NGO MAGAZINE - Nr. 2 (December 2011)

FOUNDERS : EUROPEANCENTERSN7 & CENTER FOREDUCAT IONANDDEVELOPMENT - CED

NGO MAGAZINE

© NGO MAGAZINE - PUBLISHER: EUROPEAN CENTER SN7 & CENTER FOR EDUCATION AND DEVELOPMENT - CED

Editor-in-chief: Daut MEMETI; Editors: Metin MUAREMI, Kaltrina AZIZI, Fatos VELIU, Alma AZIRI, Astrit REXHEPI, Mensure ILJAZI Phone: 00 389 70 523 764; E-mail: [email protected], [email protected]; Web: www.sn7.org.mk/ngomagazine.pdf

A digital edition is an online magazine or online newspaper delivered in electronic form which is formatted identically to the print version.

�A �MAGAZINE�DEDICATED�TO�THE�NGO�SECTOR�–�NR. �2 �/ �DECEMBER�201 1 �

20th - 27th January 2012

MMMMMMMMEEEEEEEETTTTTTTT IIIIIIIINNNNNNNN

MMMMMMMMUUUUUUUUAAAAAAAARRRRRRRREEEEEEEEMMMMMMMM IIIIIIII

PAGE 3PAGE 3PAGE 3PAGE 3

Intercultural learning, ability for the 21st century

FFAATTOOSS VVEELLIIUU


Human Rights - Role of NGOs

KKAALLTTRRIINNAA AAZZIIZZII


How to set up your NGO!?

DECEMBER 2011 NGO MAGAZINE PAGE 2

FOREWORD

Dear readers, you have the second issue of “NGO MAGAZINE” in front of you, with an objective of facilitating dissemination of knowledge and information. Our magazine is proud of its role in facilitating the communication between NGOs and people actively involved in the non-governmental sector in our country and abroad. As a principle of the right for information, our editorial staff expects to accept more and more papers from different kinds of NGOs, youth activists, volunteers, facilitators to share their knowledge and experience with our readers. That’s the purpose of the magazine. Digital edition of the second issue of the “NGO MAGAZINE” (.pdf version) will be distributed in electronic form completely free of any charge. The second issue of the “NGO MAGAZINE” is due to the efforts of many people. Special acknowledgement is dedicated to all the editors, authors and contributors for their great support for helping this happen and making the second issue of the “NGO MAGAZINE” a really true success. Please don't hesitate to contact any of our editorial staff to discuss further professional aspects of their unforgettable experiences. I would like once again to extend my invitation to all people actively involved in the field of the non-governmental sector to publish their papers, works, analysis, case studies in the “NGO MAGAZINE”. We believe in its future and invite you to work and collaborate with us. Your views are welcomed! We hope you enjoy reading this second issue.

Daut MEMETI Editor-in-chief

HHHHHHHHHHHHOOOOOOOOOOOOWWWWWWWWWWWW TTTTTTTTTTTTOOOOOOOOOOOO SSSSSSSSSSSSEEEEEEEEEEEETTTTTTTTTTTT UUUUUUUUUUUUPPPPPPPPPPPP

YYYYYYYYYYYYOOOOOOOOOOOOUUUUUUUUUUUURRRRRRRRRRRR NNNNNNNNNNNNGGGGGGGGGGGGOOOOOOOOOOOO!!!!!!!!!!!!????????????

By: Kaltrina AZIZI

You decided to start an NGO, the procedure is as follows: You have to arrange a founding assembly of the proposed NGO. In the assembly you should mention and elect: aims, objectives, the president, the secretary general and other bodies, statute, working program, members etc. Thereafter you have to go to the Central Registry of the Republic of Macedonia to apply for registration. List of necessary documents needed: application form; act of establishment; statute; working program; name of the president and of the secretary general.

EUROPEAN CENTER SN7 BEGAN IMPLEMENTING THE CYCLE OF DEBATES

KKKnnnooowwwiiinnnggg EEEUUU ttthhhrrrooouuuggghhh cccooonnnvvveeerrrsssaaatttiiiooonnnsss

European Center SN7 began with the implementation and realization of the project, Cycle of Debates “Knowing EU

through conversations". Fatos Veliu, secretary general of the European Center SN7 and project manager of the Cycle of Debates “Knowing EU through conversations", said that the realization of these debates is intended to inform

participants through debates about the establishment and function of the European Union and to learn more about the different values of EU. The first debate was held in Tetovo and had regional character with participants from Macedonia, Kosovo and Serbia. Otherwise, the implementation of the first phase of this project will continue with realization of two other debates in Gostivar and Skopje.

HHHuuummmaaannn��RRRiiiggghhhtttsss��---��RRRooollleee��ooofff��NNNGGGOOOsss

The Government institutions are responsible

for respecting, protecting and promoting

human rights but they are not the only ones

involved in human rights and sustainable

human development. There are other civil

organizations such as human rights NGO’s

and other law related NGO’s, Socio-

economic NGOs, community organizations,

schools, indigenous people’s organizations,

women’s advocacy groups and the media.

They play a crucial role in Monitoring,

protecting and promoting human rights.

Civil society organizations can monitor

Human rights even under extreme or

authoritarian political conditions. NGOs so

are playing a major role in pushing for

sustainable development not only at

international level and national level. NGOs

can carry on their policies and actions on

continuous while government organizations

depend too much on the policy appraisal

sheet. The NGOs can adjust quickly and are

more flexible in the implementation of their

plans and policies. Government

organizations have long line of command,

and it takes a long time to decide on

appropriate strategies or possible changes of

course in the middle of project for human

rights. The government organizations have

to wait for decision making from “above”

which may take weeks, months, or

sometimes and years. NGOs projects are

usually smaller and go fast when compared

to those of the government organizations

where everything has to be done “nationally”

in state. In this sense, the preparation of

“qualified” personnel is more difficult to

meet all the needs. The NGOs can involve

other “actors”, for example, the private

sector, while the government organizations

are more reluctant to do so. To end, I am of

the view that building a strategy for

development and supporting NGOs, for a

better situation in realty and all instruments

should be used to portray the problems and

encourage people to be a part of this

movement.

Fatos

VELIU

IInntteerrccuullttuurraall lleeaarrnniinngg -- aabbii ll iittyy

ffoorr tthhee 2211sstt cceennttuurryy

OUR UNDERSTANDING

We are living on a world of differences. Each

day we are witnessing different changes in

many fields of every human’s lives and

surroundings. It is more dynamically and

complex in the field of science and

education. These various circumstances

request individuals which are flexible and

compatible for different social and

economical changes in societies. The

process of education in Macedonia is still on

the stage, where many projects are

implemented, but most of them are not long

term determined, and the people involved

doesn’t understand learning as an active

process, where the success of it is therefore

largely in the responsibility of the learner. In

different learning processes the learner must

critically reflect to his attitudes and its

behaviours regarding to some universal

principles and values, then he should

understand concepts, analyse and adapt the

knowledge. The last phase it should be about

implementing the different intercultural

education in the real life through different

actions and activities.

OUR SYSTEM

Our formal education system offers a narrow

frame of the knowledge; it is very

theoretically and doesn’t equip the students

with the skills, the methods and knowledge

needed to take committed actions to

improve lives and conditions in their

communities. In many cases those who learn

aren’t prepared for an uncertain world, where

they might not know what the challenges are

going to be, or how they are unfolding. The

situation becomes even harder due the lack

of human capacities to lead groups which

are culturally mixed. The teachers are very

important in this process, because they play

huge role on choosing the right

methodology, where teaching and learning

even though methods are diverse, they still

complete each other. There are some

initiatives on some schools to use

intercultural as main resources for learning,

but due the lack material capacities, they

failed. So according us, human recourses and

the material capacities are two main reasons

to have a successful intercultural education,

which as every other learning process tends

to create humanity.

