NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an...

34

Transcript of NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an...

Page 1: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.
Page 2: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

NUCLEIC ACIDS REMEMBERED

Page 3: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

TRANSFORMATIONDefinition: process in which genetic characteristics of an organism are

changed due to the absorption of DNA from a lysed bacterial cell.

Griffith’s experiment: proved transformation occurs but did not identify the “transforming agent”

Page 4: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

AVERY, MACLEOD, MCCARTY

Series of experiments to determine transforming factor;

a) Mixed live non-virulent cells with different cell parts individually; only DNA caused transformation

b) Used combinations of DNA components- NO TRANSFORMATION

c) Ribonucleases & proteases – no effect on transformation; deoxyribonucleases inhibited transformation

Conclusion: DNA (whole molecule) transforming factor

Page 5: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

Bacteriophagevirus that infects bacterial cells

Page 6: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

Lederberg & Zinder

TRANSDUCTION Transmission of

genetic material by a virus

Resistant bacteria receive a new gene, transferred by the virus (from 1st host)

Page 7: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

HERSHEY & CHASERadioactive isotopes (sulfur & phosphorus): prove that the DNA of

the phage enters the cell, protein coat remains outside the cell

Page 8: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

LEDERBERG & TATUMConjugation – sexual reproduction in bacteria,

leads to genetic recombination

• 2 strains of DNA grown together – one has traits (A,B,C) other has (D,E,F)

• Cytoplasmic bridge (pilus) forms and cells exchange plasmid

• Offspring (recombinants) have traits of both parents (A,B,C,D,E,F)

Page 9: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA ERWIN CHARGAFF: analyzed nuclei of many

species Base pairing rules (1:1 ratios) Concentration of cytosine & guanine equal Concentration of adenine & thymine equal

ROSALIND FRANKLIN & MAURICE WILKINS‒ X-ray diffraction

WATSON & CRICK‒ DNA Model‒ Proposed semi conservative replication

Page 10: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.
Page 11: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

• Double helix• Double strand of

nucleotides (deoxyribose, phosphate, nitrogen base) held together by H-bonds

• Anti-parallel strands• Purines: adenine &

guanine (double rings)• Pyrimidines: thymine &

cytosine (single rings)

DNA STRUCTURE

Page 12: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

NOTE: # of H-bonds between bases, measurements, anti-parallel strands

Page 13: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.
Page 14: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA REPLICATION

Page 15: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA REPLICATION

Page 16: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA REPLICATION

Page 17: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA REPLICATION

Page 18: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA REPLICATION

Given one strand of DNA, what is the base sequence of the complimentary strand?

ACGTTGCAAGCTGACCTGGTCAG

Page 19: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

REPLICATION MODELS

Page 20: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

MESELSON & STAHL PROVE SEMICONSERVATIVE

REPLICATION

Page 21: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

MESELSON & STAHL PROVE SEMICONSERVATIVE

REPLICATION

DNA has two “heavy” strands

DNA is now hybrid; ½ heavy, ½ light

Page 22: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION

Conservative replication proven wrong.

Semi-conservative & dispersive still possible (all strands hybrids)

Page 23: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION

After another replication (on “light” medium), semi-conservative replication confirmed (1/2 hybrid & ½ light)

Predict the next generation!

Page 24: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.
Page 25: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA replication:- DNA polymerases catalyze the reaction- Hydrolysis of phosphate bonds provides energy

Page 26: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

DNA: anti-parallel strands

• Carbons of deoxyribose numbered 1' - 5'

• Phosphodiester bonds involve the 3' & 5' carbons

• One strand runs 5' to 3'• The other strand runs 3'

to 5'

Page 27: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

1. DNA polymerase elongates DNA strands only in the 5' to 3'direction

2. One new strand, the leading strand, can elongate continuously 5' to 3'as the replication fork continues.

3. The other new strand, lagging strand, grows discontinuously in an overall 3' to 5' direction by adding short Okazaki fragments that are built in a 5' to 3' direction.

4. Ligase connects the Okazakifragments.

Page 28: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

Priming DNA Synthesis

• Polymerase cannot initiate synthesis, it can only add to the end of an already started strand.

• Primase builds RNA nucleotides into a primer.

• RNA primer eventually replaced by DNA nucleotides

Page 29: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

(topoisomerase)

Page 30: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

Summary of DNA Replication

Ligasejoins Okazakifragments

Lagging strand-discontinuous synthesis –Okazaki fragments

Helicase unwindsparental double helix

Topoisomerase stabilizes unwound DNA

Leading strand, continuous synthesis

Page 31: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

• DNA REPLICATION & MAINTENANCE• DNA Polymerase: enzyme which synthesizes single

DNA strand from template DNA (replication)• Whole nucleotides are bonded to complementary

nucleotides to form each new strand.– Trinucleotides are raw materials (ATP, GTP, TTP, CTP)– 2 (high energy bonds) used to accomplish bonding

(energy expensive); AMP, GMP,TMP,CMP bonded to each other by DNA polymerase.

• Other enzymes involved in maintaining DNA structure.– Recognition enzymes (proof reading enzymes) scan DNA

molecule to identify atypical or injured DNA– Endonucleases (restriction enzymes) – breaks DNA above

& below “atypical” sites.– DNA polymerase – synthesizes single strand segments to

replace “damaged” segments.– DNA ligase – binds new segment to old strand.

Page 32: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

ENZYMES WHICH MAINTAIN DNA

•“Scanner” or proofreading enzyme checks DNA for damage

•Endonuclease (restriction enzyme)cuts DNA

•DNA Polymerase adds new nucleotides

•DNA Ligasejoins new nucleotides (S-P)links Okazaki fragments

Page 33: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.

The end-replication problem:

Gap left at the 5’ end of each chromosome.Each end gets shorter with every replication

Telomeres-short nucleotide sequences at the end of each chromosome.- protect the genes- telomerase, present in germ cells, produces telomeres

Humans: TTAGGG

Page 34: NUCLEIC ACIDS REMEMBERED TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA.