Mycobacterium tuberculosis host adaptation and evolution … · Mycobacterium tuberculosis host...
Transcript of Mycobacterium tuberculosis host adaptation and evolution … · Mycobacterium tuberculosis host...
UNIVERSIDADE DE LISBOA
FACULDADE DE FARMÁCIA
DEPARTAMENTO DE MICROBIOLOGIA E IMUNOLOGIA
Mycobacterium tuberculosis host adaptation and
evolution reflected by defense mechanisms
against oxidative stress
Olga Maria Elviro Mestre
DOUTORAMENTO EM FARMÁCIA
MICROBIOLOGIA
2012
UNIVERSIDADE DE LISBOA
FACULDADE DE FARMÁCIA
DEPARTAMENTO DE MICROBIOLOGIA E IMUNOLOGIA
Mycobacterium tuberculosis host adaptation and
evolution reflected by defense mechanisms
against oxidative stress
Olga Maria Elviro Mestre
Tese orientada pela Prof.ª Dr.ª Brigitte Gicquel e pela Prof.ª Dr.ª Madalena
Pimentel, especialmente elaborada para a obtenção do grau de doutor em
Farmácia (Microbiologia)
2012
The studies presented in this thesis were performed at Unité de Génétique Mycobacteriénne, Institut
Pasteur, Paris, under de supervision of Professor Brigitte Gicquel and Professor Madalena Pimentel.
Olga Maria Elviro Mestre was financially supported by a PhD fellowship (SFRH/BD/39079/2007) from
Fundação para a Ciência e Tecnologia (FCT), Lisboa, Portugal. The work presented in this thesis was
supported by the TB-ADAPT (LSHP-CT-2006-037919) project, funded by the European Commission
under the Health Cooperation Work Programme of the 6th Framework Programme, as well as by TB-VIR
(Grant agreement n° 200973) and NEWTBVAC (HEALTH-F3-2009-241745) projects, from the 7th
Framework Programme.
De acordo com o disposto no ponto 1 do artigo nº40 do regulamento de Estudos Pós-Graduados da
Universidade de Lisboa, deliberação nº 93/2006, publicado em Diário da Républica – II série nº 153 – 5
de Julho de 2003, a autora desta dissertação declara que participou na concepção e execução do
trabalho experimental, interpretação dos resultados obtidos e redacção dos manuscritos.
III
ABSTRACT
Part of the success of Mycobacterium tuberculosis lies in its ability to thrive inside macrophages,
where it is exposed to strong antimicrobials molecules, such as reactive oxygen species (ROS).
However, the role of defense mechanisms against ROS in M. tuberculosis pathogenesis remains
unclear. We used, for the first time, a functional genomic approach to investigate M. tuberculosis
responses against ROS. By screening a transposon mutant library we identified a high number of
mutants, with increased susceptibility to H2O2, in genes related to cell envelope functions, including
mmpL9. This revealed the importance of M. tuberculosis cell envelope against oxidative stress.
However, we have also identified genes implicated in other kind of defense mechanism against
ROS, such as moaD1. Infection of human macrophages has shown that both mmpL9 and moaD1
have a role in M. tuberculosis intracellular lifestyle, and previous studies suggested the same for
several other genes identified during our screening. Therefore, these represent potential virulence
factors useful for the development of future anti-tuberculosis strategies.
DNA repair, recombination and replication (3R) are important mechanisms in maintaining genome
stability by repairing DNA damages, such as those induced by ROS, however, variations on 3R genes
potentially increase genomic variability, due to an increase in mutation rates. Thus, analysis of
polymorphisms in 3R genes could indicate which strains are more prone to adapt and evolve. We
have analyzed polymorphisms in 3R genes in a collection of strains of a successful family of M.
tuberculosis strains, the Beijing/W family. Specific 3R polymorphisms were found to characterize
particular groups of Beijing/W strains for which a phylogeny was constructed. Certain groups were
found to be predominant, suggesting that strains of these genotypes might have some selective
advantage. Therefore, particular 3R SNPs may define pathogenic features that have contributed to
the evolution of the Beijing/W family.
Keywords: Mycobacterium tuberculosis, Reactive oxygen species, macrophage, DNA repair
recombination and replication, The Beijing/W family, Polymorphisms
IV
V
RESUMO
Mycobacterium tuberculosis, a bactéria responsável pela tuberculose, infecta cerca de 1/3 da
população mundial e é responsável pela morte de aproximadamente 1,5 milhões de pessoas por
ano. Estes números podem ser explicados, em parte, pela capacidade desta bactéria persistir no
interior de macrófagos, num ambiente extremamente agressivo, no qual é exposta a diferentes
moléculas antimicrobianas tais como as espécies reactivas de oxigénio. Estas, sendo altamente
reativas, causam danos em todo o tipo de moléculas incluindo lípidos, proteínas e DNA. Desta
forma, os mecanismos de defesa utilizados pelo M. tuberculosis contra as espécies reativas de
oxigénio são sem dúvida importantes para este, porém, o seu papel na virulência e patogénese
desta bactéria ainda é pouco claro.
O trabalho desenvolvido nesta tese consistiu na investigação dos mecanismos de defesa
utilizados pelo M. tuberculosis contra as espécies reactivas de oxigénio. Com este objectivo,
realizou-se pela primeira vez, um screening de uma biblioteca de mutantes construída por
transposição, na estirpe clinica da família Beijing/W - GC1237, de forma a selecionar mutantes
sensíveis a espécies reativas de oxigénio. A análise de cerca de 6000 mutantes permitiu a selecção
de 18, sensíveis a peróxido de hidrogénio, para os quais a amplificação e posterior sequenciação do
sítio de inserção do transposão levaram à identificação de 11 genes. Verificou-se que grande parte
dos genes apresenta funções associadas ao invólucro celular bacteriano, o que revela que o
invólucro do M. tuberculosis representa a primeira barreira de defesa contra as espécies reactivas
de oxigénio nesta bactéria. O gene mmpL9 foi um dos identificados, cuja proteína se encontra
possivelmente envolvida no transporte de lípidos para o invólucro celular. Curiosamente, três
mutantes com diferentes mutações neste gene foram seleccionados. Identificaram-se também
alguns genes envolvidos noutro tipo de mecanismos tais como, moaD1, envolvido na síntese do
cofactor molibdénio.
Uma vez que o M. tuberculosis tem de fazer face às espécies reativas de oxigénio no interior de
macrófagos, o passo seguinte consistiu em analisar o fenótipo de alguns destes mutantes nestas
células. Para o efeito, macrófagos humanos foram infectados com um dos mutantes no gene
mmpL9 ou com o mutante no gene moaD1, uma vez que estudos anteriores demonstraram o papel
de diferentes MmpLs na virulência desta bactéria e que outros genes envolvidos na síntese do
cofactor molibdénio são importantes para a sobrevivência do M. tuberculosis no interior de
macrófagos. Em ambos os casos observou-se uma diminuição na capacidade de crescimento destas
VI
estirpes no interior destas células, em comparação com a estirpe selvagem. A complementação
destas estirpes mutantes restaurou o fenótipo da estirpe selvagem, o que demonstra o papel
destes genes no crescimento de M. tuberculosis em macrófagos humanos. Porém, a
complementação restaurou apenas parcialmente a sensibilidade destes mutantes às espécies
reactivas de oxigénio in vitro, em comparação com a estirpe selvagem. No entanto, mmpL9 e
moaD1 deverão ter um papel na resposta às espécies reativas de oxigénio em M. tuberculosis, caso
contrário, a complementação não teria restaurado de todo o fenótipo selvagem, nas condições
referidas.
A comparação da sequência do gene mmpL9 da nossa estirpe selvagem, GC1237, com a estirpe
de referência laboratorial, H37Rv, revelou a presença de uma deleção de um nucleótido na posição
218. Contudo, os nossos resultados obtidos a partir da infecção de macrófagos com o mutante
mmpL9 e com a mesma estirpe após complementação da mutação sugerem que o gene mmpL9
deverá ser expresso apesar desta deleção. É possível que ocorra uma reniniação da tradução a
partir de um codão de iniciação situado a montante da deleção, na posição 258, no gene mmpL9.
Para além disso, a complementação do nosso mutante mmpL9 com o respectivo gene da estirpe
H37Rv, restaurou apenas parcialmente o fenótipo da estirpe selvagem, GC1237, durante a infecção
de macrófagos. Estas observações sugerem que a proteína MmpL9 na estirpe GC1237 poderá ser
diferente da existente na estirpe H37Rv. A análise da sequência de todos os genes mmpL existentes
no genoma de M. tuberculosis, numa coleção de estirpes que representam diferentes famílias,
sugeriu que a deleção identificada poderá realmente ter um efeito na proteína. Verificou-se ainda
que esta deleção é aparentemente específica para todas as estirpes modernas da família Beijing.
Isto indica que a deleção do nucleótido 218 poderá ter conferido alguma vantagem selectiva a
estas estirpes que contribuiu para a sua evolução.
Para além de moaD1 e mmpL9, alguns dos outros genes identificados durante o screening como
importantes para a resposta de M. tuberculosis às espécies reativas de oxigénio, foram igualmente
descritos, em estudos anteriores, como importantes para a capacidade desta bactéria sobreviver
intracelularmente. Isto indica uma correlação entre sensibilidade ao stress oxidativo e capacidade
de sobreviver ou replicar-se no interior de macrófagos. No entanto, a infecção de macrófagos
tratados com inibidores da NADPH oxidase, a enzima que produz as espécies reativas de oxigénio
nestas células, com os mutantes nos genes mmpL9 e moaD1, não permitiu confirmar esta hipótese.
É possível que estes mutantes sejam sensíveis a outras moléculas antimicrobianas encontradas no
interior do macrófago, tais como as espécies reativas de azoto, que, em conjunto com as espécies
VII
reativas de oxigénio, são responsáveis pelo crescimento atenuado observado em macrófagos. Em
conclusão, este trabalho permitiu a identificação de genes envolvidos na defesa do M. tuberculosis
contra as espécies reactivas de oxigénio, os quais aparentam ter igualmente um papel na
sobrevivência desta bactéria nas suas células hospedeiras, os macrófagos. Estes genes representam
potenciais factores de virulência que poderão ser úteis para o desenvolvimento de futuros
antibióticos ou vacinas.
Numa segunda parte desta tese, realizou-se uma análise dos polimorfismos existentes em genes
de reparação, recombinação e replicação (3R) de DNA numa família específica de estirpes de M.
tuberculosis, a família Beijing. Os mecanismos de reparação, recombinação e replicação são
extremamente importantes na manutenção da estabilidade genómica, através da reparação de
danos causados no DNA, tais como os induzidos pelas espécies reativas de oxigénio. Por outro lado,
estes mecanismos podem ser igualmente responsáveis pela introdução de variabilidade genética.
Polimorfismos nos genes que codificam para as proteínas envolvidas nestes mecanismos poderão
induzir um aumento na taxa de mutação, e consequentemente, a acumulação de mutações
vantajosas para as estirpes, como por exemplo, mutações responsáveis pela resistência a
antibióticos. Deste modo, a análise de polimorfismos nos genes 3R poderá indicar que estirpes
estão mais predispostas a adaptar-se ou evoluir. A família Beijing é uma família de M. tuberculosis
que apresenta uma maior virulência e que tem sido identificada um pouco por todo o mundo como
estando frequentemente associada a resistência a antibióticos. Deste modo, analisaram-se
polimorfismos em genes 3R numa coleção de estirpes Beijing, isoladas em várias partes do mundo.
Diferentes polimorfismos foram identificados que permitiram a discriminação de vários grupos,
para os quais foi construída uma árvore filogenética. Estes resultados foram congruentes com os
resultados obtidos utilizando outros marcadores genéticos, o que significa que as mesmas
associações filogenéticas foram obtidas, para a colecção de estirpes utilizada neste estudo, usando
polimorfismos nos genes 3R ou outro tipo de marcadores genéticos.
Uma grande percentagem das estirpes foi agrupada num dos grupos, Bmyc10, que incluiu
estirpes isoladas em diferentes partes do mundo. Um estudo anterior demonstrou que estirpes
com características genéticas que definem as deste grupo são igualmente predominantes numa
outra região geográfica, não representada no nosso estudo. Em conjunto, estes resultados
sugerem que o genótipo das estirpes do grupo Bmyc10 poderá ter-lhes conferido alguma
vantagem selectiva que permitiu a sua evolução. Isto é igualmente sugerido num estudo anterior,
no qual a caracterização do efeito da mutação no gene mutT2, que caracteriza todas as estirpes do
VIII
grupo Bmyc10, indica que esta induz uma alteração na função da proteína que pode ser vantajosa
para as estirpes que a possuem. Portanto, alguns dos polimorfismos identificados no nosso estudo
poderão ter um efeito na função das respectivas proteínas, o que significa que este tipo de análise
é importante para compreender o significado dos mesmos.
Em conclusão, a análise de polimorfismos em genes 3R demonstrou que diferentes grupos
podem ser identificados na família Beijing caracterizados por polimorfismos específicos. Estes
podem ter conferido alguma vantagem que permitiu a expansão de certos grupos e contribuiu para
a evolução desta família. A análise da variabilidade genética entre estirpes é importante uma vez
que estas podem reflectir diferenças patogénicas. Este estudo poderá contribuir para aprofundar
os nossos conhecimentos acerca dos mecanismos que determinam o êxito das estirpes da família
Beijing.
Palavras-Chave: Mycobacterium tuberculosis; Espécies reactivas de oxigénio; Macrófago;
Reparação, recombinação e replicação de ADN; Família Beijing; Polimorfismos
IX
ACKNOWLEDGMENTS
I would like to thank, first of all, to my supervisor, Professor Brigitte Gicquel, for accepting me in her
laboratory, and for all the support, help and guidance during the last six years. Thank you for believing
in me and for giving the opportunity to learn all the things I have learnt that allowed me to evolve
professionally and personally and became the person I am today. Pour tout ça, un grand Merci.
Queria agradecer igualmente à Professora Madalena Pimentel, co-orientadora desta tese. Agradeço
todo o apoio que me deu durante estes cinco anos em que, esteve sempre disponível para nos
reunirmos e discutirmos sobre a evolução dos trabalhos, e para me ajudar e aconselhar. Obrigada pela
sua ajuda e apoio, principalmente nesta fase final, foi muito importante para mim.
Ao Tiago, por ter acreditado em mim e me ter apoiado incondicionalmente. Sem ti este trabalho nunca
teria sido possível. Obrigada por todo o apoio e carinho, que tu e a Zrinka sempre me deram. Por me
teres ouvido e aconselhado e por me teres orientado e guiado. Vou estar eternamente agradecida por
tudo.
À Helena, a minha grande amiga, a quem dificilmente conseguirei exprimir o quanto estou agradecida.
Pelo apoio incondicional e pela paciência que tiveste, sobretudo nos momentos mais difíceis. Obrigada
por todos os momentos únicos e inesquecíveis que passámos juntas no laboratório e em Paris!
Obrigada pela amizade, que vai para sempre durar, não tenho dúvidas.
À Mena, amiga do coração, foste um apoio imprescindível neste cinco anos. Este percurso não teria
sido possível se não tivesses estado presente para me ajudares, escutares e aconselhares. Por isso,
muito obrigada a ti, ao Elias, e ao Sebastian por tornarem a minha estadia em Paris mais fácil e por me
proporcionarem momentos únicos e especiais.
À Soraia pela amizade e por teres estado sempre presente e disponível para me apoiares apesar da
distância, e sobretudo pela ajuda e apoio nesta fase final, muito obrigada por tudo amiga.
Ao Bruno e à Elisabete, que estiveram sempre disponíveis para me apoiar, obrigada! Ao Hugo, muito
obrigada pela constante preocupação e apoio. Obrigada aos três pelos momentos inesquecíveis
passados juntos em Paris, nunca esquecerei!
Ao Amine, merci beaucoup pour tous les moments passés ensemble au labo, pour travailler et aussi
pour décontracter et rigoler. Pour toute ton aide et soutien et aussi pour ta patience, essentiel pendant
ces dernières années, je te remercie vraiment du fond du cœur.
X
À Raquel, por todas as horas passadas no P3, foste uma ajuda importante, obrigada, pelo apoio e pela
preocupação e carinho que tu e Marco me deram.
À tous les personnes avec qui j’ai travaillé au laboratoire à l’Institut Pasteur, en particulier à Sandrine et
Véronique, pour toute votre aide, soutient et compagnie, pour les bons moments passés ensemble, je
vous remercie et je m’en souviendrais toujours!
A special thanks to Alessandro for all the advices, support, discussions, and long hours spent in the P3,
and off course for the Italian meals in the weekends!
A todos os meus amigos, em especial à Telma que sempre se preocupou e sempre me apoiou, obrigada
pela tua amizade incondicional.
À minha família, primos, tios e avós muito obrigada pela constante preocupação e apoio!
Aos meus pais, pelo amor e apoio incondicional que sempre me deram, sem eles sem dúvida alguma
que eu não teria conseguido chegar até aqui e ser o que sou hoje. Por tudo isso e pela preocupação e
ajuda, não tenho palavras que possam agradecer tudo o que já fizeram por mim, a não ser dizer que vos
adoro e que tenho muito orgulho em ser vossa filha.
À minha irmã e ao meu cunhado, e claro, às minhas sobrinhas lindas, pelo amor que me dão e por todo
o apoio que me deram ao longo destes anos, sobretudo pela paciência nesta fase final. A vossa ajuda
foi imprescindível para finalizar esta tese, muito muito obrigada, adoro-vos!
Ao meu irmão e cunhada obrigada pelo carinho, apoio e preocupação incondicional, muito obrigada!
Aos meus sogros, ao Nuno e à Inês, por me tratarem de uma forma tão especial, por se preocuparem
comigo e pelo apoio e força que sempre me deram, obrigada.
Por fim, ao Rui, pelo teu amor, apoio, ajuda, compreensão e sobretudo pela enorme paciência que
tiveste durante estes cinco anos. Sem ti seguramente eu não teria tido a força que tive para concluir
esta tese. Obrigada por tudo e por fazeres parte da minha vida. Por tudo isto e muito mais estarás
sempre no meu coração.
XI
ABREVIATIONS
3R DNA repair, recombination and replication 8-oxoG 7,8-dihydro-8-oxo-2'-deoxyguanosine
Ahp Alkyl hydroperoxide
AIDS Acquired Immunodeficiency Syndrome
AP sites apurinic or apyrimidinic sites
BCG Bacillus Calmette-Guérin
BER Base excision repair
CGD Chronic Granulomatous Disease
CFU Colony-Forming Unit
CMN Corynebacterium Mycobacterium Nocardia
DAT Diacyltrehaloses
DCs Dendritic Cells
DC-SIGN Dendritic cell-specific intercellular adhesion molecule-3 grabbing nonintegrin
DMSO Dimethyl Sulfoxide
DNA Deoxyribonucleic Acid
DosR Dormancy regulon
DPI Diphenyleneiodonium
DSBs Double Strand Breaks
DTM-PCR Deletion-Targeted Multiplex PCR
EEA1 Early endosome antigen 1
ESAT-6 Early secreted antigenic target protein 6
GMD GDP-D-Mannose-Dehydratase
HIV Human Immunodeficiency Virus
HR Homologous Recombination
iNOS inducible Nitric Oxide Synthase
IFNγ Interferon gamma
LAM Lipoarabinomannan
LM Lipomannan
LpdC Lipoamide dehydrogenase C
LSPs Large Sequence Polymorphisms
ManLAM Mannose-capped Lipoarabinomannan
MDR Multi-Drug Resistant
MIRUs Mycobacterial Interspersed Repetitive Units
MLST Multilocus Sequence Typing
MmpL Mycobacterial Membrane Protein Large
MMR Mismatch repair
MNNG N-methyl-N’-nitro-N-nitrosoguanidine
MoCo Molybdenum Cofactor
MOI Multiplicity Of Infection
XII
MR Mannose Receptor
Msr Methionine Sulfoxide Reductase
NER Nucleotide Excision Repair
NHEJ Non-Homologous End-Joining
nsSNPs non-synonymous SNPs
NTF Noise Transfer Function
OD Optical Density
PCR Polymerase Chain Reaction
PDIM Phthiocerol Dimycocerosate
PGLs Phenolic Glycolipids
Phox Phagocyte NADPH oxidase
PI3P phosphatidylinositol-3-phosphate
PIMs Phosphatidyl-myo-Inositol Mannosides
pks Polyketide biosynthesis
PMA Phagosome maturation arrest/ Phorbol 12-myristate 13-acetate (reagent)
PPRs Pattern Recognition Receptors
rhM-CSF Recombinant Human Macrophage Colony Stimulating Factor
RD Region of Difference
RecA-NDp RecA/LexA-independent promoter
RFLP Restriction Fragment Length Polymorphism
RLUs Relative Light Units
RND Resistance, nodulation and cell division proteins
RNS Reactive nitrogen species
ROS Reactive Oxygen Species
SLs Sulfatides
SNPs Single Nucleotide Polymorphisms
SOD Superoxide Dismutase
Spoligotyping Spacer Oligonucleotide Typing
SSBs Single Strand Breaks
sSNPs synonymous SNPs
TAT Triacyltrehaloses
TB Tuberculosis
TDM Trehalose Dimycolate
TDR Totally Drug resistant
TLRs Toll-like Receptors
TMM Trehalose Monomycolate
Trx Thioredoxin
UV Ultraviolet
VNTR Variable Number of Tandem Repeat
Vps33B Vacuolar Protein Sorting 33B
VitD3 Vitamin D3
WHO World Health Organization XDR Extensively-drug resistant
XIII
PUBLICATIONS
Most of the work presented in this thesis is included in the following published or submitted
manuscripts in international peer-reviewed journals:
Mestre O, Hurtado-Ortiz R, Dos Vultos T, Namouchi A, Cimino M, Pimentel M, Neyrolles O,
Gicquel B. (2012). High throughput phenotypic selection of Mycobacterium tuberculosis mutants
with impaired resistance to reactive oxygen species identifies genes important for intracellular
growth PLoS One; Submitted
Mestre O, Luo T, Dos Vultos T, Kremer K, Murray A, Namouchi A, Jackson C, Rauzier J, Bifani P,
Warren R, Rasolofo V, Mei J, Gao Q, Gicquel B. (2011). Phylogeny of Mycobacterium tuberculosis
Beijing strains constructed from polymorphisms in genes involved in DNA replication,
recombination and repair. PLoS One. 20;6(1):e16020.
The following manuscripts have also been published during the Ph. D. studies:
Dos Vultos, T., Mestre, O., Rauzier, J., Golec, M., Rastogi, N., Rasolofo, V., Tonjum, T., Sola, C.,
Matic, I., and Gicquel, B. (2008). Evolution and diversity of clonal bacteria: the paradigm of
Mycobacterium tuberculosis. PloS one 3, e1538.
Dos Vultos, T., Mestre, O., Tonjum, T., and Gicquel, B. (2009). DNA repair in Mycobacterium
tuberculosis revisited. FEMS microbiology reviews 33, 471-487.
Wang, C., Peyron, P., Mestre, O., Kaplan, G., van Soolingen, D., Gao, Q., Gicquel, B., and Neyrolles,
O. (2010). Innate immune response to Mycobacterium tuberculosis Beijing and other genotypes.
PloS one 5, e13594.
XIV
XV
TABLE OF CONTENTS
Abstract III
Resumo V
Acknowledgments IX
Abreviations XI
Publications XIII
Table of contents
XV
Chapter 1: General introduction
1
1.1 Tuberculosis na ancient disease 3
1.2 TB today’s major issues 3
1.3 The genus Mycobacterium 6
1.3.1 The Mycobacterium tuberculosis complex 7
1.3.2 Mycobacterial cell envelope 7
1.4 Molecular evolution of mycobacteria 9
1.4.1 Molecular genetic markers that define M. tuberculosis complex genetic
diversity
9
1.4.2 Phylogeny of the M. tuberculosis complex 12
1.4.3 The Beijing/W family 15
1.5 M. tuberculosis Infection 17
1.5.1 Recognition of M. tuberculosis and initiation of immune response 18
1.5.2 Granuloma formation 20
1.6 M. tuberculosis interactions with macrophages 22
1.6.1 M. tuberculosis evasion of macrophage’s antimicrobial mechanisms 23
1.6.1.1 Inhibition of phagosome maturation 24
1.6.2 Nitrosative and oxidative stress relevance in tuberculosis 26
1.6.3 M. tuberculosis responses against oxidative stress caused by ROS 27
1.6.3.1 The formation of ROS 27
1.6.3.2 ROS scavenging systems 29
1.6.3.3 Protein and lipid repair 31
1.6.3.4 Oxidative DNA damage caused by ROS 33
1.6.3.5 M. tuberculosis DNA repair 34
1.6.3.6 Oxidative stress response regulation 44
Objectives 47
XVI
Chapter 2: Identification of M. tuberculosis virulence factors involved in defense
mechanisms against oxidative stress
49
2.1 Abstract 51
2.2 Introduction 53
2.3 Materials and Methods 55
2.4 Results 61
2.4.1 Screening for mutants with increased susceptibility to oxidative stress 61
2.4.2 Sensitive mutants to oxidative stress are affected in cell envelope
functions
62
2.4.3 Quantification of sensitivity of mutants to oxidative stress 64
2.4.4 MmpL9 and MoaD1 are important for M. tuberculosis survival in human
macrophages
66
2.4.5 The mmpL9 deletion at position 218 is conserved in Beijing/W strains 67
2.4.6 MmpL9 and MoaD1 are required to counteract other forms of stress
existent in macrophages
69
2.5 Discussion 77
Chapter 3: Evolution and diversity of M. tuberculosis Beijing/W strains reflected by
polymorphisms in 3R genes
83
3.1 Abstract 85
3.2 Introduction 87
3.3 Materials and Methods 89
3.4 Results 93
3.4.1 Identification of polymorphisms in 3R genes in Beijing/W strains 93
3.4.2 Construction of a phylogeny for Beijing/W strains using 3R SNPs 96
3.5 Discussion 99
Chapter 4 : Concluding Remarks 103
References 111
Annex 133
XVII
FIGURES
Chapter 1
Figure 1 – Estimated MDR-TB cases among notified TB patients in 2010 4
Figure 2 – Mycobacterial cell envelope constitution 8
Figure 3 – Representation of M. tuberculosis genome of the H37Rv reference strain,
indicating the major genetic markers used for strain genotyping
10
Figure 4 – M. tuberculosis phylogeography 13
Figure 5 – M. tuberculosis infection and granuloma formation 21
Figure 6 – Assembly of the phagocyte NADPH oxidase NOX2 28
Figure 7 – Reactive oxygen species decomposed from superoxide produced by
phagocyte oxidase
29
Figure 8 – Cellular reactions leading to oxidative DNA damage via the Fenton
Reaction.
34
Figure 9 – Major mechanisms repairing DNA damages in bacteria 35
Figure 10 – Enzymatic systems that protect from the mutagenic effects of 8-
oxoguanine
36
Figure 11 – Early steps during the repair of double strand breaks (DSBs) 41
Chapter 2
Figure 1 – Growth curves of M. tuberculosis H37Rv, ΔmutT1, ΔmutM and ΔmutY in
increasing concentrations of hydrogen peroxide.
61
Figure 2 – Growth curves of M. tuberculosis GC1237 in increasing concentrations of
hydrogen peroxide.
62
Figure 3 – Susceptibility of transposon mutants to oxidative stress. 65
Figure 4 – Intracellular growth of mmpL9 and moaD1 mutants in human
macrophages.
67
Figure 5 – Graphical representation of the distribution of polymorphisms in mmpL9 in
several M. tuberculosis genomes.
69
Figure 6 – Survival of mmpL9 and moaD1 mutant and complemented strains exposed
to hydrogen peroxide.
70
Figure 7 – Macrophages treated with the NADPH oxidase inhibitors, apocynin and DPI. 71
Figure 8 – Intracellular growth of mmpL9 and moaD1 mutants in human macrophages
treated with Phox inhibitors.
72
Figure 9 – Macrophages activated with Vitamin D3. 73
Figure 10 – Intracellular growth of mmpL9 and moaD1 mutants in VitaminD3-
activated macrophages treated with Phox inhibitors.
74
Figure 11 – Susceptibility of mmpL9 and moaD1 mutants to acidic pH and starvation. 75
Figure 12 – Representation of the mmpL9 gene in M. tuberculosis GC1237 78
XVIII
Chapter 3
Figure 1. Phylogenetic network based on SNPs discovered in the collection of 58
Beijing/W isolates.
95
Figure 2. Phylogenetic network based on SNPs characterized in the entire collection of
305 Beijing/W isolates.
97
TABLES
Chapter 2
Table 1. List of oligonucleotides (5’-3’) used in this study. 56
Table 2. List of identified sensitive mutants to oxidative stress using hydrogen
peroxide.
63
Table 3. Statistical analysis of SNP density in mmpL genes in a collection of M.
tuberculosis genomes.
68
Chapter 3
Table 1. List of oligonucleotides used for SNP analysis. 90
Table 2. List of primers used in Multiplex-PCR for Large Sequence Polymorphisms
(LSPs) analysis.
92
Table 3. List of SNPs identified by sequencing 3R genes in Beijing/W strains, which
define different sequence types (Figure 1 and 2).
94
Annex
Table A1. Description of M. tuberculosis Beijing/W strains belonging to each node
found in Figure 1 and 2, and respective country of isolation.
133
CHAPTER 1
General Introduction
3 Introduction
Tuberculosis an ancient disease 1.1
Tuberculosis (TB) is an ancient disease. Skeletal abnormalities, typical of TB, were found in
Egyptian mummies, dated of several thousand years ago, and DNA analyses have later confirmed
the presence of the disease-causing pathogen Mycobacterium tuberculosis. At this time TB was
probably sporadic, but, as population densities increased, the disease reached epidemic
proportions in Europe and North America in the 18th and 19th centuries (Daniel, 2006).
The development of a live attenuated vaccine, Bacillus Calmette-Guérin (BCG), by Albert
Calmette and Camille – Guérin in 1921, and the discovery of the first antibiotic against TB,
streptomycin, by Selman Waksman in 1943, led to the opinion that appropriate control measures
had become available for fighting TB. Between 1950 and 1965 TB-control programs were
established. However, these initiatives have had limited success in developing countries. In
industrialized countries there was a pronounced reduction of infection and death rates.
Consequently, TB programs became a lower priority because the disease was considered close to
elimination. In the early 1980s, cases of TB began to raise due to factors such as increases in prison
and homeless populations, intravenous drug use and especially Human Immunodeficiency
Virus/Acquired Immunodeficiency Syndrome (HIV/AIDS) epidemics. By 1993 increasing TB could no
longer be ignored so the World Health Organization (WHO) declared the disease a global
emergency (Daniel, 2006) (Harries and Dye, 2006). In 2000, the World Health assembly endorsed
the establishment of a Global Partnership to Stop TB with several priorities for the next 50 years
(WHO at www.who.int/topic/tuberculosis/en/).
TB today’s major issues 1.2
Despite the efforts to combat the disease, TB remains today a major public-health problem.
Every 15 seconds someone dies from TB, which means that about 1.5 million people die each year
from this treatable disease. The current TB epidemic is being sustained and fuelled by two
important factors: the HIV infection, and its association with active TB disease, and increasing
resistance of M. tuberculosis strains to anti-TB drugs (WHO at
www.who.int/topic/tuberculosis/en/).
Despite the availability of an effective antibiotherapy for decades, tuberculosis control has been
seriously challenged due to the appearance of drug-resistant strains. Drug resistance in M.
tuberculosis arises mainly from spontaneous mutations in the chromosome (Heym et al., 1994),
and not from mobile genetic elements such as plasmids or transposons, acquired by horizontal
4 Chapter 1
gene transfer, as observed in other bacteria. Then, irregular drug supply, inappropriate prescription
and poor patient adherence to treatment allow selection of strains carrying drug-resistance
mutations. These strains can be transmitted and other mutations involved in resistance to
individual drugs can be accumulated resulting in the appearance of multidrug-resistant (MDR)
strains, defined as resistant to at least rifampin and isoniazid, the most effective first-line anti-TB
drugs (WHO at www.who.int/topic/tuberculosis/en/). The WHO estimates that there were 290 000
MDR-TB cases among notified TB cases in 2010 (Figure 1). The estimated number of prevalent
MDR-TB cases seems to reach 650 000 among the 12 million total prevalent cases of TB (WHO,
2011). The number of extensively-drug resistant strains (XDR), defined as MDR plus resistance to
any fluoroquinolone and to one of the three injectable second line drugs (capreomycin, kanamycin,
or amikacin), has been increasing every year, and, by the end of 2010, 77 countries had reported at
least one case of XDR TB to WHO (WHO at http://www.who.int/tb/challenges/mdr/en/index.html).
More recently, the appearance of totally drug-resistant tuberculosis (TDR), resistant to all
antituberculosis drugs, seriously threatens TB control (Velayati et al., 2009).
Figure 1 - Estimated MDR-TB cases among notified TB patients in 2010. From WHO at
http://www.who.int/tb/challenges/mdr/en/index.html.
More than one in ten TB cases occur among HIV-infected people, and almost one in four deaths
among people with HIV is due to TB. In 2010 350 000 people died of HIV-associated TB (WHO,
2011)(WHO at http://www.who.int/tb/publications/TBHIV_Facts_for_2011.pdf). In fact,
immunodeficiency caused by HIV infection greatly increases susceptibility to infection and the risk
of developing TB, which is 21-34 times higher in HIV co-infected individuals than in non-infected
No data
0-300
301-3,000
3,001-30,000
30,001-60,000
>60,000
5 Introduction
(WHO, 2011). On the other hand, TB may accelerate the course of HIV infection, increasing the viral
load in some patients (Day et al., 2004; Whalen et al., 1995). In addition to contribute to an
increase in TB burden in general, HIV might also be contributing to the increase of MDR-TB
prevalence (Wells et al., 2007). Co-infection of TB in HIV patients further complicates treatment
because it has to be combined with antiretroviral therapy. This leads to an increased pill burden,
drug-drug interactions that may lead to suboptimal concentrations of anti-TB drugs, and finally
overlapping side effects (Swaminathan et al., 2010; Wells et al., 2007). Moreover, TB patients co-
infected with HIV are more likely to progress to disease, and thus potentially accelerate the
propagation and spread of these MDR strains (Gandhi et al., 2010). The intersection of drug-
resistance and HIV epidemics might represent a lethal combination and further threaten TB
control.
The development of an effective vaccine against TB could also have a significant impact in the
control of the disease. The only available vaccine today is BCG, a live vaccine derived from an
attenuated Mycobacterium bovis strain, obtained after serial passages (Calmette, 1931). It has
been used since 1921, yet, it has given little contribution to contain the current TB pandemic. It is
effective in protection against disseminated TB in children, like meningitis and miliary TB (Trunz et
al., 2006), but, it seems to have variable efficacy against adult pulmonary TB – the most prevalent
form of disease – being particularly limited in endemic areas (Colditz et al., 1994; Fine, 1995). TB
vaccine research has made huge progress and as a result twelve vaccine candidates have been
developed and entered clinical trials (Kaufmann, 2011). Nevertheless, we do not know with
certainty whether they will confer robust protection against TB in humans.
Finally, enormous progress has been made in the last decade resulting in the appearance of
much promising tools for diagnosing TB (Palomino, 2012). Still, no tests are available that are
universally applicable to all patients including HIV-coinfected people and children with TB, for
which diagnosis is usually more difficult. Additionally, an important gap in this field is the
development of tools to determine progression to disease in people infected with M. tuberculosis
without active disease (latent TB). This would be extremely important given that one-third of the
world’s population seem to be latently infected with M. tuberculosis (WHO at
www.who.int/topic/tuberculosis/en/).
Although the number of incident cases has decreased substantially during the last twenty-years,
Portugal has still an elevated rate of TB incidence, being the highest among western European
countries ((WHO, 2011) - Annex 3). There is also a high prevalence of MDR-TB and alarming rates
6 Chapter 1
of XDR-TB, particularly in the Lisbon Health Region (Direcção Geral de Saúde (DGS) at
http://www.dgs.pt/upload/membro.id/ficheiros/i012626.pdf) (Perdigao et al., 2008).
The genus Mycobacterium 1.3
The first notion that TB could be an infectious disease was described by Benjamin Martens in
1790, followed by Jean-Antoine Villemin who demonstrated, in 1865, the transmissible and
infectious nature of TB in animals (Daniel, 2006). However, it was Robert Koch, in 1882, who first
described the tubercle bacillus, M. tuberculosis (Koch, 1882; Koch, 1982). Nevertheless, the
identification of mycobacteria, however, occurred earlier with the discovery of the leprosy bacillus
in 1873 (Hansen, 1874(Mange, 1992).
Mycobacteria are aerobic non-motile rod-shaped actinobacteria with a high G+C content in their
DNA (61-71%). These bacteria are characterized by an unusual cell envelope composed by mycolic
acids with long branched chains (60 to 90 carbons), which confer alcohol and acid-fast staining
properties (Levy-Frebault and Portaels, 1992; Shinnick and Good, 1994). Along with
Corynebacterium and Nocardia, they form a well-defined sub-group (CMN) of actinobacteria, which
share properties such as the production of mycolic acids (Embley and Stackebrandt, 1994; Ventura
et al., 2007). Other mycolic acid-containing genera include Gordonia, Rhodococcus, Tsukamurella
and Dietzia among others (Gurtler et al., 2004) being thus considered to be closely related to
mycobacteria.
The genus Mycobacterium is highly diverse and comprises more than 100 species (Dworkin et
al., 2006). It can be divided into two major groups’ – fast and slow growers, a traditional division
was found to be congruent by 16S rRNA analyses (Stahl and Urbance, 1990). This definition is based
on the time required for visible colonies to appear on a solid medium, after plating suspensions
diluted enough to give well separated colonies (Shinnick and Good, 1994):
I. Fast growers (colonies in less than seven days) – usually non-pathogenic mycobacteria
and free-living saprophytes that include M. smegmatis, commonly used as a non-
pathogenic model in the laboratory, to study essentially genetics or physiology of
mycobacteria (O'Toole, 2010). An exception would be M. abssecus, a fast grower that is
pathogenic.
II. Slow growers (colonies in more than seven days) – usually associated with human or
animal disease and include important pathogens such as M. leprae, M. ulcerans, and M.
tuberculosis complex members. There are, however, slow growers that are not
pathogenic, such as M. gordonae.
7 Introduction
1.3.1 The Mycobacterium tuberculosis complex
The M. tuberculosis complex includes several closely related species, responsible for
tuberculosis, with different phenotypic properties and host preferences. M. tuberculosis and M.
africanum are almost exclusively human pathogens. M. microti causes disease in voles and M.
pinnipedii causes TB in seals and sea lions. M. caprae infects both goats and deer and, finally, M.
bovis has the largest host range although it can be mainly isolated from cattle (Brosch et al., 2002;
Mostowy et al., 2005; Smith et al., 2006). Some very rare isolates of tubercle bacilli, with the ability
to cause disease in humans, were found to belong to the same phylogenetic lineage as M.
tuberculosis complex members as shown by 16sRNA analyses (van Soolingen et al., 1997). These
bacteria, referred to as M. canetti, have shown unusual smooth colony morphology, in contrast to
the rough colonies produced by the other M. tuberculosis complex members.
1.3.2 Mycobacterial cell envelope
Mycobacteria possess a remarkably complex cell envelope consisting of three principal layers:
the cytoplasmic membrane, the cell wall core and an outer membrane (Figure 2). Cell walls are
constituted by a peptidoglycan – arabinogalactan polymer core with covalently bound mycolic
acids (the mycolyl-AG-peptidoglycan complex) that, along with non-covalently bound, extractable
lipids, form an outermost bilayer structure (Hoffmann et al., 2008; Zuber et al., 2008). Thus,
despite the classification of mycobacteria as Gram-positive bacteria it seems that the
mycobacterial cell envelope contains an outer membrane containing pore-forming proteins
(Niederweis et al., 2010), and, by inference, a periplasmic space (Hoffmann et al., 2008; Zuber et
al., 2008) (Figure 2). This complex structure represents a permeability barrier that contributes to
the intrinsic resistance of mycobacteria to antibiotics, dehydration and chemical damage (Brennan
and Nikaido, 1995; Nguyen and Thompson, 2006). An outer layer (also called capsule) surrounding
the outer membrane (Figure 2), mainly composed of polysaccharides, proteins and only minor
amounts of lipids (Ortalo-Magne et al., 1995), also seems to exist in various mycobacterial species
(Sani et al., 2010). Most of these compounds were found released in the culture fluids of in vitro-
grown bacteria but seem to coat intracellularly grown bacteria (Daffe and Draper, 1998).
Numerous extractable lipids are present in mycobacterial cell walls, being many of these
suspected to be present in the outermembrane. However, their exact arrangement and
distribution remains poorly understood. These include: phthiocerol dimycocerosate (PDIM), a
major lipid of the cell wall, important for virulence, architecture and permeability (Camacho et al.,
1999; Cox et al., 1999); phenolic glycolipids (PGLs), that share a common lipid core with PDIMs and
8 Chapter 1
are also associated with virulence, but are produced by only a few groups of M. tuberculosis (Reed
et al., 2004; Tsenova et al., 2005); as well as glycolipids such as diacyltrehaloses (DAT),
triacyltrehaloses (TAT), sulfatides (SLs), and the mycolic acid derivatives trehalose monomycolate
(TMM) and trehalose dimycolate (TDM) (also known as cord factor) (Kaur et al., 2009).
Other important molecules in the mycobacterial cell envelope are mannosylated molecules such
as lipoarabinomannan (LAM), the related lipomannan (LM), and phosphatidyl-myo-inositol
mannosides (PIMs) (Kaur et al., 2009), that seem to be anchored not only to the outer membrane
but also to the cytoplasmic membrane (Pitarque et al., 2008) (Figure 2). In M. tuberculosis and
other pathogenic mycobacteria LAM is mannose-capped (ManLAM) (Brennan and Nikaido, 1995).
Figure 2 – Mycobacterial cell envelope constitution. LAM: lipoarabinomannan, PIMs: phosphatidyl-myo-
inositol mannosides, TDM: trehalose dimycolate, TMM: trehalose monomycolate. Adapted from Catalão et al.
(2012), with authors’ permission. (Catalao et al., 2012)
As most of these molecules are the first to contact with host cellular constituents, the
importance of these in facilitating host cell entry and modulating the host cell response has been
well documented (discussed in more detail in section 1.5.1).
A large proportion of the M. tuberculosis genome is devoted to fatty acid and lipid metabolism
(Cole et al., 1998). The colocalization of some mmpL (mycobacterial membrane protein Large)
genes with genes involved in polyketide biosynthesis (pks) and lipid metabolism suggested that
MmpLs are generally involved in lipid synthesis and/or transport (Tekaia et al., 1999). This was
found to be indeed the case for MmpL7 (Camacho et al., 2001; Cox et al., 1999) as well as MmpL8
(Converse et al., 2003; Domenech et al., 2004), involved in the transport of PDIM and SL-1,
9 Introduction
respectively. However, certain MmpLs do not colocalize with genes involved in lipid synthesis (Cole
et al., 1998) and it seems that MmpL substrate specificity is dictated, in part, by their interaction
with particular cytosolic enzymes (Jain and Cox, 2005).
Molecular evolution of mycobacteria 1.4
It is important to investigate diversity of bacterial pathogens for both epidemiological, to
elucidate prevalence of strains, and biological reasons, because specific strains or groups of strains
(lineages/families) might have specific relevant phenotypes (e.g. differences in virulence or drug
susceptibility).
M. tuberculosis complex members are genetically extremely closely related when compared to
other bacteria, being thus considered as monomorphic (Achtman, 2008). Therefore, some of the
genotyping tools applied to other pathogens can be uninformative in M. tuberculosis (Achtman,
2008). For example, early attempts at using multilocus sequence typing (MLST) to study strain
diversity in M. tuberculosis complex have shown that these bacteria are characterized by more
than 99.9% similarity at the DNA level and identical 16S rRNA sequences (Sreevatsan et al., 1997).
Despite this apparent genetic homogeneity, M. tuberculosis complex members display diverse
phenotypic characteristics and host ranges and several polymorphic molecular genetic markers
(Figure 3) have proved to be useful to identify and discriminate M. tuberculosis complex isolates.
1.4.1 Molecular genetic markers that define M. tuberculosis complex genetic diversity
One of the most widely applied molecular methods to type M. tuberculosis strains has been the
IS6110 Restriction Fragment Length Polymorphism (RFLP) typing. Individual strains vary in the
number of copies and in the sites into which IS6110 is inserted. A method using a restriction
enzyme has been developed and IS6110 Southern blots of the digested DNA separated by
electrophoresis on agarose gels provide a RFLP pattern (van Embden et al., 1993). Unfortunately,
this method has some limitations and disadvantages such as poor discrimination between isolates
with low copy numbers (<5) of IS6110 and it is even absent from certain strains. In addition, it is a
technically demanding and expensive technique and requires high amounts of DNA (Kato-Maeda et
al., 2011). This has led to the development of other techniques, frequently based in amplification
of DNA, being spacer oligonucleotide typing (Spoligotyping) and variable number of tandem repeat
(VNTR) typing (Frothingham and Meeker-O'Connell, 1998) the most frequently used.
10 Chapter 1
Figure 3 - Representation of M. tuberculosis genome of the H37Rv reference strain, indicating the major
genetic markers used for strain genotyping. As an example one specific mycobacterial interspersed repetitive
unit (MIRU) locus, insertion sequence (IS6110), large sequence polymorphism (region of difference - RD) and
single nucleotide polymorphism are shown. Adapted from Nicol et al. (2008). (Nicol and Wilkinson, 2008)
Spoligotyping involves PCR amplification of the DR locus, a single region of M. tuberculosis
complex strains chromosome that contains multiple copies of a 36-bp direct repeat, separated by a
DNA spacer with various sequences (Kamerbeek et al., 1997). Strains have the same overall
arrangement of spacers but differ in terms of presence or absence of specific spacers. Comparison
with the 43 spacers identified in M. tuberculosis H37Rv, the laboratory reference strain, and M.
bovis BCG, allows discrimination and classification of strains (Van Soolingen, 2001). Forty-one
VNTRs of the mycobacterial interspersed repetitive units (MIRUs) have been identified in M.
tuberculosis genome (Supply et al., 2000). PCR amplification of each locus will reflect the number
of copies of the repeat unit and is the basis of VNTR typing. Several number and combinations of
loci have been used to genotype M. tuberculosis strains which might have similar or higher
discriminatory power than IS6110-RFLP and may also vary according to certain characteristics of
the sample that is being analyzed, such as geographic origin. Thus, the set of loci might have to be
adapted to the type of collection of isolates to analyze. Nevertheless, MIRU-VNTR is considered by
some authors as the gold standard for M. tuberculosis genotyping (Kato-Maeda et al., 2011). These
methods are, however, not reliable for evolutionary and phylogenetic studies (Comas et al., 2009)
because intragenomic recombination events could occur independently at the level of repetitive
sequences (Achtman, 2008).
Recently, systematic comparative genomic analyses have identified Single Nucleotide
Polymorphisms (SNPs) and Large Sequence Polymorphisms (LSPs) as robust markers that generate
11 Introduction
portable and comparable data for studying population variation. This kind of markers have been
especially used to infer phylogenetic relations in M. tuberculosis (Baker et al., 2004; Dos Vultos et
al., 2008; Filliol et al., 2002; Fleischmann et al., 2002; Gagneux et al., 2006a; Gutacker et al., 2006;
Gutacker et al., 2002; Hershberg et al., 2008). LSPs correspond to genomic deletions that have
been suggested as an important mechanism for genetic variation in M. tuberculosis. Affected
sequences might have functional relevance in pathogenesis and immunity since deleted sequences
can include putative open reading frames as well as intergenic regions and housekeeping genes
(Alland et al., 2007). LSPs may be informative markers for discrimination of strains and have been,
therefore, proposed for genotyping and, as these are irreversible mutations, have also been used
for constructing phylogenies and to investigate M. tuberculosis complex evolution (Alland et al.,
2007; Brosch et al., 2002; Gagneux et al., 2006a; Tsolaki et al., 2005). SNPs also contribute to strain
variability and may have a functional effect. For example, drug-resistance is mainly caused by SNPs
in M. tuberculosis (Zhang and Yew, 2009). SNPs have also proved to be useful markers to
differentiate strains and to study the phylogenetic relatedness of M. tuberculosis strains (Dos
Vultos et al., 2008; Hershberg et al., 2008). A high number of such polymorphisms can be identified
by performing whole-genome sequencing which can be extremely informative, particularly for
genetically monomorphic bacteria like M. tuberculosis (Achtman, 2008).
Choosing the appropriate genetic marker will depend on the purpose of the study. For
epidemiologic analyses it is important to have markers with a high discriminatory power that
change relatively rapidly, but, are stable enough to make connections between related isolates. For
example, recognition of the regional specificity of circulating M. tuberculosis strains in Portugal
dates back to 1999 when early RFLP-IS6110 genotyping studies of an MDR cluster in the Lisbon
Health Region identified a prominent family, designated family Lisboa (Portugal et al., 1999). In
subsequent years RFLP-IS6110 and 12 loci MIRU–VNTR genotyping identified clusters of circulating
strains with similar genotypic characteristics (Perdigao et al., 2008; Perdigao et al., 2011), several of
which, including the Lisboa family, were associated with XDR–TB. The results show that active
transmission of MDR- and XDR-TB is taking place and that the high prevalence of observed XDR-TB
is due to the continued transmission of particular genetic clusters such as the Lisboa family,
identified in 1999 as strongly associated with MDR-TB (Portugal et al., 1999) and now associated
with XDR-TB (Perdigao et al., 2008; Perdigao et al., 2011).
To define phylogenetic associations unambiguously, genetic markers, need to be unique and,
ideally, irreversible. Robust phylogenetic markers will exhibit low rates of convergent evolution
12 Chapter 1
(Kato-Maeda et al., 2011) providing solid phylogenetic frameworks in which specific strains can be
positioned and biologically meaningful groups defined.
1.4.2 Phylogeny of the M. tuberculosis complex
Although many molecular methods, such as the referred in the previous section, have been
used to categorize M. tuberculosis complex strains, the phylogenetic relationships among this
group have only recently started to be detailed. Analyses of genomic deletions (LSPs) have shown
that the animal-adapted organisms of the M. tuberculosis complex are part of the same
evolutionary lineage, defined by deletion of region of difference (RD) 9 (Brosch et al., 2002).
Furthermore, M. bovis, which was initially thought to cause disease in a variety of animals, can be
divided in different subspecies characterized by additional specific deletions, which include M.
caprae, M. microti and M. pinnipedii (Brosch et al., 2002; Mostowy et al., 2005). It was suggested
that the M. tuberculosis complex consists of distinct and genetically defined groups with specific
host-adapted groups called ecotypes (Smith et al., 2006). M. africanum shares the RD9 deletion
with these animal-adapted members of the M. tuberculosis complex which has led to the
speculation that it is not primarily adapted to humans but has an animal reservoir (Smith et al.,
2006). However, this remains to be confirmed and meanwhile, given that M. africanum clearly
infects and transmits among humans being responsible for up to 40% of human TB in west Africa
(de Jong et al., 2006; Kallenius et al., 1999), it is considered as human-adapted. The same analysis
of genomic regions also showed that M. canetti had almost all the RD regions intact (Brosch et al.,
2002). Although these strains share the same 16S rRNA sequence with M. tuberculosis complex
members as referred previously, they present high levels of nucleotide variation in housekeeping
genes and clear evidence of horizontal gene transfer (Gutierrez et al., 2005). This suggests that M.
canetti strains are relatives of a highly diverse progenitor of the M. tuberculosis complex, M.
prototuberculosis, that might have underwent an extreme bottleneck in a relatively recent past.
Consequently, much of the original diversity disappeared leaving only M. canetti strains among the
M. tuberculosis complex members (Gutierrez et al., 2005).
Other studies have defined the phylogeny of M. tuberculosis and M. africanum, the human-
adapted species of the M. tuberculosis complex. Gagneux et al. (2006) also used LSPs to describe
six major lineages, two of which included M. africanum. Each lineage seems to be associated with
particular human populations (Figure 4). Several studies have used SNPs for the same purpose.
Baker et al. (2004) analysed polymorphisms in seven housekeeping genes identifying 36
synonymous SNPs (sSNPs) that allowed discrimination of 4 main lineages in M. tuberculosis. These
13 Introduction
four main lineages correspond to the same identified after by Gagneux et al. (2006) using LSPs
(Figure 4).
Figure 4 – M. tuberculosis phylogeography. Current major lineage assignments (lineage 1 to 6) are indicated
by coloured lines. (a) Tree originated from the study of Baker et al. (2004) based on 36 synonymous SNPs
identified by sequencing seven housekeeping genes in a collection of 225 strains. Roman designations correspond
to lineage assignments in the study. (b) Tree based on large sequence polymorphisms (LSPs) discovered by
Gagneux et al. (2006). (c) Association of M. tuberculosis lineages with specific geographic regions according to
data from Gagneux et al. (2006) and Filliol et al. (2006). Adapted from Achtman et al. (2008). (Filliol et al., 2006;
Gutacker et al., 2006)
Gutacker et al. (2006) have screened 5069 isolates for 36 sSNPs that have been identified by
comparison of two M. tuberculosis genomes and defined nine main lineages. Three of these
lineages corresponded to the ones described by Gagneux et al. (2006) and Baker et al. (2004). Filliol
et al. (2006) have used a similar approach to identify 159 sSNPs and screened 219 isolates of M.
tuberculosis and M. bovis. Ten major groups were identified, one of them being specific to M. bovis
and three corresponding to the same previously described (Baker et al., 2004; Gagneux et al.,
2006a). These studies have identified thus, four main M. tuberculosis lineages and two M.
africanum lineages, associated with particular geographic locations (Figure 4).
14 Chapter 1
The fact that both LSP and SNP-based analyses of large strain collections resulted in single trees
without homoplasy indicated that horizontal gene transfer is extremely rare in M. tuberculosis
complex and it has a highly clonal population structure (Supply et al., 2003).
Although these studies have provided a picture of M. tuberculosis and M. africanum evolution,
some limitations didn’t allow a better elucidation. The number of SNPs was either too limited
(Baker et al., 2004) or resulted from comparison of a limited number of genomes which can lead to
branch collapsing (Filliol et al., 2006; Gutacker et al., 2006) and biased phylogenies. As for the
phylogeny inferred from LSPs (Gagneux et al., 2006a), genetic distances based on genomic
deletions are difficult to interpret. In conclusion, genotyping approaches that rely on LSPs or a
limited numbers of sSNPs can define deep phylogenetic population structures, but they are still
characterized by low discriminatory power.
More recently, two studies have contributed to a better knowledge of M. tuberculosis evolution
by overcoming the limitations of the previous studies (Dos Vultos et al., 2008; Hershberg et al.,
2008), providing a more detailed picture of M. tuberculosis phylogeny. These studies reveal that
the human-adapted members of M. tuberculosis complex are much more genetically diverse than
generally recognized and some of this genetic diversity is likely to have functional consequences
(Hershberg et al., 2008). The genetic diversity found among the human-adapted members of M.
tuberculosis complex was just as pronounced as that among animal-adapted strains, even though
the latter are adapted to distinct animal host species (Hershberg et al., 2008). In the study of
Vultos et al. (2008) a specific group of genes was analysed: genes involved in DNA repair,
recombination and replication (3R) genes. In M. tuberculosis the main source of genetic variation
should arise from random mutations, although it was recently suggested that recent recombination
might also occur in M. tuberculosis (Namouchi et al., 2012). Defective 3R systems can potentially
increase genomic variability due to higher mutation rates (Denamur and Matic, 2006; Tonjum and
Seeberg, 2001). Thus, polymorphisms in 3R genes seems to be an important mechanism in
evolution and adaptation of microorganisms (Taddei et al., 1997; Tonjum and Seeberg, 2001) as
strains with higher mutation rates (mutators) may, under certain conditions, have a selective
advantage. Analysis of polymorphisms in such genes in a collection of strains representative of
global M. tuberculosis complex diversity has identified high levels of polymorphisms, suggesting
that these genes may have a role in M. tuberculosis complex evolution (Dos Vultos et al., 2008). In
2010, Comas et al. (2010) used 21 whole genome sequences to generate the first whole genome –
based phylogeny of human-adapted M. tuberculosis, and confirmed the existence of six main
phylogenetic lineages. More recently whole genome analysis of M. tuberculosis complex strains
15 Introduction
from major lineages has also confirmed previous phylogenetic analysis using finished and partial
genome data (Namouchi et al., 2012). It was also shown that purifying selection is acting on M.
tuberculosis genetic diversity (Namouchi et al., 2012), in contrast to what has been previously
suggested (Hershberg et al., 2008).(Comas et al., 2010)
There is increasing evidence that the observed M. tuberculosis strain variation is biologically
significant and that specific genotypes are associated with specific phenotypes. Indeed, different
M. tuberculosis genotypes show differences in terms of virulence and pathogenesis in animal
models (Lopez et al., 2003; Palanisamy et al., 2009) as well as survival and transcriptional profiles
within macrophages (Homolka et al., 2010). Although this genetic diversity seems to influence
clinical presentation of the disease in humans (Caws et al., 2008; Thwaites et al., 2008) this is still
not so clear (Coscolla and Gagneux, 2010) as several factors have a role in the development of TB.
One of the most studied M. tuberculosis genotypes due to its association with increased virulence,
as well as other characteristics that suggest that these strains have a selective advantage and are
more adapted than strains from other genotypes, is the Beijing/W family (East-Asian lineage
according to Gagneux et al. (2006)).
1.4.3 The Beijing/W family
The Beijing family was first described in 1995. A large proportion of M. tuberculosis strains in
the Beijing area of China had highly similar multi-banded IS6110 RFLP patterns and identical
spoligotyping patterns (van Soolingen et al., 1995). In the second half of the 1990’s the multidrug
resistant M. tuberculosis strain identified in New York, “W” strain (Bifani et al., 1996), was
recognized as a member of the Beijing genotype family which became the Beijing/W family (Bifani
et al., 2002; Kurepina et al., 1998). Since then, the Beijing/W genotype was found to be the most
frequently observed genotype of M. tuberculosis to cause disease globally (Glynn et al., 2002).
According to the fourth international spoligotyping database, strains from this genotype were
found to be present in the largest number of countries globally and represented 13% of global
isolates (Brudey et al., 2006). In some regions including Russia, Bangladesh, South Africa, and
Western Europe, the incidence of Beijing/W strains seems even to be increasing (Tuberculosis,
2006). This contrasts to what seems to happen with other genotypes that appear to be
predominantly restricted to defined geographical regions, and suggests that Beijing/W strains
might have some selective advantage that have allowed their global spread.
When compared to other genotypes, Beijing/W strains were found to grow significantly faster in
human macrophages (Li et al., 2002; Theus et al., 2004) and have shown increased virulence in
16 Chapter 1
different animal models of infection (Lopez et al., 2003; Tsenova et al., 2005). However, it is not
possible to conclusively demonstrate an association between the Beijing/W strain genotype and
clinical presentation in humans (Coscolla and Gagneux, 2010; Parwati et al., 2010). In addition,
Beijing/W strains are often associated with drug-resistance (Tuberculosis, 2006).
Beijing/W strains share several genetic characteristics (Bifani et al., 2002) which differentiate
them from other all M. tuberculosis genotypes, including: a spoligotyping pattern containing at
least three of the nine spacers, 35 to 43, with an absence of hybridization to spacers 1 to 34, which
classically define and identify Beijing/W strains (Kremer et al., 2004); similar IS6110 RFLP patterns
(15-26 copies); IS6110 insertion between dnaA and dnaN genes encoding DNA replication proteins
and insertion of variable numbers of IS6110 in the noise transfer function (NTF) chromosomal
region (Kurepina et al., 1998) that define typical/modern (one or several IS6110 insertions) and
atypical/ancient (no IS6110 insertions) Beijing/W strains (Mokrousov et al., 2006). VNTR typing has
been the most frequently used marker to discriminate Beijing/W strains. However, special
consideration is given to VNTR typing of Beijing/W isolates once the standardized set of 15 or 24
loci used to type M. tuberculosis strains are not always sufficient to discriminate among Beijing/W
isolates (Iwamoto et al., 2007). In addition VNTR loci might have different discriminatory powers
among Beijing/W strains depending on strain collection characteristics such as geographical origin
(Kremer et al., 2005).
By comparative whole-genome hybridization of Beijing/W strains Tsolaki et al. (2005) have
shown that there are LSPs associated with this family. These correspond to genomic regions
variably deleted in Beijing/W strains in relation to M. tuberculosis H37Rv (RDs). RD105, RD181,
RD150, RD142, were found to, not only define but also subdivide this family into four different
subgroups (Tsolaki et al., 2005) that might be associated with different phenotypes. Hanekom et al.
(2007) have shown that the Beijing/W family can be divided into seven different lineages and that,
by analysis of epidemiological data, differences between these lineages in their ability to spread
and cause disease might exist. Thus, even closely related strains from the same lineage can
accumulate genomic diversity, which can lead to different pathogenic properties. Indeed, an earlier
study has shown that not all Beijing/W strains are hypervirulent in mice (Dormans et al., 2004). In
subsequent studies this difference among Beijing/W strains was shown in different animal models
(Aguilar et al., 2010; Palanisamy et al., 2009) as well as in human macrophages (Theus et al., 2007).
A very recent study has shown, in guinea pigs, that the LSP-defined Beijing/W sublineages have
indeed differences in pathogenicity (Kato-Maeda et al., 2012).
17 Introduction
Several studies have focused on the possible mechanisms underlying the success of Beijing/W
strains. However, the results reflect, most of the times, this genetic variability observed among
Beijing/W strains. For example, the increased virulence observed for Beijing/W strains was initially
associated with the production of a polyketide synthase derived PGL (Tsenova et al., 2005).
However, it was shown later that PGL could be a virulence factor only for a fraction of Beijing/W
strains (Reed et al., 2007), not explaining the success of the entire family. It was shown though that
all Beijing/W strains tested, representing all LSPs-defined Beijing/W sublineages (Tsolaki et al.,
2005), accumulated large quantities of another kind of fatty acids, triacylglycerides associated with
constitutive overexpression of the dormancy regulon (DosR)(Reed et al., 2007), a transcriptional
program that is utilized by the bacterium to adapt for survival during periods of nonreplicating
persistence in vitro and it has been proposed to be associated with survival of the bacillus during
latent TB infection (Voskuil et al., 2003). Some authors believed that BCG vaccination is a risk factor
for developing TB in populations infected with Beijing/W strains and might even be a selective
force favoring the spread of Beijing/W strains (Abebe and Bjune, 2006). One epidemiological study
suggested that this association can be found in certain specific group of Beijing/W strains,
however, most epidemiological studies did not find a higher proportion of Beijing/W strains among
BCG-vaccinated individuals (Kremer et al., 2009).
Even though many studies have focused on this subject, the mechanisms responsible for the
apparent global success of Beijing/W strains remain unclear. Therefore, it is important to continue
to investigate genetic diversity of M. tuberculosis strains even among strains from the same
subgroup/family, because these might be responsible for the phenotypic variability observed, and
could explain the emergence of specific groups of strains.
M. tuberculosis infection 1.5
M. tuberculosis infects approximately one third of the world’s population. However, only 5 to
10% of these infected individuals will develop symptomatic disease at some point in their lives
(WHO at www.who.int/topic/tuberculosis/en/). In most cases (90-95%) the pathogen is contained,
but not eliminated, by the immune response mounted by the host (Kaufmann and McMichael,
2005). This is called latent infection – when a person is infected but is asymptomatic.
The mechanisms that determine progression to disease are not well understood but seem to be
determined by environmental and socio-economic factors (e.g. exposure to environmental
18 Chapter 1
mycobacteria, overcrowding), host factors (e.g. malnutrition, genetic predisposition) as well as
mycobacterial factors (e.g. genetic variation of mycobacterium) (Comas and Gagneux, 2009).
Pulmonary infection due to the interaction of the bacillus with host immune cells results in the
formation of a granuloma (Flynn et al., 2011), the typical pathologic hallmark of TB. This structure
provides the conditions for the bacillus to grow, and the immunologic environment, in which cells
with antimycobacterial functions interact to prevent and control dissemination of infection.
However, this structure does not always avoid progression into disease. Therefore, understanding
the molecular mechanisms occurring inside granulomas, that are likely to contribute to host
protection as well as disease progression, is essential to better understand TB infection.
1.5.1 Recognition of M. tuberculosis and initiation of immune response
Infection starts after inhalation of aerosols containing small numbers of bacilli that have been
expulsed to the air by an infected individual. Once, bacteria reach the lung alveoli these are taken
up by phagocytes, primarily resident alveolar macrophages, although dendritic cells (DCs) can also
be infected (Kaufmann and McMichael, 2005) (Figure 5). Interaction with these innate immune
cells is the first line of host defense against pathogens. M. tuberculosis initial interactions with host
cells are greatly mediated by pattern recognition receptors (PPRs), such as Toll-like receptors (TLRs)
and C-type lectins. These receptors recognize microbial determinants and bridge innate and
adaptive immune responses by regulating pro- and anti-inflammatory cytokine production as well
as endosomal and phagosomal traffic.
TLRs play a critical role in the recognition of several pathogens (Akira et al., 2006). In M.
tuberculosis one of the most important TLRs identified so far is TLR2 (Ferwerda et al., 2005) that
recognizes mycobacterial structures expressed at the surface of the bacteria such as LAM and PIM,
as well as the 19 kDa lipoprotein (Ryffel et al., 2005). The role of TLRs in controlling M. tuberculosis
in mice remains, however, controversial (Drennan et al., 2004; Reiling et al., 2002; Sugawara et al.,
2003). Nonetheless, polymorphisms in TLR2 have been associated with increased susceptibility to
TB in humans, suggesting that these receptors do have an important role in human host defense
against mycobacteria (Velez et al., 2010).
TLRs signals result in the activation of nuclear transcription factor (NF)-kB and, consequently,
the transcription of genes producing pro-inflammatory cytokines, chemokines, as well as nitric
oxide (Ryffel et al., 2005). TLR2 was also found to be essential for M. tuberculosis-induced reactive
oxygen species (ROS) production (Yang et al., 2009). In addition, TLR-dependent ROS were found to
be important signaling molecules and priming factors in the upregulation of early inflammatory
responses during TB Infection (Lee et al., 2009a; Shin et al., 2008; Yang et al., 2008). However, it
19 Introduction
has been shown that either expression of early secreted antigenic target protein 6 (ESAT-6), a
secreted antigen of M. tuberculosis associated with lower innate immune responses to infection, or
a peptide derived from it, is able to attenuate TLR signalling (Pathak et al., 2007). TLRs might have
thus a dual role during M. tuberculosis infection.
TLRs are strongly implicated in the induction of cytokines and chemokines, but they are not
strongly linked to phagocytosis (Underhill, 2007). Phagocytosis of M. tuberculosis by human
macrophages occurs primarily via the mannose receptor (MR) (Schlesinger, 1993), a C-type lectin,
expressed in high levels by alveolar macrophages (Stephenson and Shepherd, 1987). M.
tuberculosis ManLAM recognition through these receptors seems to inhibit production of the pro-
inflammatory cytokine IL-12 (Nigou et al., 2001). Furthermore, it was shown that M. tuberculosis
association with these receptors are also implicated in inhibition of phagosome fusion with
lysosomes in primary human macrophages (Kang et al., 2005; Torrelles et al., 2006), a key
mechanism for M. tuberculosis evasion of host immune responses (discussed in more detail in
section 1.6.1). Therefore, M. tuberculosis interaction with MRs inhibits the phagocytic response
and induces and anti-inflammatory response, favouring bacteria’s infection. Phagocytosis of
pathogens can also be mediated by opsonins, host factors such as immunoglobulin that attach to
the surface of the pathogen, acquiring a conformation that is recognized by phagocytic receptors.
Fcγ receptors that bind to the Fc portion of immunoglobulins, are responsible for opsonized
phagocytosis of mycobacteria leading to phagolysosomal fusion (Armstrong and Hart, 1975). Until
recently there were not studies about the relevance of such receptors during infection with M.
tuberculosis in vivo probably due to the prevailing view that humoral immunity has little or no role
in defence against this pathogen. Maglione et al. (2008) have shown that this kind of receptors are
important for M. tuberculosis recognition and host defence, as a mice lacking this receptor had
enhanced susceptibility and immunopathology to infection, associated with increased production
of immunosuppressive cytokines. (Maglione et al., 2008)
Another C-type lectin described as important to bind M. tuberculosis in dendritic cells is DC-
SIGN (dendritic cell-specific intercellular adhesion molecule-3 grabbing nonintegrin) that also
recognizes ManLAM and other ligands in mycobacterial cell envelope (Tailleux et al., 2003).
Interestingly, DC-SIGN is also expressed by alveolar macrophages in tuberculosis patients (Tailleux
et al., 2005) suggesting an important role for this molecule during TB in humans. Even though
different studies about SNPs in the promoter region of DC-SIGN gene CD209 have shown
contradictory results (Barreiro et al., 2006; Vannberg et al., 2008), a role for DC-SIGN in protection
against infection by M. tuberculosis seems to be the case. Mycobacteria recognized by SIGNR3, a
20 Chapter 1
DC-SIGN homologue in mice, expressing phagocytes induced key inflammatory cytokines, including
TNF-α (Tanne et al., 2009) as well as phagolysosome fusion in contrast to MR receptors also
recognizing ManLAM (Kang et al., 2005). However, a previous study has suggested that binding of
mycobacterial components to human DCs DC-SIGN leads to enhanced release of the anti-
inflammatory cytokine IL-10 and impair DC maturation through ManLAM in vitro (Geijtenbeek et
al., 2003). Thus, the role of DC-SIGN in TB pathogenesis remains to be further investigated.
The precise receptor involved in M. tuberculosis recognition may have a major impact on the
survival chances of this pathogen once inside macrophages. Recognition of particles through TLRs
results in an inflammatory response and increased respiratory burst while internalization via MRs
prevents this kind of responses which occur in activated macrophages. Salmonella typhi appears to
survive inside phagosomes by entering a receptor-mediated pathway not coupled with
macrophage activation (Ishibashi and Arai, 1990), however, for mycobacteria, it is not clear if there
is selective receptor-mediated intracellular survival as pathogenic strategy. It seems more likely
that different entry routes result in different cytokine production and traffic fates leading to
differential survival of M. tuberculosis.
1.5.2 Granuloma formation
The interaction of M. tuberculosis with phagocytes results in the production of pro-
inflammatory cytokines, such as TNFα and IL-12, as well as chemokines. These molecules will drive
the recruitment of monocytes, neutrophils and B cells. Effector T cells that have been, in the
meantime, primed against mycobacterial antigens by DCs, in the draining lymph nodes, will also be
recruited to the infection sites (Figure 5). These cells produce their own cytokines and chemokines,
such as IFNγ, that will activate and enhance the antibacterial activity of macrophages, and amplify
cellular recruitment (Flynn et al., 2011; Kaufmann and McMichael, 2005; Russell, 2007). However,
an intense inflammatory response like this has propensity to tissue damage. Therefore, anti-
inflammatory cytokines like IL-10, IL-27 and TGF-β are also produced and downregulate pro-
inflammatory cytokines, as well as T cell proliferation and activation, balancing the response
between bacterial eradication and host survival and culminating in the formation of a granuloma
(Flynn et al., 2011; Russell, 2007). The granuloma contains, but does not eliminate the infection, as
some resistant bacilli, capable of surviving under stressful conditions generated by the host, escape
killing.
21 Introduction
Figure 5 – M. tuberculosis infection and granuloma formation. (a) Mycobacterium tuberculosis infection starts
with inhalation of bacilli that reach the lung alveoli. (b) In the alveolus, the main host cells are alveolar
macrophages. However, bacteria can also be taken up by dendritic cells (DCs), which carry M. tuberculosis either
to the lung parenchyma, leading to initiation of the local inflammatory response, or to the draining thoracic lymph
nodes. (c) In draining lymph nodes, mycobacterial antigenic peptides are presented to the specific naïve T cells
through cross-presentation. Activated T cells proliferate, become effector T cells and leave the lymph node. (d)
Effector T cells reach the site of inflammation under the influence of chemokines and other mediators.
Extravasations of the mononuclear cells initiate the formation of a granuloma at the infection site. The classic TB
granuloma is composed of a central core of infected macrophages surrounded by epithelioid and foamy
macrophages and a peripheral rim of lymphocytes (B cells, CD4+ T cells and CD8
+ T cells) in association with a
fibrous cuff of extracellular matrix laid by fibroblasts. Adapted from Griffiths et al. (2010). (Griffiths et al., 2010)
In an early stage the granuloma is an organized, stratified, and vascularized structure composed
of mainly macrophages in the center that are surrounded by a mantle of lymphocytes enclosed
within a fibrous cuff that marks the periphery of the granuloma (Figure 5). As this structure
matures, it develops an extensive fibrous capsule, gets less vascularized and, in later stages, starts
22 Chapter 1
to become necrotic in the center of the structure (Russell, 2007). Ultimately, the granuloma
caseates, ruptures and spills infectious bacilli into the airways, resulting in active pulmonary
disease (Russell, 2007). In chronic or latent TB, granulomas can become calcified and contain the
pathogen (Russell, 2007; Ulrichs and Kaufmann, 2006) for many decades. Although the precise
state of M. tuberculosis in these latent granulomas is not clear it seems that it exists mainly in a
dormant non-replicative state (Ulrichs and Kaufmann, 2006), in a hypoxic environment and with
nutrient deprivation. The dosR regulon was found to play a critical role in preparing M.
tuberculosis for this hypoxic environment and an essential step towards dormancy, involving
induction of several genes expression (Schnappinger et al., 2003; Voskuil et al., 2003). These
dormant non-replicating bacteria may resuscitate into an active and replicative state. However,
how this determines transformation into active disease remains to be determined.
Macrophages are the primary cellular components of the granuloma and the initiating cells for
the formation of the granuloma (Flynn et al., 2011). These are the cells that most frequently
interact with M. tuberculosis as well as with the other cells within the granuloma. Thus,
understanding the interactions between M. tuberculosis and the macrophage is essential.
M. tuberculosis interactions with macrophages 1.6
M. tuberculosis is extremely adapted to host macrophages and it has developed several evasion
mechanisms to allow its survival inside these cells. Optimal mycobacterial growth during infection
seems to be even dependent on the entry into macrophages. M. tuberculosis-infected mice
depleted of macrophages had decreased bacterial loads and increased survival (Leemans et al.,
2001). On the other hand, macrophages are important to contain infection. Activated macrophages
seem to be important for early infection control, when only innate immunity is operant (Clay et al.,
2007) and to contribute to mycobacterial growth restriction in infected mice (Leemans et al.,
2005). Infections using M. marinum and embryonic zebrafish model in the absence of macrophages
led rapidly to high bacterial burdens (Clay et al., 2007) contradicting the previous results on mice
(Leemans et al., 2001). Thus, macrophages seem to play a dual role during infection: they provide
the preferred hiding and replication site of M. tuberculosis and protection from extracellular host
defense mechanisms, but display, at the same time, antimicrobial functions.
23 Introduction
1.6.1 M. tuberculosis evasion of macrophage’s antimicrobial mechanisms
Macrophages are professional phagocytes extremely qualified to internalize and eliminate most
invading organisms (Flannagan et al., 2009). After phagocytosis, the phagosome fuses with early
endosomes, late endosomes and lysosomes (Desjardins et al., 1994), culminating in the formation
of phagolysosomes. During the course of maturation, phagosome becomes a highly acidic,
oxidative and degradative environment with microbicidal substances. However, M. tuberculosis has
the ability to subsist inside these cells. Several studies have been done in which bacterial, as well as
host transcriptome, have been analyzed to have a better idea of the intracellular/phagosomal
environment as well as host-pathogen interactions. One of the first studies (Schnappinger et al.,
2003) has confirmed that M. tuberculosis inhabits, in mouse macrophages, a nitrosative, oxidative,
hypoxic and nutritional limited environment. It has also shown that M. tuberculosis seems to shift
to lipid metabolism, as carbon and energy source, given the limitation of nutrients, as it was
previously suggested (McKinney et al., 2000). Many of these responses seem to be different from
those described for other intracellular pathogens like E. coli and Salmonella enterica (Schnappinger
et al., 2003). Another transcriptomic analysis made using human macrophages has shown similar
results to the ones obtained by Schnappinger et al. (2003) and reveals the differences between
macrophages and DCs in response to infection with M. tuberculosis (Tailleux et al., 2008). One of
such differences was in production of superoxide, found to be much more pronounced in
macrophages than in DCs. More recently, a core intracellular transcriptome was established
through the examination of different strains representing the global phylogeographic diversity
of M. tuberculosis (Homolka et al., 2010). It was shown that genetic diversity resulted in functional
diversity, reflecting the power that genetic variation exerts on gene expression, and, consequently,
on host interactions. Among the important genes, for M. tuberculosis intracellular lifestyle, shared
by all strains there were genes involved in hypoxia, radical stress, cell wall remodeling and lipid
metabolism. All these studies represent, however, M. tuberculosis infection of macrophages in
culture which might not reflect all the environments that the bacteria face in the human host.
Interestingly, a study has analyzed the transcriptome of M. tuberculosis from clinical lung samples
(Rachman et al., 2006). Overall, this study identified the same class of genes previously identified in
the in vitro transcriptomic studies referred above. The major difference was that a higher
proportion of genes was identified reflecting a more accurate representation of M. tuberculosis
transcriptomic profile during natural infection.
M. tuberculosis has developed several strategies to evade mechanisms of antimicrobial
destruction by macrophages allowing its survival inside these cells. One of the most studied
24 Chapter 1
mechanisms used by M. tuberculosis to survive inside macrophages is the inhibition of normal
phagosome maturation.
1.6.1.1 Inhibition of phagosome maturation
ManLAM recognition through MRs seem to be implicated in inhibition of phagosome fusion
with lysosomes (Astarie-Dequeker et al., 1999; Kang et al., 2005), as previously referred. This
component of M. tuberculosis cell envelope interferes with the recruitment of early endosome
antigen 1 (EEA1), required for fusion of early phagosomes with late endosomal and lysosome
compartments (Flannagan et al., 2009). This seems to be mediated by interference with calcium
flux in the macrophage cytoplasm (Malik et al., 2003) that will also prevent accumulation in the
phagosomal membrane of phosphatidylinositol-3-phosphate (PI3P) (Vergne et al., 2003), a docking
site for several effector proteins involved in fusion of phagosomes and lysosomes, including EEA1
(Flannagan et al., 2009).
