lable at ScienceDirect

Biomaterials 31 (2010) 9452e9461

Contents lists avai

Biomaterials

journal homepage: www.elsevier .com/locate/biomateria ls

Osteogenesis and angiogenesis of tissue-engineered bone constructed byprevascularized b-tricalcium phosphate scaffold and mesenchymal stem cells

Le Wang a,1, Hongbin Fan b,1, Zhi-Yong Zhang b,1, Ai-Ju Lou c, Guo-Xian Pei b,*, Shan Jiang d,Tian-Wang Mu d, Jun-Jun Qin d, Si-Yuan Chen d, Dan Jin d

a Institute of Orthopaedics and Traumatology, The Third Affiliated Hospital, Guangzhou Medical University, People’s Republic of Chinab Institute of Orthopaedics and Traumatology, Xijing Hospital, The Fourth Military Medical University, Xi’an, People’s Republic of ChinacDivision of Nephrology, Nanfang Hospital, Southern Medical University, People’s Republic of Chinad Institute of Orthopaedics and Traumatology, Nanfang Hospital, Southern Medical University, People’s Republic of China

a r t i c l e i n f o

Article history:Received 8 June 2010Accepted 18 August 2010Available online 24 September 2010

Keywords:Tissue engineeringBone defectVascularizationTricalcium phosphate

* Corresponding author. Tel.: þ86 29 84773524; faxE-mail addresses: wangle8273@163.com (L. Wa

(H. Fan), mr.zhiyong@gmail.com (Z.-Y. Zhang), nfperr1 These authors contributed equally to this study.

0142-9612/$ e see front matter � 2010 Elsevier Ltd.doi:10.1016/j.biomaterials.2010.08.036

a b s t r a c t

Although vascularized tissue-engineered bone grafts (TEBG) have been generated ectopically in severalstudies, the use of prevascularized TEBG for segmental bone defect repair are rarely reported. In currentstudy, we investigated the efficacy of prevascularized TEBG for segmental defect repair. The segmentaldefects of 15 mm in length were created in the femurs of rabbits bilaterally. In treatment group, theosteotomy site of femur was implanted with prevascularized TEBG, which is generated by seedingmesenchymal stem cells (MSCs) into b-TCP scaffold, and prevascularization with the insertion of femoralvascular bundle into the side groove of scaffold; whereas in the control group, only MSC mediatedscaffolds (TEBG) were implanted. The new bone formation and vascularization were investigated andfurthermore, the expression of endogenous vascular endothelial growth factor (VEGF) which mightexpress during defect healing was evaluated, as well. At 4, 8, and 12 weeks postoperatively, the treatmentof prevascularized TEBG led to significantly higher volume of regenerated bone and larger amount ofcapillary infiltration compared to non-vascularized TEBG. The expression of VEGF in mRNA and proteinlevels increased with implantation time and peaked at 4 weeks postoperatively, followed by a slowdecrease, however, treatment group expressed a significant higher level of VEGF than control groupthroughout the whole study. In conclusion, this study demonstrated that prevascularized TEBG byinsertion of vascular bundle could significantly promote the new bone regeneration and vascularizationcompared to non-vascularized TEBG, which could be partially explained by the up-regulated expressionof VEGF.

� 2010 Elsevier Ltd. All rights reserved.

1. Introduction

Although bone has the innate regenerative capability, large bonedefects caused by severe trauma, nonunion fractures or tumorresection usually failed to heal spontaneously due to impairedregeneration capacity [1,2]. In order to achieve the complete heal-ing, bone grafts (autograft or allograft) are required for large defectstreatment in orthopaedic surgery, with more than 500,000 bonegrafting procedures conducted annually in the United States alone[3]. Despite of the promising results, the autograft or allograft

: þ86 29 84775573.ng), Fanhb75@yahoo.com.cny@163.com (G.-X. Pei).

All rights reserved.

transplantations are limited by several problems including limitedsupply, additional surgical time, donor sitemorbidity, long recoveryperiod, and pathogen transfer [4,5]. In recent years, mesenchymalstem cells (MSCs) based tissue-engineered bone grafts (TEBG) haveoffered a promising alternative approach to treat large bone defectswithout many of the undesirable side effects associated withconventional therapies [6e8].

In natural tissue, the distribution of cells is usually limited toa distance of 200 mm away from the nearest capillary, which is theeffective diffusion distance of oxygen and nutrients [9]. Therefore,to generate a capillary network with the capacity to deliver suffi-cient nutrients to cells within the scaffold becomes crucial for thesurvival of cells and the healing efficacy of the TEBG after implan-tation. Usually after the implantation of TEBG, blood vessels fromthe host tissue will invade into the construct. This spontaneousvascularization results from inflammatory response occurred in

Fig. 1. Positive alkaline phosphatase staining (A) (�100) and alizarin red S staining (B) of osteo-differentiated MSCs (�200). (C) Microporous structures of cylindrical b-TCP scaffoldobserved by SEM (�30). Inset of (C) showed gross morphology of scaffold. (D) Schematic outline of preparing prefabricated tissue-engineered bone graft. The femoral vascularbundle was fixed into the side groove of scaffold seeded with MSCs. (E) The prevascularized MSCs/scaffold construct was implanted into the femoral osteotomy site for defect repair.The arrow indicates construct and accompanying nerve. (F) The MSCs/scaffold construct was implanted into the femoral osteotomy site for defect repair. The arrow indicatesconstruct.

L. Wang et al. / Biomaterials 31 (2010) 9452e9461 9453

wound healing. In addition, the hypoxic state of seeded cells inscaffold can also contribute to the vascularization through theendogenous release of angiogenic growth factors [10]. However,this vascular ingrowth is limited to several tenths of micrometersper day, which is too slow to provide adequate nutrients to cells inthe interior part of implant, leading to the compromised healingresults [11]. So, vascularization of TEBG remains a major hurdle toachieve the satisfactory clinical outcome, especially for the trans-plantation of clinically sized, fully viable TEBG.

During the past decade, extensive studies have been carried outto expedite the vascularization process of TEBG. Current strategiesmainly include scaffold design, bioreactor design, angiogenicfactors, and prevascularization procedure [12e14]. Scaffold isspecially designed to combine the angiogenic and osteogenic factordelivery system for bone regeneration. Co-transplantation ofhematopoietic cells and MSCs may improve the regeneration ofvascularized bone. Vascular endothelial growth factor (VEGF)signaling is modulated by the Notch signaling pathway and theinhibition of Notch signaling can enhance regional neo-vascularization by altering the responsiveness of local endothelial

cells to angiogenic stimuli [15e17]. Compared with otherapproaches, prevascularization procedure demonstrated theadvantages to provide instantaneous perfusion after the graft isimplanted, which can dramatically decrease the time required forcapillary ingrowth. In recent year, various procedures of pre-vascularization including muscle vascularized pedicle, periostealflap, arteriovenous loop, and vascular bundle have been combinedwith use of tissue engineering constructs to reconstruct vascular-ized TEBG, which have demonstrated their efficacy for new boneregeneration and rapid capillary network formation throughout theimplants [18e21]. However, only ectopically vascularized tissue-engineered bone has been investigated in these reports. In order toapply this strategy in a clinical setting, where orthotopic bonedefects generally occur, the efficacy of this approach needs to bevalidated in an orthotopic bone defect animal model, especially inload bearing limbs. Furthermore, the underlining mechanism ofangiogenesis during the bone tissue regeneration still remainselusive. Therefore, we conducted a study to evaluate the graftabilityof prevascularized MSC mediated b-tricalcium phosphate (b-TCP)tissue-engineered constructs for segmental bone defects repair. We

Table 1Radiographic grading system.

Grading items Score

Periosteal Reaction* ScoreNone 0Minimal [localized to the gap] 1Medium [extends over the gap; <1/4] 2Moderate [< 1/2 but >3/4] 3Full 4

L. Wang et al. / Biomaterials 31 (2010) 9452e94619454

hypothesize that the prevascularized TEBG can successfully repairlarge bone defects in rabbit model.

In order to prove this hypothesis, the study is designed (1) toprepare a prevascularized TEBG by inserting a vascular bundle intocellular scaffold constructs, (2) to implant this prevascularized TEBGinto a critical-sized segmental defect, (3) to evaluate bone healingand vascular ingrowth of the TEBG, and (4) to examine expression ofVEGF in mRNA and protein levels in regenerated bone tissue.

Osteotomy Site*Osteotomy line completely radiolucent 0Osteotomy line partially radiolucent 2Osteotomy line invisible 4

Remodeling*None apparent 0Intramedullary space 1Intracortical 2

Graft Appearance*Unchanged/intact 0Mild resorption 1Moderate replacement 2Mostly replaced 3Fully reorganized 4

*Proximal, distal, and central part of graft scored individually.

2. Materials and methods

2.1. Isolation, expansion, and differentiation of MSCs

Animal experiment was approved by Institutional Animal Care and UseCommittee of Southern Medical University. All reagents were purchased from Sig-maeAldrich Co. (St. Louis, MO) if not otherwise stated. MSCs were isolated frombone marrow aspirates of New Zealand rabbits (12 weeks old, 2.5e3 kg, n ¼ 64). Inbrief, the bone marrow aspirate was washed three times with Hanks’ balanced saltsolution (HBSS), plated to petri dish and cultured in Dulbecco’s minimum Eagle’smedium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS)(HyClone, USA), 100 U/ml penicillin, and 100 mg/ml streptomycin at 37 �C in 5% CO2

atmosphere [22]. After 72 h, non-adherent cells were removed. When reaching70e80% confluence, adherent cells were trypsinized, harvested, and subcultured inosteogenic medium. The osteogenic mediumwas consisted of DMEM supplementedwith 10% FBS, 50 mg/ml ascorbic acid-2-phosphate, 100 nM dexamethasone, and10 mM b-glycerolphosphate in the presence of 100 U/ml penicillin and 100 mg/mlstreptomycin. After 3 weeks of culture, the osteogenic differentiation of MSCs(passage 3) was confirmed by positive results of alkaline phosphatase and alizarinred S staining (Fig. 1A, B).

2.2. TEBG generation

The cylindrical b-TCP ceramic scaffold was prepared by Biocetis Company (Bercksur Mer, France) via the impregnation of a custom-made organic edifice with b-TCP(Prolabo, France) suspension followed by sintering at 1110 �C [23]. The cylinderscaffold (diameter: 12 mm; length: 15 mm) had a side groove (width: 2 mm) con-necting the central tunnel (diameter: 3 mm), which passed through the scaffoldalong its long axis. This scaffold is highly porous with fully interconnected pore(porosity: 75 � 10%, spherical pores: 530 � 150 mm in diameter, interconnectedchannel: 150 � 50 mm in diameter). The pores are well interconnected with eachother and open into the central tunnel and the outer surface of the scaffold. Themechanics strength of the scaffold was over 2 Mpa (the characteristics of beta-TCPscaffold were showed in supplementary data) (Fig. 1C). The scaffolds were sterilizedby gamma irradiation at 25 kGy and conditioned with DMEM for 1h before cellloading. The osteogenically differentiatedMSCs (passage 3) were harvested from theculture flasks using 0.05% trypsin, counted by hemocytometer, loaded onto b-TCPscaffold (5 � 106 MSCs/scaffold) and cultured overnight for cell adhesion beforeimplantation to construct the TEBG [24].