OUR EXPERIENCE

As leader of an organization that promotes

intercultural learning, where mostly non

formal methods of education are used, we

offer to young women and men from

different regions the opportunity to make a

difference and to contribute to solutions in

their local community. Through our different

projects an individual's cultural and personal

identity depends vitally on his dialogic

relations with others. Intercultural education

plays a vital role in identity formation which

is never an isolated, but always a social-

interactive process. The intercultural ability is

key qualification for each individual in

today’s global world. It helps to realize the

concept of thinking globally and acting

locally. The children who attend in our

activities become very motivated, they

become more responsible, they see learning

as lifelong learning process. Afterward these

individuals become the leader for different

changes within their schools and later in

societies. Through these activities they are

trained to undertake responsibilities for their

self and become more consciousness for the

others, which positively affects their overall

development. Intercultural learning

promotes peace and has to do with

individual development, through cultural

diversity. "Since wars begin in the minds of

men, it is in the minds of men that the

defence of peace must be constructed." This

principle is found in the preamble of the

UNESCO constitution.

Metin

MUAREMI

FUNDS�FOR�NGOs:�GRANTS�AND�RESOURCES�FOR�SUSTAINABILITY�

http://fundsforngos.org is an online initiative, working for the

sustainability of NGOs by increasing their access to donors, resources,

and skills. It uses technology to spread knowledge and increase capacity.


IIMMPPRROOVVEE YYOOUURR

IINNTTEERRCCUULLTTUURRAALL AABBIILLIITTIIEESS

TTHHRROOUUGGHH CCEENNTTEERR FFOORR

EEDDUUCCAATTIIOONN AANNDD

DDEEVVEELLOOPPMMEENNTT -- ((CCEEDD))

Since 2009 Center for Education and Development - (CED) cooperates with Children’s Foundation “Pestalozzi” from Switzerland. Thanks to this cooperation, 20 children from region of Tetovo and Tearce each year, together with “SPPMD” and “MAJKA” can participate on the two weekly exchange children camp in Trogen. During this exchange they attend on different intercultural activities with children from Eastern Europe, learn different social and individual skills and become young leaders in their schools. If you are student between the ages of 22-28 you could apply to the nine monthly programme called empower.

This programme combined by different methods of learning, using non formal education, practical experience aims to strengthen your knowledge, self-awareness and methods of dealing with the diversity. If you are interested to visit the Children’s Village in Trogen, or participate on empower so that you contribute for protecting children rights and become modern warrior of peace, send an email or visit our web site.

BACKGROUND AND DEVELOPMENT:

Mladiinfo-FEJS MK is a NGO organization

from Skopje, which was established in 2003,

as a local office group of European Youth

Press. Its co-founder is Antoaneta Ivanova,

who was familiar with the situation of the

young people in terms of the lack of

information and online access in the field of

the educational and professional

opportunities for advancement worldwide. As

a new generation, facing with

multiculturalism, opened societies and living

in a world where the knowledge of several

languages is almost obligatory and the

intercultural communication becomes a

necessity, the existence of an organisation

and a medium that would enable the

students and young people to become part

of the multicultural world was of huge

importance. Antoaneta was aware of this

problem, especially because of her personal

experience regarding that issue, so she

started the development of the organization,

one of whose major focuses was the

development of the informative web portal

mladiinfo.com (which was founded in 2008),

which would function as an informative

medium in the international experiences,

communication and upgrading field. In 2009

Mladiinfo was chosen in the top five web

portals in the world, providing important

information in the field of the education,

competing among 622 other portals. The

contest World Summit Award was organized

by the UN. Later, in 2010 it was accredited to

function as a hosting organisation for the

EVS-volunteers and so far it performs its

function very successfully, with not less than

three volunteers from Europe, per year. From

2011 onwards, its premises location is in the

National and University Library Sv. Kliment

Ohridski, where various trainings, sessions

and workshops are being held. The same

year it completed a list of 132 projects and

was given the ERSTE foundation award for

social integration.

OBJECTIVES, GOALS AND VISION: The

major function of the organization Mladiinfo

and its web portal is to be a promoter of

projects (played or voluntary), internships,

.

scholarships and fellowships and a mediator

between the young people

researchers and the universities, professors,

university officials the youth NGOs and other

organizations, incorporated in the

educational process of the young people. In

addition it deals with the issues such as

student rights and freedom of

student standards, as well as the issues in the

field of media and communication, as means

of student interaction and gaining

information. That also provided national and

international cooperation of educational

institutions as well as student and

exchange, in addition to international and

national internship and job opportunities.

Since the organization`s portal serves as a

medium, as well, it has also enables additional

communication and exchange of experiences

and ideas. The portal www.mlad

have solved a great deal of the problems the

young people had, regarding the lack of

education information access. That is why

today it has more than 90.000 visits per

month, from all over the world, above 10.000

of which, approximately, subscri

newsletter and on the other side, around 10

universities and organizations per week,

contact the organization for publishing

DECEMBER 2011

AA

The Grant info Center is located in the

new part of the

Kliment Ohridski and it offers direct

information about the content that is

presented on the site. Mladiinfo members

are located here, so they offer help,

regarding the process of applying for a

scholarship, internship, fellowship or

other opportunity presented on the site.

The Grant Info Center it is offers:

promotional materials for the universities

around the world and the possibilities for

education; detailed information about

the scholarships (BA, MA, PhD studies),

fellowships, co

consultation in terms of the process of

application; participating as a sending and

hosting organisation in the volunteering

process; opportunity for various

organizations and the universities to

promote their educational progr

materials for educational events.

contact the organization for p

content. In addition to the info center in

Skopje, Mladiinfo has also its daughter

organizations in Slovakia, Czech Republic and

Montenegro.

spread its network, contacts and its

promotion, as much as possible

encouraging the young people to become a

part of Mladiinfo`s team. At the end,

Mladiinfo`s vision is to participate in the

process of raising awareness and shaping

healthy youth with developed personality and

a greater level of individuality, which would

help to achieve an improvement of the

society.

OTHER ACTIVITIES:

coordinator, mediator and promoter of

novelties in the field of education, Mladiinfo

is involved in other activities, as well. I has

organized a number of workshops

on the improvement of the communication

skills of the young people, their

computerliteracy, their ability to become

successful young leaders and organizers. It

also organizes info

young students to inform themselves

particular scholarship (through presentation

held directly by the representatives of the

organization offering the scholarship). In

addition, there is an article section on the site,

where young people can freely share personal

opinions, something interestin

experienced, or can organize their ideas in a

unique way and creatively express

themselves.

process; moreover, it is actively involved in

this process, participating as a sending and

hosting organization. All in all,

the mentioned activities, Mladiinfo promotes

the ideas of tolerance, preparing the young

people to work in an international

environment, as well as the idea of positive

thinking in an active society, successfully

shaped by the generations to

scholarships and fellowships and a mediator

between the young people, students or

researchers and the universities, professors,

university officials the youth NGOs and other

organizations, incorporated in the

educational process of the young people. In

addition it deals with the issues such as

student rights and freedom of speech,

student standards, as well as the issues in the

field of media and communication, as means

of student interaction and gaining

information. That also provided national and

international cooperation of educational

institutions as well as student and youth

exchange, in addition to international and

national internship and job opportunities.