Besides cell wall components, secreted proteins have also been implicated in the modulation of
M. tuberculosis phagosome, even though how these are released from bacterial cells to the
macrophage cytosol remains an intriguing question. SapM is a mycobacterial phosphatase that
specifically hydrolyses PI3P, consequently reducing its concentration (Vergne et al., 2005). Thus, M.
tuberculosis seems to possess different mechanisms that target the same protein (PI3P) in order to
arrest early endosome maturation. PtpA is a low-molecular-weight tyrosine mycobacterial
phosphatase that seems to interfere with human Vps33B (vacuolar protein sorting 33B) (Bach et
al., 2008), a host cytosolic protein that is part of a complex that regulates vesicle docking and
fusion (Flannagan et al., 2009). PtpA acts probably by dephosphorylation of Vps33B, therein,
interfering with VPS33B association with small Rab GTPases, like Rab7, required for proper
membrane fusion (Chao et al., 2010; Flannagan et al., 2009). Another mechanism of phagosome
maturation arrest (PMA) relies on prolonged retention on the phagosome by M. tuberculosis of
coronin-1 (or TACO) (Deghmane et al., 2007), a host factor involved in regulation of actin-based
dynamics (de Hostos, 1999) that specifically prevents lysosomal delivery. It seems that coronin-1
retention is mediated by LpdC (lipoamide dehydrogenase C) (Deghmane et al., 2007), a component
of the antioxidant enzyme complex peroxynitrite reductase/peroxidase (Rhee et al., 2005).
However, the exact mechanism to this retention is unclear. A nucleotide diphosphate kinase (Ndk)
inhibits phagosome maturation by deactivation of Rab5 and Rab7 GTPases (Sun et al., 2010). Rab
proteins are thought to be involved in targeting and tethering the endomembrane organelles to
form phagosomes (Flannagan et al., 2009).
25 Introduction
Several other mycobacterial proteins have been proposed to play a role in PMA, although, many
times, the exact mechanism or cellular target that interferes with phagosome maturation is
unknown. It is the case of PknG, a serine/threonine protein kinase, present in the genome of all
pathogenic mycobacteria, which inactivation by gene disruption or chemical inhibition results in
maturation of phagosome containing mycobacteria (Walburger et al., 2004). It is proposed that this
protein might phosphorylate and interfere with a host protein that is involved in phagosome
maturation, therefore, preventing its activity. Many other potential factors involved in PMA have
been identified in independent screenings using M. tuberculosis mutants (Brodin et al., 2010;
MacGurn and Cox, 2007; Pethe et al., 2004). However, if these are specific for PMA remains to be
elucidated given that these studies don’t identify most of the mutants in common.
The prevention of phagosome maturation allows pathogenic mycobacteria to reside in an early
phagosome that can access to nutrients such as iron via recycling endosomes (Clemens and
Horwitz, 1996) and avoid antigen-presenting compartments, consequently altering host immune
responses (Ramachandra et al., 2001). In addition, this phagosome has a pH close to neutral (6.4),
correlated with an absence of the vesicular proton-ATPase responsible for acidification of the
phagosome (Sturgill-Koszycki et al., 1994). However, there is still a drop in pH from 7 to 6.4 that
seems to be a signal resulting in the expression of several genes in M. tuberculosis (Rohde et al.,
2007), possibly regulated by PhoP (Walters et al., 2006), the transcriptional regulator of the two-
component system, PhoPR. Indeed, PhoPR seems to be an important for M. tuberculosis to
successfully adapt to the environment found in the host. PhoP regulates a diverse regulon of more
than 150 genes (Gonzalo-Asensio et al., 2008; Walters et al., 2006) including genes involved in lipid
metabolism, general metabolism, and respiration. It also seems to control M. tuberculosis hypoxic
response, by regulating part of the genes regulated by the DosR regulon, including the dosRS genes
(Gonzalo-Asensio et al., 2008). M. tuberculosis phoP mutants are attenuated for growth in mice
(Perez et al., 2001; Walters et al., 2006) and human (Ferrer et al., 2010; Walters et al., 2006)
macrophages which could be, in part, due to their impaired ability to induce PMA (Ferrer et al.,
2010).
PMA was initially proposed as a requirement for the survival of the pathogen (Armstrong and
Hart, 1971). But years later it was shown that live M. tuberculosis can traffic to phagolysosomes, by
opsonization with specific anti-mycobacterial antibodies without affecting bacterial survival
(Armstrong and Hart, 1975). Indeed, mutants that traffic to late compartments that do not have
decreased intracellular survival have been identified (Brodin et al., 2010; MacGurn and Cox, 2007;
Pethe et al., 2004). This means that M. tuberculosis capacity to persist inside macrophages depends
26 Chapter 1
also in its ability to resist against nitrosative and oxidative stress, caused by reactive nitrogen and
oxygen species, as well as acidic conditions, lysosomal hydrolases and antibacterial peptides
produced by macrophages (Flannagan et al., 2009).
1.6.2 Nitrosative and oxidative stress relevance in tuberculosis
Upon phagocytosis, the first microbicidal activity any microbe will encounter in macrophages
are ROS. The phagocyte NADPH oxidase (phox) complex assembles in the phagocytic cup early in
the process of phagocytosis and generates ROS (Minakami and Sumimotoa, 2006). Reactive
nitrogen species (RNS) are produced by inducible nitric oxide synthase (iNOS). In contrast to
NADPH oxidase, iNOS activity requires de novo protein synthesis and its transcription is triggered
after macrophage activation through PPR signaling together with pro-inflammatory cytokines, such
as IFNγ (Fang, 2004). Macrophage activation also leads to an increased production of ROS (Bedard
and Krause, 2007). Both RNS and ROS can be quite harmful to intracellular pathogens (Flannagan et
al., 2009).
The importance of nitric oxide production in control of tuberculosis is well established in the
mouse model (MacMicking et al., 1997). An early study has also shown that generation of nitrogen
species by iNOS, upon mouse macrophage activation, was responsible for M. tuberculosis growth
inhibition and killing inside these cells (Chan et al., 1992). However, the role of RNS in humans has
been discussed because it is still not clear if these molecules are mycobactericidal in human
macrophages. Human alveolar macrophages were able to kill M. bovis BCG through a NO-
dependent manner (Nozaki et al., 1997). However, another study has shown that the early
inhibition of mycobacterial growth by human alveolar macrophages is NO-independent (Aston et
al., 1998). Other authors have also suggested that killing of the tubercle bacilli is NO-independent
in human macrophages after activation trough TLRs (Thoma-Uszynski et al., 2001) and that these
cells activated with IFNγ didn’t produce detectable amounts of NO. On the other hand, it was
demonstrated that iNOS expression is up-regulated in alveolar macrophages from human
pulmonary TB lesions (Nicholson et al., 1996), associated with increased pulmonary NO exhalation
(Wang et al., 1998). The same has been observed in human granulomas caused by M. tuberculosis
(Choi et al., 2002; Facchetti et al., 1999). These observations in human lesions from people with TB
support the idea that NO must have a role in human host defense against infection with M.
tuberculosis.
27 Introduction
The biological significance of ROS is clearly demonstrated in patients with chronic
granulomatous disease (CGD), a disease characterized by total absence or low level of ROS caused
by a deficiency of Phox. These persons are highly susceptible to bacterial, fungal and yeast
infections (Heyworth et al., 2003). Increasing numbers in cases of mycobacterial diseases are being
recognized in patients with CGD. A number of patients with BCG disease, clinical disease caused by
BCG vaccine, and tuberculosis have been reported (Bustamante et al., 2007). Nevertheless, the
significance of ROS in host defence against M. tuberculosis remains controversial. Despite the early
demonstration that ROS can be mycobactericidal (Walker and Lowrie, 1981), studies have shown
later that M. tuberculosis could be in fact resistant to killing by oxidative stress caused by
macrophages (Manca et al., 1999). However, no effect on M. tuberculosis intracellular growth in
Phox-deficient mice macrophages was observed (Chan et al., 1992), even though phagocytes
collected from patients with CGD failed to destruct intracellular BCG (Lamhamedi-Cherradi et al.,
1999). In addition, studies using M. tuberculosis-infected mice defective in the production of ROS
are not always congruent (Adams et al., 1997; Cooper et al., 2000; Jung et al., 2002), but in general,
these mice seem to be relatively resistant to TB. These results might be explained by the fact that
M. tuberculosis possesses efficient resistance mechanisms against ROS, thus rendering
antimicrobial effects of these agents ineffective and masking the effects of M. tuberculosis growth
during infection in the absence of ROS.
1.6.3 M. tuberculosis responses against oxidative stress caused by ROS
1.6.3.1 The formation of ROS
ROS are constantly produced as by-products of aerobic respiration. Therefore, oxidative stress is
an unavoidable consequence of the aerobic lifestyle. Aerobic organisms have evolved in order to
maintain levels beneath toxicity avoiding oxidative stress caused by these endogenous ROS (Storz
and Imlay, 1999). Other sources might increase ROS concentrations and perturb this balance in the
redox state of the cell and oxidative stress occurs. This happens when bacteria is captured by
phagocytes, which generate ROS as part of their antimicrobial response (Flannagan et al., 2009).
Phox, expressed mainly in macrophages (including alveolar macrophages) and neutrophils,
generates ROS through the reduction of molecular oxygen (Bedard and Krause, 2007). Phox is a
multi-subunit complex, consisting of a transmembrane heterodimer composed of NOX2 (gp91phox)
and p22phox, known as cytochrome b, the catalytic part of Phox. In resting macrophages, these
transmembrane components are localized mainly in plasma membranes (Bedard and Krause, 2007;
28 Chapter 1
Bylund et al., 2010). Upon phagocytosis it assembles with three cytosolic subunits, p47 phox, p67 phox
and p40 phox, as well as with Rac, and becomes activated (Minakami and Sumimotoa, 2006) (Figure
6).
Figure 6 - Assembly of the phagocyte NADPH oxidase NOX2. Upon activation, the cytosolic components
p47phox
, p67phox
, p40phox
, and Rac2 translocate to cytochrome b and form a functional NADPH oxidase. The active
enzyme complex transports electrons from cytoplasmic NADPH to extracellular or phagosomal oxygen to generate
superoxide (O2−). Adapted from Bylund et al. (2010).
The active oxidase transfers electrons from cytosolic NADPH to molecular oxygen, releasing
superoxide (O2-) into the phagosomal lumen (Bedard and Krause, 2007) (Figure 6 B). Superoxide
has a low reactivity, and, consequently, low bactericidal potential. It cannot cross bacterial lipidic
membranes at neutral pH but it may do it at acidic pH, found in the phagolysosomes (Storz and
Imlay, 1999). However, superoxide rapidly dismutates into hydrogen peroxide (H2O2)
(spontaneously especially at low pH, or catalysed by superoxide dismutase) which readily
permeates biological membranes and oxidize several molecules. Finally, H2O2 in turn can produce
hydroxyl radicals (•OH) (Figure 7), which are strong oxidants, when reacting with iron in what is
known as Fenton reaction (discussed below).
29 Introduction
Figure 7 – Reactive oxygen species decomposed from
superoxide produced by phagocyte oxidase. Adapted from
Fang et al. (2004).
The contribution of NOX2 to microbial killing lies in both direct effects, due to ROS damaging
character on proteins, lipids and nucleic acids (Imlay, 2008; Storz and Imlay, 1999; Zahrt and
Deretic, 2002), as well as indirect effects through changes in the phagosomal pH and ion
concentrations (Bedard and Krause, 2007). ROS also seem to be involved in cellular signaling,
especially because of their potential for protein oxidation. For example, phosphatases inhibition by
oxidation of cysteines in their catalytic region (Denu and Tanner, 1998), might affect the
phosphorylation state of numerous other proteins involved in signal transduction. In macrophages,
ROS seems to have an important function in activation of kinases and transcription factors, gene
expression, regulation of proliferation, and apoptosis (Bedard and Krause, 2007).
Bacterial pathogens have developed strategies to counteract production of ROS by the host,
which interfere with the synthesis of these products, catabolize or repair the damage caused by
them. Most of what we know about these mechanisms is due to its study in E. coli and S.
typhimurium, the two model systems for oxidative stress responses (Zahrt and Deretic, 2002).
1.6.3.2 ROS scavenging systems
In early studies mycobacterial cell wall was found to be implicated in ROS resistance particularly
due to LAM (Chan et al., 1991) and PGL-1 (Chan et al., 1989) ability to scavenge oxygen-radicals.
Antioxidant enzymes are present in most bacteria dealing with endogenous or exogenous ROS
(Zahrt and Deretic, 2002) including: catalases that catalyze the decomposition of hydrogen
peroxide to water and oxygen, superoxidases that convert two superoxide anions into a molecule
of hydrogen peroxide and peroxidases that catalyze the reduction of hydrogen peroxide by organic
30 Chapter 1
reductants, such as glutathione. M. tuberculosis has a protein with both catalase and peroxidase
activities, KatG (Heym et al., 1993; Manca et al., 1999). A katG mutant was hypersensitive to H2O2
and attenuated in wild-type mice as well as in wild-type mouse macrophages. However, it was
virulent in gp91-deficient mice and in macrophages from these phox-deficient mice, unable to
produce an oxidative burst (Ng et al., 2004). Thus, KatG contributes to M. tuberculosis virulence by
catabolizing peroxides produced by Phox. M. tuberculosis also has two superoxide dismutases:
SodA a Mn,Fe enzyme (Zhang et al., 1991) and SodC a Cu,Zn enzyme (Wu et al., 1998). SodC was
found to be important for bacteria’s resistance against exogenous superoxide as well as H2O2, as
sodC mutants had increased susceptibility to these ROS when compared to wild-type (Dussurget et
al., 2001; Piddington et al., 2001). A sodC mutant had also enhanced susceptibility to killing by
IFNγ-activated murine peritoneal macrophages, but not by Phox-deficient or non-activated murine
macrophages (Piddington et al., 2001), suggesting that SodC is important for M. tuberculosis
resistance against ROS produced by activated macrophages. However, sodC mutants were not
attenuated in mice or guinea pigs (Dussurget et al., 2001; Piddington et al., 2001). It was suggested
that SodA might compensate for SodC deletion in vivo. SodA seems to be essential for M.
tuberculosis growth as an attempted of inactivating its gene failed (Dussurget et al., 2001).
However, a M. tuberculosis mutant having diminished production of SodA, was more susceptible to
H2O2 and significantly attenuated in mice (Edwards et al., 2001), which exhibited increased
apoptosis of mononuclear cells. On the other hand, a BCG strains overexpressing SodA induced a
reduction in apoptosis in macrophages, as well as an impaired IFNγ and increased IL-10 release in
mice (Jain et al., 2011). As previously referred, ROS induce several cellular functions. These include
induction of apoptosis through the inhibition of phosphatases, and consequently, activation of
signaling molecules such as MAP kinases (Bedard and Krause, 2007). M. tuberculosis has the ability
to inhibit apoptosis which was recently found to be correlated with the inhibition of ROS
accumulation (Miller et al., 2010). Therefore, antioxidant enzymes, such as SodA and KatG, seem to
be involved in M. tuberculosis apoptosis inhibition through elimination of ROS (Edwards et al.,
2001; Miller et al., 2010). By affecting ROS levels, in the host cell, M. tuberculosis not only avoids
killing, but also interferes with other host defense mechanisms against pathogens.
Other antioxidant enzymes found in M. tuberculosis include an alkyl hydroperoxide reductase,
AhpC, involved in detoxification of organic peroxides, as shown by the increased sensitivity of an
ahpC mutant to cumene hydroperoxide, but not hydrogen peroxide (Springer et al., 2001). Even
though M. tuberculosis ahpC mutant had a decreased survival in macrophages (Master et al.,
2002), growth was not affected in mice, suggesting that AhpC doesn’t have a significant role during
31 Introduction
infection in vivo (Springer et al., 2001). The ahpC gene belongs to an operon along with ahpD. AhpD
was found to be implicated in AhpC peroxidase activity, along with DlaT (SucB) and LpdC (Rv0462)
enzymes, involved, as well, in important metabolic pathways. AhpC, AhpD, DlaT and LpdC were
found to form a peroxynitrite reductase-peroxidase complex responsible for peroxynitrite
detoxification (Bryk et al., 2002).
1.6.3.3 Protein and lipid repair
Specialized enzyme systems comprising members of the oxidoreductase family are involved in
generalized protein reduction. In E. coli the thioredoxin (Trx) system comprises two thioredoxins
and a thioredoxin reductase. The glutaredoxin (Grx) system is composed of glutathione, three
glutaredoxins, and a glutathione oxidoreductase (Holmgren, 2000).
M. tuberculosis has mycothiol, instead of glutathione, and several thioredoxins, including AhpD
(referred above), involved in AhpC reduction, as well as a thioredoxin reductase (Akif et al., 2008).
Mutants in genes involved in mycothiol biosynthesis have shown increased susceptibility to
oxidative stress (Buchmeier et al., 2006; Buchmeier et al., 2003), although no significant growth
defects were observed during mice infection (Vilcheze et al., 2008). M. tuberculosis thioredoxins
are involved in protection against peroxides (Zhang et al., 1999) and trx genes are transcribed
under a variety of oxidative stress conditions, suggesting a role in M. tuberculosis oxidative stress
response. WhiB proteins were initially thought to have a role as transcriptional regulators,
however, most of these proteins were found to be disulfide reductases with properties similar to
thioredoxins (Alam et al., 2009), involved in M. tuberculosis oxidative stress response. It was shown
that each of the M. tuberculosis whiB family member has a unique transcriptional response pattern
to different stresses and two of these, whiB3 and whiB6, were found to be commonly induced by
diamide and cumene hydroxiperoxide (Geiman et al., 2006).
Sulfur assimilation is important for the biosynthesis of cysteine, methionine, and a variety of
cofactors that will then be integrated in reduced-sulfur-containing molecules, such as mycothiols
and thioredoxins. Genes involved in this pathway are induced in M. tuberculosis inside
macrophages (Schnappinger et al., 2003), showing the importance of these molecules in M.
tuberculosis intracellular lifestyle. CysH is an enzyme involved in this pathway and a deletion
mutant in the cysH gene shows an increased sensitivity to H2O2 and peroxynitrite. This mutant had
an attenuated phenotype in wild-type mice, in the persistence phase of infection, but was fully
virulent in NOX2-/- mice treated with iNOS inhibitor (Senaratne et al., 2006). The attenuated
32 Chapter 1
phenotype of ΔcysH mutant in mice was, probably, due to an impaired antioxidant response
caused by a decrease in reduced-sulfur-containing molecules such as mycothiols.
Methionine sulfoxide reductase (Msr) is responsible for the conversion of methionine sulfoxide,
the product of oxidized methionine, whether in proteins or as free amino acid. Two Msr exist in
almost all living organisms, MsrA and MsrB that are responsible for the reduction of the two
stereomeric forms of methionine sulfoxide: methionine S-sulfoxide and methionine R-sulfoxide. In
E. coli or Helicobacter pylori one of these genes has been shown to be important for bacteria’s
oxidative stress response. In M. tuberculosis, only a double mutant in both msrA and msrB showed
increased susceptibility to hypochlorite but not to other oxidants such as hydrogen peroxide (Lee
et al., 2009b). Therefore, their role in protection of M. tuberculosis against oxidative stress in
macrophages remains unclear.
The membrane-associated protease Rv3671c also seems to protect M. tuberculosis against
oxidative stress probably by degrading damaged proteins, however, this has still to be confirmed
(Biswas et al., 2010).
A M. tuberculosis overexpressing Wag31, a protein that regulates polar cell wall synthesis, was
found to be attenuated in human macrophages and had increased susceptibility to hydrogen
peroxide (Mukherjee et al., 2009). Wag31 protects PBP3 protein (FtsI) (involved in synthesis of
septal peptidoglycan) from proteolysis induced in oxidative stress conditions in mycobacteria.
These results suggest that M. tuberculosis had also developed mechanisms to preserve cell shape
under oxidative stress conditions, in order to survive.
Curiously, a locus - mel2 - with homologous genes involved in bioluminescence in other bacteria
seems to protect M. tuberculosis against oxidative stress. A M. tuberculosis mutant in this locus has
increased susceptibility to ROS and a defective growth in activated mouse macrophages that was
less obvious in Phox-/- macrophages. Disease was found to be less severe in mice infected with this
mutant strain but similar to wild-type in Phox-/-. Although the mechanism by which this occurs
remains unknown, mel2 mutants have increased levels of oxidized lipids (Cirillo et al., 2009). Thus,
it might be involved in protection or repair of oxidized lipids.
The mechanisms described above show that M. tuberculosis oxidative stress response include
not only antioxidant enzymes and other molecules that scavenge ROS, but also, mechanisms
involved in the repair of the damages caused in proteins and lipids. ROS also cause damage in the
DNA (Demple and Harrison, 1994), which means that M. tuberculosis should have efficient DNA
repair mechanisms as well. Indeed, several transcriptomic analyses show that DNA repair genes are
induced after exposure to H2O2 (Boshoff et al., 2003; Cabusora et al., 2005; Schnappinger et al.,
33 Introduction
2003; Voskuil et al., 2011). DNA repair mechanisms have also been identified as important for M.
tuberculosis survival during infection in mouse (Schnappinger et al., 2003) and human (Cappelli et
al., 2006) macrophages; as well as in mouse (Sassetti and Rubin, 2003) and human (Rachman et al.,
2006) lung tissues.
It was suggested, from early studies in E. coli, that most of the cell death that occurs upon H2O2
exposure is probably due to DNA damage (Imlay and Linn, 1986), emphasizing the potential killing
effect of ROS trough DNA damage. Pathogens have adapted and DNA repair mechanisms have
been shown to be essential for the survival of the intracellular pathogens Salmonella typhimurium
(Buchmeier et al., 1995) and H. pylori (O'Rourke et al., 2003) by repairing DNA damage resulting
from oxidative stress.
1.6.3.4 Oxidative DNA damage caused by ROS
Oxidative DNA damages constitute, probably, the most varied class of DNA damages (Demple
and Harrison, 1994). ROS induce a vast number of different types of DNA damages, including:
strand breaks (particularly single- although double-strand breaks might also occur), base loss
leading to abasic (apurinic, apyrimidinic or AP) sites, and base damages. Over 80 products of DNA
base damage caused by ROS are known, among which, the oxidation product of guanine, 7,8-
dihydro-8-oxo-2'-deoxyguanosine (8-oxoG) either in the DNA or nucleotide pool, is one of the most
frequent (Friedberg et al., 2006). M. tuberculosis is at greater risk of acquiring this kind of lesion
due to the high GC content of its genome (Cole et al., 1998).
The hydroxyl radical (•OH) is the most reactive of the primary ROS, oxidizing organic molecules
almost indiscriminately. In the DNA it can add or abstract hydrogen atoms and originate many
products. However, oxidation of DNA is surely not a result of free •OH. Its reactivity is so high that
it reacts with another cellular component before it reaches DNA. Consequently, to oxidize DNA,
•OH must be generated immediately next to a nucleic acid molecule (Friedberg et al., 2006).
Hydrogen peroxide, as opposite to •OH, is not as highly reactive with DNA. However, it acts as a
much stronger oxidant when decomposed by ferrous ions. In fact, the main source of DNA damage
by ROS is thought to be the formation of Fenton oxidants, such as •OH, by reaction of H2O2 with
iron-complexed DNA (Figure 8) (Friedberg et al., 2006). Another frequent base damage, induced by
H2O2, is 2,6-diamino-4-hydrixy-5-formamidopyrimidine (FaPy) (Friedberg et al., 2006) resulting also
from the oxidization of guanine. Free superoxide (O2-) is also not very reactive with DNA. However,
as referred previously, O2- dismutate into H2O2 and it has the ability to release protein-bound iron
to produce Fe2+ that will be used in the Fenton reaction (Figure 8) (Friedberg et al., 2006).
34 Chapter 1
Figure 8 – Cellular reactions leading to oxidative DNA damage via the Fenton Reaction. Superoxide
dismutates into H2O2 and releases protein-bound iron, which in turn can react to form oxidants such as ⋅OH that
will cause DNA damage. Adapted from Friedberg et al. (2006).
1.6.3.5 M. tuberculosis DNA repair
To prevent DNA damage it was recently shown that M. tuberculosis seems to be physically
protected by Lsr2, a histone-like protein (Colangeli et al., 2009). An M. smegmatis mutant was
found to be hypersusceptible to H2O2 and attenuated in wild-type, but virulent in Phox-/- deficient,
macrophages. No mutants in lsr2 gene could be constructed in M. tuberculosis, highlighting the
importance of such protein for this pathogen and as a future drug target (Colangeli et al., 2009).
Due to the technical difficulty of working with such a slow growing pathogen, the study of M.
tuberculosis DNA repair systems has advanced slower than for other bacteria. As a result, most of
the assumptions are still made based on homology rather than on functional studies. Genes
necessary to perform base excision repair, nucleotide excision repair and recombinational repair
were identified. In addition, genes involved in the SOS response – a mechanism that responds to
DNA damage by inducing various genes required for DNA repair - were also identified. In contrast,
no homologs of mismatch repair genes were identified (Cole et al., 1998; Mizrahi and Andersen,
1998), a finding that should have potentially significant implications with respect to genome
stability.
Major DNA repair mechanisms that control DNA damages in bacteria and the corresponding
homologues found in M. tuberculosis are represented in Figure 9 (Dos Vultos et al., 2009).
35 Introduction
Figure 9 – Major mechanisms repairing DNA damages in bacteria. Listed beside each pathway are the
homologues of DNA repair proteins found in M. tuberculosis. Mismatch repair homologs were found in M.
tuberculosis, and so this pathway is not shown in the figure. Adapted from Dos Vultos et al. (2009).
1.6.3.5..1 Base excision repair pathway
Base excision repair (BER) is probably one of the most frequently used DNA repair systems in
nature since it is responsible for the repair of the majority of DNA damages (Friedberg et al., 2006).
BER is initiated by DNA glycosylases, which excise the chemically altered or inappropriate bases
from DNA – like 8-oxoG – by cleavage of the N-glycosyl bond between the base and the
deoxyribose sugar. This forms a site in DNA without a base, called AP site. AP endonucleases
specifically recognize these sites in the DNA and produce nicks immediately 5’ to the AP site. Some
DNA glycosylases have an associated AP lyase activity that cleaves the phosphodiester backbone 3’
to the AP site. Then, the action of an exonuclease or DNA-deoxyribophosphodiesterase (dRpase)
completes the removal of the damaged nucleotide and DNA polymerase and DNA ligase conclude
the repair (Dianov and Lindahl, 1994; Friedberg et al., 2006; Seeberg et al., 1995) (Figure 9).
- Oxidative DNA damage repair by BER
Oxidative DNA damage is primarily processed by the BER pathway, given that DNA bases are
particularly susceptible to oxidation mediated by ROS (Dizdaroglu, 2005). As referred, one of the
most frequently occurring stable and abundant oxidized base lesions in DNA is 8-oxoG. This lesion
36 Chapter 1
has strong promutagenic properties. During replication, 8-oxoG frequently mispairs with the
nucleotide A (Shibutani et al., 1991). This error is not detected by replicative DNA polymerases
leading to G→T/C→A transversions (Cheng et al., 1992). Enzymatic systems dealing with the 8-
oxoG are represented on Figure 10. Prior to DNA replication, at 8-oxoGC sites, repair can be
effected by conventional BER with MutM (Fpg) DNA glycosylase operating on the 8-oxoG damage
(Figure 10B, right pathway). If this base is not removed before replication, DNA polymerase can
introduce a C opposite to the lesion leading to another opportunity for MutM to catalyse the repair
(Figure 10B, left pathway). But DNA polymerase can also introduce an A opposite to 8-oxoG (Figure
10B, central pathway). In this situation, MutY DNA glycosylase excises the A that is usually replaced
by a C resulting in a 8-oxoGC base pair that is, again, repaired by the BER system involving the DNA
glycosylase MutM.
Moreover, ROS can contaminate the nucleotide pool with 8-oxod-GTP. MutT hydrolyses 8-oxo-
dGTP back to the monophosphate form, removing it from the dNTP pool (Figure 10C, right
pathway). If replication occurs with some 8-oxo-GTP in the dNTP pool, usually T is preferentially
inserted opposite to A. However, if 8-oxo-GTP is incorporated instead of T, 8-oxoG may be
removed either by MutM (Figure 10C, left pathway) or MutY (Figure 10C, central pathway), as
described above.
Figure 10 - Enzymatic systems that protect from the mutagenic effects of 8-oxoguanine. Details are discussed
in the text. Adapted from Friedberg et al. (2006).
37 Introduction
This triplet of DNA repair enzymes – MutM, MutY and MutT – comprises the G° system that is
involved in handling with the potential mutagenic effects of guanine oxidation (David et al., 2007;
Michaels and Miller, 1992). Four mutT homologues have been annotated in mycobacterial
genomes, which contain a single mutY homolog (Cole et al., 1998; Mizrahi and Andersen, 1998).
The study of knockout mutants for MutT1, MutT2, MutT3 and Rv3908 (MutT4) in M. tuberculosis
has revealed that only the absence of mutT1 leads to an increase in the mutation frequency
(mutator phenotype) (Dos Vultos et al., 2006) although at a much lower level than the observed for
other bacteria. This may be due to the existence of other enzymes capable of counteracting this
kind of oxidative stress. Biochemical analysis show that M. tuberculosis MutY is involved in the
excision of A opposite to 8-oxoG in the DNA, as it happens in E. coli. However, excisions of G or T
opposite to 8-oxoG can also occur (Kurthkoti et al., 2010). M. tuberculosis genome possesses two
homologues of mutM (Cole et al., 1998), however, one of these (rv0944) may code for a protein
that is not functional (Guo et al., 2010). A study of MutM deficient M. smegmatis has shown that
this protein plays an important role in protecting bacteria from oxidative DNA damage. The
complementation of this mutant with the M. tuberculosis mutM gene, coding for the main MutM
(Rv2924c), could restore the sensitive phenotype to oxidative stress (Jain et al., 2007).
Interestingly, M. tuberculosis MutM was also found to be important for infection of non-human
primates (Dutta et al., 2010).
Another enzymes that excise oxidized bases are endonuclease VIII (Nei) and Nth. These act
primarily on oxidized pyrimidines, in contrast to Fpg that acts primarily on oxidized purines
(Dizdaroglu, 2005). Homologues of these proteins are present in M. tuberculosis (Cole et al., 1998;
Mizrahi and Andersen, 1998).
DNA glycosylases give rise to AP sites. Additionally, these sites can also arise spontaneously or
be directly induced by ROS (Demple and Harrison, 1994). Such lesions are repaired by the
ubiquitous AP endonucleases, including XthA and Nfo, which belong to the oxidative defence
regulon in E. coli (Storz and Imlay, 1999). These proteins are both encoded in the genome of M.
tuberculosis (nfo corresponds to end) (Cole et al., 1998) (Figure 9) and their biological importance is
shown by the fact that no variations are observed for xthA in clinical strains (Dos Vultos et al.,
2008). The existence of two enzymes for the same function highlight that dealing with abasic sites
is a crucial aspect of DNA repair and may be a reflection of either the high number of DNA
glycosylases that M. tuberculosis possesses, or the constant aggression by ROS in the host.
38 Chapter 1
The filling of gaps that result from AP endonuclease activity is mediated mainly by polymerase I,
PolA (Dianov and Lindahl, 1994; Seeberg et al., 1995). M. tuberculosis possesses a DNA-dependent
PolA (Cole et al., 1998). In E. coli, it was demonstrated that overproduction of DnaE protein (an
subunit of DNA polymerase III) could restore viabilityy, in a conditionally unviable strain deficient in
PolA (Witkin and Roegner-Maniscalco, 1992). M. tuberculosis contains two apparently functionally
redundant replicative DNA polymerases designated DnaE1 and DnaE2 (Cole et al., 1998), but lacks
PolII. DnaE2 was found to be upregulated in vitro by several DNA damaging agents (including H2O2),
as well as during infection in mice. It seems to be an error prone polymerase that is the primary
mediator of survival through inducible mutagenesis and plays a role in the emergence of drug
resistance (Boshoff et al., 2003). Indeed, mutations in the rpoB gene that confer resistance to
rifampicin, were associated with an increased dnaE2 expression, suggesting a role for DnaE2 in
adaptation of fitness impaired, rifampicin resistant, M. tuberculosis strains. It was postulated that
by increasing expression of this error-prone polymerase the probability of a subsequent adaptation
would also be augmented (Bergval et al., 2007). Other genes, dnaZX, dnaQ and dnaN, encoding ,
and ß subunits of polymerase III, respectively, are also found in the M. tuberculosis genome as
well as the DNA ligases: LigA, LigB, LigC and LigD (Cole et al., 1998; Mizrahi and Andersen, 1998)
(Figure 9).
Although the study of M. tuberculosis repair of oxidative damage by BER needs to be deepened,
it is already clear that these bacteria are well adapted to environments where oxidative stress is
prevalent. This is illustrated by the sheer number of putative genes whose products might be
involved in dealing with this kind of aggressions and by the restricted nucleotide diversity that
these genes present (Dos Vultos et al., 2008). In addition, the analysis of rpoB mutation patterns in
both clinical (O'Sullivan et al., 2005) and laboratory (Morlock et al., 2000) strains has led to the
conclusion that oxidative damage is generally not the driving force behind mutations in the M.
tuberculosis genome. Finally, genes of the BER system were found to be essential for M.
tuberculosis survival in mice (Sassetti and Rubin, 2003) revealing the importance of this system to
resist oxidative damage during infection in vivo.
- BER Repair of DNA damages caused by other forms of stress
Several DNA glycosylases involved in the repair of other kinds of damaged bases were also
found in the genome of M. tuberculosis (Mizrahi and Andersen, 1998). It is the case of tagA and
alkA, important genes in repairing alkylative DNA damages that can be induced by RNS (Durbach et
al., 2003; Taverna and Sedgwick, 1996). The tagA gene encodes a highly specific 3-methyladenine
39 Introduction
DNA glycosylase I that is constitutively expressed (Bjelland et al., 1993). AlkA encodes a 3-
methyladenine DNA glycosylase II (O'Brien and Ellenberger, 2004), which is a component of the
adaptive response controlled by ada. The ada gene encodes O6-alkylguanine-DNA alkyltransferase
I. A second type of O6-alkylguanine-DNA alkyltransferase is encoded by the ogt gene in E. coli
(Friedberg et al., 2006). In M. tuberculosis, ada and alkA are predicted to encode fused proteins
and to be part of an operon including ogt (Cole et al., 1998). M. tuberculosis mutants lacking this
operon were shown to be hypersensitive to the genotoxic effects of N-methyl-N’-nitro-N-
nitrosoguanidine (MNNG), an alkylating mutagen (Durbach et al., 2003). The exposure to the DNA
damaging agents - UV radiation, mitomycin C and H2O2, results in the upregulation of this operon
as well (Boshoff et al., 2003). However, these mutants were not attenuated in mice, suggesting
that nitrosative stress does not induce cytotoxic DNA damage in M. tuberculosis in vivo (Durbach et
al., 2003).
1.6.3.5..2 Nucleotide excision repair pathway
Nucleotide excision repair (NER) is an alternative pathway to BER, in which genomic damage is
repaired by means of incisions in regions flanking the damaged DNA, leading to the excision of an
oligonucleotide rather than a single base (Friedberg et al., 2006). In E. coli NER involves UvrA, B and
C proteins, which interact in complex. UvrA binds to DNA and leads to the formation of an UvrA-
UvrB-DNA complex that recognizes the damage. Then, UvrA dissociates and UvrB recruits UvrC that
catalyse incisions 5’ and 3’ to DNA damage. DNA helicase (UvrD), polymerase, and ligase reactions
then eliminate the damaged oligonucleotide and complete repair (de Laat et al., 1999) (Figure 9).
- Oxidative DNA repair by NER
Although this system is not pivotal for handling oxidative damage (it is the core mechanism for
repair of UV-induced damage) evidence indicates a demonstrable function as a secondary defence
against oxidative damages in E. coli and in Saccharomyces cerevisae (Demple and Harrison, 1994).
It is an extremely important DNA repair system that recognizes a wider range of damaged bases
than the BER system, due to the use of more generic endonucleases.
Homologues of uvrABC were found in M. tuberculosis (Cole et al., 1998). The expression of uvr
genes was increased in M. tuberculosis within human macrophages, which highlights the
importance of the uvr system for M. tuberculosis survival upon infection (Graham and Clark-Curtiss,
1999). Additionally, uvr genes seem to be involved in H2O2 response network (Cabusora et al.,
2005) being expression of uvrA and uvrB increased upon exposure to H2O2 (Boshoff et al., 2003).
40 Chapter 1
However, inactivation of uvrB resulted in severe sensitivity to acidified nitrite and UV light but not
to ROS in M. tuberculosis. Yet, an uvrB mutant attenuated phenotype was reverted only in mice
lacking both iNOS and Phox, suggesting that UvrB is important for resistance against combined RNS
and ROS during infection in vivo (Darwin and Nathan, 2005). Importantly, uvrB was also shown to
be required for M. tuberculosis growth in primate lungs (Dutta et al., 2010). An M. smegmatis uvrB
mutant, however, has shown increased susceptibility to oxidative DNA damages (Kurthkoti et al.,
2008) and a recent study has shown that M. tuberculosis deficient in UvrA is also sensitive to
several DNA damaging agents including ROS (Rossi et al., 2011). It seems, thus, that NER proteins
are important players in the repair of oxidative DNA damages in mycobacteria.
Although most bacteria carry just one gene encoding DNA helicase II, M. tuberculosis possesses
two putative genes encoding this protein: uvrD1 and uvrD2 (Cole et al., 1998). Interestingly, uvrD1
seems to be critical for mycobacterial repair of UV damage and is upregulated upon H2O2 stress
(Boshoff et al., 2003), suggesting a role in NER. This has been recently confirmed. M. tuberculosis
uvrD1 mutant has shown an increased susceptibility to UV irradiation as well as to mitomycin C and
ROS-inducing agents (Houghton et al., 2012). The role of UvrD1 in mycobacterial DNA repair is of
significant interest given that deletion of uvrD1 attenuates M. tuberculosis growth in macrophages
and persistence in mice (Houghton et al., 2012).
1.6.3.5..3 Recombinational repair
Oxidative DNA damage includes DNA strand breaks, particularly single strand breaks (SSBs)
because two nearby attacks in each strand are very rare under physiological conditions. But, if this
happens, double strand breaks (DSBs) can occur. DSBs can also arise if a replication fork encounters
a SSB in the DNA, and SSBs may occur if the replication fork encounters another kind of lesion in
the DNA (Friedberg et al., 2006). Thus, SSBs and DSBs might occur by a direct or indirect effect of
oxidative DNA damaging agents. These lesions are potentially lethal and require repair through
homologous and non-homologous recombination mechanisms (Demple and Harrison, 1994;
Slupphaug et al., 2003). In homologous recombination (HR) a second intact copy of the broken
chromosome segment serves as template, which in prokaryotes corresponds to the newly
replicated sister chromatid (Friedberg et al., 2006). Proteins involved in HR play key roles in DNA
repair mechanisms and two major pathways can be found: the RecBCD and RecF pathways. It is
now evident that DSBs initiate recombinational events carried out by the RecBCD pathway,
whereas single strand gaps initiate recombinational events carried out by the RecF pathway
(Morimatsu and Kowalczykowski, 2003). In E. coli, RecBCD is a helicase that splits the duplex and
41 Introduction
digests them until it reaches a recombinational hotspot (Singleton et al., 2004) (Figure 11A). In the
RecF pathway, RecQ and RecJ process gapped DNA before RecFOR proteins recognize the single
strand gap (Figure 11B) (Morimatsu and Kowalczykowski, 2003). Both pathways provide an ssDNA
molecule coated with RecA, facilitating the invasion of a homologous molecule (Figure 11). Strand
exchange is promoted by RecA, resulting in formation of a holliday junction that will be resolved by
the RuvABC complex or the RecG ligase (Friedberg et al., 2006). In M. tuberculosis the RecBCD
pathway seems to be intact (Mizrahi and Andersen, 1998). The RecF pathway was initially thought
to be defective given that recJ is absent. However, recR is one of the genes upregulated in M.
tuberculosis upon capreomycin exposure (Fu and Shinnick, 2007), a drug used for treatment of
MDR-TB. Furthermore, both recR and recF are upregulated upon translational inhibition induced by
drugs (Boshoff et al., 2004) suggesting that, despite of the absence of recJ, this pathway is active in
M. tuberculosis.
Figure 11 – Early steps during the repair of double strand breaks (DSBs) (A) and single strand breaks (SSBs) (B)
in the DNA by homologous recombination mechanisms. (A) In the RecBCD pathway, RecBCD binds to the end of a
DSB, unwinds and degrades the double strand DNA until it finds a DNA sequence (χ). RecA is then loaded onto the
χ-containing single-stranded DNA. (B) In the RecF pathway, RecQ and RecJ process the gapped DNA. Then RecFOR
recognize the SSB-coated GAP and lead to RecA filament assembly. Adapted from Friedberg et al. (2006).