2.3. Animals and surgical procedures

Sixty-four rabbits were used in this study to compare the defect healing efficacyof the prevascularized TEBG (MSCs mediated scaffold constructs) (Group A, n ¼ 64)and non-prevascularized TEBG (Group B, n ¼ 64). The surgery was performed understrictly aseptic conditions. The bilateral femurs were exposed through a laterallongitudinal incision. The quadriceps muscles were retracted and the entire femoraldiaphysis was exposed. The periosteumwas stripped off the bone using a periostealelevator. A 2.0-mm titanium six-hole plate was then applied to the anterolateralcortex and fixated with four 2.0 mm diameter bicortical screws. Two screws wereinserted on either side of the proposed osteotomy site. Subsequently, the plate waswrapped with circumferential wires to reinforce the fixation. A reciprocating sawwas then used to create a 15 mm-long segment of central diaphysis in each femur.The 15 mm-long femur defect used in this study have been demonstrated as a crit-ical-sized defect by several other studies [25e27]. In Group A, the osteotomy site ofright femur was filled with TEBG prepared from autologous MSCs mediated scaffoldconstructs and prevascularized by elevating the femoral vascular bundle (artery andvein) from the muscular layer and inserting into the side groove of scaffold withproper fixation of suture (Fig. 1D, E). In Group B, the contralateral osteotomy sitewasfilled with TEBG without vascular bundle insertion (Fig. 1F). The incision was closedin two layers. All rabbits were allowed to move freely after surgery without plasterimmobilization.

2.4. X-ray analysis

The rabbits were lightly anesthetized at 2, 4, 8, and 12 weeks postoperatively.Then the standardized anteroposterior and lateral radiographs of femur were taken.

The exposure conditionswere 45 kV,125mA, and 32ms. TheX-rayfilmswere gradedaccording to the scoring system reported by Yang’s group [28]. The scale wascomposed of four categories: (1) the first category evaluated periosteal reactiongraded from 0 to 4 points. (2) The second category evaluated osteotomy line gradedfrom0 to 4 points. (3) The third categoryevaluated remodeling graded from0 to 2. (4)The fourth category evaluated graft appearance graded from 0 to 4 points (Table 1).The proximal, central, and distal part of graft was scored individually. A graft that hadfully consolidated and had completely reorganized would receive a maximum totalscore of 42 points. The X-ray films were scored and compared between groups atdifferent time points.

2.5. Histological and immunohistochemical assessment

2.5.1. Histological analysis of new bone formationAfter X-ray films were taken, the rabbits were sacrificed and regenerated bone

washarvestedat 2, 4, 8, and 12weeks postoperatively. Eight samples fromeach groupwere used for histological and immunohistological assessment. The periosteumwasstripped off. Then, the samples were fixed in 4% buffered paraformaldehyde, decal-cified in 50 mM ethylenediaminetetraacetic acid (EDTA), embedded in paraffin, andsectioned at 5 mmthickness. The slideswere stainedwith hematoxylin and eosin (HE)and Masson’s trichrome staining. Quantification of new bone area was doneaccording to Masson’s trichrome staining. The newly formed bone acquired a bluestain. The bone formation areawasmeasuredusing an image analysis system (Image-Pro Plus software, Media Cybernetics, Silver Spring, USA) coupled to a light micro-scope, and then presented as the percentage of bone area in total cross-sectional area[(bone area/total area) � 100%]. The mean percentage of new bone area was calcu-lated from all sections of each sample and compared between groups [2].

2.5.2. Immunohistochemical analysis of VEGF expressionFor immunohistochemistry staining, endogenous peroxidase was firstly blocked

with hydrogen peroxide before pepsin treatment for 20 min. Monoclonal antibodiesfor VEGF (Abcam, UK) and CD31 (Abcam, UK) were applied for 24 h at 4 �C followedby incubation with biotinylated secondary antibody (Lab Vision Corporation, CA) for30 min. Streptavidin peroxidase was added for 45 min and 3,30-diaminobenzidinewas used as a chromogenic agent. The negative control was set by replacing theprimary antibodies with PBS alone. Counterstaining was done with hematoxylin.The slides were then dehydrated and coverslipped. The results were evaluated bythree individuals who were blinded to the treatments.

2.5.3. Immunohistochemical analysis of vascular regenerationThe number of microvessels at the implantation site was determined by

analyzing the sections immunostained with anti-CD31 antibodies according toreported procedure [2,29]. To limit counting bias, the total number of vessels oncomplete implant sections was recorded with Image-Pro Plus software. A vascularsection was defined as a vessel with a recognizable lumen. Microhemorrhage wasexcluded in vessel count. The cluster of red blood cells without definite surroundinglumen was not regarded as one countable vessel. Any single endothelial cell orcluster of endothelial cells clearly separated from adjacent vessels was considered asone countable vessel. Areas of bleeding and fibrosis were also disregarded. The

Table 2Real-time RT-PCR primer sequences.

Gene Forward Reverse Productsize(bp)

VEGF TGCCCACCGAGGAGTTCA GGCCCTGGTGAGGTTTGAT 60GAPDH AAACTCACTGGCATGGCCTT TTAGCAGCTTTCTCCAGGCG 83

Table 3Summary of radiographic grading score between groups (Data in mean � SD,n ¼ 16).

Post-operation time Group A Group B

2 weeks 4.8 � 1.2* 1.7 � 0.34 weeks 10.8 � 0.6* 7.3 � 0.98 weeks 15.2 � 1.4* 10.2 � 0.712 weeks 20.3 � 1.8* 13.8 � 1.2

*P < 0.05 compared with Group B.

L. Wang et al. / Biomaterials 31 (2010) 9452e9461 9455

evaluationwas performed by three individuals who were blinded to the treatments.They each perform all counts of every sample. Then, their counts were averaged asthe blood vessel count of each sample.

2.6. Real-time quantitative RT-PCR analysis

At 2, 4, 8, and 12 weeks postoperatively, eight samples from each group werecollected. The periosteumwas stripped off. Then, they were snap-frozen and groundinto powder under liquid nitrogen. Total RNA was extracted using RNeasy Mini Kit(Qiagen, Valencia, CA, US) and concentration was determined spectrophotometri-cally. Then, 1 mg RNAwas used to synthesize cDNAwith First Strand cDNA SynthesisKit (GeneCopoeia Inc, USA) according to manufacturer’s instruction. Quantitativereal-time PCR reactions were carried out and monitored with a Stratagene Mx3005Psystem (Stratagene, La Jolla, CA, US). QuantiTect SYBR Green PCR kit (Qiagen,Valencia, CA, US) was used to quantify the transcription level of VEGF gene. Thesequences of primers for GAPDH and VEGF genes were listed in Table 2. The reactionvolume (20 ml) contained 2 ml of cDNA, 10 ml of SYBR Green PCR Master Mix, 0.2 ml ofeach primer, and 8.6 ml of nuclease-free water. Real-time PCR reactions were per-formed at 95 �C for 10 min, followed by 40 cycles of amplification consisting ofdenaturation step at 95 �C for 10 s and extension step at 60 �C for 1 min. A differencein Ct values (DCt) was calculated for each gene by triplicate. The relative quantifi-cation of VEGF genewas determined by using the DDCTmethod. Briefly, the Ct valueof VEGF gene was normalized to GAPDH gene (DCT ¼ CtVEGF � CtGAPDH) andcompared with a calibrator (loaded cells at week 0): DDCT¼ DCtSample � DCtCalibrator.Relative expression (RQ) was calculated using the formula RQ ¼ 2�DDCT.