Since the organization`s portal serves as a

medium, as well, it has also enables additional

communication and exchange of experiences

and ideas. The portal www.mladiinfo.com

have solved a great deal of the problems the

young people had, regarding the lack of

education information access. That is why

today it has more than 90.000 visits per

month, from all over the world, above 10.000

of which, approximately, subscribe to a

newsletter and on the other side, around 10

universities and organizations per week,


DECEMBER 2011 NGO MAGAZINE PAGE

VVOOLLUU

WWIITTHH

The young people that are interested to

visit some European country and do a

voluntary work there can have the

opportunity to do that through Mladiinfo

as their sending organization. Ilija

Dimitrovski is the EVS coordinator from

Macedonia, responsible for the

volunteering projects. So, everyone

interested should just contact the

organization and they will be given the

appropriate information for the

application and the participation process.

THE GRANT INFO CENTER

AABBOOUUTT TTHHEE GGRRAANNTT IINNFFOO CCEENNTTEERR

The Grant info Center is located in the

new part of the National Library St.

Kliment Ohridski and it offers direct

information about the content that is

presented on the site. Mladiinfo members

are located here, so they offer help,

regarding the process of applying for a

scholarship, internship, fellowship or

ther opportunity presented on the site.

The Grant Info Center it is offers:

promotional materials for the universities

around the world and the possibilities for

education; detailed information about

the scholarships (BA, MA, PhD studies),

fellowships, conferences, trainings, etc;

consultation in terms of the process of

application; participating as a sending and

hosting organisation in the volunteering

process; opportunity for various

organizations and the universities to

promote their educational programs;

materials for educational events.


content. In addition to the info center in

Skopje, Mladiinfo has also its daughter

organizations in Slovakia, Czech Republic and

Montenegro. However, its further plans are to

spread its network, contacts and its

promotion, as much as possible, by

encouraging the young people to become a

part of Mladiinfo`s team. At the end,

Mladiinfo`s vision is to participate in the

process of raising awareness and shaping

healthy youth with developed personality and

a greater level of individuality, which would

help to achieve an improvement of the

OTHER ACTIVITIES: Except for the role of

coordinator, mediator and promoter of

novelties in the field of education, Mladiinfo

is involved in other activities, as well. I has

organized a number of workshops working

on the improvement of the communication

skills of the young people, their

computerliteracy, their ability to become

successful young leaders and organizers. It

also organizes info-sessions, helping the

young students to inform themselves about a

rticular scholarship (through presentation

held directly by the representatives of the

organization offering the scholarship). In

addition, there is an article section on the site,

where young people can freely share personal

opinions, something interesting they have

experienced, or can organize their ideas in a

unique way and creatively express

themselves. We support the volunteering

process; moreover, it is actively involved in

this process, participating as a sending and

hosting organization. All in all, by practicing

the mentioned activities, Mladiinfo promotes

the ideas of tolerance, preparing the young

people to work in an international

environment, as well as the idea of positive

thinking in an active society, successfully

shaped by the generations to come.

NGO MAGAZINE PAGE 4

UUNNTTAARRYY SSEERRVVIICCEE

HH MMLLAADDIIIINNFFOO The young people that are interested to

visit some European country and do a

voluntary work there can have the

opportunity to do that through Mladiinfo

as their sending organization. Ilija

Dimitrovski is the EVS coordinator from

Macedonia, responsible for the

volunteering projects. So, everyone that is

interested should just contact the

organization and they will be given the

appropriate information for the

application and the participation process.

ABOUT US: The Youth of the Euro-Atlantic

Council of Macedonia – YATA Macedonia is a

youth organization of EACM. YATA Macedonia

was founded in 1999 by a group of ambitious

students and young politicians who were

interested in the work on the Atlantic values.

In the past years the Youth has been very

active in promoting the euro-atlantic idea and

values in the country as well as developing

cooperation with other YATA national

chapters and other organizations in the

country and abroad. YATA Macedonia is

accomplishing broad cooperation with state

institutions, civil society, media and diplomatic

missions in the country. In wider context YATA

Macedonia through its activities is promoting

democracy, human rights, civil society and rule

of law in the Republic of Macedonia. Long

lasting activities of YATA Macedonia are well

known on national, regional and international

level. One of them is the NATO student

simulation which was organized for the first

time in December 2010. Since many students

showed interest in participating, we decided

to make the NATO Student simulation a

traditional event that will take place each year.

YATA Macedonia is member of YATA – Youth

Atlantic Treaty Association, organization that

has 42 national atlantic associations which act

in Euro – Atlantic region and wider, building

support to civil society for NATO and trans-

atlantic cooperation, sharing the best practices

between their members. The General

Assembly of the YATA is the highest level

within YATA held once a year. In political

terms, it is one of the largest security forums

for the youths in the Atlantic world with

participating global leaders, experts and the

media. YATA Macedonia works in the

premises of the Euro

Macedonia where it has its own office, Statue

and membership. YATA Macedonia has its

own Facebook group and section at the

EACM website, and autonomy to develop its

program of activities which need to be

approved by the Executive Office of the Euro

Atlant

realization, considering the fact that they

need to be in line with the policy of the

organization and the policy of ATA.

PURPOSE:

to attract young people to join the Atlantic

community. Furth

works on developing core of people who are

interested in NATO, security, international

relations and they will be actively involved in

mobilization of the youth for these questions

and on that way will promote public debate

between th

Atlantic topic. The work with young people is

one of the key goals of every organization

knowing the fact that they are the future

leaders and they will have the responsibility

for the processes in the society. In addition,

we

Atlantic network and their informing and

education for euro

is from vital importance.

EXECUTIVE OFFICE:

the members of the YATA who have come

over the age of 26

the ATA membership and the current policy

of the YATA Macedonia is to involve students

from the age of 19 to 26. Due to the transition

TTHHEE YYOOUUTTHH OOFF TTHHEE EEUURROO

Second NATO Student simulation – “Meeting of NATO ministers of foreign affairs: NATO Enlargement and Western Balkans”

DECEMBER 2011

media. YATA Macedonia works in the

premises of the Euro-Atlantic Council of

Macedonia where it has its own office, Statue

and membership. YATA Macedonia has its

own Facebook group and section at the

EACM website, and autonomy to develop its

program of activities which need to be

approved by the Executive Office of the Euro-

Atlantic Council of Macedonia before

realization, considering the fact that they

need to be in line with the policy of the

organization and the policy of ATA.

PURPOSE: Main goal of YATA Macedonia is

to attract young people to join the Atlantic

community. Furthermore YATA Macedonia

works on developing core of people who are

interested in NATO, security, international

relations and they will be actively involved in

mobilization of the youth for these questions

and on that way will promote public debate

between the youth in the country on the

Atlantic topic. The work with young people is

one of the key goals of every organization

knowing the fact that they are the future

leaders and they will have the responsibility

for the processes in the society. In addition,

believe that the inclusion of youth in the

Atlantic network and their informing and

education for euro – atlantic idea and values

is from vital importance.

EXECUTIVE OFFICE: Throughout the years

the members of the YATA who have come

over the age of 26 have been transferred to

the ATA membership and the current policy

of the YATA Macedonia is to involve students

from the age of 19 to 26. Due to the transition

of the former YATA members into the ATA in

2010 we saw the need for transformation

and reorganiz

Therefore we have decided on the policy of

the age groups involved as well as project

activities that the YATA will work on. In 2010

we set up an Executive Office of the YATA

Macedonia that works on attracting new

members and d

line with the policy and practices of the

Atlantic Treaty Association and the Youth of

the Atlantic Treaty Association. YATA

Macedonia has more than 150 members and

its Executive office consists of four members

Ilija Djugu

Madzoska and

YATA is to promote diversity regarding

gender, ethnic community groups as well as

the wide range of students involved from all

the Universities in the country.