A B
42 Chapter 1
As referred, DSBs can also be repaired by another mechanism: the non-homologous end-joining
(NHEJ). NHEJ does not rely on a homologous DNA template, which means it can operate in
situations when only one chromosomal copy is available (Friedberg et al., 2006). NHEJ requires the
approximation of the broken ends, a process that is assisted by the DNA-end-binding protein Ku,
followed by the sealing of, at least, one of the broken strands by a specialized DNA ligase (Figure 9).
Unlike HR, which is generally error free, NHEJ can be either faithful, if the ends are sealed directly,
or mutagenic, if the ends are remodelled by nucleases or polymerases before sealing by DNA
ligases (Shuman and Glickman, 2007). This pathway was thought to be restricted to eukaryotes but
it was recently identified in prokaryotes, including M. tuberculosis (Gong et al., 2005), being LigD
the specialized DNA ligase involved in (Della et al., 2004). Mycobacteria possess a backup
mechanism for LigD-independent error-prone repair of blunt-end DSBs, probably involving LigC.
This is suggested by the fact that blunt-end NHEJ efficiency in LigD-deficient cells is reduced by 20-
fold when ligC is deleted (Gong et al., 2005). Another Ku-dependent protein is, UvrD1. However,
exactly how it contributes to DSB repair remains to be determined. This suggests a cross-talk
between NHEJ and NER pathways (Sinha et al., 2007).
The reason why do only certain bacterial species possess this pathway is unclear. In
mycobacteria, even though expression profiles suggest that M. tuberculosis ligD and ku
transcription is not regulated during infection in human macrophages (Cappelli et al., 2006), NHEJ
may be important for survival within these cells, where bacteria are continuously exposed to
genotoxic compounds that induce DSBs, such as ROS. This may explain why M. tuberculosis has
retained a functional NHEJ apparatus that has been lost by other species. On the other hand, this
mechanism would contribute to mutagenesis that can sometimes be a selective advantage
(Shuman and Glickman, 2007), for example for the acquisition of antibiotic resistance mutations.
- RecA – a central molecule in DNA damage response
RecA is a central component of bacterial response to DNA damage. Not only it has a direct role
in recombinational DNA repair as described above, but it also controls the expression of other
genes whose function promotes increased survival following DNA damage, in conjunction with the
repressor protein LexA (Friedberg et al., 2006; Little, 1982). This is the so-called SOS response. M.
tuberculosis has, with the exception of polB and umuD, the genes required for a functional SOS
system in E. coli (Cole et al., 1998; Mizrahi and Andersen, 1998). As in most species of bacteria, the
expression of M. tuberculosis recA has been shown to be inducible by DNA damaging agents
43 Introduction
(Boshoff et al., 2004). RecX seems to be a negative regulator of RecA in M. tuberculosis (Venkatesh
et al., 2002).
Recently, the mechanisms underlying M. tuberculosis response to DNA damage were studied,
through a global analysis of gene expression following DNA damage induced by mitomycin C, in
both wt and recA- M. tuberculosis. Curiously, the majority of genes induced by DNA damage didn't
have known roles in DNA repair. However, it was noticed that most of the inducible genes with
known or predicted function in DNA repair did not depend on recA for induction (Rand et al.,
2003), a rare occurrence in bacteria, only documented for Acinetobacter calcoacetius (Rauch et al.,
1996). Among those, were genes involved in NER, BER, and recombination. As it has been
previously suggested (Brooks et al., 2001), it appears that an alternative mechanism of gene
regulation, RecA/LexA – independent, important for DNA repair, exists in M. tuberculosis (Rand et
al., 2003). A motif has been identified that seems to define the RecA/LexA-independent promoter
(RecA-NDp) (Gamulin et al., 2004).
It remains unclear why does M. tuberculosis have multiple mechanisms for DNA damage
induction. A possible explanation is that each mechanism responds to different stimuli. For
example, the RecA-NDp-mechanism may be important for survival in macrophages, given that the
majority of genes under the control of this promoter are induced in the macrophage environment
to a significant level (Gamulin et al., 2004; Schnappinger et al., 2003). Implication of the RecA-NDp-
mediated response in the regulation of a variety of genes that are involved in M. tuberculosis
oxidative stress response, such as ahpC, argues for this possibility (Gamulin et al., 2004).
1.6.3.5..4 The lack of Mismatch repair
Mismatch repair (MMR) systems are important for mutation avoidance by repairing
mismatched base pairs in the DNA (Friedberg et al., 2006). For example, MMR also contributes to
the repair of 8-oxoG as a backup for the repair of newly replicated strains (Friedberg et al., 2006).
One of the most striking characteristics of M. tuberculosis DNA repair system is the absence of
homologs for MMR, which highly suggests that these bacteria do not perform this kind of repair
(Dos Vultos et al., 2009). This should have potentially significant implications with respect to
genome stability and could lead us to regard M. tuberculosis as possible natural mutator. Even
though it has been show recently that M. tuberculosis complex strains show high levels of
polymorphisms in DNA repair, replication and recombination genes (Dos Vultos et al., 2008), M.
tuberculosis genomes are very stable when compared to other organisms such as H. pylori, where
the absence of a functional MMR system was correlated to a remarkably high level of genetic
44 Chapter 1
diversity (Kang and Blaser, 2006). Nevertheless, its capacity to adapt to host conditions has been
demonstrated by the appearance of MDR as well as XDR, and, more recently, TDR strains resistant
to all available drugs against TB (Zumla et al., 2012).
The possibility of a higher fidelity in the processivity of DNA as a compensation for the lack of
MMR can be posed, as M. tuberculosis has a slower rate of DNA synthesis when compared to E. coli
(Hiriyanna and Ramakrishnan, 1986). The use of codons in a context-specific way may also
contribute to the stability of the genome in deficient MMR M. tuberculosis by reducing the number
of targets for frameshift mutations (Wanner et al., 2008). In addition, besides the important role in
counteracting directly the damages in DNA provoked by host conditions, it is possible that NER (as
well as BER) is involved in compensating for MMR deficiency, a model that has recently been
proposed (Guthlein et al., 2008).
1.6.3.6 Oxidative stress response regulation
S. typhimurium and E. coli oxidative stress response is primarily controlled by SoxR and OxyR
regulators. SoxR, in response to superoxide, induces expression of several genes including sodA.
OxyR is activated by hydrogen peroxide and stimulates transcription of genes such as katG
(catalase) and ahpCF (alkylhydroxyperoxidase reductase). Although OxyR is the most common
regulator of responses to hydrogen peroxide, other regulators might exist. PerR was identified in
Bacillus subtilis and in Staphylococcus aureus as transcriptional repressor that regulates
transcription of most of the genes regulated by OxyR (Imlay, 2008).
In M. tuberculosis and other closely related species of the M. tuberculosis complex, oxyR is a
pseudogene containing multiple frameshift mutations and deletions (Deretic et al., 1995). In some
fast-growing mycobacteria, such as M. smegmatis, oxyR seems to be absent from their genomes. In
contrast, an intact oxyR has been observed in several other mycobacterial species including M.
leprae, M. marinum and M. avium (Pagan-Ramos et al., 1998). As for soxRS, no apparent homolog
seems to exist in M. tuberculosis genome (Cole et al., 1998). This apparent absence of important
oxidative stress response regulators in M. tuberculosis would explain the very little transcriptional
response to H2O2 or menadione (a superoxide producer) (Garbe et al., 1996) when compared to
other species, like E. coli or Salmonella (Zahrt and Deretic, 2002). The same was observed inside
macrophages. Few potential antioxidant genes were induced in M. tuberculosis (Schnappinger et
al., 2003). These observations suggested a constitutive expression of the antioxidant genes usually
under the regulation of OxyR and SoxRS. Indeed this seems to be the case as shown recently by a
transcriptomic analysis of M. tuberculosis response to oxidative stress. Expression of katG and
45 Introduction
ahpC was maintained at high basal levels (Voskuil et al., 2011). This might be an advantage for M.
tuberculosis and explain part of its success during host infection. However, even in the absence of
these classical regulators M. tuberculosis was capable of a large transcriptional response to H2O2
(Voskuil et al., 2011). Thus, other transcriptional regulators might be involved in the control of M.
tuberculosis oxidative stress responses.
IdeR, an iron-dependent transcriptional repressor, seems to play a role in M. tuberculosis
oxidative stress response (Rodriguez et al., 2002). Inactivation of IdeR in M. tuberculosis results in
increased sensitivity to oxidative stress. However, no difference in expression of genes involved in
oxidative stress protection was found between ideR mutant and the wild-type. Therefore, the
sensitive phenotype of the ideR mutant to oxidative stress might be due to an indirect effect,
caused by changes on iron levels, instead of a direct interference with gene expression. Iron
deficiency can lead to oxidative stress by decreasing the activity of iron-containing enzymes such as
superoxide dismutases and catalases. On the other hand, increased intracellular free iron,
participate in Fenton reactions, resulting in the enhanced generation of oxygen radicals and
oxidative stress.
Several sigma factors might also be involved in regulation of oxidative stress responses in
mycobacteria. M. tuberculosis sigH mutant is more susceptible than wild-type to oxidative stress
caused by H2O2 and other oxidative agents. In addition, SigH seems to regulate expression of
thioredoxin/thioredoxin reductase genes (Manganelli et al., 2002; Raman et al., 2001) as well as
sodA (Mehra and Kaushal, 2009). Other sigma factors (SigF, SigJ) might be also implicated in
mycobacterial oxidative stress responses, as mutants in these genes are more susceptible to
oxidative agents (Gebhard et al., 2008; Hu et al., 2004). However, no known antioxidant genes have
been identified as regulated by these sigma factors, suggesting that the contribution of these
transcriptional regulators might be indirect. The same happens for CarD, a recently identified
transcriptional regulator in M. tuberculosis, which expression is induced by H2O2 and depletion
leads to sensitivity to oxidative stress and other conditions (Stallings et al., 2009).
Even though the referred regulators seem to, somehow, contribute to oxidative stress response
regulation in mycobacteria, these are not specific for oxidative stress being also involved in the
regulation of other kind of stresses/responses. A very recent study has shown that OxyS might be
an oxidative stress response regulator in mycobacteria lacking OxyR (Li and He, 2012). OxyS is a
LysR-type transcriptional regulator – the most abundant type of transcriptional regulators in
prokaryotes involved in regulation of diverse functions including oxidative stress responses
(Maddocks and Oyston, 2008). In fact, it was previously shown that OxyS might play a role in M.
46 Chapter 1
tuberculosis oxidative stress response, as increasing concentrations of OxyS lowered levels of AhpC
and made bacteria more sensitive to organic hydroperoxides. However, deletion of oxyS did not
affect expression of katG (Domenech et al., 2001), suggesting that this was not the main katG
regulator. Li et al. (2012) have shown though that M. tuberculosis OxyS binds to katG promoter,
and this binding is inhibited by H2O2. Furthermore, M. smegmatis overexpressing OxyS had a
reduced expression of katG and increased susceptibility to H2O2, suggesting that this was, indeed, a
transcriptional repressor of katG (Li and He, 2012). These characteristics of OxyS are similar to that
of FurA that also regulates expression of katG in M. tuberculosis (Sala et al., 2003). OxyS seems to
regulate not only katG but also ahpC (Domenech et al., 2001). Further studies need to be
performed to characterize the OxyS regulon and confirm if this could be a substitute regulator to
OxyR. In addition, RoxY was identified in M. smegmatis as a repressor of OxyS, suggesting that
oxidative stress regulation in mycobacteria that lack OxyR might be more complex than imagined.
Objectives
The main goal of this thesis is to investigate M. tuberculosis defense mechanisms against
oxidative stress and their role in mycobacterial host adaptation and evolution. This particular kind
of studies are relevant given that M. tuberculosis resistance mechanisms against reactive oxygen
species (ROS) should contribute to the success this pathogen, however, their role in pathogenesis
remains poorly understood. On the other hand, DNA repair, replication and recombination (3R)
proteins are involved in the repair of the damages such as the ones induced by ROS, being
important players in maintaining genome integrity, however, 3R proteins can also be responsible
for genome variability and contribute to microbial adaptation and evolution, through allelic
variation of its genes. Given that certain M. tuberculosis families seem to have some selective
advantage over others, it is important to investigate the basis for their genetic variability.
To achieve this goal two research studies were performed:
A. Screening of a transposon mutant library for mutants with an impaired ability to resist to ROS
in order to address the following questions:
Which genes are identified as important for M. tuberculosis resistance against ROS?
How do these genes contribute to M. tuberculosis virulence by allowing its survival in host
cells?
B. Analysis of polymorphisms in 3R genes in strains belonging to a successful family of M.
tuberculosis to address the following questions:
Do we find 3R polymorphisms associated with this family?
Could some of these polymorphisms confer some selective advantage and contribute
to the evolutionary success of these strains?
The ultimate goal of this kind of studies is to identify potential virulence factors useful for the
development of new anti-tuberculosis drugs or vaccine candidates. It could serve the purpose of
identifying the strains that are more capable of evolving, and/or resisting treatment, which would
be particularly relevant, given the increase of M. tuberculosis drug-resistant strains.
CHAPTER 2
Identification of M. tuberculosis virulence factors
involved in defense mechanisms against
oxidative stress
Olga Mestre1, Raquel Hurtado-Ortiz1, Tiago Dos Vultos1, Amine Namouchi1, Mena Cimino1,
Madalena Pimentel2, Olivier Neyrolles3,4, Brigitte Gicquel1
1
Unité de Génétique Mycobactérienne, Institut Pasteur, Paris, France ; 2
Centro de Patogénese Molecular,
Unidade dos Retrovírus e Infecções Associadas, Faculdade de Farmácia, Universidade de Lisboa, Lisboa, Portugal;
3 Centre National de la Recherche Scientifique, Institut de Pharmacologie et de Biologie Structurale, Toulouse,
France; 4
Université de Toulouse, Université Paul Sabatier, Institut de Pharmacologie et de Biologie Structurale,
Toulouse, France
Part of the data presented in this chapter is included in the manuscript: “High throughput phenotypic selection
of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes
important for intracellular growth”. Mestre O, Hurtado-Ortiz R, Dos Vultos T, Namouchi A, Cimino M, Pimentel
M, Neyrolles O, Gicquel B (2012) PLoS One; Submitted
51 M. tuberculosis resistance to ROS
ABSTRACT 2.1
Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile
environment of the macrophage and to resist potent antibacterial molecules such as reactive
oxygen species (ROS). Thus, understanding mycobacterial defence mechanisms against ROS may
contribute to the development of new anti-tuberculosis therapies. Here we identified genes
involved in such mechanisms by screening a high-density transposon mutant library and showed
that most of these genes are involved in the intracellular lifestyle of the pathogen. Many of these
genes were found to play a part in cell envelope functions further strengthening the important role
of the mycobacterial cell envelope in protecting against aggressions such as the ones caused by
ROS inside host cells.
53 M. tuberculosis resistance to ROS
INTRODUCTION 2.2
Part of the success of Mycobacterium tuberculosis lies in its ability to thrive inside macrophages,
in a very harsh environment, where bacteria are exposed to strong antimicrobial molecules such as
reactive oxygen species (ROS) (Flannagan et al., 2009). Therefore, defence mechanisms against ROS
are important for M. tuberculosis pathogenicity. Understanding the molecular basis of such
mechanisms will provide clues for the development of target-specific drugs or effective attenuated
strain-based vaccine candidates.
The generation of ROS is initiated by the phagocyte NADPH oxidase (Phox) that produces
superoxide anions. These anions have a low bactericidal potential, however, they rapidly dismutate
into H2O2, particularly at acid pH in the phagosome. H2O2 can produce hydroxyl radicals, the most
powerful oxidant, when reacting with iron in what is known as Fenton reaction(Friedberg et al.,
2006). These molecules are highly reactive agents, damaging proteins, lipids, carbohydrates and
nucleic acids (Bedard and Krause, 2007). The biological importance of ROS is clearly demonstrated
in patients with chronic granulomatous disease (CGD) characterized by a total absence or low level
of ROS, resulting from Phox genetic deficiency. These individuals are highly susceptible to bacterial,
fungal and yeast infections (Bedard and Krause, 2007) and increasing numbers of cases of
mycobacterial diseases, including tuberculosis, are being diagnosed in such patients (Bustamante
et al., 2007). Nonetheless, the significance of ROS in host defence against M. tuberculosis remains
controversial.
Despite the early demonstration that ROS were mycobactericidal (Walker and Lowrie, 1981),
years later it was shown that M. tuberculosis could be resistant to killing by oxidative stress in
macrophages (Manca et al., 1999). M. tuberculosis genes showing similarities with genes known to
be involved in ROS resistance in different bacterial species were identified (Cole et al., 1998; Zahrt
and Deretic, 2002). However, transcriptomic analysis showed that many of these genes are not
induced in oxidative conditions (Garbe et al., 1996; Schnappinger et al., 2003). This is explained by
a relatively high constitutive expression level of such genes (Voskuil et al., 2011) that, associated
with an absence of the classic oxidative stress response regulators (SoxR and OxyR) (Zahrt and
Deretic, 2002), leads to reduced induction ratios. This suggests that bacilli are continuously primed
for oxidative stress defense revealing once again the importance of this kind of responses in M.
tuberculosis. Still, evidence for a role in defence against ROS mainly comes from M. tuberculosis
katG mutant, with an alteration of both catalase and peroxidase activities, which was attenuated in
wild-type mice but grew normally in phox-deficient mice (Ng et al., 2004).
54 Chapter 2
The construction of transposon mutant libraries in mycobacteria has enabled the newly
identification and study of several potential virulence factors (Camacho et al., 1999; Cox et al.,
1999; McAdam et al., 2002). So far, different screening-based approaches using mutant libraries
have been conducted to identify M. tuberculosis mutants sensitive to different conditions found
inside host macrophages, including acidic (Vandal et al., 2008) as well as nitric (Darwin et al., 2003)
stresses. With the aim to identify and investigate genes required for resistance against ROS in M.
tuberculosis, we screened, for the first time, a transposon mutant library to identify mutants with
impaired ability to resist oxidative stress.
55 M. tuberculosis resistance to ROS
MATERIAL AND METHODS 2.3
2.3.1 Bacterial Strains and growth conditions
M. tuberculosis strains GC1237 (Caminero et al., 2001) and H37Rv were grown in Middlebrook
7H9 media (Difco) supplemented with ADC and 0,05% Tween 80, except when referred, or in
Middlebrook 7H11 media (Difco) supplemented with OADC and 0,5% glycerol for CFU analysis.
Mutant strains were grown in the presence of kanamycin 20 µg/ml and complemented strains
grew in the presence of both kanamycin and hygromycin 20 µg/ml and 50µg/ml, respectively.
Luminescent bacteria were obtained by transforming M. tuberculosis strains, by electroporation as
described (Parish and Stoker, 1998), with a luciferase-expressing plasmid derived from pSMT3
(Humphreys et al., 2006). Positive clones were selected with 50 µg/ml hygromycin and
luminescence emission from luciferase was confirmed in a luminometer.
2.3.2 Mutant library screening
Mutants of the M. tuberculosis GC1237 strain transposon library (Brodin et al., 2010) were
grown individually at 37ºC in 96-well plates in 7H9 medium for 3 weeks. Optical density (OD) was
measured, at 620nm, and mutants which presented growth defects at this phase were excluded
from subsequent analysis. For those mutants, which no growth defects were observed, aliquots
(10-20 µl) were sub-cultured in 200 µl 7H9 medium containing 9mM of H2O2 (Sigma-Aldrich). OD
was measured two to three weeks later in a plate spectrophotometer and the ratio of the OD value
of the mutant to that of the wild-type strains (growth index) was calculated. Mutants with a growth
index below 0.4 were considered as sensitive to H2O2 (Table 2).
2.3.3 Identification of transposon insertion sites
Genomic DNA from selected transposon mutants was extracted and the exact location of the
transposon insertion was determined by sequencing amplicons generated by ligation-mediated
inverse PCR (Cox et al., 1999). Briefly, 1-2 µg of DNA was digested with BssHII, a low-moderate
frequency cutting restriction enzyme that doesn’t cut the transposon, followed by heat inactivation
of the restriction enzyme and analysis in an agarose gel to check for complete digestion. An aliquot
of the digested DNA (<0,5ng) was diluted (1:10) and ligated overnight at 16ºC, followed by ethanol
precipitation. Using these products a PCR was done to amplify the DNA regions adjacent to the
transposon using TaKaRa La Taq DNA polymerase (TaKaRa, Shiga, Japan) with the primers
corresponding to the left (Tn_L) and the right (Tn_R) (Table 1) ends of the transposon. The
56 Chapter 2
amplified products were sequenced using an ABI prism 3100 Genetic Analyser (Applied Biosystems)
with Big Dye Terminator v3.1 cycle sequencing Kit (Perkin Elmer Applied Biosystems, Courtaboeuf,
France). Sequences were mapped in M. tuberculosis H37Rv genome available at Tuberculist (Cole
et al., 1998). Transposon insertions within the mmpL9, moaD1, ppe54 and ppe56 genes were also
confirmed by Multiplex-PCR using a primer flaking the site of transposon insertion (genename_F)
with primers hybridizing inside the transposon (Tn_L and Tn_R2) (Table 1).
Table 1. List of oligonucleotides (5’-3’) used in this study.
Primer name Sequence
Tn_L GTCGGCCATTAGCTTCT
Tn_R CACCACCGATCCTCAT
Tn_R2 GCACCACCGATCCTCAT
mmpL9_F GCATCAGAACCTATGTCACCG
mmpL9_R GATCGCATGGTCAACATCA
moaD1_F CGCTGTCAGCGTCACTATC
ppe54_F GGTATCGGCAATGTAGGTACTCA
ppe56_F CATCCTCATCGGCGATA
pMV_F ATTCTAGAGCATCATCCTCCCACGAC
pMV_R ATAAGCTTTATCAACCCCGGTGCAGAT
2.3.4 Complementation of mmpL9 and moaD1 mutants
To genetically complement the mmpL9 mutant, the mmpL9 gene with its putative promoter
region from the wild-type strain M. tuberculosis GC1237 or H37Rv, was introduced in the
integrative vector pMV306, conferring hygromycin resistance (Lee et al., 1991). The
complementation construct was generated by amplifying the mmpL9 gene along with 629bp
upstream intergenic region from GC1237 or H37Rv chromosomal DNA, using Phusion High-fidelity
DNA polymerase (Finnzymes), with the primers pMV_F and pMV_R (Table 1), containing the
restriction sites of XbaI and HindIII, respectively. The amplified product was gel purified, digested
with XbaI and HindIII, and cloned between XbaI and HindIII sites in pMV306. The resulting plasmid
was sequenced to confirm that no mutations were present, and transformed into the mutant by
electroporation as described (Parish and Stoker, 1998). Transformed bacteria were recovered using
hygromycin and kanamycin selection (50 µg/ml both) and the presence of the wild-type gene was
confirmed by PCR using primers mmpL9_F and mmpL9_R (Table 1).
57 M. tuberculosis resistance to ROS
The moaD1 mutant was complemented using the pYUB412-derived cosmid (Bange et al., 1999)
I528, which carries a DNA fragment covering the 3454 to 3485 Kb region of the M. tuberculosis
H37Rv chromosome and a hygromycin resistance cassette. Bacteria were transformed and selected
as described for mmpL9 mutant complementation.
2.3.5 Susceptibility to oxidative stress, starvation and acidic pH
Bacteria were collected from cultures, washed twice with PBS and clumps were dissociated by
needle passages, as performed for macrophage infection. To assess the killing effect of H2O2,
single-cell suspensions were adjusted to approximately 1x106 CFU/ml in 7H9 medium without ADC.
Then, bacteria were exposed to 9mM H2O2 for 4 hours at 37ºC. Control untreated bacteria were
also included. Dilutions were made, plated and CFUs were counted after 3 weeks growth at 37ºC.
Percentage of survival was calculated by dividing the number of H2O2 treated CFUs by the number
of untreated CFUs and multiplying by 100. For growth rate analysis, bacteria were grown in 7H9
medium at 37ºC in the presence of increasing concentrations of H2O2 (4mM, 6mM, 9mM, 12mM
and 15mM), or at pH 4.5, and OD values were measured, at 600nm, every three days, during 2 to 3
weeks.
Susceptibility to complete starvation was determined essentially as previously described (Parish,
2003). Briefly, single-cell suspensions were adjusted to approximately 1x106CFUs/ml in sterile
distilled water and incubated at 37ºC. Aliquots were taken 5 and 10 days after, dilutions were
made and plated, and CFUs were analysed 3 weeks later. Percentage of survival was calculated by
dividing the number of CFUs at day 5 or 10 by the number of CFUs at time zero and multiplying by
100.
2.3.6 Human monocyte isolation for subsequent macrophage generation
Freshly collected buffy coats were obtained in accordance with institutional requirements and
written consent from healthy donors. PBMC fraction was collected using a Ficoll gradient (Ficoll-
PaqueTM Plus, GE Health Care) and monocytes were purified by positive selection using anti-CD14
conjugated magnetic microbeads (Milteny Biotec) and Quadro MACS Separation System (Milteny
Biotec) according to manufacturer’s protocol. Monocytes were distributed into 6-well plates and
allowed to adhere in a 5% CO2 incubator at 37°C in 3ml of RPMI-1640 (Sigma-Aldrich) containing 2
mM of L-glutamine (Gibco), 10% of heat inactivated foetal bovine serum (PAN Biotech) and 50
ng/ml of cytokine rhM-CSF (recombinant human macrophage colony stimulating factor) (R&D
58 Chapter 2
Systems) to differentiate into macrophages. Cultures were fed every 2 days with this medium
containing full doses of cytokine during 6 days.
Before infection, macrophages were recovered using a non-enzymatic cell dissociation solution
(Sigma-Aldrich), counted and adjusted to 2x105 per well in 24-well plates, where they were allowed
to adhere.
2.3.7 Macrophage Infections
Bacteria were grown in 7H9 medium without Tween at 37°C. In the infection day, bacteria were
recovered, washed two times and resuspended in 1 ml PBS. Clumps were disassociated by 30
passages through a 0,8x40 mm needle and 50 passages though a 0,45x10 mm needle (3 times). OD
was measured, at 600 nm, and correlated with bacterial number in order to adjust the multiplicity
of infection (MOI) used for infection. The medium was removed from blood-monocyte derived
macrophages and replaced with 500µl of bacterial suspensions in RPMI-1640, containing 2 mM of
L-glutamine and 10% of heat inactivated foetal bovine serum. After 4 hours of infection, medium
was removed along with non-ingested bacteria and cells were incubated with fresh medium. At
each time point post-infection, macrophages were lysed, dilutions were made and samples were
plated in 7H11 Middlebrook agar. After 3 weeks growth at 37ºC, bacteria were quantified by CFUs
analysis. When using luminescent M. tuberculosis, bacteria were quantified immediately after
macrophage lysis, in a luminometer. Each infection experiment was carried out using triplicates for
each condition/strain.
When using NADPH oxidase inhibitors, macrophages were incubated for 1 hour with 100µM
Apocynin (Calbiochem) and 10µM Diphenyleneiodonium (DPI) (Sigma-Aldrich) prior to infection.
Dimethyl sulfoxide (DMSO) was added to cultures at 0.1% (vol/vol) as a solvent control. The ROS
scavenger 4-Hydroxy-TEMPO (0.1 and 0.2 mM; Sigma-Aldrich) as well as superoxide dismutase
(55U/ml; Sigma-Aldrich) were added during the 4 hour infection period and washed away from
cells along with non-ingested bacteria. To activate macrophages, 1α,25-Dihydroxyvitamin D3 (10-8,
10-7 or 10-6 M; Sigma-Aldrich), the active form of vitamin D3, was added to cells after the 4 hour
infection period and left in the medium during the entire post-infection period. Ethanol 95% was
added to cultures at 0.1% (vol/vol) as a solvent control for Vitamin D3. In these experiments
macrophages were infected with M. tuberculosis strains expressing luciferase.
59 M. tuberculosis resistance to ROS
2.3.8 Superoxide Anion detection in human macrophages
Superoxide production by macrophages was measured using the LumiMax Superoxide Anion
Detection kit (Agilent Technologies). Monocyte derived-macrophages (2x105) were incubated with
apocynin (50 and 100µM) and DPI (1 and 10 µM) for 1 hour at 37ºC, 5% CO2. Then, macrophages
were collected and resuspended in the SOA assay medium, provided with the kit. A solution
containing luminol, an enhancer, and PMA (Phorbol 12-myristate 13-acetate;Sigma), a NADPH-
oxidase stimulator, or M. tuberculosis, was added to macrophages following manufacturer’s
instructions. The chemiluminescence resulting from oxidation of luminol by the superoxide anion
was then detected using a luminometer.
2.3.9 Analysis of polymorphisms in mmpL genes in M. tuberculosis genomes
Twenty-four genomes, three recently sequenced by our lab (Namouchi et al., 2012) and 21
publicly available, from major M. tuberculosis lineages were analysed to identify SNPs in the 13
mmpL genes present in M. tuberculosis genomes (Cole et al., 1998). This was performed as
described by Namouchi et al. (2012).
2.3.10 Statistics
Statistical significance was determined using the Student’s two-tailed, unpaired, t-test. Analyses
were performed using the GraphPad Prism software (GraphPad Software, CA, USA).
2.3.11 Ethics Statement
Human monocytes were purified from buffy coats obtained from healthy blood donors
(Etablissement Français du Sang, EFS, Rungis). All donors participating to this study had given
their written consent under a EFS contract C- CPSL UNT N°09/EFS/062, following articles L1243-
4 and R1243-61 of the French Public Health Code and approved by the French Ministry of
Science and Technology. Supply and handling of human red cells followed the guidelines of the
agreement between Institut Pasteur, EFS and the regulation of blood donation in France. As a
“collection” is defined by Decree 2007-1220 as “a collection, for scientific use, of biological
samples from a group of persons who have been identified and selected on the basis of clinical
or biological characteristics of one or several members of the group”, and as the blood samples
used in our study were not obtained from individuals that have been “identified or selected on
the basis of clinical or biological characteristics”, these samples do not constitute a so-called
60 Chapter 2
“collection”, which waives the need for ethical approval by the ethical committee “Comité de
Protection des Personnes”, in agreement with Decree 2007-1220, article R1243-63.
61 M. tuberculosis resistance to ROS
RESULTS 2.4
2.4.1 Screening for mutants with increased susceptibility to oxidative stress
In order to optimize the conditions to screen a mutant library for mutants with increased
susceptibility to H2O2, we tested a small set of DNA repair mutant strains. These were knockout
mutants in mutT1, mutM, and mutY genes, involved in handling oxidized guanine, an important
DNA lesion caused by ROS (Demple and Harrison, 1994). Analysis of growth rates in the presence of
increasing concentrations of H2O2 show that 9 mM H2O2 totally inhibited the mutY mutant growth,
while the wild-type (H37Rv), as well as the mutT1 and mutM mutant strains, were still able to grow
(Figure 1). At 12mM H2O2 growth was totally inhibited for all strains (Figure 1). The mutY mutant
presented a slight growth defect in the absence of H2O2 that could also be due to sensitivity to
oxidative stress caused by endogenous ROS resulting from aerobic respiration (Imlay, 2008; Storz
and Imlay, 1999). These results show that the mutY mutant has an increased susceptibility to H2O2
and allowed us to define the conditions to use in our screening.
Figure 1. Growth curves of M. tuberculosis H37Rv, ΔmutT1, ΔmutM and ΔmutY in increasing
concentrations of hydrogen peroxide. Data represent means of triplicates in a representative
experiment.
62 Chapter 2
The difference observed between the mutY, mutT1 and mutM mutants might be explained by
the fact that M. tuberculosis possesses multiple homologs of mutT and mutM in the genome, while
a single mutY homolog has been annotated in mycobacterial genomes (Cole et al., 1998). For
example, mycobacterial MutT1 and MutT2 seem both to have 8-oxo-GTP hydrolase activity (Dos
Vultos et al., 2006).
Next, we screened a transposon mutant library constructed in a virulent M. tuberculosis clinical
isolate (GC1237) of the Beijing/W family (Brodin et al., 2010). M. tuberculosis GC1237 growth in the
presence of H2O2 was similar to H37Rv (Figure 2). Sensitive mutants were identified by comparing
their OD values to the ones of the wild-type after 3 weeks growth in the presence of 9 mM H2O2.
The analysis of approximately 6000 mutants allowed the selection of 18 H2O2 sensitive mutants
corresponding to 11 different genes and two intergenic regions identified by sequencing the
transposon insertion sites after inverse PCR (Table 2). No significant growth defect was observed
for these mutants in the absence of H2O2, indicating that their sensitivity to H2O2 is specific (Table
2).
Figure 2 - Growth curves of M. tuberculosis GC1237 in increasing concentrations of hydrogen
peroxide. Data represent means of triplicates in a representative experiment.
2.4.2 Sensitive mutants to oxidative stress are affected in cell envelope functions
Interestingly, many of the sensitive mutants to oxidative stress we have identified harbour defects in
genes involved in M. tuberculosis cell envelope functions (Table 2). These include four different ppe
genes, that code for cell surface proteins, present almost exclusively in pathogenic mycobacteria,
thought to be involved in virulence (Akhter et al., 2012), as well as an ABC transporter (Rv0986)
implicated either in the transport of an adherence factor or in mycobacterial cell wall architecture and
integrity (Rosas-Magallanes et al., 2007).
63 M. tuberculosis resistance to ROS
Table 2. List of identified sensitive mutants to oxidative stress using hydrogen peroxide.
Cell envelope associated function Insertion sequences and phages
Intermediary metabolism and respiration Unknown
Conserved hypotheticals
aAnnotations are from tuberculist http://genolist.pasteur.fr/TubercuList/.
b, c Growth index is the ratio of the optical density value of the mutant to that of the wild-type strain after 3 weeks
growth in the absence (b) or presence (c) of H2O2 9mM. Mutants with a growth index below 0.4 were selected as sensitive to H2O2.
*Tn inserted 41 bp upstream the gene start codon.
Mutant id
Gene (transposon insertion site)
Product Putative function
a Growth Index
b
Growth Index H2O2
c
Reference
118B7 Rv0305c (2701:2702)
PPE6 Unknown
0,99 0.35 This study
118F3 Rv0986 (430:431)
ABC transporter Thought to be involved in active transport of adhesion component across the membrane
1,04 0.24 (Fontan et al., 2008; Pethe et al., 2004;
Rosas-Magallanes et al., 2007)
100C5 Rv1548c (1125:1126)
PPE21 Unknown
0.85 0.38 (Voskuil et al., 2004)
98F4 Rv2339(1290:1291)
Transmembrane transport protein MmpL9 Thought to be involved in fatty acid transport
0.80 0.13 (Domenech et al., 2005; Lamichhane et al., 2005;
MacGurn and Cox, 2007)
100D7 Rv2339 (957:958)
Transmembrane transport protein MmpL9 Thought to be involved in fatty acid transport
1,02 0.31 (Domenech et al., 2005; Lamichhane et al., 2005;
MacGurn and Cox, 2007)
117C10 Rv2339 (812:813)
Transmembrane transport protein MmpL9 Thought to be involved in fatty acid transport
0,95 0.23 (Domenech et al., 2005; Lamichhane et al., 2005;
MacGurn and Cox, 2007)
104D8 Rv3343c (2758:2759)
PPE54 Unknown
1.13 0.31 (Brodin et al., 2010; Voskuil et al., 2004)
115C10 Rv3343c (5907:5908)
PPE54 Unknown
1,01 0.32 (Brodin et al., 2010; Voskuil et al., 2004)
99G11 Rv3350c (1441:1442)
PPE56 Unknown
0.93 0.23 (Voskuil et al., 2004)
115B9 Rv3350c (5059:5060)
PPE56 Unknown
1,03 0.27 (Voskuil et al., 2004)
115C9 RV3350c (5059:5060)
PPE56 Unknown
0,98 0.30 (Voskuil et al., 2004)
115C4 Rv3112 (49:50)
Molybdenum cofactor biosynthesis protein MoaD1 Involved in molybdenum cofactor biosynthesis
0,92 0.38 (Brodin et al., 2010)
100E6 Rv1507c (591:592)
Conserved hypothetical protein Unknown
0.95 0.36 (Brodin et al., 2010)
111E12 Rv3594 (774:775)
Conserved hypothetical protein Unknown
0,74 0.09 This study
96F9 Rv1509 (637:638)
Hypothetical protein Unknown
0,89 0.34 This study
100D1 Rv2337c (-41)* Hypothetical protein Unknown
1,05 0.15 This study
106H11 Rv3430c (1049:1050)
Possible transposase Involved in the transposition of the insertion sequence IS1540
0,75 0.20 (Dutta et al., 2010)
98G4 Rv2480c-Rv2481c (2786248:2786249)
Possible transposase for insertion sequence element IS6110 (fragment)-Hypothetical protein
0.76 0.14 -
64 Chapter 2
Strikingly, we could independently isolate three different mutants in the mmpL9 gene, which
suggests an important role for MmpL9 in M. tuberculosis response to oxidative stress (Table 2).
MmpLs (mycobacterial membrane protein large) are thought to be involved in lipid synthesis
and/or transport (Tekaia et al., 1999).
Some genes with no apparent known function were also identified in our screen (Table 2).
However, rv1507c belongs apparently to a cluster of genes organized in an operon (rv1503c-
rv1507c), involved in di-O-acyl-trehalose (DAT) lipid synthesis (Brodin et al., 2010). The rv1509 gene
seems to form an operon along with rv1508a. BLAST analysis identified methyltransferase domains
in the Rv1509 protein. Rv1508a shows homology with GDP-D-Mannose-Dehydratase (GMD). GMD
is involved in the production of L-fucose from GDP-D-mannose. Fucose is part of PGLs found in
Beijing/W strains. However, other GMP has been identified that seems to be already involved in
this pathway (Malaga et al., 2008). Thus, whether Rv1508a along with Rv1509 are involved in lipid
synthesis is unclear. Rv3594, another protein with unknown function found in our screen, shows
similarities with an N-acetylmuramoyl-L-alanine-amidase, a peptidoglycan hydrolase.
Peptidoglycan hydrolases participate in bacterial cell wall growth and regulation as well as in
different lysis phenomena (Vollmer et al., 2008).
We have also identified a few genes not associated with M. tuberculosis cell envelope functions.
It was the case of moaD1, recently confirmed as involved in the biosynthesis of the molybdenum
cofactor (MoCo) in M. tuberculosis (Williams et al., 2011).
Curiously, a mutant in a putative transposase (Rv3430c) was selected as sensitive to oxidative
stress. A significant proportion of insertion element genes including transposases were also found
to be highly induced in M. tuberculosis after exposure to several DNA-damaging agents, including
H2O2 (Boshoff et al., 2003). However, the correlation between these mobile genetic elements and
oxidative stress or DNA damage/repair is not clear. This gene was also found to be important for
M. tuberculosis survival in the lungs of non-human primates (Dutta et al., 2010), suggesting a role
for Rv3430c in vivo.