2.7. Western blot analysis

After stripping off the periosteum, the samples (n¼ 8) from each group at 2, 4, 8,and 12 weeks were snap-frozen and ground into powder under liquid nitrogen.Then, proteins were extracted using a 10-fold excess of RIPA buffer containinga protease inhibitor cocktail for 1 h at 4 �C. Extraction solutions were spun down at14,000 rpm for 30 min in a refrigerated microcentrifuge. Proteins were separated bysodium dodecyl sulfate polyacrylamide gel electrophoresis (12% gels) and trans-ferred to PVDF membranes. Then the membranes were blocked for 2 h using 5%nonfat dry milk and 0.05% Tween 20 in Tris-buffered saline. Thereafter, themembranes were incubated with rabbit anti-VEGF 1:1000 reagents (Santa Cruz,USA) followed by horseradish-peroxidase-linked anti-rabbit IgG peroxidase. Theemitted light was captured on X-ray film after adding Immobilon Western

Fig. 2. Roentgenograph of critical-sized bone defects repair by prevascularized TEBG (Group

chemiluminescent HRP substrate (Millipore, Billerica, MA). To verify that equalamounts of protein were loaded, membranes were stripped and re-probed withrabbit anti-b-actin (Santa Cruz, USA). Formeasuring the optical density of X-ray film,Image-Pro Plus software was used. The expression of VEGF was quantified by therelative intensity. It was calculated by the intensity of VEGF positive band normal-ized to beta-actin positive band in its own group. Then, the relative intensity of blotswas compared between groups.

2.8. Statistical analysis

All data were analyzed using SPSS software and statistically significant valueswere defined as p < 0.05. The data were expressed as mean � standard deviation(SD). Paired t test was used to detect the differences between groups.

3. Results

3.1. Roentgenographic analysis of bone defects repair

After 2 and 4 weeks of implantation, the high-density radio-opaque areas of TEBG were clearly identified at bone defect sites inboth Group A and Group B. At 8 weeks postoperatively, the calci-fication became more evident and newly formed bone connectingboth ends of defects appeared to have been remodeled into corticalbone with a bone marrow cavity in Group A. After 12 weeks, theradio-opaque areas of implants in Group A remained much largerthan those of Group B (Fig. 2). The radiographic grading scoreshowed a time-dependent increase in both groups. The scores ofGroup A increased steeply with the value of 4.8 � 1.2, 10.8 � 0.6,15.2 � 1.4, and 20.3 � 1.8 at 2, 4, 8, and 12 weeks, respectively,which were all significantly higher than those of Group B (Table 3).

A) and non-prevascularized TEBG (Group B) after 2, 4, 8, and 12 weeks postoperatively.

Fig. 3. The gross observation of regenerated bone in prevascularized TEBG (Group A) and non-prevascularized TEBG (Group B) after 12 weeks postoperatively. Note: the arrowspoint to the regenerated bone.

L. Wang et al. / Biomaterials 31 (2010) 9452e94619456

3.2. Gross observation

In agreement with the radiographic results, the gross observa-tion showed that the femur defect repaired with prevascularizedTEBG achieved bony union at 12 weeks after surgery with thenewly formed bone tissue bridging the defect. Although the femurrepaired with non-vascularized TEBG also achieved bony union inGroup B, fibrous connective tissue was observed at the defect site

Fig. 4. Histological observation of regenerated bone in Group A and Group B at 2, 4, 8, and 12bone; NB: native bone; MC: medullary cavity). Note: the dotted rectangles indicate the rep

(as indicated by black arrow head) with less amount of newlyformed bone tissue compared to that of Group A. In addition, theremnants of scaffold were found in Group B (Fig. 3).

3.3. Histological assessment

There was no obvious inflammation found in the TEBG in bothGroup A and Group B. At 2 weeks postoperatively, granulation

weeks postoperatively (HE staining; TCP: tricalcium phosphate; TB: tissue-engineeredair interface.

Fig. 5. Histological observation of newly formed vessels in the regenerated bone of Group A and Group B at 2, 4, 8, and 12 weeks postoperatively (HE staining). Note: the arrowspoint to the newly formed vessels.

L. Wang et al. / Biomaterials 31 (2010) 9452e9461 9457

tissue and newly formed blood vessels invaded into themicro poresof scaffold in both groups. Although there was no abundant newlyformed bone within the scaffolds in these two groups, a thin layerof callus bone (Fig. 4E, indicated as “TB”) was observed in the outersurface of scaffold in Group A. At 4 weeks postoperatively, granu-lation tissue in micro pores began mineralized and new boneformation exhibited in Group A. The degradation of scaffolds couldbe identified from the shrinkage of empty space surrounding thegranulation tissue, which was occupied by the b-TCP materialbefore the decalcification (Fig. 4, indicated as “TCP”). Group Bshowed similar histological changes while with less newly formedbone tissue. After 8 weeks, an endochondral ossification patternshowed endochondral conversion to bone in some parts of thescaffold, and vasculature invasion in the area of newly formed bonein Group A. Because of the regular shape of pores of scaffolds, thenewly formed bone tissue displayed as the spots (Fig. 4 F, N, indi-cated as “TB”) dispersed by the empty space, which was occupiedby beta-TCP scaffold rods before decalcification (Fig. 4 F, N,

Fig. 6. Histological observation of regenerated bone in Group A and Group B at 2, 4, 8, anTB: tissue-engineered bone).

