Online Genomics & Bioinformatics...
Transcript of Online Genomics & Bioinformatics...
![Page 1: Online Genomics & Bioinformatics Trainingbgc-genomics.com/BGC_OnlineTraining2_Brochure_2020_Rshd.pdfISO 15189:2012 “Bringing the Experts from Genomics and Computer Science” After](https://reader033.fdocuments.net/reader033/viewer/2022043007/5f92d10bebd5f263c90f2949/html5/thumbnails/1.jpg)
Online Genomics & Bioinformatics Training
Modules Date Topic Fee (INR) without
GST
Sequencing Technologies (Lectures/Demo/Hands-On)
Module 1 18/05/2020 Introduction to Genomics Complementary
Module 2 19/05/2020Short Read Sequencing Technology:
Illumina/IonTorrent1,000
Module 3 20/05/2020Short Read Sequencing Technology:
Illumina/IonTorrent1,000
Module 4 21/05/2020Long Read Sequencing Technology –
PacBio and Nanopore1,000
Bioinformatics (Lectures/Demo/Hands-On)
Module 5 22/05/2020Introduction to Bioinformatics and NGS
Data Analysis
Complementary
for Data Analysis
Modules
Module 6 23/05/2020Whole Genome Sequencing (WGS)
Analysis3,000
Module 7 25/05/2020 Transcriptome/RNA Seq Analysis3,000
Registration Together for
Module 2 & 3
Phone No:
+91-6364335551
Email:
ISO 15189:2012
“Bringing the Experts from Genomics and Computer Science”
After receiving an outstanding response to our first online training Bengaluru
Genomics Center happily announces the second online training-cum-workshop
by
Certified Medical Genomics Laboratory
Organizing Secretaries:
• Fatima Tuz Zehra, Research Scientist
• Dr Sandeep C Naidu, Research Scientist
Bengaluru Genomics Center (BGC)
Program Director:
Dr. Pruthvi Chakravarthi T,
Chief Executive Officer
Bengaluru Genomics Center (BGC)
Photos: A glimpse of our first on-going online training program
18th May – 25th May, 2020
Technology Partners and
Industry Interaction:
Premas Illumina
Spinco-PacBio
ThermoFisher
Scientific-IonTorrent
![Page 2: Online Genomics & Bioinformatics Trainingbgc-genomics.com/BGC_OnlineTraining2_Brochure_2020_Rshd.pdfISO 15189:2012 “Bringing the Experts from Genomics and Computer Science” After](https://reader033.fdocuments.net/reader033/viewer/2022043007/5f92d10bebd5f263c90f2949/html5/thumbnails/2.jpg)
Theme:
The recent advancements in Genomics and Bioinformatics has
revolutionized the field of life sciences. This has led to the
development of various applications to dissect genome, metagenome,
transcriptome and epigenome of humans, animals, fungi, bacteria and
viruses. Today’s scenario in Life Sciences is that any organism can be
sequenced, either cultivable or non-culturable organisms.
There is an urgent need in the industry and the academia for trained,
skilled and committed human resource. BGC is aimed to train young
minds in the area of Genomics and Bioinformatics.
Genomics and Bioinformatics Training Program is the Brainchild of
Prof. Malali Gowda
Objectives:
1. To train skilled human resources towards rapid advancement in the
area of Genomics and Bioinformatics
2.To ignite Genomics research, education and handle big data analysis
Concluded Training Programs:
BGC-The University of Tran-Disciplinary Health Sciences & Technology (TDU): 15
BGC-Sapthagiri Institute of Medical Sciences and Research Centre (SIMSRC): 3
BGC-Adelbert Innovation Research (Cochin): 2
BGC-SelectBIO (Chandigarh): 1
BGC-TDU-ICRISAT (Crop Genomics): 1
BGC-Sir M Visvesvaraya Institute of Technology (Sir MVIT): 1
BGC-Vellore Institute of Technolog (VIT): 1
BGC-Ramaiah Institute of Technology: 1BGC Online “Genomics and Bioinformatics” Internship-Training-cum-Workshop: 1
Registration Link:
https://forms.gle/QWSSD46ngPwgJ9DQ7
Please send a copy of the transaction ID and your details to
Registration starts from: 30.04.2020 (Limited seats)
No refund for cancellation of registration
Payment Mode NEFT (Online):
Name: Bengaluru Genomics Center Pvt. Ltd.