2.4.3 Quantification of sensitivity of mutants to oxidative stress
The sensitive phenotype of our newly identified mutants to oxidative stress was further
analyzed and quantified on the individual level. This was done by analyzing the killing effect of
H2O2 in several of those mutants possibly affected in cell envelope components including, two PPE
mutants, ppe54 and ppe56, and an mmpL9 mutant, as well as for the moaD1 mutant possibly
implicated in other kind of defense mechanism against oxidative stress. As several mutants,
65 M. tuberculosis resistance to ROS
carrying independent transposon insertions, were identified we have randomly chosen a ppe54
(104D8), a ppe56 (115B9) and an mmpL9 (100D7) mutant (Table 2).
The results represented in Figure 3 show that all mutant strains, except ppe54, have an
increased sensitivity to killing by H2O2 when compared to their wild-type counterpart. We observed
a decrease in survival ranging from around 40% (104D8, ppe56 mutant) to nearly 80% (100D7,
mmpL9 mutant), while the killing rate for the wild-type strain was less than 20% (Figure 3). There
was no difference in colony size or morphology of the mutants when compared to the wild-type
strain in the absence of H2O2 (data not shown). These results confirm the sensitive phenotype of
these strains to oxidative stress in the presence of H2O2 and reveal its bactericidal effects.
Figure 3. Susceptibility of transposon mutants to oxidative stress. Percentage of survival of the M.
tuberculosis 100D7 (mmpL9), 115C4 (moaD1), 104D8 (ppe54), 115B9 (ppe56) transposon mutants and
wild-type (GC1237) strains was determined by comparing bacteria treated with 9mM of hydrogen
peroxide to untreated controls. Data and error bars represent means and standard deviations of the
results from triplicates in a representative experiment carried out three times with similar results.
Statistically significant differences were calculated using the Student’s two-tailed, unpaired, t-test, and
are indicated by asterisks *P<0,05; ***P<0,001; ****P<0,0001.
The difference in sensitivity to H2O2 between the ppe54 mutant and the wild-type strain was not
statistically significant. This suggests that the effect of H2O2 on this strain is not bactericidal but
probably only bacteriostatic as we observed growth inhibition in the presence of H2O2 during the
screen (Table 2). Additionally, two different mutants, carrying independent transposon insertions
66 Chapter 2
in the ppe54 gene, were selected (Table 2), confirming the sensitivity to oxidative stress of any
strain carrying a mutation in this gene.
2.4.4 MmpL9 and MoaD1 are important for M. tuberculosis survival in human
macrophages
Because bacteria have to face oxidative stress conditions inside host cells we decided to analyze
growth in human macrophages of the moaD1 and mmpL9 mutants which were the most sensitive
strains to killing by H2O2 (Figure 3). Additionally, MmpLs have been identified as important
determinants of M. tuberculosis virulence (Camacho et al., 1999; Converse et al., 2003; Cox et al.,
1999; Domenech et al., 2005), even though reports regarding mmpL9 mutant phenotype in mice
are contradictory (Cox et al., 1999; Domenech et al., 2005; Lamichhane et al., 2005; MacGurn and
Cox, 2007). Genes involved in the same biosynthetic pathway as moaD1 have been previously
shown to be important for bacterial intracellular lifestyle (Rosas-Magallanes et al., 2007),
suggesting an important role for MoCo in M. tuberculosis survival inside host cells.
Monocyte-derived macrophages were infected with mutant, wild-type and complemented
strains and after six days post-infection cells were lysed and bacteria were plated to analyze CFUs.
As shown in Figure 4, both moaD1 and mmpL9 (100D7) mutants displayed an impaired intracellular
growth when compared to their wild-type counterpart (Figure 4A and B). At day 6 post-infection,
the moaD1 mutant showed a 4-fold increase in intracellular growth while the wild-type showed a
12-fold increase, with respect to time-point zero. Complementation of the moaD1 mutant using an
integrative vector restored the wild-type phenotype inside macrophages (Figure 4A). These results
suggest that MoCo might be indeed important for mycobacterial growth inside host cells.
Infection of human macrophages with the mmpL9 mutant resulted in an increase of 2.5-fold
while the wild-type had a 15-fold increase in CFUs, after 6 days (Figure 4B). Sequence analysis of
the mmpL9 gene of the wild-type strain GC1237 revealed, when compared to H37Rv, the presence
of one nucleotide deletion at position 218. To better understand the possible effects of this
frameshift mutation, we decided to complement the mmpL9 mutant with mmpL9 of either GC1237
or H37Rv. As shown in Figure 4B, complementation restored the wild-type phenotype inside
macrophages using mmpL9 of GC1237. However, it seems to be only partially restored when
complemented with H37Rv mmpL9.
67 M. tuberculosis resistance to ROS
Figure 4. Intracellular growth of mmpL9 and moaD1 mutants in human macrophages. Monocyte-
derived macrophages where infected with wild-type, moaD1 (A) or mmpL9 (B) mutant and
complemented (COMP) strains, at an MOI of 1:100 (bacteria per macrophage). At time point zero (0)
and six days of infection, cells were lysed and bacteria were enumerated. Data and error bars represent
means and standard deviations of the results from triplicates in a representative experiment carried out
three times with similar results. Statistically significant differences were calculated using the Student’s
two-tailed, unpaired, t-test, and are indicated by asterisks *P<0,05; **P<0,01;***P<0,001.
Unfortunately, we could not detect, using Western blotting, expression of either H37Rv or
GC1237 mmpL9 carrying a hemagglutinin tag, under the control of its own or of a strong promoter
(hsp60), in either M. tuberculosis or M. smegmatis, using different growth conditions and whole
cell lysate preparation methods (data not shown).
2.4.5 The mmpL9 deletion at position 218 is conserved in Beijing/W strains
To investigate the possible effects of the deletion identified in mmpL9 for the GC1237 strain, we
searched for SNPs in the 13 M. tuberculosis mmpL genes (Cole et al., 1998) in a collection of strains
representing main M. tuberculosis lineages. Statistical analysis of the identified SNPs suggests that
68 Chapter 2
the mmpL9 gene does not accumulate more polymorphisms than the other mmpLs (Table 3),
excluding the hypothesis of pseudogene formation but not that of an effect, of the observed
polymorphisms, on protein’s functions.
Table 3. Statistical analysis of SNP density in mmpL genes in a collection of M. tuberculosis genomes.
Name Length (bp)
SNPs Binomial testa
Bonferroni correctionb
mmpL1 2877 3 0,926187042 12,96661859
mmpL2 2907 9 0,167599855 2,346397974
mmpL3 2835 13 0,008366836 0,117135699
mmpL4 2904 6 0,565387826 7,915429562
mmpL5 2895 7 0,406734347 5,694280858
mmpL6 1194 6 0,026461116 0,370455623
mmpL7 2763 5 0,670824515 9,391543207
mmpL8 3270 9 0,270440559 3,786167821
mmpL9 2889 7 0,404469247 5,662569455
mmpL10 3009 2 0,980458231 13,72641523
mmpL11 2901 5 0,716449242 10,03028939
mmpL12 3441 11 0,128927703 1,804987847
mmpL13a 912 4 0,071781264 1,004937698
mmpL13b 1413 1 0,862276271 12,07186779
Total 36210 88
aThe binomial test was used to identify mmpL genes that accumulate more SNPs than expected. The p-value was
calculated according to the number of SNPs and length of each gene and the total number of SNPs and genes length. bThe final p-value was estimated after Bonferroni correction.
Additionally, analysis of polymorphisms in mmpL9 in these collection of strains have shown that
the deletion in nucleotide 218 is specific to all modern and ancestral Beijing/W strains, being
absent from early ancestral Beijing/W strains, such as 94_M4241A, and strains of any other M.
tuberculosis family/lineage (Figure 5).
69 M. tuberculosis resistance to ROS
Figure 5. Graphical representation of the distribution of polymorphisms in mmpL9 in several M.
tuberculosis genomes. Polymorphisms in mmpL9 were analyzed in 24 different M. tuberculosis
genomes (Namouchi et al., 2012) that correspond to the following groups/lineages according to
Gagneux’s classification (Gagneux et al., 2006a): 1-8: Beijing/W strains; 9-16: Euro-American strains; 17-
20: Indo-oceanic strains; 21-22: West-African strains. Black vertical lines correspond to SNPs. Gap
correspond to deletion in position 218 identified in all modern and ancestral (2-8) but not in early
ancestral (1) Beijing/W strains.
2.4.6 MmpL9 and MoaD1 are required to counteract other forms of stress existent in
macrophages
The wild-type phenotype was partially achieved for both moaD1 and mmpL9 complemented
strains in susceptibility tests using H2O2 (Figure 6). The reasons behind these observations are not
understood. It could be due to differences in the fine tuning of expression of these genes once they
are placed outside their normal chromosomal context. Nonetheless, the mmpL9 and moaD1 genes
should have a function in M. tuberculosis oxidative stress, otherwise complementation would not
have restored the wild-type phenotype at all. These results were unexpected once
complementation totally restored the wild-type phenotype in macrophages (Figure 4). To
investigate if the attenuated growth of the mmpL9 and moaD1 mutants in macrophages was due,
at least in part, to their sensitivity to ROS, we’ve analysed their phenotype in macrophages treated
with Phox-inhibitors.
70 Chapter 2
Figure 6. Survival of mmpL9 and moaD1 mutant and complemented strains exposed to hydrogen
peroxide. Percentage of survival of M. tuberculosis wild-type (GC1237), moaD1 (A) and mmpL9 (B)
mutant and complemented (COMP) strains was determined by comparing bacteria treated with 9mM
of hydrogen peroxide to untreated controls. Data and error bars represent means and standard
deviations of the results from triplicates in a representative experiment. Statistically significant
differences were calculated using the Student’s two-tailed, unpaired, t-test, and are indicated by
asterisks ***P<0,001; ****P<0,0001.
Macrophages were treated with apocynin and diphenyleneiodonium (DPI), the most common
used NADPH inhibitors (Flannagan et al., 2009). To analyse if Phox could be effectively inhibited
using these compounds we measured superoxide production in these cells. Almost 90% reduction
in superoxide production using apocynin (100µM) and more than 70% using DPI (10µM) was
observed (Figure 7A). These compounds did not seem to significantly affect the viability of
macrophages as assessed by trypan blue exclusion (Figure 7B).
71 M. tuberculosis resistance to ROS
Figure 7. Macrophages treated with the NADPH oxidase inhibitors, apocynin and DPI.
Macrophages (~2x105) were treated for 1h with DPI (1, 10µM) and apocynin (50, 100 µM). Untreated
macrophages were used as control. Superoxide production was measured by quantifying
chemiluminescence resulting from oxidation of luminol in a luminometer (RLUs - Relative light units),
after stimulation of macrophages with PMA (A). Effect on cell viability was determined by counting
cells unstained (viable) with trypan blue. DMSO was included as a solvent control. No statistical
significant differences between cells treated with inhibitors and untreated cells were observed (B).
Data and error bars represent means and standard deviations of the results from triplicates.
Macrophages were treated with the inhibitors and infected with luminescent M. tuberculosis
mmpL9 and moaD1 mutants, as well as the wild-type strain. As shown in figure 8, no statistically
significant differences were observed between untreated and inhibitor-treated macrophages
infected with either mutants or the wild-type strain (Figure 8). We realized, however, that infected
macrophages treated with DPI had a different morphology compared to untreated macrophages,
when observed under the light microscope (data not shown) even though this compound didn’t
seem to significantly affect macrophage viability (Figure 7B). This could be probably because DPI is
a nonspecific inhibitor of many different electron transporters (Bedard and Krause, 2007). Given
that we did not know which consequences this could have on intracellular bacterial survival, DPI
was excluded from the subsequent experiments.
72 Chapter 2
Figure 8. Intracellular growth of mmpL9 and moaD1 mutants in human macrophages treated with
Phox inhibitors. Monocyte-derived macrophages (~2x105) where treated with apocynin (100µM) and
DPI (10µM) prior to infection with luminescent wild-type (GC1237), moaD1 or mmpL9 mutant strains, at
an MOI of 1:10 (bacteria per macrophage). DMSO was used as a solvent control. After 3 days (D3) of
infection cells were lysed and bacteria were quantified by detecting luminescence in a luminometer
(RLUs - Relative light units). Data and error bars represent means and standard deviations of the results
from triplicates in a representative experiment carried out three times with similar results.
Vitamin D3-activated macrophages have an increased antimycobacterial activity that seems to
be mediated, at least in part, by superoxide produced by Phox (Sly et al., 2001). By increasing ROS
production we could possibly increase the difference between treated and untreated macrophages
with Phox inhibitors, in case there is one. We did indeed observe a reduction in bacterial load
(Figure 9A) as well as an increased superoxide production (Figure 9B) in macrophages activated
with 1α,25-Dihydroxyvitamin D3, the active form of vitamin D3, infected with M. tuberculosis
GC1237. Thus, we decided to use vitamin D3-activated macrophages to analyse the phenotype of
the mmpL9 and moaD1 mutants in the presence of phox inhibitors.
73 M. tuberculosis resistance to ROS
Figure 9. Macrophages activated with Vitamin D3. Monocyte-derived macrophages were treated with
1α,25-Dihydroxyvitamin D3 (10-6M), the active form of vitamin D3, and superoxide production was
measured by quantifying chemiluminescence resulting from oxidation of luminol in a luminometer
(RLUs - Relative light units), after stimulation with M. tuberculosis GC1237 (A). Macrophages were
infected with luminescent M. tuberculosis GC1237 at an MOI of 1:10 (bacteria per macrophage), and
incubated with 1α,25-Dihydroxyvitamin D3 (10-8, 10-7,10-6M). After 3 days of infection, cells were lysed
and bacteria were quantified by detecting luminescence in a luminometer (RLUs - Relative light units).
Data and error bars represent means and standard deviations of the results from triplicates in a
representative experiment carried out two times with similar results. Statistically significant differences
were calculated using the Student’s two-tailed, unpaired, t-test, and are indicated by asterisks *P<0,05;
***P<0,001; ****P<0,0001 (B). Untreated macrophages were used as control. Ethanol was used as a
solvent control.
Given that the ROS scavengers TEMPO, and the antioxidant enzyme superoxide dismutase (SOD)
were found to abrogate Vitamin D3 antimycobacterial effect (Sly et al., 2001), we used these
compounds, along with apocynin, to inhibit ROS production. Infected macrophages treated with
apocynin, TEMPO, as well as SOD, were incubated with vitamin D3 and bacteria were quantified by
detecting luminescence. The results presented in Figure 10 show a bacterial growth augmentation,
for the mutants as well as the wild-type strain, in macrophages treated with TEMPO, when
compared to untreated cells. However, this increase was similar in all strains, which means no
difference between mutants and wild-type. No statistically significant difference was observed in
bacterial growth, for any of the strains, in apocynin or SOD treated macrophages.
74 Chapter 2
Figure 10. Intracellular growth of mmpL9 and moaD1 mutants in VitaminD3-activated
macrophages treated with Phox inhibitors. Monocyte-derived macrophages (~2x105) where treated
with apocynin (100µM), superoxide dismutase (SOD) (55U/ml) and TEMPO (T ) (0.1 and 0.2 mM),
infected with luminescent M. tuberculosis wild-type (GC1237), moaD1 or mmpL9 mutant strains, at an
MOI of 1:10 (bacteria per macrophage), and incubated with 1α,25-Dihydroxyvitamin D3 (5x10-7M).
Untreated macrophages were used as control. Ethanol and DMSO were used as a solvent control for
vitaminD3 and apocynin, respectively. After 3 days of infection, cells were lysed and bacteria were
quantified by detecting luminescence in a luminometer (RLUs - Relative light units). Data and error bars
represent means and standard deviations of the results from triplicates in a representative experiment
carried out two times with similar results. Statistically significant differences were calculated using the
Student’s two-tailed, unpaired, t-test, and are indicated by asterisks *P<0,05; **P<0,01; ***P<0,001.
75 M. tuberculosis resistance to ROS
These results suggest that mmpL9 and moaD1 genes are required to protect M. tuberculosis
against other kind of stress found inside macrophages. Therefore, we tested susceptibility of these
mutants to other conditions such as starvation and acidic pH. Due to technical issues we couldn’t
obtain results for the moaD1 mutant in acidic conditions. Preliminary results showed no
statistically significant difference in mutant’s fitness, when compared to the wild-type, in the
conditions tested (Figure 11). Unfortunately, we didn’t have the opportunity to test for
susceptibility to reactive nitrogen species (RNS), another group of antimicrobial molecules
produced by macrophages to destroy intracellular bacteria (Flannagan et al., 2009).
Figure 11. Susceptibility of mmpL9 and moaD1 mutants to acidic pH and starvation. Growth curves
of M. tuberculosis GC1237, and mmpL9 mutant in 7H9 medium at pH7 or 4.5 (A). Susceptibility of
mmpL9 and moaD1 mutants to starvation was determined by quantifying CFUs after 5 and 10 days of
incubation in sterile water at 37ºC. Percentage of survival was determined by comparing CFUs at the
referred time points with CFUs at time-point zero, before incubation (B).
76 Chapter 2
77 M. tuberculosis resistance to ROS
DISCUSSION 2.5
The role of ROS during infection with M. tuberculosis remains unclear. Therefore, we decided to
look for genes involved in M. tuberculosis oxidative stress response using, for the first time, a
functional genomic approach. By screening a transposon mutant library we found a high number of
mutants sensitive to H2O2 that were affected in genes involved in cell envelope functions. M.
tuberculosis cell envelope is an important permeability barrier involved in bacterial protection
against different kinds of aggression (Brennan and Nikaido, 1995). This has been continuously
shown. For example, a high percentage of genes identified as responsible for M. tuberculosis
resistance to acidic stress during a genetic screening, were also found to be involved in bacteria’s
cell wall functions (Vandal et al., 2008). However, few studies have previously described cell
envelope components/mechanisms as involved in M. tuberculosis defense against ROS. Our results
reveal the important role of M. tuberculosis cell envelope in protection against ROS.
One of the genes identified during our study as associated with cell envelope functions was
mmpL9. We identified three mutants carrying independent transposon insertions is this gene. Even
though it is possible that mmpL9 represents a hotspot for transposon insertion, our results suggest
that it seems to be indeed important for M. tuberculosis survival under oxidative stress conditions
as well as inside host cells. MmpLs belong to the RND (resistance, nodulation and cell division
proteins) family of pumps that recognize and mediate the transport of a range of substrates. In M.
tuberculosis, the colocalization of some mmpL genes with genes involved in polyketide biosynthesis
(pks genes) and lipid metabolism, suggested that MmpLs are involved in lipid synthesis and/or
transport (Tekaia et al., 1999). However, their substrate specificity seems to be dictated, in part, by
their interaction with particular cytosolic enzymes (Jain and Cox, 2005). Thus, mmpL9 might be
involved in the transport of lipids, even though, it does not colocalize with known genes involved in
lipid synthesis (Cole et al., 1998). This seems also to be the case for MmpL3 found to be involved in
the transport of trehalose mycolate in mycobacteria (Grzegorzewicz et al., 2012). Curiously,
MmpL3 has been previously described as involved in heme iron acquisition as well (Tullius et al.,
2011), suggesting that MmpL transporters might be involved in more than one physiological
process in M. tuberculosis. Therefore, MmpL9 could be involved in the transport of other kind of
substances, related to detoxification processes responsible for maintaining an oxidative balance
within the cell. A previous study has shown that mycobacterial P55 efflux pump, besides being
involved in drug resistance, is important for different processes in the cell, including oxidative
stress response (Ramon-Garcia et al., 2009). A Δp55 mutant had increased sensitivity to redox
compounds including diamide, a thiol-oxidizing agent, suggesting that this pump may be involved
78 Chapter 2
in the extrusion of toxic compounds generated by a thiol reductant such as mycothiol (Ramon-
Garcia et al., 2009). Curiously, this mutant was also highly sensitive to drugs targeting the
peptidoglycan layer of the cell wall, suggesting that P55 is also involved in the transport of some
important substrate to the cell wall (Ramon-Garcia et al., 2009). A similar scenario might be
happening for MmpL9.
Strikingly, we’ve identified a frameshift mutation in the mmpL9 gene of the Beijing/W GC1237
strain. Nonetheless, the fact that a transposon mutant had an attenuated phenotype inside
macrophages that was restored after complementation with the wild-type gene suggests that the
GC1237 mmpL9 gene might be functional. Translation of mmpL9 in GC1237 might occur due to a
recoding mechanism (Baranov et al., 2001), for example through the reinitiation of translation from
a second initiation codon, at position 259, in the same reading frame (Figure 12).
Figure 12. Representation of the mmpL9 gene in M. tuberculosis GC1237. The mmpL9 gene in M.
tuberculosis GC1237 contains a deletion (Δ) in position 218. Reinitiaton of translation might occur from
a second initiation codon situated upstream the deletion, at position 259, which would explain the
attenuated phenotype observed in macrophages of the mmpL9 (100D7) mutant carrying a transposon
inserted at position 957:958. The initial part of the gene’s sequence is shown where both deletion (-)
and the putative second initiation codon, which in the same reading frame, are highlighted in bold.
In this case the Beijing/W MmpL9 would be a modified protein, what would explain the partial
complementation by H37Rv mmpL9 in macrophages. Statistical analysis of polymorphisms in mmpL
genes showed that this deletion could have indeed an effect on protein’s functions and seems to
be specific to all modern and ancestral Beijing/W strains. These results suggest that this
polymorphism might have contributed to the evolution of these strains by conferring some
selective advantage. This is important because the Beijing/W family is one of the most successful
groups of M. tuberculosis strains as it has been frequently associated with drug resistance and
found to be distributed throughout the world (Parwati et al., 2010).
79 M. tuberculosis resistance to ROS
Curiously, we did not identify during our screen known antioxidant genes, such as katG or sodC.
It is possible that these mutants were not represented in our library given that we have screened
around 6000 mutants, which may not cover the entire 4000 ORFs of the M. tuberculosis genome
(Cole et al., 1998). On the other hand, some of these mutants might be sensitive to endogenous
ROS resulting from aerobic respiration (Imlay, 2008; Storz and Imlay, 1999), which can result in
some in vitro growth defect in the absence of H2O2. In this case, they could have been excluded
from the study before the screening with H2O2. Indeed, an exhaustive study of M. tuberculosis
whole genome expression in response to oxidative stress caused by H2O2 has shown that katG,
sodA, sodC, ahpD, ahpE and ahpC have high basal levels of expression (Voskuil et al., 2011).
However, most of these are not highly induced by H2O2. In addition these genes are not
consistently induced in M. tuberculosis in host cells (Fontan et al., 2008; Schnappinger et al., 2003).
Thus, these genes might be important to counteract low or basal levels of ROS, however, other
pathways are induced when bacteria are exposed to additional levels of oxidative stress, such as
those produced during the phagocytic oxidative burst (Imlay, 2008; Storz and Imlay, 1999). On the
other hand, M. tuberculosis oxidative stress response is concentration-dependent (Voskuil et al.,
2011), as previously shown for E. coli (Imlay and Linn, 1986). Therefore, using different ROS levels
induce different kinds of responses. Finally, it is also possible that some of these genes have
redundant functions and some mutants might not be sensitive to H2O2 but to other forms of
oxidative stress.
Our results have shown that the molybdenum cofactor (MoCo) seems to be important for M.
tuberculosis growth inside macrophages and resistance to oxidative stress. The same has also been
suggested in previous studies. Several genes involved in MoCo biosynthetic pathway have been
identified as important for M. tuberculosis to counteract oxidative stress conditions (Manganelli et
al., 2002) and to parasitize macrophages (Rosas-Magallanes et al., 2007). Additionally, MoCo also
appears to be important for M. tuberculosis to grow in primate lungs (Dutta et al., 2010), which
reveals the significance of this molecule during infection in vivo. MoCo seems to be required for
the activity of several M. tuberculosis enzymes that present recognizable MoCo-associated
domains, including Nitrate reductase (NarGHJI) (Williams et al., 2011). Nitrate reductase seems to
have both nitrate respiratory (Sohaskey and Wayne, 2003) and assimilatory functions (Malm et al.,
2009). It also seems that nitrate reductase is involved in protection of hypoxic M. tuberculosis from
acid killing, as well as against RNS, conditions encountered by this pathogen during host infection
(Tan et al., 2010). This would explain the importance of MoCo in M. tuberculosis survival in host
cells. However, the role of this molecule in protection against oxidative stress is less clear. Biotin
sulfoxide reductase is also a MoCo-enzyme in M. tuberculosis (Williams et al., 2011) that seems
80 Chapter 2
important for protection from oxidative stress in E. coli, by reducing biotin sulfoxide, the product of
oxidized biotin, into biotin (Ezraty et al., 2005). However, whether this enzyme is functional and
whether it has the same role in M. tuberculosis remains to be determined.
Several genes identified in our screen seem to also have a role in bacterial survival inside host
cells. In a previous study, a ppe54 mutant, identified in a screening using the same transposon
mutant library, exhibited an attenuated growth in mouse macrophages (Brodin et al., 2010). In
addition, M. tuberculosis ppe54 along with ppe56 and ppe21 expression was found to be induced in
IFNγ-activated macrophages (Voskuil et al., 2004). The Rv0986 transporter was also previously
identified as important for M. tuberculosis to bind (Rosas-Magallanes et al., 2007) and replicate
(Pethe et al., 2004) inside macrophages. We have shown that moaD1 and mmpL9 are important for
M. tuberculosis growth in human macrophages as well. Strikingly, some of these genes, rv0986,
ppe54, moaD1 and mmpL9, were also found to be involved in inhibition of phagosome maturation
by M. tuberculosis in previous studies (Brodin et al., 2010; MacGurn and Cox, 2007; Pethe et al.,
2004). We hypothesize that mutants in these genes are delivered to late phagosome
compartments as a consequence of being more susceptible to intracellular killing. Any strain
impaired in intracellular survival will traffic to late endosomes as a secondary effect (Philips, 2008).
Taken together, these observations, suggest a correlation between resistance to oxidative stress
and intracellular growth in macrophages. However, we could not provide experimental proof for a
direct link between increased susceptibility to ROS and reduced intracellular mycobacterial growth.
There was no significant change in mmpL9 and moaD1 mutants phenotype, when compared to the
wild-type, in macrophages treated with ROS inhibitors/scavengers, even when cells where
activated with Vitamin D3, which triggers antimicrobial responses involving ROS production (Sly et
al., 2001)(Sly et al., 2001; Yang et al., 2009). Vitamin D3 activated macrophages might be able to
control mmpL9 and moaD1 mutants growth in a ROS-independent manner, for example through
the induction of autophagy, an apparently central mechanism of vitamin D3 antimicrobial activity
(Shin et al., 2010; Yuk et al., 2009). On the other hand, there are no potent and specific NOX
inhibitors, so, apocynin or DPI, may not be effectively inhibiting Phox throughout the infection
period and could have NOX-unrelated effects (Bedard and Krause, 2007). It is also possible that the
mmpL9 and moaD1 genes are required to protect M. tuberculosis against other forms of stress
existent in macrophages. Indeed, several acid-sensitive mutants, with defects in their cell wall,
were also found to be hypersensitive to oxidative stress (Vandal et al., 2009). However, the mmpL9
mutant did not appear to have an increased susceptibility to acidic pH. Furthermore, neither
mmpL9 nor the moaD1 mutants were more susceptible to starvation. Thus, these genes might be
important to protect M. tuberculosis against RNS or some product resulting from the combination
81 M. tuberculosis resistance to ROS
of ROS with RNS inside macrophages, such as peroxynitrite, one of the most potent natural
oxidants in biological systems (Zahrt and Deretic, 2002). Indeed, few bacterial genes seem to
exclusively participate in resistance to ROS in vivo (Ehrt and Schnappinger, 2009). Finally, another
possible explanation for the results obtained using the phox inhibitors is that M. tuberculosis
oxidative stress resistance mechanisms are extremely efficient thus masking the antimicrobial
effects of ROS on this pathogen. Consequently, M. tuberculosis infection in the absence of ROS is
not particularly affected. This also seems to be an explanation for the results observed during M.
tuberculosis infection in phox-deficient mice (Jung et al., 2002) and macrophages (Chan et al.,
1992).
Most of the genes identified during our screen have not been described in previous genetic
screenings as required for M. tuberculosis survival in macrophages (Rengarajan et al., 2005) or in
animal models such as mice and non-human primates (Dutta et al., 2010; Lamichhane et al., 2005;
Sassetti and Rubin, 2003). They have also not been previously reported as upregulated in M.
tuberculosis inside host cells (Fontan et al., 2008; Schnappinger et al., 2003). However, we cannot
exclude that the genes identified in our and previous reports are involved in the same metabolic
pathway (as observed for MoaD1), or involved in the synthesis of the same factor. For example,
MmpL9 and Rv0986 are transporters of a yet unidentified substrate and some of the genes we
have identified have unknown annotated functions (Table 2). Similarly, numerous genes identified
during analysis of M. tuberculosis whole genome expression in response to oxidative stress are
annotated as having unknown functions (Voskuil et al., 2011). We also have to consider that
differences regarding M. tuberculosis strains and host cells (human or mice cells; primary cell
cultures or cell lines) employed might also explain the only modest overlap of our results with
those of previous studies.
In conclusion, genes involved in M. tuberculosis oxidative stress response are important for this
pathogen and seem to contribute to its intracellular growth in host cells, which make the products
of these genes attractive targets for the development of new drugs or vaccine candidates.
82 Chapter 2
CHAPTER 3
Evolution and diversity of M. tuberculosis Beijing/W strains
reflected by polymorphisms in 3R genes
Olga Mestre1, Tao Luo2, Tiago Dos Vultos1†, Kristin Kremer3, Alan Murray1,4, Amine
Namouchi1, Céline Jackson1, Jean Rauzier1, Pablo Bifani5, Rob Warren6, Voahangy Rasolofo7,
Jian Mei8, Qian Gao2, Brigitte Gicquel1
1 Unité de Génétique Mycobactérienne, Institut Pasteur, Paris, France ;
2Key Laboratory of Medical Molecular
Virology, Fudan University, Shanghai, China; 3
Tuberculosis Reference Laboratory, National Institute for Public
Health and the Environment, Bilthoven, The Netherlands; 4 Institute of Veterinary, Animal and Biomedical Science,
Massey University, Palmerston North, New Zealand;5 Mycobacterial Immunology, Scientific Institute of Public
Health, Brussels, Belgium;6 NRF Centre of Excellence in Biomedical Tuberculosis Research/ MRC Centre for
Molecular and Cellular Biology, Stellenbosch University, Tygerberg, Cape Town, South Africa;7 Unité de la
Tuberculose et des Mycobactéries, Institut Pasteur de Madagascar, Antananarivo, Madagascar;8 Department of TB
Control, Shanghai Municipal CDC, Shanghai, China
The data presented in this chapter is included in the manuscript: “Phylogeny of
Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA
replication, recombination and repair.” Phylogeny of Mycobacterium tuberculosis Beijing strains constructed
from polymorphisms in genes involved in DNA replication, recombination and repair.
Mestre O, Luo T, Dos Vultos T, Kremer K, Murray A, Namouchi A, Jackson C, Rauzier J, Bifani P, Warren R,
Rasolofo V, Mei J, Gao Q, Gicquel B. (2011) PLoS One Jan 20;6(1):e16020.
85 Polymorphisms in 3R genes in Beijing/W strains
ABSTRACT 3.1
Investigating the genetic variability among Mycobacterium tuberculosis is important as it can
provide a basis for understanding pathogenesis and host adaptation, as well as the evolution of this
pathogen. Polymorphic genetic markers have been used to determine this genetic diversity. We
have recently shown that SNPs in DNA repair, recombination and replication (3R) genes are a
useful high resolution tool for strain discrimination and can be used to study M. tuberculosis
evolution.
The Beijing/W family is a successful group of M. tuberculosis strains, often associated with drug
resistance and widely distributed throughout the world. To investigate the genetic diversity and
evolution of the Beijing/W family, polymorphisms in 3R genes were analyzed in a collection of
Beijing/W isolates from different geographic origins. We found SNPs in 3R genes associated with
the Beijing/W family, which enabled discrimination of different groups and the proposal of a
phylogeny. One of these groups appeared to be predominant, representing over 60% of all isolates
in distinct parts of the world. Our results show that the Beijing/W family can be divided into
different groups, characterized by particular SNPs in 3R genes that may define their pathogenic
features and contribute to the evolution of this family. These results may contribute to better
understand the success of the Beijing/W family.
86 Chapter 3
87 Polymorphisms in 3R genes in Beijing/W strains
INTRODUCTION 3.2
Mycobacterium tuberculosis is considered as one of the most successful human pathogens,
infecting nearly one third of the world’s population. However, only 5 to 10% of these infected
persons will develop the disease (TB) and become sick at a certain point during their lifetimes
(WHO at www.who.int/topic/tuberculosis/en/). One of the main questions that has occupied
researchers is what defines who becomes infected and who develops TB. The genetic variability of
M. tuberculosis seems to have a significant role in the outcome of the disease. Epidemiological data
suggested that differences in transmissibility and virulence among M. tuberculosis strains are
related to the genetic background of the organisms (Caminero et al., 2001; Valway et al., 1998).
Years later, studies using animal models have shown that different M. tuberculosis genotypes
display indeed differences in pathogenesis and virulence (Dormans et al., 2004; Lopez et al., 2003;
Palanisamy et al., 2009).
Polymorphic molecular genetic markers have been used to investigate M. tuberculosis genetic
diversity. IS6110 restriction fragment length polymorphism typing is one of the most widely used
methods, however, this technique is time consuming, technically demanding and insufficiently
discriminatory for isolates containing less than five copies of IS6110 (Kato-Maeda et al., 2011). This
has led to the development of other methods based on the polymorphism of repetitive sequences,
either the direct repeat (DR) region (spoligotyping) (Kamerbeek et al., 1997) or mini satellites
(variable numbers of tandem repeats (VNTR) typing) (Frothingham and Meeker-O'Connell, 1998).
In the recent years, the availability of whole-genome sequences has enabled comparative genomic
analysis to identify single nucleotide polymorphisms (SNPs). SNPs have been used to differentiate
between clinical isolates and are preferred over the use of repeats for the construction of
phylogenetic trees, because recombination events that could occur, independently, at the level of
repetitive sequences, are avoided (Achtman, 2008). Large numbers of SNPs have been identified
and used to genotype worldwide strain collections and investigate M. tuberculosis evolutionary
history (Baker et al., 2004; Filliol et al., 2006; Gutacker et al., 2006; Hershberg et al., 2008). On the
other hand, SNPs might have a role in pathogenesis by affecting expression of genes. We have
recently analyzed SNPs in DNA replication, recombination and repair (3R) genes (Dos Vultos et al.,
2008) in a set of geographically diverse M. tuberculosis strains. Pathogens are constantly exposed
to stressful environments and aggressions to the DNA, such as reactive oxygen species (ROS),
produced by host macrophages (Flannagan et al., 2009). DNA replication, recombination and repair
are responsible for the repair of such damages to the DNA, and, therefore, important mechanisms
in genome dynamics and stability. On the other hand, variations on 3R genes potentially increase
88 Chapter 3
genomic variability, due to an increase in mutation rates, and contribute to the adaptation and
evolution of bacteria (Denamur and Matic, 2006; Taddei et al., 1997; Tonjum and Seeberg, 2001).
Our study has revealed an unexpectedly high polymorphic set of genes, useful for strain
discrimination. Additionally, analysis of polymorphism in these genes may indicate which strains
are more prone to adapt or evolve (Dos Vultos et al., 2008).
The Beijing/W family, a group of genetically related strains, has demonstrated particular
properties when compared to other M. tuberculosis families, including: increased virulence in
various in vitro (Li et al., 2002; Theus et al., 2004) and in vivo models of infection (Lopez et al.,
2003; Tsenova et al., 2005), association with drug resistance (Tuberculosis, 2006), as well as a wide
distribution throughout the world (Brudey et al., 2006; Glynn et al., 2002). Taken together this
suggests that Beijing/W strains have selective advantages over other M. tuberculosis strains and
represent a serious threat to TB control. Therefore, we decided to investigate genetic diversity and
evolution of Beijing/W strains by analyzing polymorphisms in 3R genes. This will hopefully
contribute to better understand the mechanisms underlying the phenotypic and genotypic
characteristics that explain the success of the Beijing/W family.
89 Polymorphisms in 3R genes in Beijing/W strains
MATERIALS AND METHODS 3.3
3.3.1 Study isolates and SNP detection
M. tuberculosis Beijing/W clinical isolates used in this study are listed in Table A1. DNA from the
58 isolates, with a Beijing/W spoligotype, used for SNP discovery in 3R genes was provided by:
Madagascar Pasteur Institute, Madagascar (MG); RIVM, The Netherlands (NL) and the Scientific
Institute of Public Health, Belgium (BE). These DNAs were used to amplify the 22 3R genes (Table 1)
using TaKaRa LA Taq (TaKaRa, Shiga, Japan) and primers listed in Table 1. A control non-Beijing
isolate, Myc2 (DNA also provided by the Scientific Institute of Public Health, Belgium (BE)), was also
included. Myc2 is a clinical strain belonging to the Euro-American lineage according to Gagneux’s
classification (Gagneux et al., 2006a).
The amplified products were purified in a single step using exonuclease I (USB, USA) and shrimp
alkaline phosphatase (USB, USA), as previously described (Werle et al., 1994). The purified products
were then sequenced by the dideoxy chain-termination method using the Big Dye Terminator v3.1
cycle sequencing Kit (Perkin Elmer Applied Biosystems, Courtaboeuf, France), according to
manufacturer’s instructions. Sequencing products were run on an ABI prism 3100 Genetic Analyser
(Applied Biosystems).
Sequences were analyzed using the software Genalys obtained at http://software.cng.fr.
Detection of polymorphic sites was performed by comparison with the non-Beijing strain, H37Rv
(Myc1) sequences, obtained from Institute Pasteur at http://genolist.pasteur.fr. Beijing/W specific
SNPs were identified by comparison of sequences with the non-Beijing (Myc2).
Sequencing was also performed for subsequent SNP analysis of the Beijing/W isolates from
South Africa (ZA) (Table A1), which DNAs were provided from NRF Centre of Excellence in
Biomedical Tuberculosis Research/ MRC Centre for Molecular and Cellular Biology in South Africa,
and the GC1237 strain, available in our laboratory. A mismatched PCR method, using one wild-type
primer and one containing the SNP which matched/mismatched the template DNA at the 3'-end of
the primer (Table 1), was used to detect SNPs in the Beijing/W isolates from China (CN) (Table A1).
90 Chapter 3
Table 1. List of oligonucleotides used for SNP analysis.