indicated as “TCP”). Based on the findings that less empty spaceswere found in the Group A when compared with Group B after 8weeks, it was deduced that the scaffold might degrade faster inGroup A than Group B. With the absorption of scaffolds, the islandsof newly formed bone began connected and woven bone structureswere presented in Group A. In contrast, most newly formed bonewas still in the region of micro pores of scaffolds in Group B. After12 weeks, with the degradation of most of the scaffolds, newlyformed bone grew and merged extensively in Group A. Althoughsimilar histological changes occurred in Group B, the amount andrate of new bone formation was less and slower than that of GroupA (Figs. 4, 5 and 6). The percentage of new bone tissue in the defectregion increased rapidly with implantation time in both groups.Despite there was no significant difference between groups at 2weeks postoperatively, the percentage of new bone formation inGroup A increased dramatically from 17.9 � 1.8% at 4 weeks, to50.9 � 5.3% at 8 weeks, and 80.7 � 7.5% at 12 weeks, which weresignificantly higher than those of Group B (P < 0.05) (Fig. 7).

d 12 weeks postoperatively (Masson’s trichrome staining; TCP: tricalcium phosphate;

Fig. 7. The percentage of new bone formation in Group A and Group B at 2, 4, 8, and 12weeks postoperatively (Data in mean � SD, n ¼ 8, *p < 0.05).

L. Wang et al. / Biomaterials 31 (2010) 9452e94619458

3.4. Immunohistochemistry assessment

The positive immunohistochemistry staining for VEGF wasfound in newly regenerated tissue in both groups at week 2 post-operatively with more intensive positive staining in Group A thanGroup B. The intensity of positive VEGF staining increased withtime and peaked at week 4, and remained less VEGF staining inGroup B compared to Group A. In addition, it was found that thevascular endothelial cells and osteoblasts adjacent to the newlyformed woven bone expressed VEGF actively. At week 8 and 12,there was a dramatical decrease of positive VEGF staining.However, the positive staining of VEGF in Group B remained lessintensive than that of Group A (Fig. 8).

3.5. Quantification of vascular regeneration

The vascular regeneration was examined by the CD31 specificstaining of endothelial cells in newly formed vessels (Fig. 9). Asearly as the second week, capillary vessels arising from the inserted

Fig. 8. Histological observation of regenerated bone by immunohistochemistry staining spe

vascular bundle were observed in the core area of the implant inGroup A. Vessels infiltrated from the surrounding muscular tissuewere found at the periphery of the implants in both groups. Due tothe prevascularization, the density of CD31 positive stained capil-lary vessels increased steeply with time in Group A with thecalculated numbers of 76� 6, 254�12, 350� 16, and 506� 20 at 2,4, 8, and 12 weeks, respectively. Whereas, in Group B withoutprevascularization, vessels were mainly localized at the peripheryof the implants during the examination and the numbers of capil-lary vessels were significantly less than those of Group A at eachtime point (P < 0.05) (Fig. 10).

3.6. VEGF mRNA and protein expression

The expression of VEGF gene was evaluated by real-timequantitative RT-PCR. The mRNA level of VEGF was dramatically up-regulatedwith 3.9� 0.1 folds and 5.3� 0.2 folds at 2 and 4weeks inGroup A, respectively. Thereafter, it decreased with 3.5 � 0.2 foldsand 3.1�0.1 folds at 8 and 12weeks, respectively. The transcriptionin Group B showed the similar trend with significantly lower levelscompared to those of Group A at each time point (Fig. 11).

The protein expression of VEGF was analyzed to indicatevascularization in newly formed bone. The VEGF was prominentlyexpressed throughout the implantation time in both groups. Therelative intensity of bands in Group A reached a peak value with85 � 4% at 2 weeks postoperatively. Thereafter, it decreased withimplantation time. The values were 63� 3% and 53� 3% at 8 and 12weeks, respectively. At all time points, the values of VEGF protein inGroup A were significantly higher than those of Group B (Fig. 12).

3.7. Complications

Three rabbits in Group B and one rabbit in Group A experiencedinternalfixation failurewithin 3weeks after implantation. One rabbitinGroupAhadtobeeuthanizedduetoaseverewound infection.Theywere replaced in the study. No other hardware failure, woundbreakdown or self-mutilationwas found throughout this study.

4. Discussion

The principles of flap prevascularization have been applied toprepare axially vascularized bone graft for many years [30,31].

cific for VEGF in Group A and Group B at 2, 4, 8, and 12 weeks postoperatively (�200).

Fig. 9. Histological observation of newly formed vessels by immunohistochemistry staining specific for CD31 in Group A and Group B at 2, 4, 8, and 12 weeks postoperatively(�400). Note: the arrows point to the newly formed vessels.

L. Wang et al. / Biomaterials 31 (2010) 9452e9461 9459

Although this technique works well in practice, a major disadvan-tage is the potential donor site morbidity [32]. The current advancein microsurgery facilitates the free distant transfer of revascular-ized bone grafts by immediately anastomosing the nutrient vessels.Such bone grafts retain their intrinsic blood supply and preserveviability [33]. Vascular bundle has been used to prevascularizeTEBG and proved to be a safe, simple, and effective way [34e36].However, most of these studies concentrate on ectopic vascularizedtissue-engineered bone formation instead of orthotopic bonedefect repair in load bearing limbs. Therefore, the efficacy of pre-vascularized TEBG with vascular bundle insertion for segmentalfemoral defect repair was investigated in this study. The resultsindicated that the implantation of prevascularized TEBG couldresult in faster capillary vessel infiltration in the defect region andmore bone regeneration with concurrently higher up-regulation ofVEGF expression, when compared to the non-vascularized TEBG.

