cultivation and Utilization of Wild Fruit

Crops. Bernhard Thalacker Verlag GmbH & Co. 23-29 pp. (in German).

Xu, Z. 1956. Studies on sea buckthorn juice. Acta Nutritioni., 1: 334-349.

Yao, Y. and C. Zhu. 1985. Investigation on natural resources of Hippophae

rhamnoides L. in West-Shanxi Plateau. Shansxi Sci. and Tech. of Forestry. 4:

105-119. (in Chinese).

Yao, Y. and P.M.A. Tigerstedt. 1993. Lsozyme studies of genetic diversity and

evolution in Hippophae. Genet Resour. Crop Ev., 40: 153-164.

Yao, Y. and P.M.A. Tigerstedt. 1994. Genetic diversity in Hippophae L. and its use

in plant breeding. Euphytica., 77: 165-169.

197

197

Yao, Y. and P.M.A. Tigerstedt. 1995. Geographic variation of growth rhythm, height

and hardiness and their relations in Hippophaė rhamnoides. J. Am.

Soc. Hortic. Sci., 120: 691-698.

Yang, B., K. Kalimo, L. Mattila, S. Kallio, J. Katajisto, O. Peltola and H. Kallio.

1999. Effect of dietary supplementation with sea buckthorn (Hippophaë rhamnoides) seed and

pulp oils on atopic dermatitis. J. Nutr. Biochem., 10: 622-630.

Yang, B. and H. Kallio. 2002a. Composition and physiological effects of sea

buckthorn (Hippophaė) lipids. Trends Food Sci. Technol., 13: 160-167.

Yang, B. and H. Kallio. 2002b. Effects of harvesting time on triacylglycerols and

glycerophospholipids of sea buckthorn (Hippophaė rhamnoides L.) berries of

different origins. J. Food Compost. Anal., 15: 143-157.

Yang, B and H. Kallio. 2005. Lipophilic components of sea buckthorn (Hippophae

rhamnoides L.) seeds and berries V. Singh (Ed.), Sea buckthorn (Hippophae

L), A Multipurpose Wonder Plant. Daya Publishing House, India. 70-97 pp.

Yang, B. and H. Kallio. 2002. Lipophilic components in seeds and berries of sea

buckthorn and physiological effects of sea buckthorn oils. Trends Food Sci.

Technol., 13: 160-167.

Yang, B. and H. Kallio. 2002. Composition and physiological effects of sea

buckthorn (Hippophae) lipids. Trends Food Sci. Technol., 13: 160-167

Yang, B., R.M. Karlsson, P.H. Oksman and H.P. Kallio. 2001. Phytosterols in sea

buckthorn (Hippophaė rhamnoides L.) berries: Identification and effects of

different origins and harvesting times. J. Agric. Food Chem., 49: 5620-5629.

198

198

Yang, B.R. 2001. Lipophilic components of sea buckthorn (Hippophaė rhamnoides)

seeds and berries and physiological effects of sea buckthorn oils. PhD

dissertation, Turku University, Finland.

Yang, B., M. Ahotupa, P. Maatta and H. Kallio. 2011. Composition and antioxidative

activities of supercritical CO2-extracted oils from seeds and soft parts of

northern berries. Food Res. Int., 44: 2009-2017.

Yang, H., S. Wang and X. Su. 1988. A study on the dynamic variation of ascorbic

acid in Hippophae. Hippophae, 4: 41-44 (in Chinese).

Yoneyama, T., L. Wilson and K. Hatakeyama. 2001. GTP cyclohydrolase I feedback

regulatory protein-dependent and -independent inhibitors of GTP

cyclohydrolase I. Arch. Biochem. Biophys., 388: 67-73.

Yuanxiu, L.X.G., H. Tang, Y. Hou, D. Yu and X. Zhang. 2013. Cloning and

Expression Analysis of an Ascorbate Oxidase (AO) Gene from Strawberry

(Fragaria×ananassa cv. Toyonaka). Journal of Agricultural Sci., 5: 14-22.

Yuzhen, Z. and W. Fuheng. 1997. Sea buckthorn flavonoids and their medicinal

value. Hippophaė., 10: 39-41.