Primer name Sequence (5’-3’) Primer name (mismatch)
Sequence (5’-3’)
ligD_f GTCACGGCGAAATTCCACGCGATATTTGA ligD580_f CGGGCATTGGCGGAGGATCT
ligD_r CCCGACCAGATCCAGCAACGACACGTC ligD580_wt-f TGCGTTAGCTAGGGTTTCGAGCAG
ligD_2 TCACCAGCGGCAGCAAGGGATTGCAT ligD580_mt-r TGCGTTAGCTAGGGTTTCGAGCAA
ligD_3 GATACACACCGAGGACCACCCGCTGGAATA ligD162_f CGACGACCTATCCGATCATCG
ligB_f CCACATAGCCCCCAGGCGGTATTGGTA ligD162_wt-r GGAAGGTGACCAACCCGATAT
ligB_r CGCTTGGTCGACGAGCGTGAATCTG ligD162_mt-r GGAAGGTGACCAACCCGATAG
ligB_2 GGCACTCTACCGGGCAAAGGGTCTCAG rccR44_f AAGCGCCCCGCCCAGGACGTG
ligC_f ACCCCAGCTTCGGGAAATACATCCTGT rccR44_wt-r CGGACATCGACCGGCTGACCG
ligC_r TCGCCACACAGACGACAAGTCCCAA rccR44_mt-r CGGACATCGACCGGCTGACCT
dnaZX_f CGCCGAAATCACGCCGAACGTTCA ligD346_f ACCACCATCGCGCCGTACTCA
dnaZX_r CGAACGAAACAACCTGCAGCTACATCACG ligD346_wt-r ACCGCCCACGAGACCAGCACG
dnaZX_2 AACACCTGATCTTCATATTCGCCACCA ligD346_mt-r ACCGCCCACGAGACCAGCACA
dnaZX_3 CTGCTGCTGGAAGTGGTTTGCG uvrC388_r GGATCCCGAAGTGGCGGTAGT
recD_f GGTGTGTTCACCTGGAACCCGCCCA uvrC388_wt-f CAACAACACAAGCTGAAGCGG
recD_r GTCGCCGTGCTGTTCGTGTATGCGATGT uvrC388_mt-f CAACAACACAAGCTGAAGCGC
recD_2 TCTCGCAAGGTGTTACGGTGTTGACTGG mutT4-48_r CGCATCAAATAATGGTGGACG
recG_f CATGTGCACGACCACCATCCAGGCAC mutT4-48_wt-f CGGCAACGGCGAAGCGGTCCC
recG_r CGATGATCCCAGCGTCTGATACGCGA mutT4-48_mt-f CGGCAACGGCGAAGCGGTCCG
recG_2 CAGCACAAAAGTGCAGAGCTGGGACATCTT ogt37_f AGCTGGGCCTGCCTGCACAAC
recG_3 GATGACGGCAGGGCAGAAGAAGCAAGTTC ogt37_wt-r GGTCGGGTGTCCAGTGTGTGC
recX_f CCGACGTGGCTGACGAGATCGAGAAGAA ogt37_mt-r GGTCGGGTGTCCAGTGTGTGA
recX_r CCGCCATCAAGTCGAGGTAAATTCGTTCA uvrC166_f CCGCTACCGCGACGACAAGTC
ruvB_f GATACGGTGCTGGCCGCCAACCAT uvrC166_wt-r GCAGGCATGGACGATCGATCTG
ruvB_r GGGGTCATTGCCAACGGCTCCTTTG uvrC166_mt-r GCAGGCATGGACGATCGATCTT
uvrC_f CAATGCACCCGACCAACAGTGGGATAGC recX8_r GGCCGAGTTCGACATCCTCTA
uvrC_r CCGGACAGCCCGGTTACCAAGACGA recX8_wt-f CTTCGCGCTCAGAAGTCGACG
uvrC_2 TACATCGACAAATGTTCCGCGCCGTGT recX8_mt-f CTTCGCGCTCAGAAGTCGACA
uvrC_3 CGGTGCACCGAAACGCAGAAGATGC recX59_wt-f GGTGTCATCCACCAGGCCAAC
recR_f AAGATGGCGCAGGAACGGCTGGGT recX59_mt-f GGTGTCATCCACCAGGCCAAG
recR_r GAGATCAACATTTTGCAGGCAAGGTGCG recX59-r CTCGGCCAGGGCAAGGAGAAT
nei_f TCTGGTCGAGCGGGCCGACGGCAT recG285_r CGTGCGGCAGGTGCTCGATGT
nei_r GGTGGCAGGCAATATCTGCCCAAGGCGG recG285_wt-f TCCCGCCGTCAGCTCAAAAGG
nth_f ATGACACAAGGAGAGTAAACATGGC recG285_mt-f TCCCGCCGTCAGCTCAAAAGA
nth_r AATAGTCATGCAGTTGGGCAACCA mutT2-58_f CCGGCCATAAACGTCGGAAAC
rv2979_f GTTCGAAGGTCCACAGGGCCAGAACG mutT2-58_wt-r GAGGTCGGCGACCTCGAGTCC
rv2979_r TCCAGTTGTATGCCTTGCGACGAGCA mutT2-58_mt-r GAGGTCGGCGACCTCGAGTCG
tagA_f TGAGCTCGAGGCGCTACGCTCTCAGC ogt12_f CCGCAGGAGAAGATCGCAT
tagA_r CCCCGCCATTGGATTTCCAGCCATA ogt12_wt-r GCCCGGCCAGGGTTAATAGC
uvrD1_f CCCGCAAAAACTTGGCGGGAAAAGTG ogt12_mt-r GCCCGGCCAGGGTTAATAGT
uvrD1_r GGACTTAGCGTCGGCAATTACACCGGTTGA recR89_f CGGACGCGATCCGTGTGACGG
uvrD1_2 CAACCTGAAGAACGAGTTGATCGACCC recR89_wt-r GTGCATTGTCGAGGAACCCAAAGAC
uvrD1_3 CGAGGGTAGCGAGATCACCTACAACGAT recR89_mt-r GTGCATTGTCGAGGAACCCAAAGAT
dnaQ_f CGGGTGGTTACCACCCGGGCAGTTTAC recF269_f GGCGGAGCACGGGGCTGAACT
dnaQ_r TCTCGCAAGGTGTTACGGTGTTGACTGG recF269_wt-r CGGTGCGGACCAACTAGACAAACC
radA_f TAATGGTGCCGATCTCGGCCGGATT recF269_mt-r CGGTGCGGACCAACTAGACAAACA
radA_r GTTGCTGCATAGCGGACATCGAGGGAGAA uvrD1-462_f TCCGCGCCGGTATTCCGTACA
radA_2 GAGATCTACCTCGCCGCACAGTCCGA uvrD1-462_wt-r GACGAGCGCGTCACCGAAGCC
recF_f GGAGCGAGTGTCTTTCGGGTTTACGACTGC uvrD1-462_mt-r GACGAGCGCGTCACCGAAGCT
recF_r CGCCCTCGACCGGCGTCTTGTCC ligB77_r TGTCGGCGAGACATGCCAAGCT
mutT2_f CTGCCAGCCGTTGAGGTCGT ligB77_wt-f GGGTGGCGTCGACACCGGTGA
mutT2_f CGGGCATGCAAACCCAAGTTA ligB77_mt-f GGGTGGCGTCGACACCGGTGG
mutT4_f TCGAAGGTGGGCAAATCGTG dnaQ161_f GGACCAGCGGGCGGCCCTGGA
mutT4_r TGGGGTTCGCTGGAAGTGG dnaQ161_wt-r CAACGGCCGCACGATGCATTC
ogt_f CAGCGCTCGCTGGCGCC dnaQ161_mt-r CAACGGCCGCACGATGCATTT
ogt_r GACTCAGCCGCTCGCGA nth122_f CCCGCCGTCCGTGAAAGATCA
alkA_f AGCCGCGTAGGTAACCT nth122_wt-r GCCGGCCACCATGGACAAGTT
alkA_r TGCTCGAGCATCCGCAG nth122_mt-r GCCGGCCACCATGGACAAGTG
alkA_2 CGCATGCAGACCGCCCG nth34_f TCACCGCCAAACCGCTCAA
alkA_3 CACTGCACGTTGCCGAC nth34_wt-r ATTTCCGCACGTATACTGAGA
alkA_4 GCTGACGATGCCGTTGCC nth_34_mt-r ATTTCCGCACGTATACTGAGC
dnaZX92_f GCGAGCAACGCCCGCATAGT
dnaZX92_wt-r GCAGCATCGACGTGGTAGAGC
91 Polymorphisms in 3R genes in Beijing/W strains
Primer name (mismatch)
Sequence (5’-3’)
dnaZX92_mt-r GCAGCATCGACGTGGTAGAGT
alkA11_f ATCGCCCGCGCCACGACGTCA
alkA11_wt-r ACTTCGAACGCTGCTACCGGG
alkA11_mt-r ACTTCGAACGCTGCTACCGGA
mutT4-99_f GGCGGCGCGCTGCGGCTACAG
mutT4-99_wt-r CAACTCGATGTGCCCCTTGGGTAGC
mutT4-99_mt-r CAACTCGATGTGCCCCTTGGGTAGT
recX153_f GCGGGCGAACGCAGCAAAGAG
recX153_wt-r CCTCGCACGCCAAGGTCTGGC
recX153_mt-r CCTCGCACGCCAAGGTCTGGT
recD277_r CGGGCCTGGCACCGGGAAGAC
recD277_wt-f TCGGCCAGCCGGGCCATCAGC
recD277_mt-f TCGGCCAGCCGGGCCATCAGT
radA186_f TCCGGACGGCGCGCGCTCTAT
radA186_wt-r CCTGCGTGACCCCGCCGGTGA
radA186_mt-r CCTGCGTGACCCCGCCGGTGG
tagA179_f GTGCGCAACCGCGCCAAGATT
tagA179_wt-r CCAGCATGCTTGGATATGGTCGTCG
tagA179_mt-r CCAGCATGCTTGGATATGGTCGTCA
(f) for forward and (r) for reverse oligonucleotides used for amplification and sequencing reactions.
Oligonucleotides whose name finishes in number were used for sequencing reactions. (wt) for wild-type and (mt)
for mutant oligonucleotides used for detection of SNPs by mismatched PCR.
3.3.2 LSPs detection
Tsolaki et al. (2005) have described Large Sequence Polymorphisms (LSPs) for the Beijing/W
family. These, designated regions of Difference (RDs) (RD105, RD181, RD150, RD142), correspond
to genomic regions present in M. tuberculosis H37Rv but variably deleted in Beijing/W strains. The
initial set of 58 Beijing/W isolates were tested for the presence or absence of these RDs through a
Deletion-Targeted Multiplex PCR (DTM-PCR), as previously described for RD105 detection in
Beijing/W strains (Chen et al., 2007). Briefly, two primers were designed flanking each one of the
RD regions (P1 and P2) and one primer hybridizing inside each the RD region (P3) (Table 2).
Multiplex-PCR reactions were performed using TaKaRa LA Taq (TaKaRa, Shiga, Japan) and different
sets of primers for each RD (Table 2). The presence or absence of deletions was determined,
following electrophoresis on an agarose gel, by comparison with M. tuberculosis H37Rv PCR
products, used as control.
92 Chapter 3
Table 2. List of primers used in Multiplex-PCR for Large Sequence Polymorphisms (LSPs) analysis.
3.3.3 SNP Data analysis for Phylogenetic tree construction
SNPs were concatenated resulting in one character string (nucleotide sequence) for each clinical
isolate analyzed. A FASTA file was created to run in the Network software (Bandelt et al., 1999) to
build a phylogenetic tree based on the median-joining method. This software assumes that there is
no recombination between genomes.
Region of difference (RD) Primer sequence (5’ – 3’)
RD105
P1(105) - GGAGTCGTTGAGGGTGTTCATCAGCTCAGT
P2(105) - GCGCCAAGGCCGCATAGTCACGG
P3(105) - GGTTGCCCACTGGTCGATATGGTGGACTT
RD181
P1(181) - CGCAACGGCCGCGGTGAACTCT
P2(181) - CGGGCGGCTGCGGGAACCTT
P3(181) - CTGGCCTGGTTCGGCTTGGTCCC
RD150
P1(150) - TGTGGCGTGGCTCGGCAAATAG
P2(150) - CGGGACGGCAAACGGGTGAT
P3(150) - CGGCGTCATCGCGTATCTGA
RD142
P1(142) - CGTCCGCGACGACGAACAA
P2(142 - TCACTTTCCATTTCCAGCGGCAACT
P3(142) - CGTCGATGGCAACACACCGAAA
93 Polymorphisms in 3R genes in Beijing/W strains
RESULTS 3.4
3.4.1 Identification of polymorphisms in 3R genes in Beijing/W strains
A collection of 58 clinical isolates with a Beijing/W spoligotype from different geographic origins
(Table A1, materials and methods), was used to search for variations in 3R genes. Of the 56
described genes encoding 3R components (Dos Vultos et al., 2008), 22 were previously
demonstrated to be polymorphic among Beijing/W strains. However, these studies analyzed either
a small number of isolates or a restricted number of genes (Dos Vultos et al., 2008; Ebrahimi-Rad et
al., 2003). Therefore, these 22 genes (Table 3) were sequenced for each of the 58 Beijing/W
isolates as well as for a non-Beijing strain (Myc2), resulting in roughly 1,6 Mbp of sequence data.
Comparative analysis with the M. tuberculosis H37Rv (Myc1) genome sequence identified 48 SNPs.
Forty-one (85%) SNPs appeared to be specific for Beijing/W strains, as these were absent from the
non-Beijing strain (Myc2), as well from the 86 non-Beijing strains included in our previous analysis
of 3R polymorphisms using a global M. tuberculosis collection (Dos Vultos et al., 2008). Almost half
of these SNPs (19/41) corresponded to new variations, not previously described in Beijing/W
strains (Dos Vultos et al., 2008; Ebrahimi-Rad et al., 2003; Hershberg et al., 2008). Thirty of the 41
Beijing/W specific SNPs enabled discrimination of 24 different sequence types for which a
preliminary phylogenetic network was constructed using the Network software (Table 3) (Figure
1A). Based on the inferred proteins, the number of non-synonymous SNPs (nsSNPs) was twice the
number of synonymous SNPs (sSNPs) (Table 3).
Analysis of large sequence polymorphisms (LSPs) revealed that these isolates included the four
different sublineages previously defined in Beijing/W strains using these markers (Tsolaki et al.,
2005)(Figure 1B).
94 Chapter 3
Table 3. List of SNPs identified by sequencing 3R genes in Beijing/W strains, which define
different sequence types (Figure 1 and 2).
* Most informative SNPs (identified in more than one isolate) observed in this study.
SNP number Gene Codon position SNP type
1* ligD 580 (CTG > TTG) Synonymous
2 ligD 162 (GAT > GCT) Non-synonymous
3* recR 44 (GGT > TGT) Non-synonymous
4 ligD 346 (GGC > GGT) Synonymous
5 uvrC 388 (CGG > CGC) Synonymous
6* mutT4 48 (CGG > GGG) Non-synonymous
7* ogt 37 (CGC > CTC) Non-synonymous
8 uvrC 166 (CAG > AAG) Non-synonymous
9 recX 8 (CCG > CTG) Non-synonymous
10* recX 59 (GTT > CTT) Non-synonymous
11 recG 285 (CCT > TCT) Non-synonymous
12* muT2 58 (GGA > CGA) Non-synonymous
13* ogt 12 (GGG > GGA) Synonymous
14 recR 89 (GAC > GAT) Synonymous
15* recF 269 (GGG > GGT) Synonymous
16* uvrD1 462 (GGC > AGC) Non-synonymous
17 ligB 77 (GTC > GCC) Non-synonymous
18 dnaQ 161 (TTC > TTT) Synonymous
19 nth 122 (TTG > TGG) Non-synonymous
20* dnaZX 92 (CTG > TTG) Synonymous
21 nth 34 (GAG > GCG) Non-synonymous
22 alkA 11 (GCG > ACG) Non-synonymous
23* mutT4 99 (TCG > TCA) Synonymous
24* tagA 129 (GCG > ACG) Non-synonymous
25* recX 153 (GGC > GAC) Non-synonymous
26* radA 276 (ATC > ACC) Non-synonymous
27 recD 139 (GTA > TTA) Non-synonymous
28 recD 277 (ACG > ACA) Non-synonymous
29 radA 186 (GTC > GCC) Non-synonymous
30 tagA 179 (GTC > GTT) Synonymous
95 Polymorphisms in 3R genes in Beijing/W strains
Figure 1. Phylogenetic network based on SNPs discovered in the collection of 58 Beijing/W isolates. This
phylogenetic network was constructed using the median-joining algorithm with the final set of 48 SNPs
characterized by sequencing 22 3R genes in 58 Beijing/W isolates plus one non-Beijing isolate (Myc2). Isolates are
96 Chapter 3
color coded according to their geographic origin (A), large sequence polymorphisms (LSPs) (B) and, SNPs in mutT2
mutT4 and ogt genes (C). The reference strain M. tuberculosis H37Rv (Myc1) was also included. The numbers in
each branch correspond to SNPs (Table 3) that enabled discrimination of sequence types. Node sizes are
proportional to the number of isolates belonging to the same sequence type: Bmyc4 node (2); Bmyc12 node (3);
Bmyc13 node (3); Bmyc19 (2); Bmyc16 node (7); Bmyc10 node (23). Table A1 describes the strains that belong to
each node. Mv represents a median vector created by the software and can be interpreted as possibly extant
unsampled sequences or extinct ancestral sequences. The evolutionary pathways proposed previously for
Beijing/W strains using LSPs (Tsolaki et al., 2005) and SNPs in mutT2, mutT4 and ogt (Ebrahimi-Rad et al., 2003)
have been included for comparison (B and C right bottom).
The same SNP patterns were found in isolates from different geographic regions (Figure 1A),
suggesting that the present collection of Beijing/W isolates is representative of this family.
A color code was attributed to each node according to SNPs previously described in mutT2,
mutT4 and ogt DNA repair genes (Ebrahimi-Rad et al., 2003), as well as according to LSPs (Tsolaki et
al., 2005) (Figure 1B and C). Phylogenetic relationships established by 3R SNPs were in agreement
with evolutionary pathways suggested previously using these genetic markers (Ebrahimi-Rad et al.,
2003; Tsolaki et al., 2005) (Figure 1B and 1C). However, sequencing of 3R genes was more
discriminatory than LSPs; 24 sequence types versus four sublineages defined by the LSPs.
3.4.2 Construction of a phylogeny for Beijing/W strains using 3R SNPs
Next, we investigated the set of 30 polymorphic SNPs (Table 3), discovered by sequence analysis
of the 3R genes, in a larger collection of Beijing/W strains including: 192 Beijing/W clinical isolates
from China and 55 Beijing/W strains isolated in South Africa (Table A1). The M. tuberculosis
Beijing/W strain, GC1237, responsible for a tuberculosis epidemic in Gran Canaria (Caminero et al.,
2001), was also included.
A phylogenetic network was constructed including this larger set of isolates (Figure 2). Certain
SNPs that were previously found in a single isolate were confirmed with this larger sample. Overall,
fourteen SNPs were found in more than one isolate and were therefore informative (Table 1). Two
new sequence types (Bmyc25 and Bmyc26) were identified (Figure 2). Strikingly, sixty-two percent
of the isolates belonged to a single group, Bmyc10, which included strains from distinct parts of the
world. The second most represented sequence-type was Bmyc25 that included the Gran Canaria TB
outbreak strain GC1237 (Caminero et al., 2001).
97 Polymorphisms in 3R genes in Beijing/W strains
Figure 2. Phylogenetic network based on SNPs characterized in the entire collection of 305
Beijing/W isolates. This phylogenetic network was constructed using the median-joining algorithm with
the set of SNPs identified in the 3R genes analyzed on the final collection of 305 Beijing/W isolates.
Isolates are color coded according to their geographic origin. M. tuberculosis strains Myc1 (H37Rv) and
Myc2 are included as non-Beijing strains. The numbers in each branch correspond to SNPs (Table 3) that
enabled discrimination of sequence types. Node sizes are proportional to the number of isolates
belonging to the same SNP type: Bmyc1 node (2); Bmyc2 node (14); Bmyc4 node (13); Bmyc6 node (7);
Bmyc25 node (28); Bmyc26 node (13); Bmyc12 node (3); Bmyc13 node (13); Bmyc16 node (7); Bmyc19
node (2); Bmyc10 node (188). Table A1 describes the strains that belong to each node. Mv represents a
median vector created by the software and can be interpreted as possibly extant unsampled sequences
or extinct ancestral sequences. The relative proportion of isolates in each node, of a given geographic
origin, may not reflect the population structure of the Beijing/W family of that geographic region.
98 Chapter 3
99 Polymorphisms in 3R genes in Beijing/W strains
DISCUSSION 3.5
M. tuberculosis complex strains have been considered as highly clonal, when compared to other
pathogens (Achtman, 2008). Initial reports have even suggested that these strains share 99%
similarity at the nucleotide level (Sreevatsan et al., 1997). However, in the recent years, large
numbers of SNPs have been identified and used in order to get a more detailed insight into the
diversity and evolutionary history of this bacteria (Baker et al., 2004; Dos Vultos et al., 2008; Filliol
et al., 2006; Hershberg et al., 2008). SNPs analysis is a simple and relatively fast way to compare
organisms and trace back the evolutionary history of strains, as some SNPs are highly informative.
Therefore, SNPs analyses are becoming more and more attractive with the increasing number of
genome sequencing projects. This will provide data particularly relevant to understand the genetic
basis for strain differences in pathogenesis.
Allelic variation in 3R genes seems to be an important mechanism in evolution and adaptation
of microorganisms. Defective 3R systems could potentially increase genomic variability, due to an
increase in mutation rates. Strains with high mutations rates (mutators), may have, in certain
conditions, a selective advantage, as they produce more adaptive mutations (Denamur and Matic,
2006; Taddei et al., 1997; Tonjum and Seeberg, 2001). The Beijing/W family is a group of strains
that seems to have a selective advantage when compared to other M. tuberculosis families.
Therefore, polymorphisms in 3R genes were analyzed in a collection of Beijing/W isolates from
different geographic origins. SNPs in 3R genes associated with the Beijing/W family were identified
that enabled the discrimination of 26 different sequence types for which a phylogeny was
constructed. Phylogenetic relationships established by sequence types were in agreement with
evolutionary pathways suggested by other genetic markers, such as Large Sequence
Polymorphisms (LSPs). The remarkable clonality of M. tuberculosis implies that different genetic
markers reveal similar phylogenies (Supply et al., 2003), if not, these are not robust markers
appropriate to evolutionary analyses.
Polymorphisms in 3R genes show that the Beijing/W family can be subdivided in different
groups, as previously shown using other genetic markers (Hanekom et al., 2007; Tsolaki et al.,
2005). We did find however, a recently expanded group, Bmyc10, which seems to be predominant
as it includes over 60% of strains. This sequence type was identified in isolates from China, where
the Beijing/W family is highly prevalent, but also in other countries, where the Beijing/W family is
less prevalent, such as Madagascar and The Netherlands. In a previous study, a group of Beijing/W
strains characterized by the RD181 deletion and polymorphisms in mutT4 and mutT2 appears to be
predominant in a collection of strains isolated in Italy (Rindi et al., 2009). Strains belonging to
100 Chapter 3
Bmyc10 node also had the RD181 deletion and the same SNPs in mutT4 and mutT2 genes (SNP6
and SNP12). This seems, though, to be a prevalent group in different parts of the world, suggesting
that Beijing/W strains of this genotype might have some selective advantage. The Bmyc25 group
that includes the Gran Canaria TB outbreak strain GC 1237 (Caminero et al., 2001), might represent
another predominant group among Beijing/W strains. Taken together, these observations suggest
that polymorphisms in 3R genes may confer advantageous phenotypes on certain Beijing/W
genotypes. Indeed, different Beijing/W strains show different pathogenic characteristics in human
macrophages (Theus et al., 2007), as well as in mice (Aguilar et al., 2010; Dormans et al., 2004), or
guinea pigs (Kato-Maeda et al., 2011; Palanisamy et al., 2009). However, host cell transcriptome
responses were found to be similar in Beijing/W strains from different genotypes defined by 3R
SNPs (Wu et al., 2012). Similarly, different Beijing/W genotypes, including Bmyc10 and Bmyc25
strains, do not seem to induce a differential cytokine modulation in macrophages (Wang et al.,
2010). Therefore, other pathogenic characteristics might explain the increased adaptability of
strains with the Bmyc10 and Bmyc25 genotypes (Wang et al., 2010; Wu et al., 2012). For example,
Beijing/W strains belonging to different sublineages defined by LSPs (Tsolaki et al., 2005) seem to
present differences in transmissibility in a mouse model of infection (Aguilar et al., 2010).
Beijing/W strains have also shown variability in the expression levels of the dormancy regulon
(DosR) (Fallow et al., 2010). Therefore, it could be interesting to evaluate differences in Beijing/W
strains ability to persist in a dormant state inside host cells. It should also be interesting to analyze
if these strains have different capacity to resist macrophage antimicrobial mechanisms during
hypoxia, a granuloma characteristic condition that determines DosR activation in M. tuberculosis
(Nickel et al., 2012). Hypoxia doesn’t change cytokine release but triggers an antimicrobial pathway
associated with growth inhibition of the bacilli (Nickel et al., 2012).
Analysis of the effect on enzyme characteristics of the variation in the mutT2 gene, a
characteristic of all Bmyc10 isolates (SNP12, Figure 2), has revealed significant changes in enzyme
properties, caused by a single amino acid substitution, that leads to protein destabilization. It was
suggested that this altered MutT2 enzyme may contribute to the success of strains due to an
increase in nucleotide-dependent reactions (Moreland et al., 2009). Therefore, some of the SNPs
identified in this study might have an effect on protein’s function. The analysis of the functional
effects of the polymorphisms observed in 3R genes might be crucial to understand the real
meaning of such variations. In our previous analysis we have shown that the observed variations in
3R might be slightly deleterious, resulting in suboptimal 3R system activity (Dos Vultos et al., 2008).
Therefore, some of these strains might have a mutator phenotype, increasing the probability of
acquiring mutations in genes conferring some selective advantage. For example, mutator strains
101 Polymorphisms in 3R genes in Beijing/W strains
may generate mutations that confer antibiotic-resistance at a higher rate than non-mutator strains
(Denamur and Matic, 2006). When antibiotic-resistance is mainly determined by the acquisition of
mutations in the chromosome, as is the case of M. tuberculosis (Heym et al., 1994), the advantage
of being a mutator increases significantly (Tenaillon et al., 1999). A study tried to evaluate
contribution of polymorphism on the DNA repair genes, mutT, to resistance to antibiotics. Even
though no statistically significant association of missense mutations on these genes with and
increased prevalence of antibiotic-resistance was detected, the authors couldn’t rule out the
hypothesis that mutator phenotypes might increase the rate of drug resistance (Lari et al., 2006).
Beijing/W strains have been often associated with drug resistance, even though, the underlying
mechanisms for this association remain unknown (Tuberculosis, 2006). Beijing/W strains have
shown similar rates of mutation-conferring resistance to rifampin compared to non-Beijing strains
(Werngren and Hoffner, 2003). Therefore, another explanation would be that drug-resistance in
Beijing/W strains has a lower or no cost on fitness, given that resistance-conferring mutations are
often associated with a fitness cost (Andersson and Levin, 1999). The fitness of non-Beijing drug
resistant strains was found to be slightly reduced when compared to drug-susceptible M.
tuberculosis. However, drug resistant Beijing/W strains presented some variability: some strains
showed loss of fitness while others did not (Toungoussova et al., 2004). Given that the fitness
impact of resistance-conferring mutations in M. tuberculosis depends on the genetic background of
the strain (Fenner et al., 2012; Gagneux et al., 2006b), the fitness cost of these mutations may vary
among different Beijing/W sublineages. Indeed, different sublineages of the Beijing/W family may
differ in their mechanisms of adaptation to drug selection pressures (Iwamoto et al., 2008;
Mokrousov et al., 2006). It is also possible that the accumulation of compensatory mutations will
mitigate the biological cost of drug-resistance mutations (Gagneux et al., 2006b). Thus, certain
Beijing/W sublineages could have an advantage due to the occurrence of compensatory mutations.
In mutator strains, the probability for this to occur is much higher. However, the concept of a
mutator phenotype in Beijing/W strains was not supported when the frequency of spontaneous
mutations was calculated using the Luria–Delbruck fluctuation test. The rate of spontaneous
mutations was the same in Beijing/W, non-Beijing and laboratory strains (Werngren and Hoffner,
2003). In mutator strains, reduction in mutation rates should occur, for example, by the acquisition
of suppressor/compensatory mutations, before the load of deleterious mutations becomes too
high (Denamur and Matic, 2006; Taddei et al., 1997). Thus, polymorphisms found in 3R genes may
be related to transient mutator phenotypes in Beijing/W strains.
In conclusion, analysis of polymorphisms in 3R genes has shown that different Beijing/W groups
can be identified and characterized by specific 3R SNPs. These might have induced some selective
102 Chapter 3
advantage that allowed the expansion of certain genotypes, therefore contributing to the evolution
of the Beijing/W family. We hope that our study will contribute to better understand the molecular
basis for the enhanced pathogenicity attributed to the Beijing/W family.
CHAPTER 4
Concluding Remarks
104 Chapter 4
105 Concluding Remarks
Mycobacterium tuberculosis is one of the most successful pathogens, being extremely adapted
to its host. It is estimated that one-third of the world’s population is infected with this pathogen
(WHO at www.who.int/topic/tuberculosis/en/) and, even though in 90-95% of these cases the
infection is contained, M. tuberculosis is not eliminated and is able to persist in its host for years,
until, disease develops due to not always well-understood reasons (Kaufmann and McMichael,
2005). Understanding the mechanisms used by M. tuberculosis to successfully persist in its host,
particularly inside macrophages, will lead to insights into possible targets for new effective anti-TB
strategies.
M. tuberculosis cell envelope constitution explains part of its resistance against host
antimicrobial mechanisms. It forms a permeability barrier and is, thus, the first line of defense
against toxic molecules (Brennan and Nikaido, 1995). However, the contribution of M. tuberculosis
envelope components to this remains poorly documented. We have shown, by screening, for the
first time, a transposon mutant library for mutants with increased susceptibility to reactive oxygen
species (ROS), that M. tuberculosis cell envelope is the first line of defense against ROS,
antimicrobial molecules produced by macrophages to destroy intracellular pathogens such as M.
tuberculosis (Flannagan et al., 2009). Certain cell wall lipids, such as LAM, have been previously
identified as ROS scavengers (Chan et al., 1991). Even though we did not identify any known genes
involved in the biosynthesis of mycobacterial lipids, such as pks (polyketide synthases), we have
identified transporters possibly involved in transport of lipids or other molecules to the cell
envelop (MmpL9 and Rv0986). We have identified as well, proteins that seem to be involved in the
synthesis of components of the cell envelope, although no known function has been assigned so
far (Rv1507c, Rv1508a, Rv1509, Rv3594). Several PPE coding genes were also identified. However,
how these proteins protect mycobacteria against ROS is not clear once not much is known about
the molecular function of PE/PPEs (Akhter et al., 2012). Nonetheless, PE_PGRS11 was shown to be
exposed to the cell surface and to be involved in mycobacterial resistance against H2O2-induced
oxidative stress. This protein was found to be a phosphoglycerate mutase, a protein involved in
glycolysis that has been previously demonstrated to decrease the accumulation of ROS in cells
(Chaturvedi et al., 2010). In addition, a transcriptomic analysis has also shown that several PE/PPE
genes are induced by H2O2, but not by NO, in M. tuberculosis (Voskuil et al., 2011). These results
provide proof that PE/PPEs have indeed a role in protecting mycobacteria against oxidative stress.
The highly impermeable cell wall of M. tuberculosis also contributes to its intrinsic resistance
against chemotherapeutic agents (Jarlier and Nikaido, 1994; Nikaido, 2001). Therefore, cell wall
components are good targets for developing new chemotherapeutic agents against TB. Indeed,
these are currently the target of several antimycobacterial agents, including the two important first
106 Chapter 4
line drugs, isoniazid and ethambutol (Sarkar and Suresh, 2011). Nonetheless, there is an ongoing
search for new cell wall targets. Certain bacterial antibiotics are responsible for an increase in ROS
production within cells via the fenton reaction (Kohanski et al., 2007). Tolerance to these
antibiotics may, therefore, depend on the ability of the cell to defend itself against ROS. Thus,
targeting molecules involved in resistance to ROS, such as those identified in our study, could
enhance the efficacy of mycobacterial drugs known to generate ROS, such as isoniazid, kanamycin
or ofloxacin (Kohanski et al., 2007; Mukherjee et al., 2009). Indeed, a mutant overexpressing
Wag31, a protein involved in regulation of polar cell wall synthesis, had increased susceptibility to
hydrogen peroxide as well as to isoniazid and ofloxacin (Mukherjee et al., 2009). This kind of
approach could significantly contribute to TB treatment accomplishment. On the other hand, it
could also avoid the appearance of drug-resistant bacteria. It was shown recently that bacterial
death induced by ROS might eliminate persisters (Grant et al., 2012), small populations that resist
to high doses of antibiotics and contribute to the rise in MDR- and XDR-TB (Keren et al., 2011).
Furthermore, these drug-tolerant, persistent bacteria have, in M. tuberculosis, the physiological
state of dormant bacilli, typically found in latent TB (Keren et al., 2011; Ulrichs and Kaufmann,
2006). Therefore, targeting M. tuberculosis molecules involved in resistance to ROS may contribute
to TB treatment improvement and could be suitable to treat patients latently infected with M.
tuberculosis, which represent today a huge reservoir for the disease, without increasing the burden
of drug-resistant TB.
Usually, basal oxidative defences are sufficient to protect bacteria from endogenous ROS that
result from aerobic respiration. However, these defences are inadequate if rates of ROS are
accelerated, for example during the phagocytic oxidative burst. Most microbes induce additional
responses when this happens (Imlay, 2008; Storz and Imlay, 1999). Thus, it is important to
discriminate the effects of phagocytic and endogenous ROS (Craig and Slauch, 2009; Storz and
Imlay, 1999). The fact that most of the genes identified in our study are components of the cell
envelop suggests that these are relevant to counteract ROS generated exogenously, such as those
originated during the phagocytic burst. However, extracellular ROS that penetrate bacterial
membranes will increase intracellular ROS to superior levels to those induced by endogenous ROS
(Imlay, 2008; Storz and Imlay, 1999). Therefore, mechanisms against high intracellular levels of ROS
are also important for bacteria to counteract oxidative stress induced by phagocytes. This would
explain the identification of genes in our screen that do not code for envelope components, such
as moaD1. One might hypothesise that these genes are not essential for sustaining endogenous
ROS as no significant growth defects were observed in vitro without H2O2 for these mutants (Table
1). Additionally, many of the genes identified in our screening seem to have a role in the
107 Concluding Remarks
intracellular lifestyle of M. tuberculosis, suggesting that these are important to resist against ROS
produced by host cells. However, to confirm that these proteins are specific for resistance against
phagocytic ROS, mutants’ growth in phox-deficient macrophages should be investigated.
The proteins identified in our study might thus contribute to M. tuberculosis virulence. Putative
virulence factors could be useful for designing attenuated vaccine candidates. Indeed, PPEs and
MmpL proteins have been frequently associated with virulence (Akhter et al., 2012; Domenech et
al., 2005). In a recent study, the comparative genomic analysis of free-living soil mycobacteria and
obligate parasites of the M. tuberculosis complex has shown that, along with the known gene
families related to pathogenesis such as PE/PPE genes, gene families related to biosynthesis of
Molybdenum Cofactor (MoCo) were found to be expanded in pathogenic mycobacteria. These
results suggest an important role for MoCo in the adaptation of environmental mycobacteria to
obligate pathogenesis (McGuire et al., 2012). Proteins involved in MoCo biosynthesis, such as
MoaD1, seem to represent potential virulence factors as well.
In the study of McGuire et al. (2012) it was also shown that genes related to DNA repair are
associated with adaptation of environmental mycobacteria to obligate pathogenesis. Surprisingly,
we did not select any mutant in known DNA repair genes during our screen. In E. coli, at low
concentrations (1mM) of H2O2, the main mechanism of ROS-dependent antibacterial activity is
DNA damage (Imlay and Linn, 1986). In M. tuberculosis induction of DNA repair gene expression
indicates that DNA damage occurs only at 5-10 mM H2O2 (Voskuil et al., 2011). However, bacteria
are not killed at these concentrations, suggesting that the damage does not result in DNA-
dependent killing, like in E. coli. These results suggest that M. tuberculosis DNA repair mechanisms
are highly effective in repairing the damages caused by H2O2. In addition, M. tuberculosis possesses
many genes with redundant functions, particularly in the BER pathway, one of the major
mechanisms involved in the repair of oxidative DNA damage (Dos Vultos et al., 2009; Friedberg et
al., 2006). These observations could explain why we did not identify any H2O2 sensitive mutant in
genes playing a role in DNA repair mechanisms. DNA repair mechanisms have also been suggested
to be essential for the survival of the intracellular pathogen Salmonella typhimurium (Buchmeier et
al., 1995). However, a recent study has shown that phagocytic superoxide primarily damages an
extracytoplasmic target to inhibit or kill this pathogen, suggesting that the dogma that DNA is a
primary bacterial target of the phagocytic oxidative burst needs to be re-evaluated (Craig and
Slauch, 2009).
In conclusion, our study has allowed us to identify genes involved in M. tuberculosis defence
against oxidative stress. However, there are still many genes with apparently unknown functions
that seem to have a role in such kind of mechanisms. This means that further studies are required
108 Chapter 4
to expand our knowledge about the molecular mechanisms used by M. tuberculosis to counteract
oxidative stress, particularly during macrophage infection.
Genome variability is required for bacteria to successfully adapt to constantly changing and
stressful environments, such as the ones found in human hosts or those induced by antibiotic
treatment. DNA repair, recombination and replication (3R) are important mechanisms in
generating this genomic variability (Denamur and Matic, 2006; Tonjum and Seeberg, 2001).
Therefore, analysis of polymorphisms in 3R genes can provide clues into which strains are/were
more prone to adapt and evolve. Our previous analysis of polymorphisms in 3R genes have shown
that these genes may indeed play a role in M. tuberculosis evolution and could be a useful tool for
strain discrimination (Dos Vultos et al., 2008). These results prompt us to investigate
polymorphisms in a successful group of M. tuberculosis strains, the Beijing/W family. We have
shown that different groups carrying specific polymorphisms in 3R genes exist within the Beijing/W
family (Chapter 3). It has been previously, shown that the Beijing/W family can be divided into
several groups/sublineages using other genetic markers (Hanekom et al., 2007; Tsolaki et al., 2005).
3R mechanisms might have contributed to this genetic diversity observed in Beijing/W strains.
However, an important question needs to be asked: what is the meaning of these polymorphisms?
Polymorphisms in 3R genes might have induced the accumulation of mutations conferring a
selective advantage (Denamur and Matic, 2006). Indeed, certain mutations could have conferred
some advantage to M. tuberculosis Beijing/W strains. For example, it was shown that typical
Beijing/W strains carry a high number of non-synonymous SNPs in genes coding for the regulatory
network (Schurch et al., 2011) that could result in changes in cellular processes controlled by
transcriptional regulation. These variations may play an important role in adaptation of these
bacteria to different environments and explain why typical Beijing/W strains are an emerging
phenotype (Schurch et al., 2011). A frameshift mutation in the gene encoding the DosT sensor
kinase, which senses the environmental stimuli that trigger dosR expression, was found to
correlate with the appearance of constitutive overexpression of the DosR regulon in the most
recently evolved Beijing/W sublineages (Fallow et al., 2010). Even though mutation in dosT doesn’t
seem to be directly responsible for DosR constitutive expression, its inactivation might have
induced for selection of this phenotype, which is associated with M. tuberculosis adaptation and
survival to conditions found in human lungs (Voskuil et al., 2003). Another frameshift mutation that
might have induced a selective advantage to Beijing/W strains was the one identified by us in the
mmpL9 gene given that all publicly available modern Beijing/W genomes were found to carry it.
Despite this mutation, MmpL9 seems to be functional in Beijing/W strains and to have a role in
bacterial response to oxidative stress as well as in survival inside host cells (Chapter 2). This
109 Concluding Remarks
mutation might have induced a protein change that confers a better protection to bacteria in these
conditions.