In this study, direct vascular insertion has helped to enhanceangiogenesis and osteogenesis of TEBG in vivo. With regard to theangiogenesis, the number of capillary vessels in Group A was

Fig. 10. The number of vascular sections in Group A and Group B at 2, 4, 8, and 12weeks postoperatively (Data in mean � SD, n ¼ 8, *p < 0.05).

significantly higher than that in Group B, keeping consistent withPelissier P et al’ report that vascular insertion in the central areaof theimplants significantly increased the vascularization throughout thewhole grafts, while in the absence of inserted vascular bundle,vascular infiltration from peripheral muscular tissue failed to reachthat central region [37]. Furthermore, our study demonstrateda rapid increase of vascular structure found in the defect region from2 to 12 weeks postoperatively and a similar trend of new boneregeneration rate, which is inline with the findings of Divakov et al.[38]. The rate and morphology of bone ingrowth in Group B isconsistent with other reports [39,40], demonstrating the osteo-conductivity and osteoinductivity cellar scaffold constructs. Thesefindings indicated the degree of vascularization might havea profound influence on the rate of newbone regeneration, as shownby many other studies [12,31,32,34]. In prevascularized scaffold, theinserted vascular bundle sprouted a capillary vessel network in thepores of scaffold,whichmighthelp to increase the initial survival andengraftment of transplanted cells and the follow-up mineralizationand new bone regeneration [41], as shown that majority of the new

Fig. 11. Transcription level VEGF gene in Group A and Group B at 2, 4, 8, and 12 weekspostoperatively (Data in mean � SD, n ¼ 8, *p < 0.05).

Fig. 12. Protein expression of VEGF gene in Group A and Group B at 2, 4, 8, and 12weeks postoperatively (Data in mean � SD, n ¼ 8, *p < 0.05).

L. Wang et al. / Biomaterials 31 (2010) 9452e94619460

bone formed central region located close to the inserted vessels [42].In clinical application, the vascular bundle implantation has beenconducted for revascularization in necrotic bone such as in avascularnecrosis of the femoral head and carpal bones [38]. However, theexact molecular mechanism of using vascular bundle insertion toenhance angiogenesis and osteogenesis remains uncertain.

Angiogenesis is definedas theprocessbywhichnewbloodvesselsare produced by sprouting from established vessels. It is regulatedthrougha complex interplayofmolecular signalsmediatedbygrowthfactors involving extracellular matrix remodeling, endothelial cellmigration and proliferation, capillary differentiation and anasto-mosis. Angiogenesis is essential for delivery of oxygen, nutrients,soluble factors, and numerous cell types required for reparativeprocesses of bone healing. VEGF is a vital angiogenic factor because itregulates the budding and growth of new vessels from existingvascular structures [43]. It is predominantly produced in tissues thatacquire new capillary networks [44], and the importance of VEGFduring angiogenesis has been demonstrated in gene knockoutstudies. Homozygous Vegfa knockoutmice die at embryonic days E8-E9, and mice lacking a single Vegfa allele die at days E11eE12, due todeficient endothelial cell development and lack of blood vessels [45].Invitro and invivo studieshavedemonstrated thatVEGFcanpromoteendothelial cell survival, proliferation, migration, and vascularizationduring endochondral bone formation [46,47].

VEGF, as a critical regulator in physiological angiogenesis, playsa significant role in skeletal growth and repair. VEGF was expressedby osteoblasts during membranous bone repair in vivo [48] andimmunolocalized in proliferating osteoblasts near the osteotomyfront within the fracture callus [49]. The mRNA and proteinexpression of VEGF usually up-regulated during the early phase offracture repair [50]. In present study, vascular endothelial cells andosteoblasts showed intensive VEGF positive staining. The rate ofdifferentiation of MSCs to osteoblasts was reported to be sophisti-catedly regulated by endothelial cells, which initiated the recruit-ment of osteoprogenitor cells at sites of bone remodeling andmaintained them in a pre-osteoblastic stage [51]. In addition, it wasreported that VEGF can lead to an up-regulation of BMP-2 inendothelial cells, indicating the intricate signaling pathways regu-lating the interactive relationship between endothelial cells andcells of the osteoblastic lineage [52]. In this study, Group A showedmore intensive VEGF specific staining together with significantlyhigher amount of capillary vessels, which may be attributed to

increased growth factor release or delivered oxygen and nutrientsbrought by the vascular bundle insertion [37].

In this study, we observed a different expression pattern of VEGFfrom the growth of capillary vessels and new bone regeneration.VEGF expression peaked at 4 weeks and decreased thereafter,whereas both capillary vessels and new bone regeneration main-tain a continuous increase from 2 to 12 weeks. An up-regulation ofVEGF prior to the vessel formation is thought to be part of the earlyevents in the full process of new bone regeneration [53,54]. Inagreement with our study, Ohtsubo et al. reported a similar findingthat VEGF was only highly expressed in the early stages then itsexpression level gradually decreased, and followed by the occur-rence of angiogenesis at a more mature stage [50].

5. Conclusions

This study demonstrated that prevascularization of TEBG byvascular bundle insertion could augment new bone production andcapillary vessel formation with up-regulated expression of VEGF inthe early stage of defect healing. The prevascularization procedurepresents a fast and effective way to promote the osteogenesis andangiogenesis of TEBG, with great clinical potentials for the largebone defect treatment.

6. Disclosures

There was 1) No direct ownership of equity or shares in a healthcare or pharmaceutical company relating to the manuscript, by anyauthor or their immediate family members. 2) No receipt of anyform of income by any author or their immediate family membersfrom health care or pharmaceutical companies related to themanuscript within the calendar year preceding original submis-sion. 3) No personal interest such as being an expert witness, publicadvocate, grantee, consultant, founder, owner, or employee ofa health care or pharmaceutical company related to the research.

Acknowledgements

This work was supported by National Natural Science Founda-tion of China (U0732003, 30600643, 30872638, 30900311) andMajor State Basic Research Development Program of China(2009CB930000). Young researchers funded project of GuangzhouMedical University ([2010]1; 2010Y01).

Appendix. Supplementary data

Supplementary data associated with this article can be found, inthe on-line version, at doi:10.1016/j.biomaterials.2010.08.036.

Appendix

Figures with essential colour discrimination. Figs. 1, 3-6, 8 and 9in this article have parts that are difficult to interpret in black andwhite. The full colour images can be found in the on-line version, atdoi:10.1016/j.biomaterials.2010.08.036.