OO--AATTLLAANNTTIICC CCOOUUNNCCIILL OOFF MMAACCEE

AAAAAAAACCCCCCCCTTTTTTTTIIIIIIIIVVVVVVVV

o Macedonia and NATO in 2020

o Youth delegation visit NATO HQ

o NATO happening

o NATO summit student simulation

o Project about cyber security

o SEE in 2020

o Social platform for security

o BALKAN

Skype conference

o Regional policies in the context of EU

accession

o Debates on the universities

o General assembly of the YATA

o Implementation of the Euro

values in the educational process in

Republic of Macedonia

“Meeting of NATO ministers of foreign affairs: NATO Enlargement and Western Balkans”

DECEMBER 2011 NGO MAGAZINE PAGE

of the former YATA members into the ATA in

2010 we saw the need for transformation

and reorganization of the YATA Macedonia.

Therefore we have decided on the policy of

the age groups involved as well as project

activities that the YATA will work on. In 2010

we set up an Executive Office of the YATA

Macedonia that works on attracting new

members and developing project activities in

line with the policy and practices of the

Atlantic Treaty Association and the Youth of

the Atlantic Treaty Association. YATA

Macedonia has more than 150 members and

its Executive office consists of four members:

Ilija Djugumanov, Jordan Tasev, Stefanija

Madzoska and Emir Berisha. The policy of the

YATA is to promote diversity regarding

gender, ethnic community groups as well as

the wide range of students involved from all

the Universities in the country.

EEDDOONNIIAA –– YYAATTAA

VVVVVVVVIIIIIIIITTTTTTTTIIIIIIIIEEEEEEEESSSSSSSS FFFFFFFFOOOOOOOORRRRRRRR 22222222000000001111111122222222 Macedonia and NATO in 2020 – essay

Youth delegation visit NATO HQ

NATO happening – 4th April

NATO summit student simulation

Project about cyber security

SEE in 2020 – regional conference

Social platform for security

BALKAN – Mediterranean webcast or

Skype conference

Regional policies in the context of EU

accession

Debates on the universities

General assembly of the YATA

Implementation of the Euro-Atlantic

values in the educational process in

Republic of Macedonia

“Meeting of NATO ministers of foreign affairs: NATO Enlargement and Western Balkans”

NGO MAGAZINE PAGE 5

RRCCCC��ssuuppppoorrttss��rreeggiioonnaall��nneettwwoorrkkiinngg��

aanndd��ccaappaacciittyy��bbuuiillddiinngg��

Regional cooperation and capacity building activities between Project partners were done in twice during this reporting period. In May RCC members from Macedonia as well as our local partners from Rostushe region (bordering region of Gora) together with ATTA from and local partners from Gora and Zupa regions in Kosovo have meet in Dragash. Also Mayors and representatives of both municipalities together with RCC representatives have joint meeting where modalities of future cooperation between two regions were discussed. In Macedonia on May in Rostushe we organize meeting of cultural practitioners, artist, NGO- representatives and municipality representatives (including Mayors) from Rostushe and Vevchani region in order to establish stronger interregional cooperation between this two project regions with similar problems and potentials. In Bosnia and Herzegovina we developed project proposal ''Regional cultural cooperation of youth from rural areas'' and submitted to the BH Ministry of Civil Affairs. Also in Bosnia and Herzegovina during the visit of Serbian partner’s mozaik team members deliver workshop intended to build capacities of Serbian partner organization for providing assistance to rural communities in participatory planning and running cultural initiatives. The workshop was organized in the form of exchange of experiences and discussion about possibilities for transfer of Mozaik methodologies in work of ''Školama na ivici opstanka'', having in mind the nature of this organization, as well as project goals. Members of project partners from Serbia visit Kosovo in order to organize theatre workshop in Rechane. Behind the activities of the theatre workshop this was great chance to develop capacities of ATTA Prizren for performing arts and vice verse to build capacities of Serbian partners in institutional management which is field of expertise of ATTA Prizren. During the last annual planning meeting held in Mavrovo, several international exchanges were planned to be held between NGOs from Macedonia, with those from Kosovo, Serbia, Bosnia and Albania. Activities are planned to contribute for international institutional cooperation between different leaders such as moving theatres, music performances, exhibition, trainings and other similar activities.


The Institute for Democracy “Societas Civilis” Skopje (IDSCS) is a Macedonian based think-tank organisation that is non-governmental, non-partisan and non-profit. It was established in 1999 by a group of intellectuals gathered around the idea for democracy, solidarity and civil society. Long term objectives of the Institute are to work on balanced socio economic development, active citizen engagement and participative political culture. In this direction, we focus our activities on rule of law, good governance and multiethnic and multicultural

coexistence. IDSCS work is primarily based on sociometric research and project-based activities. We believe that human capital is a key precondition for positive social change, hence we eagerly undertake capacity building projects based on skills and knowledge transfer. Finally, ours society improvement is directly linked to availability of resources for self-reflection. In this sense, we advocate policy recommendations and strive to enrich the public discourse through promotion of evidence based policy, publishing and public events.

PERMANENT�FORUM�OF�EUROPEAN�CIVIL�SOCIETY�

TTTOOOWWWAAARRRDDDSSS TTTHHHEEE FFFEEEDDDEEERRRAAATTTIIIOOONNN OOOFFF

EEEUUURRROOOPPPEEE At the initiative of the Permanent Forum of European Civil Society, created in 1995 around a draft Charter of Fundamental Rights of the EU, citizens from several Member States met on 1 October 2011. The themeof the meeting - held in Houjarray (Yvelines) in Jean Monnet House – was to revive the idea of theFederation of Europe mentioned in the Schuman Declaration of May 9, 1950. The coincidence of date placed this meeting in the wake of President Barroso's speech on "the State of the Union" on September 28, and a few days before the presentation by President Van Rompuy of his report on reforming the governance of the euro area, at the European Council of 18 and 19 October. Amidst the current turmoil of the euro area, the participants in this meeting are convinced that only a democratic European federation, based on the interdependence of the peoples of Europe, will be able to maintain their cohesion, promote their social model and ensure that such a federation plays its role in a multipolar world. The participants are also convinced that a European government – of the whole of the Union or of the euro area alone - must be accountable to European citizens. In their opinion, the path to the creation of such a European government must be initiated and laid out by citizens' initiatives of a democracy that is participatory and deliberative. To do this, it is necessary and urgent that the European society summons up all its strength. In concluding their meeting, the participants agreed to continue their work on three themes: defining the ‘Federation of Europe’; stimulating citizen dynamics for the launch of a constituent process; contributing to the creation of a Federal Ministry of Economy and Finance. Time is short. The next European elections will be held in 2014, one hundred years after the start of the First World War. The European government that will be put in place will certainly mark this anniversary, but above all will offer European peoples a new perspective of peace, justice and prosperity.

RCC ACTIVITIES

YYOOUUTTHH AALLLLIIAANNCCEE

OOFF KKRRUUSSEEVVOO

Youth Alliance is an independent, non

governmental, non political and non

profitable organization established in 1999.

Our members (70-80 members) are young

people between 15 and 35, who work,

study or express an interest in processes of

EU integration of our country.

VISION

Active participation of youth in all issues of

social life.

AXES OF PRIORITIES

• Active involvement of young people in

decision-making processes at local,

regional and national level;

• Contribution of youth in the process of

EU integration of the SEE;

• Increasing the contribution of youth in

the economic development of their

local communities.

GOALS

• To promote new ways of expressing

the views of young people from SEE vs.

well-known political and uncooperative

methods;

• Acceptance of the modern European

values of young people from SEE;

• Creation of conditions for faster and

sustainable economic development.

HOW�TO�WRITE��A�PROPOSAL!?�

All proposals must

include certain basic

information. These

basics include:

� Why are you doing this project?