Studies in vitro (Firmani and Riley, 2002; O'Brien et al., 1994) and in animal models (Aguilar et
al., 2010; Dormans et al., 2004; Lopez et al., 2003; Palanisamy et al., 2009; Tsenova et al., 2005),
have demonstrated strain-dependent variation in key aspects of virulence such as stress survival,
transmission, pathology and lethality. On the other hand, it is also important to consider the
genetic diversity of any pathogen when identifying drug targets, vaccine antigens and developing
tools for molecular diagnostics. The analysis of 3R genes in Beijing/W strains might indicate which
strains are more prone to develop mutations conferring-drug resistance, or are more able to adapt
and persist in host cells. This is important considering that Beijing/W strains have been frequently
associated with drug resistance (Tuberculosis, 2006), and seem to have increased virulence when
compared to strains from other M. tuberculosis families (Lopez et al., 2003; Tsenova et al., 2005).
110 Chapter 4
REFERENCES
Abebe, F., and Bjune, G. (2006). The emergence of Beijing family genotypes of Mycobacterium tuberculosis and low-level protection by bacille Calmette-Guerin (BCG) vaccines: is there a link? Clinical and experimental immunology 145, 389-397. Achtman, M. (2008). Evolution, population structure, and phylogeography of genetically monomorphic bacterial pathogens. Annual review of microbiology 62, 53-70. Adams, L.B., Dinauer, M.C., Morgenstern, D.E., and Krahenbuhl, J.L. (1997). Comparison of the roles of reactive oxygen and nitrogen intermediates in the host response to Mycobacterium tuberculosis using transgenic mice. Tubercle and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 78, 237-246. Aguilar, D., Hanekom, M., Mata, D., Gey van Pittius, N.C., van Helden, P.D., Warren, R.M., and Hernandez-Pando, R. (2010). Mycobacterium tuberculosis strains with the Beijing genotype demonstrate variability in virulence associated with transmission. Tuberculosis 90, 319-325. Akhter, Y., Ehebauer, M.T., Mukhopadhyay, S., and Hasnain, S.E. (2012). The PE/PPE multigene family codes for virulence factors and is a possible source of mycobacterial antigenic variation: perhaps more? Biochimie 94, 110-116. Akif, M., Khare, G., Tyagi, A.K., Mande, S.C., and Sardesai, A.A. (2008). Functional studies of multiple thioredoxins from Mycobacterium tuberculosis. Journal of bacteriology 190, 7087-7095. Akira, S., Uematsu, S., and Takeuchi, O. (2006). Pathogen recognition and innate immunity. Cell 124, 783-801. Alam, M.S., Garg, S.K., and Agrawal, P. (2009). Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv. The FEBS journal 276, 76-93. Alland, D., Lacher, D.W., Hazbon, M.H., Motiwala, A.S., Qi, W., Fleischmann, R.D., and Whittam, T.S. (2007). Role of large sequence polymorphisms (LSPs) in generating genomic diversity among clinical isolates of Mycobacterium tuberculosis and the utility of LSPs in phylogenetic analysis. Journal of clinical microbiology 45, 39-46. Andersson, D.I., and Levin, B.R. (1999). The biological cost of antibiotic resistance. Current opinion in microbiology 2, 489-493. Armstrong, J.A., and Hart, P.D. (1971). Response of cultured macrophages to Mycobacterium tuberculosis, with observations on fusion of lysosomes with phagosomes. The Journal of experimental medicine 134, 713-740. Armstrong, J.A., and Hart, P.D. (1975). Phagosome-lysosome interactions in cultured macrophages infected with virulent tubercle bacilli. Reversal of the usual nonfusion pattern and observations on bacterial survival. The Journal of experimental medicine 142, 1-16. Astarie-Dequeker, C., N'Diaye, E.N., Le Cabec, V., Rittig, M.G., Prandi, J., and Maridonneau-Parini, I. (1999). The mannose receptor mediates uptake of pathogenic and nonpathogenic mycobacteria and bypasses bactericidal responses in human macrophages. Infection and immunity 67, 469-477. Aston, C., Rom, W.N., Talbot, A.T., and Reibman, J. (1998). Early inhibition of mycobacterial growth by human alveolar macrophages is not due to nitric oxide. American journal of respiratory and critical care medicine 157, 1943-1950. Bach, H., Papavinasasundaram, K.G., Wong, D., Hmama, Z., and Av-Gay, Y. (2008). Mycobacterium tuberculosis virulence is mediated by PtpA dephosphorylation of human vacuolar protein sorting 33B. Cell host & microbe 3, 316-322. Baker, L., Brown, T., Maiden, M.C., and Drobniewski, F. (2004). Silent nucleotide polymorphisms and a phylogeny for Mycobacterium tuberculosis. Emerging infectious diseases 10, 1568-1577. Bandelt, H.J., Forster, P., and Rohl, A. (1999). Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16, 37-48.
112 References
Bange, F.C., Collins, F.M., and Jacobs, W.R., Jr. (1999). Survival of mice infected with Mycobacterium smegmatis containing large DNA fragments from Mycobacterium tuberculosis. Tubercle and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 79, 171-180. Baranov, P.V., Gurvich, O.L., Fayet, O., Prere, M.F., Miller, W.A., Gesteland, R.F., Atkins, J.F., and Giddings, M.C. (2001). RECODE: a database of frameshifting, bypassing and codon redefinition utilized for gene expression. Nucleic Acids Res 29, 264-267. Barreiro, L.B., Neyrolles, O., Babb, C.L., Tailleux, L., Quach, H., McElreavey, K., Helden, P.D., Hoal, E.G., Gicquel, B., and Quintana-Murci, L. (2006). Promoter variation in the DC-SIGN-encoding gene CD209 is associated with tuberculosis. PLoS medicine 3, e20. Bedard, K., and Krause, K.H. (2007). The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiological reviews 87, 245-313. Bergval, I.L., Klatser, P.R., Schuitema, A.R., Oskam, L., and Anthony, R.M. (2007). Specific mutations in the Mycobacterium tuberculosis rpoB gene are associated with increased dnaE2 expression. FEMS microbiology letters 275, 338-343. Bifani, P.J., Mathema, B., Kurepina, N.E., and Kreiswirth, B.N. (2002). Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends in microbiology 10, 45-52. Bifani, P.J., Plikaytis, B.B., Kapur, V., Stockbauer, K., Pan, X., Lutfey, M.L., Moghazeh, S.L., Eisner, W., Daniel, T.M., Kaplan, M.H., et al. (1996). Origin and interstate spread of a New York City multidrug-resistant Mycobacterium tuberculosis clone family. JAMA : the journal of the American Medical Association 275, 452-457. Biswas, T., Small, J., Vandal, O., Odaira, T., Deng, H., Ehrt, S., and Tsodikov, O.V. (2010). Structural insight into serine protease Rv3671c that Protects M. tuberculosis from oxidative and acidic stress. Structure 18, 1353-1363. Bjelland, S., Bjoras, M., and Seeberg, E. (1993). Excision of 3-methylguanine from alkylated DNA by 3-methyladenine DNA glycosylase I of Escherichia coli. Nucleic Acids Res 21, 2045-2049. Boshoff, H.I., Myers, T.G., Copp, B.R., McNeil, M.R., Wilson, M.A., and Barry, C.E., 3rd (2004). The transcriptional responses of Mycobacterium tuberculosis to inhibitors of metabolism: novel insights into drug mechanisms of action. The Journal of biological chemistry 279, 40174-40184. Boshoff, H.I., Reed, M.B., Barry, C.E., 3rd, and Mizrahi, V. (2003). DnaE2 polymerase contributes to in vivo survival and the emergence of drug resistance in Mycobacterium tuberculosis. Cell 113, 183-193. Brennan, P.J., and Nikaido, H. (1995). The envelope of mycobacteria. Annual review of biochemistry 64, 29-63. Brodin, P., Poquet, Y., Levillain, F., Peguillet, I., Larrouy-Maumus, G., Gilleron, M., Ewann, F., Christophe, T., Fenistein, D., Jang, J., et al. (2010). High content phenotypic cell-based visual screen identifies Mycobacterium tuberculosis acyltrehalose-containing glycolipids involved in phagosome remodeling. PLoS pathogens 6, e1001100. Brooks, P.C., Movahedzadeh, F., and Davis, E.O. (2001). Identification of some DNA damage-inducible genes of Mycobacterium tuberculosis: apparent lack of correlation with LexA binding. Journal of bacteriology 183, 4459-4467. Brosch, R., Gordon, S.V., Marmiesse, M., Brodin, P., Buchrieser, C., Eiglmeier, K., Garnier, T., Gutierrez, C., Hewinson, G., Kremer, K., et al. (2002). A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proceedings of the National Academy of Sciences of the United States of America 99, 3684-3689. Brudey, K., Driscoll, J.R., Rigouts, L., Prodinger, W.M., Gori, A., Al-Hajoj, S.A., Allix, C., Aristimuno, L., Arora, J., Baumanis, V., et al. (2006). Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology. BMC microbiology 6, 23. Bryk, R., Lima, C.D., Erdjument-Bromage, H., Tempst, P., and Nathan, C. (2002). Metabolic enzymes of mycobacteria linked to antioxidant defense by a thioredoxin-like protein. Science 295, 1073-1077.
113 References
Buchmeier, N.A., Libby, S.J., Xu, Y., Loewen, P.C., Switala, J., Guiney, D.G., and Fang, F.C. (1995). DNA repair is more important than catalase for Salmonella virulence in mice. The Journal of clinical investigation 95, 1047-1053. Buchmeier, N.A., Newton, G.L., and Fahey, R.C. (2006). A mycothiol synthase mutant of Mycobacterium tuberculosis has an altered thiol-disulfide content and limited tolerance to stress. Journal of bacteriology 188, 6245-6252. Buchmeier, N.A., Newton, G.L., Koledin, T., and Fahey, R.C. (2003). Association of mycothiol with protection of Mycobacterium tuberculosis from toxic oxidants and antibiotics. Molecular microbiology 47, 1723-1732. Bustamante, J., Aksu, G., Vogt, G., de Beaucoudrey, L., Genel, F., Chapgier, A., Filipe-Santos, O., Feinberg, J., Emile, J.F., Kutukculer, N., et al. (2007). BCG-osis and tuberculosis in a child with chronic granulomatous disease. The Journal of allergy and clinical immunology 120, 32-38. Bylund, J., Brown, K.L., Movitz, C., Dahlgren, C., and Karlsson, A. (2010). Intracellular generation of superoxide by the phagocyte NADPH oxidase: how, where, and what for? Free radical biology & medicine 49, 1834-1845. Cabusora, L., Sutton, E., Fulmer, A., and Forst, C.V. (2005). Differential network expression during drug and stress response. Bioinformatics 21, 2898-2905. Calmette, A. (1931). Preventive Vaccination Against Tuberculosis with BCG. Proceedings of the Royal Society of Medicine 24, 1481-1490. Camacho, L.R., Constant, P., Raynaud, C., Laneelle, M.A., Triccas, J.A., Gicquel, B., Daffe, M., and Guilhot, C. (2001). Analysis of the phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. The Journal of biological chemistry 276, 19845-19854. Camacho, L.R., Ensergueix, D., Perez, E., Gicquel, B., and Guilhot, C. (1999). Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis. Molecular microbiology 34, 257-267. Caminero, J.A., Pena, M.J., Campos-Herrero, M.I., Rodriguez, J.C., Garcia, I., Cabrera, P., Lafoz, C., Samper, S., Takiff, H., Afonso, O., et al. (2001). Epidemiological evidence of the spread of a Mycobacterium tuberculosis strain of the Beijing genotype on Gran Canaria Island. American journal of respiratory and critical care medicine 164, 1165-1170. Cappelli, G., Volpe, E., Grassi, M., Liseo, B., Colizzi, V., and Mariani, F. (2006). Profiling of Mycobacterium tuberculosis gene expression during human macrophage infection: upregulation of the alternative sigma factor G, a group of transcriptional regulators, and proteins with unknown function. Research in microbiology 157, 445-455. Catalao, M.J., Gil, F., Moniz-Pereira, J., Sao-Jose, C., and Pimentel, M. (2012). Diversity in bacterial lysis systems: bacteriophages show the way. FEMS microbiology reviews. Caws, M., Thwaites, G., Dunstan, S., Hawn, T.R., Lan, N.T., Thuong, N.T., Stepniewska, K., Huyen, M.N., Bang, N.D., Loc, T.H., et al. (2008). The influence of host and bacterial genotype on the development of disseminated disease with Mycobacterium tuberculosis. PLoS pathogens 4, e1000034. Chan, J., Fan, X.D., Hunter, S.W., Brennan, P.J., and Bloom, B.R. (1991). Lipoarabinomannan, a possible virulence factor involved in persistence of Mycobacterium tuberculosis within macrophages. Infection and immunity 59, 1755-1761. Chan, J., Fujiwara, T., Brennan, P., McNeil, M., Turco, S.J., Sibille, J.C., Snapper, M., Aisen, P., and Bloom, B.R. (1989). Microbial glycolipids: possible virulence factors that scavenge oxygen radicals. Proceedings of the National Academy of Sciences of the United States of America 86, 2453-2457. Chan, J., Xing, Y., Magliozzo, R.S., and Bloom, B.R. (1992). Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages. The Journal of experimental medicine 175, 1111-1122. Chao, J., Wong, D., Zheng, X., Poirier, V., Bach, H., Hmama, Z., and Av-Gay, Y. (2010). Protein kinase and phosphatase signaling in Mycobacterium tuberculosis physiology and pathogenesis. Biochimica et biophysica acta 1804, 620-627.
114 References
Chaturvedi, R., Bansal, K., Narayana, Y., Kapoor, N., Sukumar, N., Togarsimalemath, S.K., Chandra, N., Mishra, S., Ajitkumar, P., Joshi, B., et al. (2010). The multifunctional PE_PGRS11 protein from Mycobacterium tuberculosis plays a role in regulating resistance to oxidative stress. The Journal of biological chemistry 285, 30389-30403. Chen, J., Tsolaki, A.G., Shen, X., Jiang, X., Mei, J., and Gao, Q. (2007). Deletion-targeted multiplex PCR (DTM-PCR) for identification of Beijing/W genotypes of Mycobacterium tuberculosis. Tuberculosis 87, 446-449. Cheng, K.C., Cahill, D.S., Kasai, H., Nishimura, S., and Loeb, L.A. (1992). 8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G----T and A----C substitutions. The Journal of biological chemistry 267, 166-172. Choi, H.S., Rai, P.R., Chu, H.W., Cool, C., and Chan, E.D. (2002). Analysis of nitric oxide synthase and nitrotyrosine expression in human pulmonary tuberculosis. American journal of respiratory and critical care medicine 166, 178-186. Cirillo, S.L., Subbian, S., Chen, B., Weisbrod, T.R., Jacobs, W.R., Jr., and Cirillo, J.D. (2009). Protection of Mycobacterium tuberculosis from reactive oxygen species conferred by the mel2 locus impacts persistence and dissemination. Infection and immunity 77, 2557-2567. Clay, H., Davis, J.M., Beery, D., Huttenlocher, A., Lyons, S.E., and Ramakrishnan, L. (2007). Dichotomous role of the macrophage in early Mycobacterium marinum infection of the zebrafish. Cell host & microbe 2, 29-39. Clemens, D.L., and Horwitz, M.A. (1996). The Mycobacterium tuberculosis phagosome interacts with early endosomes and is accessible to exogenously administered transferrin. The Journal of experimental medicine 184, 1349-1355. Colangeli, R., Haq, A., Arcus, V.L., Summers, E., Magliozzo, R.S., McBride, A., Mitra, A.K., Radjainia, M., Khajo, A., Jacobs, W.R., Jr., et al. (2009). The multifunctional histone-like protein Lsr2 protects mycobacteria against reactive oxygen intermediates. Proceedings of the National Academy of Sciences of the United States of America 106, 4414-4418. Colditz, G.A., Brewer, T.F., Berkey, C.S., Wilson, M.E., Burdick, E., Fineberg, H.V., and Mosteller, F. (1994). Efficacy of BCG vaccine in the prevention of tuberculosis. Meta-analysis of the published literature. JAMA : the journal of the American Medical Association 271, 698-702. Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S.V., Eiglmeier, K., Gas, S., Barry, C.E., 3rd, et al. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537-544. Comas, I., Chakravartti, J., Small, P.M., Galagan, J., Niemann, S., Kremer, K., Ernst, J.D., and Gagneux, S. (2010). Human T cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved. Nature genetics 42, 498-503. Comas, I., and Gagneux, S. (2009). The past and future of tuberculosis research. PLoS pathogens 5, e1000600. Comas, I., Homolka, S., Niemann, S., and Gagneux, S. (2009). Genotyping of genetically monomorphic bacteria: DNA sequencing in Mycobacterium tuberculosis highlights the limitations of current methodologies. PloS one 4, e7815. Converse, S.E., Mougous, J.D., Leavell, M.D., Leary, J.A., Bertozzi, C.R., and Cox, J.S. (2003). MmpL8 is required for sulfolipid-1 biosynthesis and Mycobacterium tuberculosis virulence. Proceedings of the National Academy of Sciences of the United States of America 100, 6121-6126. Cooper, A.M., Pearl, J.E., Brooks, J.V., Ehlers, S., and Orme, I.M. (2000). Expression of the nitric oxide synthase 2 gene is not essential for early control of Mycobacterium tuberculosis in the murine lung. Infection and immunity 68, 6879-6882. Coscolla, M., and Gagneux, S. (2010). Does M. tuberculosis genomic diversity explain disease diversity? Drug discovery today Disease mechanisms 7, e43-e59. Cox, J.S., Chen, B., McNeil, M., and Jacobs, W.R., Jr. (1999). Complex lipid determines tissue-specific replication of Mycobacterium tuberculosis in mice. Nature 402, 79-83. Craig, M., and Slauch, J.M. (2009). Phagocytic superoxide specifically damages an extracytoplasmic target to inhibit or kill Salmonella. PloS one 4, e4975.
115 References
Daffe, M., and Draper, P. (1998). The envelope layers of mycobacteria with reference to their pathogenicity. Advances in microbial physiology 39, 131-203. Daniel, T.M. (2006). The history of tuberculosis. Respiratory medicine 100, 1862-1870. Darwin, K.H., Ehrt, S., Gutierrez-Ramos, J.C., Weich, N., and Nathan, C.F. (2003). The proteasome of Mycobacterium tuberculosis is required for resistance to nitric oxide. Science 302, 1963-1966. Darwin, K.H., and Nathan, C.F. (2005). Role for nucleotide excision repair in virulence of Mycobacterium tuberculosis. Infection and immunity 73, 4581-4587. David, S.S., O'Shea, V.L., and Kundu, S. (2007). Base-excision repair of oxidative DNA damage. Nature 447, 941-950. Day, J.H., Grant, A.D., Fielding, K.L., Morris, L., Moloi, V., Charalambous, S., Puren, A.J., Chaisson, R.E., De Cock, K.M., Hayes, R.J., et al. (2004). Does tuberculosis increase HIV load? The Journal of infectious diseases 190, 1677-1684. de Hostos, E.L. (1999). The coronin family of actin-associated proteins. Trends in cell biology 9, 345-350. de Jong, B.C., Hill, P.C., Brookes, R.H., Gagneux, S., Jeffries, D.J., Otu, J.K., Donkor, S.A., Fox, A., McAdam, K.P., Small, P.M., et al. (2006). Mycobacterium africanum elicits an attenuated T cell response to early secreted antigenic target, 6 kDa, in patients with tuberculosis and their household contacts. The Journal of infectious diseases 193, 1279-1286. de Laat, W.L., Jaspers, N.G., and Hoeijmakers, J.H. (1999). Molecular mechanism of nucleotide excision repair. Genes Dev 13, 768-785. Deghmane, A.E., Soualhine, H., Bach, H., Sendide, K., Itoh, S., Tam, A., Noubir, S., Talal, A., Lo, R., Toyoshima, S., et al. (2007). Lipoamide dehydrogenase mediates retention of coronin-1 on BCG vacuoles, leading to arrest in phagosome maturation. Journal of cell science 120, 2796-2806. Della, M., Palmbos, P.L., Tseng, H.M., Tonkin, L.M., Daley, J.M., Topper, L.M., Pitcher, R.S., Tomkinson, A.E., Wilson, T.E., and Doherty, A.J. (2004). Mycobacterial Ku and ligase proteins constitute a two-component NHEJ repair machine. Science 306, 683-685. Demple, B., and Harrison, L. (1994). Repair of oxidative damage to DNA: enzymology and biology. Annual review of biochemistry 63, 915-948. Denamur, E., and Matic, I. (2006). Evolution of mutation rates in bacteria. Molecular microbiology 60, 820-827. Denu, J.M., and Tanner, K.G. (1998). Specific and reversible inactivation of protein tyrosine phosphatases by hydrogen peroxide: evidence for a sulfenic acid intermediate and implications for redox regulation. Biochemistry 37, 5633-5642. Deretic, V., Philipp, W., Dhandayuthapani, S., Mudd, M.H., Curcic, R., Garbe, T., Heym, B., Via, L.E., and Cole, S.T. (1995). Mycobacterium tuberculosis is a natural mutant with an inactivated oxidative-stress regulatory gene: implications for sensitivity to isoniazid. Molecular microbiology 17, 889-900. Desjardins, M., Huber, L.A., Parton, R.G., and Griffiths, G. (1994). Biogenesis of phagolysosomes proceeds through a sequential series of interactions with the endocytic apparatus. The Journal of cell biology 124, 677-688. Dianov, G., and Lindahl, T. (1994). Reconstitution of the DNA base excision-repair pathway. Curr Biol 4, 1069-1076. Dizdaroglu, M. (2005). Base-excision repair of oxidative DNA damage by DNA glycosylases. Mutation research 591, 45-59. Domenech, P., Honore, N., Heym, B., and Cole, S.T. (2001). Role of OxyS of Mycobacterium tuberculosis in oxidative stress: overexpression confers increased sensitivity to organic hydroperoxides. Microbes and infection / Institut Pasteur 3, 713-721. Domenech, P., Reed, M.B., and Barry, C.E., 3rd (2005). Contribution of the Mycobacterium tuberculosis MmpL protein family to virulence and drug resistance. Infection and immunity 73, 3492-3501. Domenech, P., Reed, M.B., Dowd, C.S., Manca, C., Kaplan, G., and Barry, C.E., 3rd (2004). The role of MmpL8 in sulfatide biogenesis and virulence of Mycobacterium tuberculosis. The Journal of biological chemistry 279, 21257-21265. Dormans, J., Burger, M., Aguilar, D., Hernandez-Pando, R., Kremer, K., Roholl, P., Arend, S.M., and van Soolingen, D. (2004). Correlation of virulence, lung pathology, bacterial load and delayed type
116 References
hypersensitivity responses after infection with different Mycobacterium tuberculosis genotypes in a BALB/c mouse model. Clinical and experimental immunology 137, 460-468. Dos Vultos, T., Blazquez, J., Rauzier, J., Matic, I., and Gicquel, B. (2006). Identification of Nudix hydrolase family members with an antimutator role in Mycobacterium tuberculosis and Mycobacterium smegmatis. Journal of bacteriology 188, 3159-3161. Dos Vultos, T., Mestre, O., Rauzier, J., Golec, M., Rastogi, N., Rasolofo, V., Tonjum, T., Sola, C., Matic, I., and Gicquel, B. (2008). Evolution and diversity of clonal bacteria: the paradigm of Mycobacterium tuberculosis. PloS one 3, e1538. Dos Vultos, T., Mestre, O., Tonjum, T., and Gicquel, B. (2009). DNA repair in Mycobacterium tuberculosis revisited. FEMS microbiology reviews 33, 471-487. Drennan, M.B., Nicolle, D., Quesniaux, V.J., Jacobs, M., Allie, N., Mpagi, J., Fremond, C., Wagner, H., Kirschning, C., and Ryffel, B. (2004). Toll-like receptor 2-deficient mice succumb to Mycobacterium tuberculosis infection. The American journal of pathology 164, 49-57. Durbach, S.I., Springer, B., Machowski, E.E., North, R.J., Papavinasasundaram, K.G., Colston, M.J., Bottger, E.C., and Mizrahi, V. (2003). DNA alkylation damage as a sensor of nitrosative stress in Mycobacterium tuberculosis. Infection and immunity 71, 997-1000. Dussurget, O., Stewart, G., Neyrolles, O., Pescher, P., Young, D., and Marchal, G. (2001). Role of Mycobacterium tuberculosis copper-zinc superoxide dismutase. Infection and immunity 69, 529-533. Dutta, N.K., Mehra, S., Didier, P.J., Roy, C.J., Doyle, L.A., Alvarez, X., Ratterree, M., Be, N.A., Lamichhane, G., Jain, S.K., et al. (2010). Genetic requirements for the survival of tubercle bacilli in primates. The Journal of infectious diseases 201, 1743-1752. Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H., and Stackebrandt, E. (2006). The Prokaryotes: Proteobacteria:gamma subclass, Vol 3 (Springer). Ebrahimi-Rad, M., Bifani, P., Martin, C., Kremer, K., Samper, S., Rauzier, J., Kreiswirth, B., Blazquez, J., Jouan, M., van Soolingen, D., et al. (2003). Mutations in putative mutator genes of Mycobacterium tuberculosis strains of the W-Beijing family. Emerging infectious diseases 9, 838-845. Edwards, K.M., Cynamon, M.H., Voladri, R.K., Hager, C.C., DeStefano, M.S., Tham, K.T., Lakey, D.L., Bochan, M.R., and Kernodle, D.S. (2001). Iron-cofactored superoxide dismutase inhibits host responses to Mycobacterium tuberculosis. American journal of respiratory and critical care medicine 164, 2213-2219. Ehrt, S., and Schnappinger, D. (2009). Mycobacterial survival strategies in the phagosome: defence against host stresses. Cellular microbiology 11, 1170-1178. Embley, T.M., and Stackebrandt, E. (1994). The molecular phylogeny and systematics of the actinomycetes. Annual review of microbiology 48, 257-289. Ezraty, B., Bos, J., Barras, F., and Aussel, L. (2005). Methionine sulfoxide reduction and assimilation in Escherichia coli: new role for the biotin sulfoxide reductase BisC. Journal of bacteriology 187, 231-237. Facchetti, F., Vermi, W., Fiorentini, S., Chilosi, M., Caruso, A., Duse, M., Notarangelo, L.D., and Badolato, R. (1999). Expression of inducible nitric oxide synthase in human granulomas and histiocytic reactions. The American journal of pathology 154, 145-152. Fallow, A., Domenech, P., and Reed, M.B. (2010). Strains of the East Asian (W/Beijing) lineage of Mycobacterium tuberculosis are DosS/DosT-DosR two-component regulatory system natural mutants. Journal of bacteriology 192, 2228-2238. Fang, F.C. (2004). Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nature reviews Microbiology 2, 820-832. Fenner, L., Egger, M., Bodmer, T., Altpeter, E., Zwahlen, M., Jaton, K., Pfyffer, G.E., Borrell, S., Dubuis, O., Bruderer, T., et al. (2012). Effect of mutation and genetic background on drug resistance in Mycobacterium tuberculosis. Antimicrobial agents and chemotherapy 56, 3047-3053. Ferrer, N.L., Gomez, A.B., Neyrolles, O., Gicquel, B., and Martin, C. (2010). Interactions of attenuated Mycobacterium tuberculosis phoP mutant with human macrophages. PloS one 5, e12978. Ferwerda, G., Girardin, S.E., Kullberg, B.J., Le Bourhis, L., de Jong, D.J., Langenberg, D.M., van Crevel, R., Adema, G.J., Ottenhoff, T.H., Van der Meer, J.W., et al. (2005). NOD2 and toll-like receptors are nonredundant recognition systems of Mycobacterium tuberculosis. PLoS pathogens 1, 279-285.
117 References
Filliol, I., Driscoll, J.R., Van Soolingen, D., Kreiswirth, B.N., Kremer, K., Valetudie, G., Anh, D.D., Barlow, R., Banerjee, D., Bifani, P.J., et al. (2002). Global distribution of Mycobacterium tuberculosis spoligotypes. Emerging infectious diseases 8, 1347-1349. Filliol, I., Motiwala, A.S., Cavatore, M., Qi, W., Hazbon, M.H., Bobadilla del Valle, M., Fyfe, J., Garcia-Garcia, L., Rastogi, N., Sola, C., et al. (2006). Global phylogeny of Mycobacterium tuberculosis based on single nucleotide polymorphism (SNP) analysis: insights into tuberculosis evolution, phylogenetic accuracy of other DNA fingerprinting systems, and recommendations for a minimal standard SNP set. Journal of bacteriology 188, 759-772. Fine, P.E. (1995). Variation in protection by BCG: implications of and for heterologous immunity. Lancet 346, 1339-1345. Firmani, M.A., and Riley, L.W. (2002). Mycobacterium tuberculosis CDC1551 is resistant to reactive nitrogen and oxygen intermediates in vitro. Infection and immunity 70, 3965-3968. Flannagan, R.S., Cosio, G., and Grinstein, S. (2009). Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nature reviews Microbiology 7, 355-366. Fleischmann, R.D., Alland, D., Eisen, J.A., Carpenter, L., White, O., Peterson, J., DeBoy, R., Dodson, R., Gwinn, M., Haft, D., et al. (2002). Whole-genome comparison of Mycobacterium tuberculosis clinical and laboratory strains. Journal of bacteriology 184, 5479-5490. Flynn, J.L., Chan, J., and Lin, P.L. (2011). Macrophages and control of granulomatous inflammation in tuberculosis. Mucosal immunology 4, 271-278. Fontan, P., Aris, V., Ghanny, S., Soteropoulos, P., and Smith, I. (2008). Global transcriptional profile of Mycobacterium tuberculosis during THP-1 human macrophage infection. Infection and immunity 76, 717-725. Friedberg, E.C., Walker, G.C., Siede, W., Wood, R.D., Schultz, R.A., and Ellenberger, T. (2006). DNA repair and mutagenesis, 2nd ed. edn (ASM press, Washington, DC.). Frothingham, R., and Meeker-O'Connell, W.A. (1998). Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology 144 ( Pt 5), 1189-1196. Fu, L.M., and Shinnick, T.M. (2007). Genome-wide exploration of the drug action of capreomycin on Mycobacterium tuberculosis using Affymetrix oligonucleotide GeneChips. The Journal of infection 54, 277-284. Gagneux, S., DeRiemer, K., Van, T., Kato-Maeda, M., de Jong, B.C., Narayanan, S., Nicol, M., Niemann, S., Kremer, K., Gutierrez, M.C., et al. (2006a). Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 103, 2869-2873. Gagneux, S., Long, C.D., Small, P.M., Van, T., Schoolnik, G.K., and Bohannan, B.J. (2006b). The competitive cost of antibiotic resistance in Mycobacterium tuberculosis. Science 312, 1944-1946. Gamulin, V., Cetkovic, H., and Ahel, I. (2004). Identification of a promoter motif regulating the major DNA damage response mechanism of Mycobacterium tuberculosis. FEMS microbiology letters 238, 57-63. Gandhi, N.R., Nunn, P., Dheda, K., Schaaf, H.S., Zignol, M., van Soolingen, D., Jensen, P., and Bayona, J. (2010). Multidrug-resistant and extensively drug-resistant tuberculosis: a threat to global control of tuberculosis. Lancet 375, 1830-1843. Garbe, T.R., Hibler, N.S., and Deretic, V. (1996). Response of Mycobacterium tuberculosis to reactive oxygen and nitrogen intermediates. Mol Med 2, 134-142. Gebhard, S., Humpel, A., McLellan, A.D., and Cook, G.M. (2008). The alternative sigma factor SigF of Mycobacterium smegmatis is required for survival of heat shock, acidic pH and oxidative stress. Microbiology 154, 2786-2795. Geijtenbeek, T.B., Van Vliet, S.J., Koppel, E.A., Sanchez-Hernandez, M., Vandenbroucke-Grauls, C.M., Appelmelk, B., and Van Kooyk, Y. (2003). Mycobacteria target DC-SIGN to suppress dendritic cell function. The Journal of experimental medicine 197, 7-17.
118 References
Geiman, D.E., Raghunand, T.R., Agarwal, N., and Bishai, W.R. (2006). Differential gene expression in response to exposure to antimycobacterial agents and other stress conditions among seven Mycobacterium tuberculosis whiB-like genes. Antimicrobial agents and chemotherapy 50, 2836-2841. Glynn, J.R., Whiteley, J., Bifani, P.J., Kremer, K., and van Soolingen, D. (2002). Worldwide occurrence of Beijing/W strains of Mycobacterium tuberculosis: a systematic review. Emerging infectious diseases 8, 843-849. Gong, C., Bongiorno, P., Martins, A., Stephanou, N.C., Zhu, H., Shuman, S., and Glickman, M.S. (2005). Mechanism of nonhomologous end-joining in mycobacteria: a low-fidelity repair system driven by Ku, ligase D and ligase C. Nat Struct Mol Biol 12, 304-312. Gonzalo-Asensio, J., Mostowy, S., Harders-Westerveen, J., Huygen, K., Hernandez-Pando, R., Thole, J., Behr, M., Gicquel, B., and Martin, C. (2008). PhoP: a missing piece in the intricate puzzle of Mycobacterium tuberculosis virulence. PloS one 3, e3496. Graham, J.E., and Clark-Curtiss, J.E. (1999). Identification of Mycobacterium tuberculosis RNAs synthesized in response to phagocytosis by human macrophages by selective capture of transcribed sequences (SCOTS). Proceedings of the National Academy of Sciences of the United States of America 96, 11554-11559. Grant, S.S., Kaufmann, B.B., Chand, N.S., Haseley, N., and Hung, D.T. (2012). Eradication of bacterial persisters with antibiotic-generated hydroxyl radicals. Proceedings of the National Academy of Sciences of the United States of America 109, 12147-12152. Griffiths, G., Nystrom, B., Sable, S.B., and Khuller, G.K. (2010). Nanobead-based interventions for the treatment and prevention of tuberculosis. Nature reviews Microbiology 8, 827-834. Grzegorzewicz, A.E., Pham, H., Gundi, V.A., Scherman, M.S., North, E.J., Hess, T., Jones, V., Gruppo, V., Born, S.E., Kordulakova, J., et al. (2012). Inhibition of mycolic acid transport across the Mycobacterium tuberculosis plasma membrane. Nature chemical biology 8, 334-341. Guo, Y., Bandaru, V., Jaruga, P., Zhao, X., Burrows, C.J., Iwai, S., Dizdaroglu, M., Bond, J.P., and Wallace, S.S. (2010). The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts. DNA repair 9, 177-190. Gurtler, V., Mayall, B.C., and Seviour, R. (2004). Can whole genome analysis refine the taxonomy of the genus Rhodococcus? FEMS microbiology reviews 28, 377-403. Gutacker, M.M., Mathema, B., Soini, H., Shashkina, E., Kreiswirth, B.N., Graviss, E.A., and Musser, J.M. (2006). Single-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites. The Journal of infectious diseases 193, 121-128. Gutacker, M.M., Smoot, J.C., Migliaccio, C.A., Ricklefs, S.M., Hua, S., Cousins, D.V., Graviss, E.A., Shashkina, E., Kreiswirth, B.N., and Musser, J.M. (2002). Genome-wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium tuberculosis complex organisms: resolution of genetic relationships among closely related microbial strains. Genetics 162, 1533-1543. Guthlein, C., Wanner, R.M., Sander, P., Davis, E.O., Bosshard, M., Jiricny, J., Bottger, E.C., and Springer, B. (2008). Characterisation of the mycobacterial NER system reveals novel functions of uvrD1 helicase. Journal of bacteriology. Gutierrez, M.C., Brisse, S., Brosch, R., Fabre, M., Omais, B., Marmiesse, M., Supply, P., and Vincent, V. (2005). Ancient origin and gene mosaicism of the progenitor of Mycobacterium tuberculosis. PLoS pathogens 1, e5. Hanekom, M., van der Spuy, G.D., Streicher, E., Ndabambi, S.L., McEvoy, C.R., Kidd, M., Beyers, N., Victor, T.C., van Helden, P.D., and Warren, R.M. (2007). A recently evolved sublineage of the Mycobacterium tuberculosis Beijing strain family is associated with an increased ability to spread and cause disease. Journal of clinical microbiology 45, 1483-1490. Harries, A.D., and Dye, C. (2006). Tuberculosis. Ann Trop Med Parasitol 100, 415-431. Hershberg, R., Lipatov, M., Small, P.M., Sheffer, H., Niemann, S., Homolka, S., Roach, J.C., Kremer, K., Petrov, D.A., Feldman, M.W., et al. (2008). High functional diversity in Mycobacterium tuberculosis driven by genetic drift and human demography. PLoS Biol 6, e311.
119 References
Heym, B., Honore, N., Truffot-Pernot, C., Banerjee, A., Schurra, C., Jacobs, W.R., Jr., van Embden, J.D., Grosset, J.H., and Cole, S.T. (1994). Implications of multidrug resistance for the future of short-course chemotherapy of tuberculosis: a molecular study. Lancet 344, 293-298. Heym, B., Zhang, Y., Poulet, S., Young, D., and Cole, S.T. (1993). Characterization of the katG gene encoding a catalase-peroxidase required for the isoniazid susceptibility of Mycobacterium tuberculosis. Journal of bacteriology 175, 4255-4259. Heyworth, P.G., Cross, A.R., and Curnutte, J.T. (2003). Chronic granulomatous disease. Current opinion in immunology 15, 578-584. Hiriyanna, K.T., and Ramakrishnan, T. (1986). Deoxyribonucleic acid replication time in Mycobacterium tuberculosis H37 Rv. Archives of microbiology 144, 105-109. Hoffmann, C., Leis, A., Niederweis, M., Plitzko, J.M., and Engelhardt, H. (2008). Disclosure of the mycobacterial outer membrane: cryo-electron tomography and vitreous sections reveal the lipid bilayer structure. Proceedings of the National Academy of Sciences of the United States of America 105, 3963-3967. Holmgren, A. (2000). Antioxidant function of thioredoxin and glutaredoxin systems. Antioxidants & redox signaling 2, 811-820. Homolka, S., Niemann, S., Russell, D.G., and Rohde, K.H. (2010). Functional genetic diversity among Mycobacterium tuberculosis complex clinical isolates: delineation of conserved core and lineage-specific transcriptomes during intracellular survival. PLoS pathogens 6, e1000988. Houghton, J., Townsend, C., Williams, A.R., Rodgers, A., Rand, L., Walker, K.B., Bottger, E.C., Springer, B., and Davis, E.O. (2012). Important role for Mycobacterium tuberculosis UvrD1 in pathogenesis and persistence apart from its function in nucleotide excision repair. Journal of bacteriology 194, 2916-2923. Hu, Y., Kendall, S., Stoker, N.G., and Coates, A.R. (2004). The Mycobacterium tuberculosis sigJ gene controls sensitivity of the bacterium to hydrogen peroxide. FEMS microbiology letters 237, 415-423. Humphreys, I.R., Stewart, G.R., Turner, D.J., Patel, J., Karamanou, D., Snelgrove, R.J., and Young, D.B. (2006). A role for dendritic cells in the dissemination of mycobacterial infection. Microbes and infection / Institut Pasteur 8, 1339-1346. Imlay, J.A. (2008). Cellular defenses against superoxide and hydrogen peroxide. Annual review of biochemistry 77, 755-776. Imlay, J.A., and Linn, S. (1986). Bimodal pattern of killing of DNA-repair-defective or anoxically grown Escherichia coli by hydrogen peroxide. Journal of bacteriology 166, 519-527. Ishibashi, Y., and Arai, T. (1990). Roles of the complement receptor type 1 (CR1) and type 3 (CR3) on phagocytosis and subsequent phagosome-lysosome fusion in Salmonella-infected murine macrophages. FEMS microbiology immunology 2, 89-96. Iwamoto, T., Yoshida, S., Suzuki, K., Tomita, M., Fujiyama, R., Tanaka, N., Kawakami, Y., and Ito, M. (2007). Hypervariable loci that enhance the discriminatory ability of newly proposed 15-loci and 24-loci variable-number tandem repeat typing method on Mycobacterium tuberculosis strains predominated by the Beijing family. FEMS microbiology letters 270, 67-74. Iwamoto, T., Yoshida, S., Suzuki, K., and Wada, T. (2008). Population structure analysis of the Mycobacterium tuberculosis Beijing family indicates an association between certain sublineages and multidrug resistance. Antimicrobial agents and chemotherapy 52, 3805-3809. Jain, M., and Cox, J.S. (2005). Interaction between polyketide synthase and transporter suggests coupled synthesis and export of virulence lipid in M. tuberculosis. PLoS pathogens 1, e2. Jain, R., Dey, B., Khera, A., Srivastav, P., Gupta, U.D., Katoch, V.M., Ramanathan, V.D., and Tyagi, A.K. (2011). Over-expression of superoxide dismutase obliterates the protective effect of BCG against tuberculosis by modulating innate and adaptive immune responses. Vaccine 29, 8118-8125. Jain, R., Kumar, P., and Varshney, U. (2007). A distinct role of formamidopyrimidine DNA glycosylase (MutM) in down-regulation of accumulation of G, C mutations and protection against oxidative stress in mycobacteria. DNA repair 6, 1774-1785. Jarlier, V., and Nikaido, H. (1994). Mycobacterial cell wall: structure and role in natural resistance to antibiotics. FEMS microbiology letters 123, 11-18.