References

[1] Kim HS, Jahng JS, Han DY, Park HW, Chun CH. Immediate ipsilateral fibulartransfer in a large tibial defect using a ring fixator. A case report. Int Orthop1998;22:321e34.

[2] Jeon O, Song SJ, Kang SW, Putnam AJ, Kim BS. Enhancement of ectopic boneformation by bone morphogenetic protein-2 released from a heparin-conju-gated poly(L-lactic-co-glycolic acid) scaffold. Biomaterials 2007;28:2763e71.

[3] Greenwald AS, Boden SD, Goldberg VM, Khan Y, Laurencin CT, Rosier RN.Bone-graft substitutes: facts, fictions, and applications. J Bone Jt Surg Am2001;83-A(Suppl. 2 Pt 2):98e103.

L. Wang et al. / Biomaterials 31 (2010) 9452e9461 9461

[4] Bucholz RW. Nonallograft osteoconductive bone graft substitutes. Clin Orthop2002;395:44e52.

[5] Delong Jr WG, Einhorn TA, Koval K, McKee M, Smith W, Sanders R, et al. Bonegrafts and bone graft substitutes in orthopaedic trauma surgery. A criticalanalysis. J Bone Jt Surg Am 2007;89:649e58.

[6] Fan H, Liu H, Zhu R, Li X, Cui Y, Hu Y, et al. Comparison of chondral defectsrepair with in vitro and in vivo differentiated mesenchymal stem cells. CellTransplant 2007;16:823e32.

[7] Khan Y, Yaszemski MJ, Mikos AG, Laurencin CT. Tissue engineering of bone:-material andmatrix considerations. J Bone Jt SurgAm2008;90(Suppl. 1):36e42.

[8] Marcacci M, Kon E, Moukhachev V, Lavroukov A, Kutepov S, Quarto R, et al.Stem cells associated with macroporous bioceramics for long bone repair: 6-to7-year outcome of a pilot clinical study. Tissue Eng 2007;13:947e55.

[9] Lovett M, Lee K, Edwards A, Kaplan DL. Vascularization strategies for tissueengineering. Tissue Eng Part B Rev 2009;15:353e70.

[10] Rouwkema J, Rivron NC, Van Blitterswijk CA. Vascularization in tissue engi-neering. Trends Biotechnol 2008;26:434e41.

[11] LaschkeMW,Harder Y, AmonM,Martin I, Farhadi J, Ring A, et al. Angiogenesis intissue engineering: breathing life into constructed tissue substitutes. Tissue Eng2006;12:2093e104.

[12] Akita S, Tamai N, Myoui A, Nishikawa M, Kaito T, Takaoka K, et al. Capillaryvessel network integration by inserting a vascular pedicle enhances boneformation in tissue-engineered bone using interconnected porous hydroxy-apatite ceramics. Tissue Eng 2004;10:789e95.

[13] Dutt K, Sanford G, Harris-Hooker S, Brako L, Kumar R, Sroufe A, et al. Three-dimensionalmodel of angiogenesis: coculture of human retinal cells with bovineaortic endothelial cells in the NASA bioreactor. Tissue Eng 2003;9:893e908.

[14] Zisch AH, Lutolf MP, Hubbell JA. Biopolymeric delivery matrices for angiogenicgrowth factors. Cardiovasc Pathol 2003;12:295e310.

[15] Cao L, AranyPR,WangYS,MooneyDJ. Promoting angiogenesis viamanipulationof VEGF responsiveness with notch signaling. Biomaterials 2009;30:4085e93.

[16] Huang YC, Kaigler D, Rice KG, Krebsbach PH, Mooney DJ. Combined angio-genic and osteogenic factor delivery enhances bone marrow stromal cell-driven bone regeneration. J Bone Miner Res 2005;20:848e57.

[17] Moioli EK, Clark PA, Chen M, Dennis JE, Erickson HP, Gerson SL, et al. Syner-gistic actions of hematopoietic and mesenchymal stem/progenitor cells invascularizing bioengineered tissues. PLoS One 2008;3:e3922.

[18] Hokugo A, Kubo Y, Takahashi Y, Fukuda A, Horiuchi K, Mushimoto K, et al.Prefabrication of vascularized bone graft using guided bone regeneration.Tissue Eng 2004;10:978e86.

[19] Kneser U, Polykandriotis E, Ohnolz J, Heidner K, Grabinger L, Euler S, et al.Engineering of vascularized transplantable bone tissues: induction of axialvascularization in an osteoconductive matrix using an arteriovenous loop.Tissue Eng 2006;12:1721e31.

[20] Kocman AE, Kose AA, Karabagli Y, Baycu C, Cetin C. Experimental study onaxial pedicled composite flap prefabrication with high density porous poly-ethylene implants: medporocutaneous flap. J Plast Reconstr Aesthet Surg2008;61:306e13.

[21] Vögelin MDE, Jones NF, Lieberman JR, Baker JM, Tsingotjidou AS, Brekke JH.Prefabrication of bone by use of a vascularized periosteal flap and bonemorphogenetic protein. Plast Reconstr Surg 2002;109:190e8.

[22] Fan H, Liu H, Wang Y, Toh SL, Goh JC. Development of a silk cable-reinforcedgelatin/silk fibroin hybrid scaffold for ligament tissue engineering. CellTransplant 2008;17:1389e401.

[23] Descamps M, Duhoo T, Monchau F, Lu J, Hardouin P, Hornez JC, et al. Manu-facture of macroporous b-tricalcium phosphate bioceramics. J Eur Ceram Soc2008;11:149e57.

[24] Liu Y, Pei G, Jiang S. New porous beta-tricalcium phosphate as scaffold for bonetissue engineering. Zhongguo Xiu Fu Chong JianWai Ke Za Zhi 2007;21:1123e7.

[25] Yoneda M, Terai H, Imai Y, Okada T, Nozaki K, Inoue H, et al. Repair of anintercalated long bone defect with a synthetic biodegradable bone-inducingimplant. Biomaterials 2005;25:5145e52.

[26] Gil-Albarova J, Salinas AJ, Bueno-Lozano AL, Román J, Aldini-Nicolo N, García-Barea A, et al. The in vivo behavior of a solegel glass and a glass-ceramic duringcritical diaphyseal bone defects healing. Biomaterials 2005;26:4374e82.