� What will you do?

� How will you be doing it?

� Who will be doing it?

� Where will it be done?

� How long will it take?

� How much will it cost?

Macedonia. The events took place in

Tetovo and Krusevo. In Krusevo a round

table that put together the concepts of

lifelong learning and community

development took place on November 4th

2011. In Tetovo similar round table took

place on November 8th 2011. Apart from

educational professionals, the director of

the Center for Adult Education in the

Republic of Macedonia, Lindita Qazimi

addressed the present participants.

LIFELONG LEARNING STREET

FESTIVAL

On November 8th a Lifelong Learning

Street Festival took place in front of the

Center for Culture in Tetovo. The visitors

were distributed with useful information on

lifelong learning and adult education and

the benefits they bring to the community.

Moreover, there was a presentation of

various guilds such as woodcarving,

knitting and crochet, traditional clothes

making, silversmithing and shoe-cleaning.

PARTNERSHIPS AND

COLLABORATIONS

So far ADAE has partnered and

collaborated with dvv-International - office

Skopje. Furthermore, ADAE is in process of

establishing collaboration and partnerships

with the Center for Adult Education in the

Republic of Macedonia, the Federation of

Adult Education Associations in Spain and

the European Basic Skills Network.

CONTACT INFO

St. Ljubo Bozinovski - Pish 82

1200 Tetovo, Rep. of Macedonia

Phone: 044 340 677

Email: [email protected]

Web: www.srov.mk


The Alliance for Lifelong Learning and

Adult Education (ADAE) is a membership-

based program established within the

frames of the Community Development

Institute (CDI).

AIMS OF ADAE

Development and promotion of adult

education; reducing the unemployment in

the Republic of Macedonia; support for

structures, organizations and institutions

for sustainable adult education

MEMBERS OF ADAE

• Community Development

Institute - Tetovo

• Workers University - Prilep

• Youth Cultural Center - Bitola

• AGTIS - Prilep

• ADORA - Tetovo

• People Technique - Tetovo

• OMU - Open Multicultural

University - Prilep

• Center for Education and

Development (CED) - Tearce

HOW TO BECOME A MEMBER OF

ADAE?

Every legal and physical entity who wants

to contribute toward adult education

development can become member of

ADAE. One can become a member by

filling out a registration form that can be

found at www.srov.mk. The legal entities

that want to become members, in addition

to the registration form should submit

decision for accession.

ACTIVITIES

ADAE with support of dvv-International -

office Skopje organized events in the

frames of the Days of Lifelong Learning in

The days of lifelong learning in Tetovo


For the first time in our historywehave been given the honor to hostthe65-thIAESTEAnnualConference.In January 2012, the whole worldcomes toMacedonia.Ononeof themost significant events thatconnects IAESTE leaders from allover theworld,over400delegates,guests and members from over 87countrieswill attend theconferencewheretheywilldiscussthefutureofIAESTE,exchangeoffers forenablingtechnical experience for as manystudents as possible, develop globalstrategy and build long-termorganizational vision and shareexperienceandskills.

MACEDONIANCOMMITTEEFORTHEINTERNATIONALEXCHANGEOFSTUDENTSFORTECHNICALEXPERIENCE

ABOUT IAESTE MACEDONIA

IAESTE Macedonia (Macedonian Committee

for the International Exchange of Students for

Technical Experience) is an independent, non-

profit and non-political student exchange

association, who is a full member of IAESTE

a.s.b.l. IAESTE Macedonia, provides students of

science, engineering, technology and the

applied arts with paid, course-related,

technical training abroad.

A BIT OF HISTORY

The international IAESTE was founded in

January 1948 after the initiative of the Royal

College in London. Starting with just 10

European member countries, IAESTE soon

began to spread quickly now counting around

90 members with IAESTE Macedonia being

one of them. We have joined the “big family”

in 1992 and we are proud to celebrate our 19-

th birthday this year.

OUR MISSION AND GOALS

o Providing students a chance to gain

technical experience in their field of

studies which would be significant in their

overall education and professional growth

o Promoting mutual understanding and

good will among students, the academic

community and employers

o Providing employers with highly qualified

and motivated trainees

NETWORK AND STRUCTURE

IAESTE Macedonia has 4 Local Committees at

the state universities in Skopje, Bitola, Shtip

and Ohrid. It is run by the national committee

which is the executive body of IAESTE

Macedonia, consisted of 9 members: National

Secretary, Representative of LC Skopje,

Representative of LC Bitola, Representative of

LC Shtip, Representative of LC Ohrid, Finance

responsible, Marketing responsible, Incoming

responsible and Outgoing responsible. These

are all elected by the National Assembly which

is the most powerful body in IAESTE

Macedonia and is an assembly of all full

members of IAESTE Macedonia. It holds

meetings according to the needs, but at least

once per year in the third Saturday of every

December.

WHO CAN BE A MEMBER?

Our members can be any students at the

following faculties: Faculty of Agricultural

Sciences and Food, Faculty of architecture,

Faculty of Civil Engineering, E-business from

Faculty of Economics, Faculty of Electrical

Engineering and Information Technologies,

Faculty of Forestry, Faculty of Mathematics

and Natural Sciences, Faculty of mechanical

engineering, Faculty of Pharmacy, Faculty of

Technology and Metallurgy, all from “Ss Cyril

and Methodius” University. If you want to join

us, all you have to do is come to one of our

regular meetings which are being held every

Monday at 8pm. at the amphitheatre at FEIT

and MFS.

EVENTS

Throughout the year, IAESTE Macedonia

organizes many events such as the Seminar

for training and motivation, IAESTE Day,

International Evenings, TWIN Seminar and

many, many more.

TheUnitedNationsVolunteers(UNV)The United Nations Volunteers (UNV) programme is the UN organization that contributes to peace and development through volunteerism worldwide. Volunteerism is a powerful means of engaging people in tackling development challenges, and it can transform the pace and nature of development. Volunteerism benefits both society at large and the individual volunteer by strengthening trust, solidarity and reciprocity among citizens, and by purposefully creating opportunities for participation. UNV contributes to peace and development by advocating for recognition of volunteers, working with partners to integrate volunteerism into development programming, and mobilizing an increasing number and diversity of volunteers, including experienced UN Volunteers, throughout the world. UNV embraces volunteerism as universal and inclusive, and recognizes volunteerism in its diversity as well as the values that sustain it: free will, commitment, engagement and solidarity. Based in Bonn, Germany, UNV is active in around 130 countries every year. Source: unv.org

IAESTE Macedonia


TThhee��LLaaww��oonn��YYoouutthh��aanndd��tthhee��IInniittiiaattiivvee��

““IInn��ddeeffeennssee��ooff��ppaarrttiicciippaattiioonn””��During the summer month of August, while

looking into the National Assembly’s working

agenda something unexpected and curious

caught our eye. The Commission on

Education, Youth and Sport had scheduled a

meeting for a first reading of the Law on

Youth, a law which until that day we had only

heard that was going to be created, but there

was no other information on it. Immediately

we contacted other youth organizations to

inquire whether anyone had the slightest idea

about the Law on Youth being brought into

parliament. What came as a total shock was

the fact that no one we contacted was at any

point asked or included in the creation of the

draft law. When we raised the question about

how the law was created, a further shocker

came through the announcement that the

proposed law not only included the opinions

of youth organizations, but it was also created

according to EU standards. Hearing notions

like this, that resembled nothing to the real

situation, meant that there was an urgent

need for action. Youth Educational Forum

immediately issued a call to other youth

organization who were willing to join us and

create a united front that will raise their voices

and speak about the necessary changes of a

law on youth that should be envisioned as a

protector of youth rights but somehow

forgets to include youth in the actual process

of creation of the law. Within a week of

placing the call, 35 civil society organizations

joined. With that the initiative “In defense of

participation” was born. Today there are 45

member organizations and non-formal groups

directly participating in the initiative. From the

very beginning the Initiative decided to

present its opinions both to the wider public

and directly to members of parliament. A

website for the initiative was launched and a

policy brief was created which was

immediately sent to all members of

parliament. The policy brief showed effective

as its data was used both by parliamentarians

from both the opposition and coalition

partners in the governments were

commenting on the many shortfalls of the text

of the draft law. Thanks to the initiative a

public call was placed for recommendations to

be submitted in order for the draft law on

youth to be improved. In the open call for

comments on the Law, the members of the

initiative prepared comments and submitted

them to the MPs as well as the Assembly’s

Commission of Education, Science and Sport.