Bank: State Bank of India
Branch: Sahakari Nagar, Bangalore-560092
Account Number: 35545121471
IFSC Code: SBIN0005191
Address:
P-40/2, 2nd Floor, Ramanashree California Garden,
Ananthapura Main Road, Yelahanka, Bangalore - 560064
Computer Support:
• Participants should have laptop with 2 to 4 GB RAM, 500 GB hard
disk, i5 or i7 core processor and Ubuntu 16 or above operating
system.
• Strong internet connection
• Headphones
• We will install all requirements in the Cloud ID. Participants can
access the cloud even if they have Windows operating system.
Website:
http://www.bgc-genomics.com
Organizing Secretary:Fatima Tuz Zehra
Bengaluru Genomics Center (BGC)
Flow Chart: Workflow of DNA Isolation, NGS and Data Analysis
Data Analysis
Sample collection
(Human)
Genomic DNA extraction
and library preparation
Sequencing using NGS
Platforms
ISO 15189:2012Certified Medical Genomics Laboratory
Why Online?
• Flexible learning through webinar on your laptop
• Experts’ guidance for Genomics, Next Generation Sequencing (NGS)
and Bioinformatics
• Easy to understand e-manual to expand your knowledge
• Boost your CV while staying at home
TargetAudience:
All stream of Medical Sciences, Ayurveda/AYUSH, Dental Science,
Neuroscience, Cardiology, Life Sciences, Agriculture, Animal
Husbandry, Wildlife, Pharmacy, Microbiology, Biochemistry,
Biotechnology, Allied Health Sciences and Computer Science
A Glimpse of our Achievements:
• BGC is affiliated with various institutes to conduct trainings on
Genomics and Bioinformatics.
• BGC has trained >1000 participants from India and abroad
(e.g. Germany, Italy, Thailand & Nepal etc.) since 2017.
• BGC has trained >100 interns across India.
We aim at up-regulating the learning potential, skill-sets and job
credibility of our participants through the transformation and
counselling in the fields of Bioinformatics and Genomics.
“Bringing the Experts from Genomics and Computer Science”
Registration Fee
Indian Participants International Participants
Module No.
Amount per Module (INR)
18% GST Total (INR) Amount per Module (USD)
2 to 4 1,000 180 INR 1,180 150
6 & 7 3,000 540 INR 3,540 200
All modules
9,000 1,620 10,620 850
Program Director:
Dr. Pruthvi Chakravarthi T, CEO, Bengaluru Genomics Center (BGC)
ATGCGGCTATGCTTGCGCGCCGCGCGCGATATATAGGGGCCTTAAGCATGCGGCTATGCTTGCGCGCCGCATAGGGGCCTTAAGATAGGGGCCTTAAGCGCGCGCCGCATAGGGGCCTTA
Participants will receive certificate for every module
Note: We regret that we can not give any technical or internet
connectivity assurance.
Module 1 is complementary for all and Module 5 is
complementary for Bioinformatics modules
Computer Programming
for Biologists
Print(DNA_string)
ATGCATGCGGAATTCCATATAGGCC
DNA_lst=list(DNA_string)DNA_lst.count("G")6GC_count=DNA_lst.count("G")+DNA_lst.count("C")
GC_fraction=float(GC_count)/len(DNA_lst)100*GC_frac
Technology Partners and
Industry Interaction:
Premas Illumina
Spinco-PacBio
ThermoFisher
Scientific-IonTorrent
by
18th May – 25th May, 2020
Email:
Phone No:
+91-6364335551