[27] Yoon SJ, Park KS, Kim MS, Rhee JM, Khang G, Lee HB. Repair of diaphysealbone defects with calcitriol-loaded PLGA scaffolds and marrow stromal cells.Tissue Eng 2007;13:1125e33.

[28] Yang CY, Simmons DJ, Lozano R. The healing of grafts combining freeze-driedand demineralized allogeneic bone in rabbits. Clin Orthop Relat Res1994;298:286e95.

[29] Henno S, Lambotte JC, Glez D, Guigand M, Lancien G, Cathelineau G. Charac-terisation and quantification of angiogenesis in beta-tricalcium phosphate

implants by immunohistochemistry and transmission electron microscopy.Biomaterials 2003;24:3173e81.

[30] Khouri RK, Upton J, ShawWW. Principles of flap prefabrication. Clin Plast Surg1992;19:763e71.

[31] Tan H, Yang B, Duan X, Wang F, Zhang Y, Jin X, et al. The promotion ofthe vascularization of decalcified bone matrix in vivo by rabbit bonemarrow mononuclear cell-derived endothelial cells. Biomaterials2009;30:3560e6.

[32] Tu YK, Yen CY, Yeh WL, Wang IC, Wang KC, Ueng WN. Reconstruction ofposttraumatic long bone defect with free vascularized bone graft. Acta OrthopScand 2001;72:359e64.

[33] Taylor GI, Miller GD, Ham FJ. The free vascularized bone graft: a clinicalextension of microvascular technique. Plast Reconstr Surg 1975;55:533e44.

[34] Gill DR, Ireland DC, Hurley JV, Morrison WA. The prefabrication of a bone graftin a rat model. J Hand Surg 1998;23:312e21.

[35] Lee JH, Cornelius CP, Schwenzer N. Neo-osseous flaps using demineralizedallogeneic bone in a rat model. Ann Plast Surg 2000;44:195e204.

[36] RabieAB, ShumL,ChayanupatkulA.VEGFandboneformation in theglenoid fossaduring forword mandibular positioning. Am J Orthod Dentofacial Orthop2002;122:202e9.

[37] Pelissier P, Villars F, Mathoulin-Pelissier S, Bareille R, Lafage-Proust MH,Vilamitjana-Amedee J. Influences of vascularization and osteogenic cells onheterotrophic bone formation within a madreporic ceramic in rats. PlastReconstr Surg 2003;111:1932e41.

[38] Divakov MG. Revascularization of avascular spongy bone and head of thefemur in transplantation of vascular bundle (An experimental and clinicalstudy). Acta Chir Plast 1991;33:114e25.

[39] Wang C, Wang Z, Li A, Bai F, Lu J, Xu S, et al. Repair of segmental bone-defect ofgoat’s tibia using a dynamic perfusion culture tissue engineering bone. J BiomedMater Res A 2010;92:1145e53.

[40] Jang BJ, Byeon YE, Lim JH, Ryu HH, Kim WH, Koyama Y, et al. Implantation ofcanine umbilical cord blood-derivedmesenchymal stem cellsmixedwith beta-tricalcium phosphate enhances osteogenesis in bone defect model dogs. J VetSci 2008;9:387e93.

[41] Lokmic Z, Stillaert F, Morrison WA, Thompson EW, Mitchell GM. An arterio-venous loop in a protected space generates a permanent, highly vascular,tissue-engineered construct. FASEB J 2007;21:511e22.

[42] Polykandriotis E, Arkudas A, Beier JP, Hess A, Greil P, Papadopoulos T, et al.Intrinsic axial vascularization of an osteoconductive bone matrix by means ofan arteriovenous vascular bundle. Plast Reconstr Surg 2007;120:855e68.

[43] Ferrara N. Molecular and biological properties of vascular endothelial growthfactor. J Mol Med 1999;77:527e43.

[44] Shweiki D, Itin A, Neufeld G, Gitay-Goren H, Keshet E. Patterns of expression ofvascular endothelial growth factor (VEGF) and VEGF receptors in mice suggesta role in hormonally regulated angiogenesis. J Clin Invest 1993;91:2235e43.

[45] Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M, et al.Abnormal blood vessel development and lethality inembryos lacking a singleVEGF allele. Nature 1996;380:435e9.

[46] Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. NatMed 2003;9:669e76.

[47] Roberts WG, Palade GE. Increased microvascular permeability and endothelialfenestration induced by vascular endothelial growth factor. J Cell Sci1995;108:2369e79.

[48] Steinbrech DS, Mehrara BJ, Saadeh PB, Greenwald JA, Spector JA, Gittes GK,et al. VEGF expression in an osteoblast-like cell line is regulated by a hypoxiaresponse mechanism. Am J Physiol, Cell Physiol 2000;278:C853e60.

[49] Saadeh PB, Mehrara BJ, Steinbrech DS, Dudziak ME, Greenwald JA, Luchs JS,et al. Transforming growth factor-b1 modulates the expression of vascularendothelial growth factor by osteoblasts. Am J Physiol, Cell Physiol1999;277:C628e37.

[50] Ohtsubo S, Matsuda M, Takekawa M. Angiogenesis after sintered boneimplantation in rat parietal bone. Histol Histopathol 2003;18:153e63.

[51] Meury T, Verrier S, Alini M. Human endothelial cells inhibit BMSC differen-tiation into mature osteoblasts in vitro by interfering with osterix expression.J Cell Biochem 2006;98:992e1006.

[52] Bouletreau PJ, Warren SM, Spector JA, Peled ZM, Gerrets RP, Greenwald JA,et al. Hypoxia and VEGF up-regulate BMP-2 mRNA and protein expressioninmicrovascular endothelial cells: implications for fracture healing. PlastReconstr Surg 2002;109:2384e97.

[53] Carano RA, Filvaroff EH. Angiogenesis and bone repair. Drug Discov Today2003;8:980e9.

[54] Gerber HP, Ferrara N. Angiogenesis and bone growth. Trends Cardiovasc Med2000;10:223e8.