The amount of comments and amendments

that we created were so large, that there

came a need to produce a clean text version

of the draft law in order to ensure that a clear

picture is shown of the necessary changes in

the draft law on youth. During the whole

period, the Initiative always stayed active and

within the radar of the media as the topic

seemed interesting to the wider public. Two

public debates were organized one by YEF

and the other by supporters of the initiative -

Progress Institute. YEF’s debate had members

of parliament, Political Party Youths and

NGOs. However the public debates were not

the only extent of work the initiative did. YEF

organized meetings with representatives from

political parties’ youths in order to try to find

a common ground for all youth

representatives and send a clear picture to the

parliament that by joining efforts and working

towards a common goal can be done, and

political interests can be cast aside. During

the meetings with various representatives

from the largest political party youths, we had

the chance to hear their stance on the matter,

discuss common ground and gain their

support with their MPs. The interest by the

European Youth Forum was another

encouragement for us in the process, as the

report that was sent to the Commission of

Education, Science and Sport reflected many

of the flaws we also noticed in the draft

version of the law. When the second reading

of the Draft-Law was scheduled in the

Assembly’s Commission on Education, Science

and Sport, the problem arising was that the

Commissions’ session was scheduled before

there was a report published about the

outcomes of the public discussion on the

draft version of the law. Not ready to give up,

the initiative organized a conference for the

press in front of the national Assembly. The

key message delivered was that the MPs

should rise above the party interests and

focus their attention on the comments by the

organizations which thoroughly approached

this matter and dedicated a lot of time and

effort in improving the proposed law. With

the continuous public pressure created, on

October 30th the Government of Macedonia

decided to retract the Draft-Law on youth in

order to conduct a wider consultation with

the youth NGOs. This does not mean that the

battle is over, but that it has yet to start. The

non-formal coalition will continue to follow

the development of the matter in the future

and organize meetings and focus groups

with its members to locate the optimal

solution for youth organizing in the country

and the future steps for action.

TThhee��WWoorrlldd��

AAssssoocciiaattiioonn��ooff��NNoonn--

GGoovveerrnnmmeennttaall��

OOrrggaanniizzaattiioonnss��--��

((WWAANNGGOO))��

WANGO is an international organization uniting NGOs worldwide in the cause of advancing peace and global well being. WANGO helps to provide the mechanism and support needed for NGOs to connect, partner, share, inspire, and multiply their contributions to solve humanity’s basic problems. Initiated in 2000 by a handful of international NGOs and prominent visionaries, WANGO has quickly become one of the premier international bodies for non-governmental organizations that are committed to the ideals of universal peace, justice, and well being for all humanity. Concerned with universal values shared across the barriers of politics, culture, religion, race and ethnicity, the founding organizations and individuals envisioned an organization that would enable NGOs to work in partnership across those barriers, thereby weaving a selfless social fabric essential to establishing a worldwide culture of peace. By optimizing resources and sharing vital information, WANGO provides a means for NGOs to become more effective in completing their vital tasks. With its global network of NGOs, as well as affiliates drawn from the ranks of governmental and intergovernmental bodies, business, and universities, WANGO has become an international leader in tackling issues of serious global concern. Source: wango.org


The Coalition of youth organizations SEGA is a national platform of youth organizations active in the field of lobbying for the needed legislative changes in youth policies, as well as committed to support youth activism, youth participation and access to information, by implementing activities for improving the overall state of youth. The Coalition SEGA addresses its activities towards initiation and implementation of legislation aiming to improve the young people’s life in Macedonia. The Coalition SEGA gave significant contribution towards creation of the National Youth Strategy of the Republic of Macedonia and the Action Plan for Implementation of the National Youth Strategy of the Republic of Macedonia. In 2009 the Coalition of youth organizations SEGA prepared the Alternative Report for the implementation of the Convention on the rights of the child in Macedonia. The report was presented in 2010 in front of the UN Committee on the Rights of the Child in Geneva. The recommendations of the Alternative Report were presented to the Commission for labor and social policy of the National Assembly of the Republic of Macedonia. In 2010, the Coalition of youth organizations SEGA conducted national research on the Youth trends and youth organizing in Macedonia. In its seven year working experience SEGA produced numerous publications, toolkits and manuals, and have organized a number of seminars and trainings for raising the awareness for the need of youth participation and as well advocacy and lobbying for the youth needs. Aiming to increase the youth participation in decision and policy making processes, SEGA supported the process of establishment of Councils of Youth within 6 municipalities of Macedonia. Regarding to the increasing the youth information the first Youth Information and Counseling Center INFO SEGA was opened. Beginning from 2010 the Coalition of youth organizations SEGA started to implement activities advocating for adoption of Law which will support the youth organizing and youth participation in the Republic of Macedonia.

The strengths part of a Youth Worker is that when we work in the community with youths some job we have very big responsibility, consecration, and they take the job very seriously then you are doing your job honestly and you enjoy working with youth, in the most of the case the Youths they works for the youths in the Community.

THE MAIN TASKS OF THE YOUTH

WORKER ARE:

1. Treat young people with respect: The youth worker is necessary to treat all the youth of equally and work with them no meter if they are different from ages, nationality, religions, race, gander, ability.

2. Respect and promote young people’s

rights to make their own decisions and

choices: Help them and create an atmosphere where everyone to have opportunity to discus in group or in peers and I will respect their choices and decisions.

3. Promote and ensure the welfare and

safety of young people: It’s necessary to be prepared in any situations and confront with it. Even there he has to take risk because in some situations is necessarybut also the Youth worker to take responsibility for my action in that case I will safe and ensure young people who are involved too. They have to be careful to avoid unnecessary rick and to be aware for the job I did in this way I will encourage young people of my practical placement group to participate in every activity without been afraid.

4. Contribute towards the promotion of

social justice for young people and in

society generally: The Youth Worker needs to encourage the members in group to respect all the peoples and to value the differences, multicultural society and they will encourages all of them to participate and to work together in activities that they will have in the project.

5. Recognize the boundaries between

personal and professional life: They need to have one line in which level they will have the relationships with the youth on their work, not to be so closer with them but and not to be so close person but to have one gold mess and both sides to be satisfied with the relationships that we will have during the projects.

6. “Recognize the need to be accountable

to young people, their parents or

guardians, employers, funders, wider

society and other people with a relevant

interest in the work”: They need to be open and very honest with the youth on their work, and be sure that every actions that they will make need to be in accordance with the low, is necessary to make discussion in case when we work with youth if we have some conflict in our project. They will take opportunity to collages of other agency to collaborate with youth activities.

7. Develop and maintain the skills and

competence required to do the job: They need to give and receive feedback with their collages for having quality work and skills and knowledge’s and recognizes and use new skills for educations and training.

8. Foster and engage in ethical debate in

youth work: They need to develop like a youth worker and they need to l relate their own personal values with the ethical principles of youth work.