Yu, Z., F. Ao and Y. Lian. 1989. Discussion on the problems of origin, classification,

community and resource of sea-buckthorn in China. Proc. Int. Symp. Sea-

buckthorn (H. rhamnoides L.), Xian, China. 21-30 pp.

Yuanxiu, L., X. Gu, H.Tang, Y. Hou, D. Yu and X. Zhang. 2013. Cloning and

Expression Analysis of an Ascorbate Oxidase (AO) Gene from Strawberry

(Fragaria×ananassa cv. Toyonaka). J. Agr.Sci., 5: 14-22.

199

199

Yu, L., Z. Hong, C. Wei, H. Shao-zhen and L. Qing-chang. 2013. Cloning and

Functional Analysis of Lycopene ε-Cyclase (IbLCYe) Gene from

Sweetpotato, Ipomoea batatas (L.) Lam. Journal of Integ. Agr., 12: 773-780.

Zadernowski, R., H. Nowak-Polakowska, B. Lossow and J.

Nesterowicz., 1997. Sea-buckthorn lipids. J. Food Lipids, 4: 165-172.

Zadernowski, R., M. Naczk, S. Czaplicki, M. Rubinskiene and M. Szalkiewicz.

2005. Composition of phenolic acids in sea buckthorn (Hippophae rhamnoides

L.) berries. J. Am. Oil Chem. Soc., 82: 175-179.

Zar, B.A., L. Zacaryas and M.J. Rodrigo. 2009. Molecular and functional

characterization of a novel chromoplast-specific lycopene β-cyclase from

Citrus and its relation to Lycopene accumulation. J. Exp. Bot., 60: 17831797.

Zeb, A., and I. Malook. 2009. Biochemical characterization of sea buckthorn

(Hippophaė rhamnoides L. spp. turkestanica) seed. Afr. J. Biotechnol., 8:

1625-1629.

Zeb, A. 2004a. Chemical and nutritional constituents of sea buckthorn juice. Pak. J.

Nut., 3: 99-106.

Zeb, A. 2004b. Important therapeutic uses of sea buckthorn (Hippophaė): A review.

J. Biol. Sci., 4: 687-693.

Zhang, W., J. Yan, J. Duo, B. Ren and J. Guo. 1989. Preliminary Study of

Biochemical Constituents of Berry of Sea buckthorn growing in Shanxi

Province and their Changing Trend. In: Proc. of Int. Symp. Sea buckthorn

(Hippophae rhamnoides L.), Xian, China. 96-105 pp.

200

200

Zhang, P. 1989. Anti-cancer activities of sea buckthorn seed oil and its effects on the

weight of immune organs. Sea buckthorn. 2: 31-34.

Zhang, P.X., L.M. Ding and Li. 1989. Anti tumor effects of fruit juice and seed oil

of (Hyppophae rhamnoides L.)and their influences on immune function.

Proc. Int. Symp. Sea buckthorn (H. rhamnoides L.), Xian, China. 373-381 pp.

Zhang, W., J. Yan, J. Duo, B. Ren and J. Guo. 1989. Preliminary study of

biochemical constitutions of berry of sea buckthorn growing in Shanxi

province and their changing trend. Proc. of int. symp. on sea buckthorn (H.

rhamnoides L.), Xian, China. 96-105 pp.

Zhang, Y., J. Xu and N. Yu. 1989. Research on the centrifuge technology of sea

buckthorn juice and oil. Proc. of Int. Symp. on sea buckthorn (H. rhamnoides

L.), Xian, China. 307-310 pp.

Zheng, X.W. and X.J. Song. 1992. Analysis of the fruit nutrient composition of nine

types of sea buckthorn in Liaoning, China North. Fruits of China., 3: 22-

24.

Zhou, X. and C. Chen. 1989. Research on the process technology of turbid type sea

buckthorn beverage. Proceedings of international symposium on sea buckthorn

(H. rhamnoides L.), Xian, China. 310-313 pp.

Zimmermann, M.B. and R.F. Hurrel. 2002. Improving iron, Zinc and vitamin A

nutrition through plant biotechnology. Curr. Opin. Biotechnol., 13: 142-145.

201

201

Zou, L., H. Li, B. Ouyang, J. Zhang and Z. Ye. 2006. Cloning and mapping of genes

involved in tomato ascorbic acid biosynthesis and metabolism. Plant Sci., 170:

120-127.