9. Work for conditions in employing

agencies where these principles are

discussed, evaluated and upheld: The Youth Worker will be aware of the statements of principles like a Youth Worker when I will work with the students of my practical placement group and I will be prepare always to talk and discus with the collages for difficulties ethical issues.

TTThhheee jjjooobbb ooofff ttthhheee YYYooouuuttthhh WWWooorrrkkkeeerrr

Pranvera

IMERI


Skopje thus it’s office is located in the Faculty of Law “Iustinianus Primus”. In its work, AEGEE – Skopje, has organized numerous international and local events, as: Summer Universities, Winter Universities, student exchanges, conferences and other youth events. As an antenna of the AEGEE network it was pronounced as one of the ten antennas from the whole network which are the guiding force for the period of 1995 to 1999. To prove the hard work involved AEGEE - Skopje became organizer of the annual statutory event called “AUTUMN AGORA 2004” and again in 2011. It’s very rear for one antenna to organize the AGORA two times, but the legacy of AEGEE Skopje is strong and willing to promote unity and youth activism. In the current year, AEGEE Skopje has worked out some ambitious projects which core is the most noble ideas for human understanding, positive and transparent thoughts, love and tolerance. Despite having one of the toughest projects on their hands by organizing the statutory event they managed to organize one Local Training course for their members, a Youth in Action project and a Summer University. For all of those who want to be informed more about the ideas and work of AEGEE – Skopje can visit our official web site www.aegee-skopje.org.mk and can find us on Facebook. Our motto is: “Some call it Europe, we call it home”

AEGEE – Skopje is a non- government student organization (NGO), apolitical, and nonprofit secular organization which is a local antenna of the AEGEE network. AEGEE is an abbreviation for European Students Forum and is one of the biggest interdisciplinary organizations in Europe. It is present in 256 Universities in 40 European countries and it includes 17 000 members. The name is an acronym for Association des Etats Généraux des Etudiants de l’Europe and despite its student body it promotes united Europe forging towards international cooperation, communication and integration among students and creating an open and tolerant society. As well as the general network AEGEE - Skopje is European and does not function on a separate national level; this structure aims to wipe out the existing mental borders among students of whole Europe. THERE ARE FOUR MAIN ACTIVITIES: 1. University education 2. Exchange of culture 3. Peace and Stability 4. Active citizenship AEGEE enjoys the support of the European Commission. It has a consulting status in the Council of Europe and the United Nations also is a member of the European Youth Forum and cooperates with UNESCO. The members of AEGEE believe in their work. In return they gain personal current events. Needles to say they are all volunteering for a better tomorrow. AEGEE – Skopje is formed in 1993 as one of the first student NGOs registered in the independent Republic of Macedonia. Throughout its 18 years of existence it has a great cooperation with the University of Cyril and Methodius in

HOW TO WORK

WITH DEADLINES!?

The word "deadline" may bring up a spike of adrenaline in many people. So many of us are natural procrastinators, but by using deadlines, you can improve every aspect of your business even the relationship with your clients. Of course you will need some time to break old habits, but by instituting the right systems, you can start embracing the use of deadlines and reaping the benefits. Here are some ways to make deadlines work for your business!

INSTRUCTIONS

1. Accept deadlines. It's smart to come to an acceptance that you need to work with deadlines. Simply stated, they're essential to your productivity. Once you set up a system, it won't feel like such a chore. In the meantime, start reading up on business productivity.

2. Set up your system. How will you best stay updated on deadlines? Will you use the organizer in your Blackberry, or use a traditional day planner? Write or post your deadlines somewhere that you can frequently see them and that you'll actually use. There's no point in writing down deadlines in an old planner that stays under your desk. If your goals and deadlines are so long term that you almost forget them, make sure to mark baby steps or milestones into your planner.

3. Set a timeline. Start with something small. Say you want to create next year's budget and need it done in the next two months. Give yourself a deadline six weeks from now. It's best to start with things that won't have a huge impact if you miss them.

4. Start using deadlines. If you have a project due to a client in two weeks, mark it in your planner and use the baby steps necessary to get it done. Sometimes a final deadline doesn't work, so those in-between milestones are necessary. Let people know when you set a deadline for yourself, that'll motivate you more to keep it.

By: Kristen Fischer, eHow Contributor

�

NEWS�AND�RESOURCES�FOR��THE�NONPROFIT�SECTOR

Caleidoscop.org is your definitive

source of daily news aimed at the

nonprofit sector. This project is

managed exclusively through

voluntary work and it's been running in

similar formats since 2003.


YYYYYYYYoooooooouuuuuuuutttttttthhhhhhhh wwwwwwwwoooooooorrrrrrrrkkkkkkkk

Life in front of youth is like a pace of hammer

in front of one painter, and as long as one

painter collects enough colors to depict his

best picture, we, as youth, want to create and

have our possibilities in order to live a colored

life. Our reality is built as a result of our human

invention and it is harmful. People need the

true reality which is supposed to be built

according to the essential sources of life. Now

I want us to stop in our Balkan countries, and

figure out what is the problem with our society

by looking at the first important guiding

foundations- for example: what strategies are

used to guide youth? Where is the teacher to

be listened, and which is the global influence

over the Balkan society? Our Balkan countries

are not more important than we are, but the

problem is the people, who believe that our

countries are more important than our lives.

That’s why passes a year, a decade, a century,

and there is still lack of freedom, peace or a

normal life. So, this is the evident reality, but

you, try to think what kind of reality would be

important if it has no freedom or peace? And

this is what our Balkan countries have to deal

with. We have different religions, different

nations, and different ways of disrespecting

our invented integrity which is a result of our

political aspects, also our human identity

which is an endowment from our Creator. In

this point can be connected youth, therefore,

can be found ‘the misleading teacher of the

society’ which is made of politics who play the

restrictor, depriver, corruptor etc.

When there is mentioned religion than

there is present also its fellow whose name

is the faithful human, and a faithful human

must be called the one who appreciates

his/her life by appreciating others’ lives, or

his/ her own God Creature. This means that

there is no religion advice which leads us

towards to depriving each-other as long as

faithfulness is realized based on appreciation.

If there is any convincing advice from the re-

presenters of religion or patriotism than we

have to be sure that they are also the miss-

interpreters of their beautiful invented lie that

supports our false reality, in the Balkan

countries and all over the world, because the

Balkan reality is also a result of the global

.

Sadudin

BAJRAMI

society. Furthermore, our politics consider

their alternatives to be more important than

our lives; because they are separating us by

putting barriers between our communities, not

to let us exchange, thinking that we are

different from one another even when we

know how short our life to spend for these silly

things is. Our Balkan countries have millions of

people, and in us are endowed the same

abilities that are endowed in any other

generation around the world. Our problem

isn’t any lack of ideas, but it is lack of courage

to follow our instincts to change. If we stop

and look our Balkan image today we can notice

nothing unusual except our politics that stand

as a barricade in the middle of us and our

chance to change. There is always said that

avoid politics, be who you are supposed to be,

work yourselves etc. But how can we go

through these paths when the random worker

and the student are obliged by the politics to

have their partial membership certificates

which corrupt us way before we start our work

and educational research as individuals. This is

the kind of reality that we as youngsters don’t

belong to, and this what we must consider as a

wrong reality for our human society. The

meaning of this life is to live it and we can have

differences as many as we want but when it

comes to society than there in no difference.

We have to agree with the way we have come

up, having our differences, but why those

differences have to stop us share our cultures,

maintain our education, be conscious towards

to living life peacefully? We as youngsters need

to be invested our ideas, our educational

systems must be recuperated, and our politics

must be responsible for the structures of our

nations in Balkan as long as they dare to

present our will. In this way any change can

happen, because we, as youth, are the future of

our countries and our society, and if we don’t

have a valuable start than we will have a

terrible ending together with our society. So

our politics should work in their business and

we as youngsters should go on educating

ourselves. The founding of the Balkan society is

us, and our global influence is to integrate our

cultures overseas, but our teacher is our

politician and he prevents us to complete our

dream. You as a reader may consider these

facts as problems that appear all over the

world, but you should also think about our life

standards? Imagine that If in some countries

around the world have economical crisis than

we in Balkan have insurance crisis which is way

too worse than the first. I, as a citizen of

Macedonia see that we go through many

difficulties: employment and education are too

low, our investments which are supposed to

.

be in education are contrary being in

materialization. If we don’t have a ministry

of education that does its job well than we

as students will not have values in our

professions, even if we all become

academics, as long as our society is a ‘Black

Pearl’ than we all are ‘white idiots’. Our

intention is to be part of Europe, but we still

have problems with the language which is

the base of one country. There are certain

places in Macedonia where our ethnical

groups (either majorities or minorities)

grow distantly, because we as youngsters

attend our educational courses separately.

In some places where live only Albanians,

the official Macedonian language is

practiced but not learned, and that is as a

result of our Ministry of Education, also it is

because of the non-official Albanian

language who want it as an ethnic right.

The lack of the official language separates

Albanians from the Administrative

information, medical information, taxation

information etc. And we are waiting Europe

to come and solve these problems! What

we have to do is make up our minds to help

ourselves and stop being perseverant

people. Our national decisions shouldn’t be

that strong, and turn into pressure against

our lives. These notes might not look well

to your opinion, but this is the pain of

youth, and I as a part of it, present that

these are the difficulties which don’t let us

play an important role in our society and

maintain it in best way we can. So, every

disadvantage of these cases is or becomes

a disadvantage for the civilization of our

nations, and also our civilization as

humankind.

55 DDeecceemmbbeerr,, IInntteerrnnaattiioonnaall VVoolluunntteeeerr DDaayy ((IIVVDD))

International Volunteer Day (IVD) is a chance for volunteer-involving organizations and individual volunteers to promote their contributions to development at local, national and international levels. By merging UN support with a grassroots mandate, IVD is a unique opportunity for volunteer-involving organizations to work with government agencies, non-profit organizations, community groups and the private sector. Source: unv.org


The European Law Students’ Association in

Republic of Macedonia (ELSA Republic of

Macedonia) is an independent, non-political

and non-governmental organization

completely oriented towards its members-

the law students. The organization was

founded on September the 5th 1997 in

Skopje, by a group of young and enthusiastic

law students, as part of the network of the

European Law Student Association. The

founders imagined ELSA Republic of

Macedonia as a certain type of service for

the students of the Law School and a window

to Europe and it`s opportunities. ELSA

Republic of Macedonia was recognized as a

full member of ELSA Internationa аt the

International Council Meeting, held in

Opatia, Croatia in 1998. We are very proud to

say that our organization is recognized under

the constitutional name of the country which

reflects our status and reputation in ELSA

International. This is unique organization that

gives law students an opportunity to gain

knowledge and experience both on national

or international lever through its activities

and events. ELSA represents the starting

point in the process of building the carrier of

a future lawyer and allows its members to

finish the Law Faculty with maximal

knowledge and practical information for their

future profession. On international level ELSA

was found 30 years ago and the motto that

played a great role in the making and

developing the organization is “A just world

where there is a respect for human dignity

and cultural diversity”. This vision is leading

us in our mission to make law students

prepared to be great lawyers after they finish

their formal education. There are ELSA

National and Local groups in more than 200

universities throughout 40 Countries in

Europe. ELSA functions through four areas:

Seminar and Conferences, STEP (Student

Training Exchange Program), Academic

Activities and Marketing. The Seminar and

Conference area beside these two types of

events includes also international and

national institutional or regular study visits.

Until now we have organized one study visit

with the students and members of ELSA

Albania and one International Institutional

Study Visit of the European Court of Human

Rights in Strasbourg, France. We also had

several institutional visits of institutions in

Macedonia. In the STEP sector our members

have the chance to apply for an internship

that is organized by some other ELSA

National groups (for example Spain, Italy,

Germany, Poland etc.). In the same time our

members, together with the Vice President

for STEP are doing job hunting so foreign

students of law can come and do internship

here in Macedonia. Until now we have had

several foreign students on internships in

Macedonia (from Finland, Czech Republic

and Slovakia). More important our students

have gained internships in another country

(Turkey, Montenegro, Germany and The

Council of Europe). The area of Academic

Activities includes legal writing, legal

research and Moot court competitions. As a

part from ELSA Republic of Macedonia there

is a Moot Court Club that every year does

recruitment of new members that practice

law related to the topic of human rights and

its protection. The best members of the

Moot Court Club are representing our Law

Faculty Iustinianus Primus and our ELSA

group on the Regional Moot Court

Competition that is organized by Young

Lawyers of Serbia and Human Right

Defenders. Every year we have great results

on this competition. Our best year was in

2010 when our team won the first place. The

Marketing area is helping all the other

sectors with promotional materials and

maintenance of our website: www.elsa-

rm.org.mk. There are seven people that are

responsible for the functioning of the

organization: President, Treasurer, Secretary

General and four Vice Presidents for each of

the above mentioned areas. For each area we

have organized a lot of events throughout

the years and we still are. Every year we

adopt One year operational plan that is

guideline for our work. Until now we

cooperated with OSCE Mission in Skopje,

Council of Europe, MYLA, Akademika, MOF,

IHR, with a lot of our Alumni members etc.

Our organization has its office on the Law

Faculty Iustinianus Primus in Skopje. Current

president of ELSA Republic of Macedonia is

Svetlana Kjoseva - (president@elsa-

rm.org.mk).

NNEEWW LLIITTEERRAATTUURREE

SSEECCTTIIOONN BBYY

""IIZZLLEEZZ"",, WWHHYY AARRTT

MMAATTTTEERRSS??

The NGO "Izlez" decided to raise the awareness of the importance of literature by dedicating 10 new pages on the poetry and prose of uprising Macedonian talents and new birds. The first issue has now been completed and it is to be released soon. The content ranges from professional literature translations of famous world-wide poets to literary criticism. Moreover, this issue will promote the best literature pieces from the first Literature contest and some of the current cultural and artistic events. The team believes that this small step forward in the field of arts will motivate young artists to voice themselves. Why? The answer would be because art matters. By leaving out art, we unbalance science, negate social sciences and diminish the quality of education. How so? If there wasn't for creativity triggered by artistic practices we would lack the ability to tolerate the lack of scientific knowledge and ultimate facts and "thrust" because creativity makes us tolerate inconsistencies. If there wasn't for Malamud to tell us that people's spirit is colorless maybe social sciences would have to write more chapters on racism without using metaphors. Finally, can we make good education without the harmony of all the aspects mentioned above? Let art be what it is, aesthetic pleasure, but don't leave it out altogether for society will need a good satire or a reminder of humanity. It will need an aesthetic reminder and of course not always of the beautiful. At the end, I would like to reveal some of the details of the upcoming Literature contest the team is working on. The selections of the literature pieces will be made by renowned Macedonian writers, the poetry by Eftim Kletnikov, while the prose by Venko Andonovski. Everyone interested should check out the official website: www.izlez.mk

By: Afrodita Nikolova

�

STAY TUNED!

SEE YOU NEXT ISSUE!

NGO MAGAZINE - Nr. 2 (December 2011)

Documents

Transcript of NGO MAGAZINE - Nr. 2 (December 2011)