120 References
Jung, Y.J., LaCourse, R., Ryan, L., and North, R.J. (2002). Virulent but not avirulent Mycobacterium tuberculosis can evade the growth inhibitory action of a T helper 1-dependent, nitric oxide Synthase 2-independent defense in mice. The Journal of experimental medicine 196, 991-998. Kallenius, G., Koivula, T., Ghebremichael, S., Hoffner, S.E., Norberg, R., Svensson, E., Dias, F., Marklund, B.I., and Svenson, S.B. (1999). Evolution and clonal traits of Mycobacterium tuberculosis complex in Guinea-Bissau. Journal of clinical microbiology 37, 3872-3878. Kamerbeek, J., Schouls, L., Kolk, A., van Agterveld, M., van Soolingen, D., Kuijper, S., Bunschoten, A., Molhuizen, H., Shaw, R., Goyal, M., et al. (1997). Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. Journal of clinical microbiology 35, 907-914. Kang, J., and Blaser, M.J. (2006). Bacterial populations as perfect gases: genomic integrity and diversification tensions in Helicobacter pylori. Nature reviews Microbiology 4, 826-836. Kang, P.B., Azad, A.K., Torrelles, J.B., Kaufman, T.M., Beharka, A., Tibesar, E., DesJardin, L.E., and Schlesinger, L.S. (2005). The human macrophage mannose receptor directs Mycobacterium tuberculosis lipoarabinomannan-mediated phagosome biogenesis. The Journal of experimental medicine 202, 987-999. Kato-Maeda, M., Metcalfe, J.Z., and Flores, L. (2011). Genotyping of Mycobacterium tuberculosis: application in epidemiologic studies. Future microbiology 6, 203-216. Kato-Maeda, M., Shanley, C.A., Ackart, D., Jarlsberg, L.G., Shang, S., Obregon-Henao, A., Harton, M., Basaraba, R.J., Henao-Tamayo, M., Barrozo, J.C., et al. (2012). Beijing Sublineages of Mycobacterium tuberculosis Differ in Pathogenicity in the Guinea Pig. Clinical and vaccine immunology : CVI 19, 1227-1237. Kaufmann, S.H. (2011). Fact and fiction in tuberculosis vaccine research: 10 years later. The Lancet infectious diseases 11, 633-640. Kaufmann, S.H., and McMichael, A.J. (2005). Annulling a dangerous liaison: vaccination strategies against AIDS and tuberculosis. Nature medicine 11, S33-44. Kaur, D., Guerin, M.E., Skovierova, H., Brennan, P.J., and Jackson, M. (2009). Chapter 2: Biogenesis of the cell wall and other glycoconjugates of Mycobacterium tuberculosis. Advances in applied microbiology 69, 23-78. Keren, I., Minami, S., Rubin, E., and Lewis, K. (2011). Characterization and transcriptome analysis of Mycobacterium tuberculosis persisters. mBio 2, e00100-00111. Koch, R. (1882). Die Aetiogie der Tuberculose. Berl Klin Wochenschr 19, 221–230. Koch, R. (1982). Classics in infectious diseases. The etiology of tuberculosis: Robert Koch. Berlin, Germany 1882. Reviews of infectious diseases 4, 1270-1274. Kohanski, M.A., Dwyer, D.J., Hayete, B., Lawrence, C.A., and Collins, J.J. (2007). A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130, 797-810. Kremer, K., Au, B.K., Yip, P.C., Skuce, R., Supply, P., Kam, K.M., and van Soolingen, D. (2005). Use of variable-number tandem-repeat typing to differentiate Mycobacterium tuberculosis Beijing family isolates from Hong Kong and comparison with IS6110 restriction fragment length polymorphism typing and spoligotyping. Journal of clinical microbiology 43, 314-320. Kremer, K., Glynn, J.R., Lillebaek, T., Niemann, S., Kurepina, N.E., Kreiswirth, B.N., Bifani, P.J., and van Soolingen, D. (2004). Definition of the Beijing/W lineage of Mycobacterium tuberculosis on the basis of genetic markers. Journal of clinical microbiology 42, 4040-4049. Kremer, K., van-der-Werf, M.J., Au, B.K., Anh, D.D., Kam, K.M., van-Doorn, H.R., Borgdorff, M.W., and van-Soolingen, D. (2009). Vaccine-induced immunity circumvented by typical Mycobacterium tuberculosis Beijing strains. Emerging infectious diseases 15, 335-339. Kurepina, N.E., Sreevatsan, S., Plikaytis, B.B., Bifani, P.J., Connell, N.D., Donnelly, R.J., van Sooligen, D., Musser, J.M., and Kreiswirth, B.N. (1998). Characterization of the phylogenetic distribution and chromosomal insertion sites of five IS6110 elements in Mycobacterium tuberculosis: non-random integration in the dnaA-dnaN region. Tubercle and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 79, 31-42.
121 References
Kurthkoti, K., Kumar, P., Jain, R., and Varshney, U. (2008). Important role of the nucleotide excision repair pathway in Mycobacterium smegmatis in conferring protection against commonly encountered DNA-damaging agents. Microbiology 154, 2776-2785. Kurthkoti, K., Srinath, T., Kumar, P., Malshetty, V.S., Sang, P.B., Jain, R., Manjunath, R., and Varshney, U. (2010). A distinct physiological role of MutY in mutation prevention in mycobacteria. Microbiology 156, 88-93. Lamhamedi-Cherradi, S., de Chastellier, C., and Casanova, J.L. (1999). Growth of Mycobacterium bovis, Bacille Calmette-Guerin, within human monocytes-macrophages cultured in serum-free medium. Journal of immunological methods 225, 75-86. Lamichhane, G., Tyagi, S., and Bishai, W.R. (2005). Designer arrays for defined mutant analysis to detect genes essential for survival of Mycobacterium tuberculosis in mouse lungs. Infection and immunity 73, 2533-2540. Lari, N., Rindi, L., Bonanni, D., Tortoli, E., and Garzelli, C. (2006). Mutations in mutT genes of Mycobacterium tuberculosis isolates of Beijing genotype. Journal of medical microbiology 55, 599-603. Lee, H.M., Shin, D.M., Kim, K.K., Lee, J.S., Paik, T.H., and Jo, E.K. (2009a). Roles of reactive oxygen species in CXCL8 and CCL2 expression in response to the 30-kDa antigen of Mycobacterium tuberculosis. Journal of clinical immunology 29, 46-56. Lee, M.H., Pascopella, L., Jacobs, W.R., Jr., and Hatfull, G.F. (1991). Site-specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis, and bacille Calmette-Guerin. Proceedings of the National Academy of Sciences of the United States of America 88, 3111-3115. Lee, W.L., Gold, B., Darby, C., Brot, N., Jiang, X., de Carvalho, L.P., Wellner, D., St John, G., Jacobs, W.R., Jr., and Nathan, C. (2009b). Mycobacterium tuberculosis expresses methionine sulphoxide reductases A and B that protect from killing by nitrite and hypochlorite. Molecular microbiology 71, 583-593. Leemans, J.C., Juffermans, N.P., Florquin, S., van Rooijen, N., Vervoordeldonk, M.J., Verbon, A., van Deventer, S.J., and van der Poll, T. (2001). Depletion of alveolar macrophages exerts protective effects in pulmonary tuberculosis in mice. Journal of immunology 166, 4604-4611. Leemans, J.C., Thepen, T., Weijer, S., Florquin, S., van Rooijen, N., van de Winkel, J.G., and van der Poll, T. (2005). Macrophages play a dual role during pulmonary tuberculosis in mice. The Journal of infectious diseases 191, 65-74. Levy-Frebault, V.V., and Portaels, F. (1992). Proposed minimal standards for the genus Mycobacterium and for description of new slowly growing Mycobacterium species. International journal of systematic bacteriology 42, 315-323. Li, Q., Whalen, C.C., Albert, J.M., Larkin, R., Zukowski, L., Cave, M.D., and Silver, R.F. (2002). Differences in rate and variability of intracellular growth of a panel of Mycobacterium tuberculosis clinical isolates within a human monocyte model. Infection and immunity 70, 6489-6493. Li, Y., and He, Z.G. (2012). The mycobacterial LysR-type regulator OxyS responds to oxidative stress and negatively regulates expression of the catalase-peroxidase gene. PloS one 7, e30186. Little, J.W. (1982). Control of the SOS regulatory system by the level of RecA protease. Biochimie 64, 585-589. Lopez, B., Aguilar, D., Orozco, H., Burger, M., Espitia, C., Ritacco, V., Barrera, L., Kremer, K., Hernandez-Pando, R., Huygen, K., et al. (2003). A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clinical and experimental immunology 133, 30-37. MacGurn, J.A., and Cox, J.S. (2007). A genetic screen for Mycobacterium tuberculosis mutants defective for phagosome maturation arrest identifies components of the ESX-1 secretion system. Infection and immunity 75, 2668-2678. MacMicking, J.D., North, R.J., LaCourse, R., Mudgett, J.S., Shah, S.K., and Nathan, C.F. (1997). Identification of nitric oxide synthase as a protective locus against tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 94, 5243-5248. Maddocks, S.E., and Oyston, P.C. (2008). Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology 154, 3609-3623.
122 References
Maglione, P.J., Xu, J., Casadevall, A., and Chan, J. (2008). Fc gamma receptors regulate immune activation and susceptibility during Mycobacterium tuberculosis infection. Journal of immunology 180, 3329-3338. Malaga, W., Constant, P., Euphrasie, D., Cataldi, A., Daffe, M., Reyrat, J.M., and Guilhot, C. (2008). Deciphering the genetic bases of the structural diversity of phenolic glycolipids in strains of the Mycobacterium tuberculosis complex. The Journal of biological chemistry 283, 15177-15184. Malik, Z.A., Thompson, C.R., Hashimi, S., Porter, B., Iyer, S.S., and Kusner, D.J. (2003). Cutting edge: Mycobacterium tuberculosis blocks Ca2+ signaling and phagosome maturation in human macrophages via specific inhibition of sphingosine kinase. Journal of immunology 170, 2811-2815. Malm, S., Tiffert, Y., Micklinghoff, J., Schultze, S., Joost, I., Weber, I., Horst, S., Ackermann, B., Schmidt, M., Wohlleben, W., et al. (2009). The roles of the nitrate reductase NarGHJI, the nitrite reductase NirBD and the response regulator GlnR in nitrate assimilation of Mycobacterium tuberculosis. Microbiology 155, 1332-1339. Manca, C., Paul, S., Barry, C.E., 3rd, Freedman, V.H., and Kaplan, G. (1999). Mycobacterium tuberculosis catalase and peroxidase activities and resistance to oxidative killing in human monocytes in vitro. Infection and immunity 67, 74-79. Manganelli, R., Voskuil, M.I., Schoolnik, G.K., Dubnau, E., Gomez, M., and Smith, I. (2002). Role of the extracytoplasmic-function sigma factor sigma(H) in Mycobacterium tuberculosis global gene expression. Molecular microbiology 45, 365-374. Mange, P.F. (1992). Hansen and his discovery of Mycobacterium leprae. New Jersey medicine : the journal of the Medical Society of New Jersey 89, 118-121. Master, S.S., Springer, B., Sander, P., Boettger, E.C., Deretic, V., and Timmins, G.S. (2002). Oxidative stress response genes in Mycobacterium tuberculosis: role of ahpC in resistance to peroxynitrite and stage-specific survival in macrophages. Microbiology 148, 3139-3144. McAdam, R.A., Quan, S., Smith, D.A., Bardarov, S., Betts, J.C., Cook, F.C., Hooker, E.U., Lewis, A.P., Woollard, P., Everett, M.J., et al. (2002). Characterization of a Mycobacterium tuberculosis H37Rv transposon library reveals insertions in 351 ORFs and mutants with altered virulence. Microbiology 148, 2975-2986. McGuire, A.M., Weiner, B., Park, S.T., Wapinski, I., Raman, S., Dolganov, G., Peterson, M., Riley, R., Zucker, J., Abeel, T., et al. (2012). Comparative analysis of Mycobacterium and related Actinomycetes yields insight into the evolution of Mycobacterium tuberculosis pathogenesis. BMC genomics 13, 120. McKinney, J.D., Honer zu Bentrup, K., Munoz-Elias, E.J., Miczak, A., Chen, B., Chan, W.T., Swenson, D., Sacchettini, J.C., Jacobs, W.R., Jr., and Russell, D.G. (2000). Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature 406, 735-738. Mehra, S., and Kaushal, D. (2009). Functional genomics reveals extended roles of the Mycobacterium tuberculosis stress response factor sigmaH. Journal of bacteriology 191, 3965-3980. Michaels, M.L., and Miller, J.H. (1992). The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine). Journal of bacteriology 174, 6321-6325. Miller, J.L., Velmurugan, K., Cowan, M.J., and Briken, V. (2010). The type I NADH dehydrogenase of Mycobacterium tuberculosis counters phagosomal NOX2 activity to inhibit TNF-alpha-mediated host cell apoptosis. PLoS pathogens 6, e1000864. Minakami, R., and Sumimotoa, H. (2006). Phagocytosis-coupled activation of the superoxide-producing phagocyte oxidase, a member of the NADPH oxidase (nox) family. International journal of hematology 84, 193-198. Mizrahi, V., and Andersen, S.J. (1998). DNA repair in Mycobacterium tuberculosis. What have we learnt from the genome sequence? Molecular microbiology 29, 1331-1339. Mokrousov, I., Jiao, W.W., Sun, G.Z., Liu, J.W., Valcheva, V., Li, M., Narvskaya, O., and Shen, A.D. (2006). Evolution of drug resistance in different sublineages of Mycobacterium tuberculosis Beijing genotype. Antimicrobial agents and chemotherapy 50, 2820-2823.
123 References
Moreland, N.J., Charlier, C., Dingley, A.J., Baker, E.N., and Lott, J.S. (2009). Making sense of a missense mutation: characterization of MutT2, a Nudix hydrolase from Mycobacterium tuberculosis, and the G58R mutant encoded in W-Beijing strains of M. tuberculosis. Biochemistry 48, 699-708. Morimatsu, K., and Kowalczykowski, S.C. (2003). RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange: a universal step of recombinational repair. Mol Cell 11, 1337-1347. Morlock, G.P., Plikaytis, B.B., and Crawford, J.T. (2000). Characterization of spontaneous, In vitro-selected, rifampin-resistant mutants of Mycobacterium tuberculosis strain H37Rv. Antimicrobial agents and chemotherapy 44, 3298-3301. Mostowy, S., Inwald, J., Gordon, S., Martin, C., Warren, R., Kremer, K., Cousins, D., and Behr, M.A. (2005). Revisiting the evolution of Mycobacterium bovis. Journal of bacteriology 187, 6386-6395. Mukherjee, P., Sureka, K., Datta, P., Hossain, T., Barik, S., Das, K.P., Kundu, M., and Basu, J. (2009). Novel role of Wag31 in protection of mycobacteria under oxidative stress. Molecular microbiology 73, 103-119. Namouchi, A., Didelot, X., Schock, U., Gicquel, B., and Rocha, E.P. (2012). After the bottleneck: Genome-wide diversification of the Mycobacterium tuberculosis complex by mutation, recombination, and natural selection. Genome research 22, 721-734. Ng, V.H., Cox, J.S., Sousa, A.O., MacMicking, J.D., and McKinney, J.D. (2004). Role of KatG catalase-peroxidase in mycobacterial pathogenesis: countering the phagocyte oxidative burst. Molecular microbiology 52, 1291-1302. Nguyen, L., and Thompson, C.J. (2006). Foundations of antibiotic resistance in bacterial physiology: the mycobacterial paradigm. Trends in microbiology 14, 304-312. Nicholson, S., Bonecini-Almeida Mda, G., Lapa e Silva, J.R., Nathan, C., Xie, Q.W., Mumford, R., Weidner, J.R., Calaycay, J., Geng, J., Boechat, N., et al. (1996). Inducible nitric oxide synthase in pulmonary alveolar macrophages from patients with tuberculosis. The Journal of experimental medicine 183, 2293-2302. Nickel, D., Busch, M., Mayer, D., Hagemann, B., Knoll, V., and Stenger, S. (2012). Hypoxia triggers the expression of human beta defensin 2 and antimicrobial activity against Mycobacterium tuberculosis in human macrophages. Journal of immunology 188, 4001-4007. Nicol, M.P., and Wilkinson, R.J. (2008). The clinical consequences of strain diversity in Mycobacterium tuberculosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 102, 955-965. Niederweis, M., Danilchanka, O., Huff, J., Hoffmann, C., and Engelhardt, H. (2010). Mycobacterial outer membranes: in search of proteins. Trends in microbiology 18, 109-116. Nigou, J., Zelle-Rieser, C., Gilleron, M., Thurnher, M., and Puzo, G. (2001). Mannosylated lipoarabinomannans inhibit IL-12 production by human dendritic cells: evidence for a negative signal delivered through the mannose receptor. Journal of immunology 166, 7477-7485. Nikaido, H. (2001). Preventing drug access to targets: cell surface permeability barriers and active efflux in bacteria. Seminars in cell & developmental biology 12, 215-223. Nozaki, Y., Hasegawa, Y., Ichiyama, S., Nakashima, I., and Shimokata, K. (1997). Mechanism of nitric oxide-dependent killing of Mycobacterium bovis BCG in human alveolar macrophages. Infection and immunity 65, 3644-3647. O'Brien, L., Carmichael, J., Lowrie, D.B., and Andrew, P.W. (1994). Strains of Mycobacterium tuberculosis differ in susceptibility to reactive nitrogen intermediates in vitro. Infection and immunity 62, 5187-5190. O'Brien, P.J., and Ellenberger, T. (2004). The Escherichia coli 3-methyladenine DNA glycosylase AlkA has a remarkably versatile active site. The Journal of biological chemistry 279, 26876-26884. O'Rourke, E.J., Chevalier, C., Pinto, A.V., Thiberge, J.M., Ielpi, L., Labigne, A., and Radicella, J.P. (2003). Pathogen DNA as target for host-generated oxidative stress: role for repair of bacterial DNA damage in Helicobacter pylori colonization. Proceedings of the National Academy of Sciences of the United States of America 100, 2789-2794. O'Sullivan, D.M., McHugh, T.D., and Gillespie, S.H. (2005). Analysis of rpoB and pncA mutations in the published literature: an insight into the role of oxidative stress in Mycobacterium tuberculosis evolution? The Journal of antimicrobial chemotherapy 55, 674-679.
124 References
O'Toole, R. (2010). Experimental models used to study human tuberculosis. Advances in applied microbiology 71, 75-89. Ortalo-Magne, A., Dupont, M.A., Lemassu, A., Andersen, A.B., Gounon, P., and Daffe, M. (1995). Molecular composition of the outermost capsular material of the tubercle bacillus. Microbiology 141 ( Pt 7), 1609-1620. Pagan-Ramos, E., Song, J., McFalone, M., Mudd, M.H., and Deretic, V. (1998). Oxidative stress response and characterization of the oxyR-ahpC and furA-katG loci in Mycobacterium marinum. Journal of bacteriology 180, 4856-4864. Palanisamy, G.S., DuTeau, N., Eisenach, K.D., Cave, D.M., Theus, S.A., Kreiswirth, B.N., Basaraba, R.J., and Orme, I.M. (2009). Clinical strains of Mycobacterium tuberculosis display a wide range of virulence in guinea pigs. Tuberculosis 89, 203-209. Palomino, J.C. (2012). Current developments and future perspectives for TB diagnostics. Future microbiology 7, 59-71. Parish, T. (2003). Starvation survival response of Mycobacterium tuberculosis. Journal of bacteriology 185, 6702-6706. Parish, T., and Stoker, N.G. (1998). Electroporation of mycobacteria. Methods Mol Biol 101, 129-144. Parwati, I., van Crevel, R., and van Soolingen, D. (2010). Possible underlying mechanisms for successful emergence of the Mycobacterium tuberculosis Beijing genotype strains. The Lancet infectious diseases 10, 103-111. Pathak, S.K., Basu, S., Basu, K.K., Banerjee, A., Pathak, S., Bhattacharyya, A., Kaisho, T., Kundu, M., and Basu, J. (2007). Direct extracellular interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2 inhibits TLR signaling in macrophages. Nature immunology 8, 610-618. Perdigao, J., Macedo, R., Joao, I., Fernandes, E., Brum, L., and Portugal, I. (2008). Multidrug-resistant tuberculosis in Lisbon, Portugal: a molecular epidemiological perspective. Microb Drug Resist 14, 133-143. Perdigao, J., Macedo, R., Silva, C., Pinto, C., Furtado, C., Brum, L., and Portugal, I. (2011). Tuberculosis drug-resistance in Lisbon, Portugal: a 6-year overview. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 17, 1397-1402. Perez, E., Samper, S., Bordas, Y., Guilhot, C., Gicquel, B., and Martin, C. (2001). An essential role for phoP in Mycobacterium tuberculosis virulence. Molecular microbiology 41, 179-187. Pethe, K., Swenson, D.L., Alonso, S., Anderson, J., Wang, C., and Russell, D.G. (2004). Isolation of Mycobacterium tuberculosis mutants defective in the arrest of phagosome maturation. Proceedings of the National Academy of Sciences of the United States of America 101, 13642-13647. Philips, J.A. (2008). Mycobacterial manipulation of vacuolar sorting. Cellular microbiology 10, 2408-2415. Piddington, D.L., Fang, F.C., Laessig, T., Cooper, A.M., Orme, I.M., and Buchmeier, N.A. (2001). Cu,Zn superoxide dismutase of Mycobacterium tuberculosis contributes to survival in activated macrophages that are generating an oxidative burst. Infection and immunity 69, 4980-4987. Pitarque, S., Larrouy-Maumus, G., Payre, B., Jackson, M., Puzo, G., and Nigou, J. (2008). The immunomodulatory lipoglycans, lipoarabinomannan and lipomannan, are exposed at the mycobacterial cell surface. Tuberculosis 88, 560-565. Portugal, I., Covas, M.J., Brum, L., Viveiros, M., Ferrinho, P., Moniz-Pereira, J., and David, H. (1999). Outbreak of multiple drug-resistant tuberculosis in Lisbon: detection by restriction fragment length polymorphism analysis. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 3, 207-213. Rachman, H., Strong, M., Ulrichs, T., Grode, L., Schuchhardt, J., Mollenkopf, H., Kosmiadi, G.A., Eisenberg, D., and Kaufmann, S.H. (2006). Unique transcriptome signature of Mycobacterium tuberculosis in pulmonary tuberculosis. Infection and immunity 74, 1233-1242. Ramachandra, L., Noss, E., Boom, W.H., and Harding, C.V. (2001). Processing of Mycobacterium tuberculosis antigen 85B involves intraphagosomal formation of peptide-major histocompatibility
125 References
complex II complexes and is inhibited by live bacilli that decrease phagosome maturation. The Journal of experimental medicine 194, 1421-1432. Raman, S., Song, T., Puyang, X., Bardarov, S., Jacobs, W.R., Jr., and Husson, R.N. (2001). The alternative sigma factor SigH regulates major components of oxidative and heat stress responses in Mycobacterium tuberculosis. Journal of bacteriology 183, 6119-6125. Ramon-Garcia, S., Martin, C., Thompson, C.J., and Ainsa, J.A. (2009). Role of the Mycobacterium tuberculosis P55 efflux pump in intrinsic drug resistance, oxidative stress responses, and growth. Antimicrobial agents and chemotherapy 53, 3675-3682. Rand, L., Hinds, J., Springer, B., Sander, P., Buxton, R.S., and Davis, E.O. (2003). The majority of inducible DNA repair genes in Mycobacterium tuberculosis are induced independently of RecA. Molecular microbiology 50, 1031-1042. Rauch, P.J., Palmen, R., Burds, A.A., Gregg-Jolly, L.A., van der Zee, J.R., and Hellingwerf, K.J. (1996). The expression of the Acinetobacter calcoaceticus recA gene increases in response to DNA damage independently of RecA and of development of competence for natural transformation. Microbiology 142 ( Pt 4), 1025-1032. Reed, M.B., Domenech, P., Manca, C., Su, H., Barczak, A.K., Kreiswirth, B.N., Kaplan, G., and Barry, C.E., 3rd (2004). A glycolipid of hypervirulent tuberculosis strains that inhibits the innate immune response. Nature 431, 84-87. Reed, M.B., Gagneux, S., Deriemer, K., Small, P.M., and Barry, C.E., 3rd (2007). The W-Beijing lineage of Mycobacterium tuberculosis overproduces triglycerides and has the DosR dormancy regulon constitutively upregulated. Journal of bacteriology 189, 2583-2589. Reiling, N., Holscher, C., Fehrenbach, A., Kroger, S., Kirschning, C.J., Goyert, S., and Ehlers, S. (2002). Cutting edge: Toll-like receptor (TLR)2- and TLR4-mediated pathogen recognition in resistance to airborne infection with Mycobacterium tuberculosis. Journal of immunology 169, 3480-3484. Rengarajan, J., Bloom, B.R., and Rubin, E.J. (2005). Genome-wide requirements for Mycobacterium tuberculosis adaptation and survival in macrophages. Proceedings of the National Academy of Sciences of the United States of America 102, 8327-8332. Rhee, K.Y., Erdjument-Bromage, H., Tempst, P., and Nathan, C.F. (2005). S-nitroso proteome of Mycobacterium tuberculosis: Enzymes of intermediary metabolism and antioxidant defense. Proceedings of the National Academy of Sciences of the United States of America 102, 467-472. Rindi, L., Lari, N., Cuccu, B., and Garzelli, C. (2009). Evolutionary pathway of the Beijing lineage of Mycobacterium tuberculosis based on genomic deletions and mutT genes polymorphisms. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 9, 48-53. Rodriguez, G.M., Voskuil, M.I., Gold, B., Schoolnik, G.K., and Smith, I. (2002). ideR, An essential gene in mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Infection and immunity 70, 3371-3381. Rohde, K.H., Abramovitch, R.B., and Russell, D.G. (2007). Mycobacterium tuberculosis invasion of macrophages: linking bacterial gene expression to environmental cues. Cell host & microbe 2, 352-364. Rosas-Magallanes, V., Stadthagen-Gomez, G., Rauzier, J., Barreiro, L.B., Tailleux, L., Boudou, F., Griffin, R., Nigou, J., Jackson, M., Gicquel, B., et al. (2007). Signature-tagged transposon mutagenesis identifies novel Mycobacterium tuberculosis genes involved in the parasitism of human macrophages. Infection and immunity 75, 504-507. Rossi, F., Khanduja, J.S., Bortoluzzi, A., Houghton, J., Sander, P., Guthlein, C., Davis, E.O., Springer, B., Bottger, E.C., Relini, A., et al. (2011). The biological and structural characterization of Mycobacterium tuberculosis UvrA provides novel insights into its mechanism of action. Nucleic Acids Res 39, 7316-7328. Russell, D.G. (2007). Who puts the tubercle in tuberculosis? Nature reviews Microbiology 5, 39-47. Ryffel, B., Fremond, C., Jacobs, M., Parida, S., Botha, T., Schnyder, B., and Quesniaux, V. (2005). Innate immunity to mycobacterial infection in mice: critical role for toll-like receptors. Tuberculosis 85, 395-405.
126 References
Sala, C., Forti, F., Di Florio, E., Canneva, F., Milano, A., Riccardi, G., and Ghisotti, D. (2003). Mycobacterium tuberculosis FurA autoregulates its own expression. Journal of bacteriology 185, 5357-5362. Sani, M., Houben, E.N., Geurtsen, J., Pierson, J., de Punder, K., van Zon, M., Wever, B., Piersma, S.R., Jimenez, C.R., Daffe, M., et al. (2010). Direct visualization by cryo-EM of the mycobacterial capsular layer: a labile structure containing ESX-1-secreted proteins. PLoS pathogens 6, e1000794. Sarkar, S., and Suresh, M.R. (2011). An overview of tuberculosis chemotherapy - a literature review. Journal of pharmacy & pharmaceutical sciences : a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutiques 14, 148-161. Sassetti, C.M., and Rubin, E.J. (2003). Genetic requirements for mycobacterial survival during infection. Proceedings of the National Academy of Sciences of the United States of America 100, 12989-12994. Schlesinger, L.S. (1993). Macrophage phagocytosis of virulent but not attenuated strains of Mycobacterium tuberculosis is mediated by mannose receptors in addition to complement receptors. Journal of immunology 150, 2920-2930. Schnappinger, D., Ehrt, S., Voskuil, M.I., Liu, Y., Mangan, J.A., Monahan, I.M., Dolganov, G., Efron, B., Butcher, P.D., Nathan, C., et al. (2003). Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment. The Journal of experimental medicine 198, 693-704. Schurch, A.C., Kremer, K., Warren, R.M., Hung, N.V., Zhao, Y., Wan, K., Boeree, M.J., Siezen, R.J., Smith, N.H., and van Soolingen, D. (2011). Mutations in the regulatory network underlie the recent clonal expansion of a dominant subclone of the Mycobacterium tuberculosis Beijing genotype. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 11, 587-597. Seeberg, E., Eide, L., and Bjoras, M. (1995). The base excision repair pathway. Trends Biochem Sci 20, 391-397. Senaratne, R.H., De Silva, A.D., Williams, S.J., Mougous, J.D., Reader, J.R., Zhang, T., Chan, S., Sidders, B., Lee, D.H., Chan, J., et al. (2006). 5'-Adenosinephosphosulphate reductase (CysH) protects Mycobacterium tuberculosis against free radicals during chronic infection phase in mice. Molecular microbiology 59, 1744-1753. Shibutani, S., Takeshita, M., and Grollman, A.P. (1991). Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature 349, 431-434. Shin, D.M., Yang, C.S., Lee, J.Y., Lee, S.J., Choi, H.H., Lee, H.M., Yuk, J.M., Harding, C.V., and Jo, E.K. (2008). Mycobacterium tuberculosis lipoprotein-induced association of TLR2 with protein kinase C zeta in lipid rafts contributes to reactive oxygen species-dependent inflammatory signalling in macrophages. Cellular microbiology 10, 1893-1905. Shin, D.M., Yuk, J.M., Lee, H.M., Lee, S.H., Son, J.W., Harding, C.V., Kim, J.M., Modlin, R.L., and Jo, E.K. (2010). Mycobacterial lipoprotein activates autophagy via TLR2/1/CD14 and a functional vitamin D receptor signalling. Cellular microbiology 12, 1648-1665. Shinnick, T.M., and Good, R.C. (1994). Mycobacterial taxonomy. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 13, 884-901. Shuman, S., and Glickman, M.S. (2007). Bacterial DNA repair by non-homologous end joining. Nature reviews Microbiology 5, 852-861. Singleton, M.R., Dillingham, M.S., Gaudier, M., Kowalczykowski, S.C., and Wigley, D.B. (2004). Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature 432, 187-193. Sinha, K.M., Stephanou, N.C., Gao, F., Glickman, M.S., and Shuman, S. (2007). Mycobacterial UvrD1 is a Ku-dependent DNA helicase that plays a role in multiple DNA repair events, including double-strand break repair. The Journal of biological chemistry 282, 15114-15125. Slupphaug, G., Kavli, B., and Krokan, H.E. (2003). The interacting pathways for prevention and repair of oxidative DNA damage. Mutation research 531, 231-251.
127 References
Sly, L.M., Lopez, M., Nauseef, W.M., and Reiner, N.E. (2001). 1alpha,25-Dihydroxyvitamin D3-induced monocyte antimycobacterial activity is regulated by phosphatidylinositol 3-kinase and mediated by the NADPH-dependent phagocyte oxidase. The Journal of biological chemistry 276, 35482-35493. Smith, N.H., Kremer, K., Inwald, J., Dale, J., Driscoll, J.R., Gordon, S.V., van Soolingen, D., Hewinson, R.G., and Smith, J.M. (2006). Ecotypes of the Mycobacterium tuberculosis complex. Journal of theoretical biology 239, 220-225. Sohaskey, C.D., and Wayne, L.G. (2003). Role of narK2X and narGHJI in hypoxic upregulation of nitrate reduction by Mycobacterium tuberculosis. Journal of bacteriology 185, 7247-7256. Springer, B., Master, S., Sander, P., Zahrt, T., McFalone, M., Song, J., Papavinasasundaram, K.G., Colston, M.J., Boettger, E., and Deretic, V. (2001). Silencing of oxidative stress response in Mycobacterium tuberculosis: expression patterns of ahpC in virulent and avirulent strains and effect of ahpC inactivation. Infection and immunity 69, 5967-5973. Sreevatsan, S., Pan, X., Stockbauer, K.E., Connell, N.D., Kreiswirth, B.N., Whittam, T.S., and Musser, J.M. (1997). Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proceedings of the National Academy of Sciences of the United States of America 94, 9869-9874. Stahl, D.A., and Urbance, J.W. (1990). The division between fast- and slow-growing species corresponds to natural relationships among the mycobacteria. Journal of bacteriology 172, 116-124. Stallings, C.L., Stephanou, N.C., Chu, L., Hochschild, A., Nickels, B.E., and Glickman, M.S. (2009). CarD is an essential regulator of rRNA transcription required for Mycobacterium tuberculosis persistence. Cell 138, 146-159. Stephenson, J.D., and Shepherd, V.L. (1987). Purification of the human alveolar macrophage mannose receptor. Biochemical and biophysical research communications 148, 883-889. Storz, G., and Imlay, J.A. (1999). Oxidative stress. Current opinion in microbiology 2, 188-194. Sturgill-Koszycki, S., Schlesinger, P.H., Chakraborty, P., Haddix, P.L., Collins, H.L., Fok, A.K., Allen, R.D., Gluck, S.L., Heuser, J., and Russell, D.G. (1994). Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science 263, 678-681. Sugawara, I., Yamada, H., Li, C., Mizuno, S., Takeuchi, O., and Akira, S. (2003). Mycobacterial infection in TLR2 and TLR6 knockout mice. Microbiology and immunology 47, 327-336. Sun, J., Wang, X., Lau, A., Liao, T.Y., Bucci, C., and Hmama, Z. (2010). Mycobacterial nucleoside diphosphate kinase blocks phagosome maturation in murine RAW 264.7 macrophages. PloS one 5, e8769. Supply, P., Mazars, E., Lesjean, S., Vincent, V., Gicquel, B., and Locht, C. (2000). Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome. Molecular microbiology 36, 762-771. Supply, P., Warren, R.M., Banuls, A.L., Lesjean, S., Van Der Spuy, G.D., Lewis, L.A., Tibayrenc, M., Van Helden, P.D., and Locht, C. (2003). Linkage disequilibrium between minisatellite loci supports clonal evolution of Mycobacterium tuberculosis in a high tuberculosis incidence area. Molecular microbiology 47, 529-538. Swaminathan, S., Padmapriyadarsini, C., and Narendran, G. (2010). HIV-associated tuberculosis: clinical update. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 50, 1377-1386. Taddei, F., Radman, M., Maynard-Smith, J., Toupance, B., Gouyon, P.H., and Godelle, B. (1997). Role of mutator alleles in adaptive evolution. Nature 387, 700-702. Tailleux, L., Pham-Thi, N., Bergeron-Lafaurie, A., Herrmann, J.L., Charles, P., Schwartz, O., Scheinmann, P., Lagrange, P.H., de Blic, J., Tazi, A., et al. (2005). DC-SIGN induction in alveolar macrophages defines privileged target host cells for mycobacteria in patients with tuberculosis. PLoS medicine 2, e381. Tailleux, L., Schwartz, O., Herrmann, J.L., Pivert, E., Jackson, M., Amara, A., Legres, L., Dreher, D., Nicod, L.P., Gluckman, J.C., et al. (2003). DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells. The Journal of experimental medicine 197, 121-127. Tailleux, L., Waddell, S.J., Pelizzola, M., Mortellaro, A., Withers, M., Tanne, A., Castagnoli, P.R., Gicquel, B., Stoker, N.G., Butcher, P.D., et al. (2008). Probing host pathogen cross-talk by transcriptional profiling
128 References
of both Mycobacterium tuberculosis and infected human dendritic cells and macrophages. PloS one 3, e1403. Tan, M.P., Sequeira, P., Lin, W.W., Phong, W.Y., Cliff, P., Ng, S.H., Lee, B.H., Camacho, L., Schnappinger, D., Ehrt, S., et al. (2010). Nitrate respiration protects hypoxic Mycobacterium tuberculosis against acid- and reactive nitrogen species stresses. PloS one 5, e13356. Tanne, A., Ma, B., Boudou, F., Tailleux, L., Botella, H., Badell, E., Levillain, F., Taylor, M.E., Drickamer, K., Nigou, J., et al. (2009). A murine DC-SIGN homologue contributes to early host defense against Mycobacterium tuberculosis. The Journal of experimental medicine 206, 2205-2220. Taverna, P., and Sedgwick, B. (1996). Generation of an endogenous DNA-methylating agent by nitrosation in Escherichia coli. Journal of bacteriology 178, 5105-5111. Tekaia, F., Gordon, S.V., Garnier, T., Brosch, R., Barrell, B.G., and Cole, S.T. (1999). Analysis of the proteome of Mycobacterium tuberculosis in silico. Tubercle and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 79, 329-342. Tenaillon, O., Toupance, B., Le Nagard, H., Taddei, F., and Godelle, B. (1999). Mutators, population size, adaptive landscape and the adaptation of asexual populations of bacteria. Genetics 152, 485-493. Theus, S., Eisenach, K., Fomukong, N., Silver, R.F., and Cave, M.D. (2007). Beijing family Mycobacterium tuberculosis strains differ in their intracellular growth in THP-1 macrophages. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 11, 1087-1093. Theus, S.A., Cave, M.D., and Eisenach, K.D. (2004). Activated THP-1 cells: an attractive model for the assessment of intracellular growth rates of Mycobacterium tuberculosis isolates. Infection and immunity 72, 1169-1173. Thoma-Uszynski, S., Stenger, S., Takeuchi, O., Ochoa, M.T., Engele, M., Sieling, P.A., Barnes, P.F., Rollinghoff, M., Bolcskei, P.L., Wagner, M., et al. (2001). Induction of direct antimicrobial activity through mammalian toll-like receptors. Science 291, 1544-1547. Thwaites, G., Caws, M., Chau, T.T., D'Sa, A., Lan, N.T., Huyen, M.N., Gagneux, S., Anh, P.T., Tho, D.Q., Torok, E., et al. (2008). Relationship between Mycobacterium tuberculosis genotype and the clinical phenotype of pulmonary and meningeal tuberculosis. Journal of clinical microbiology 46, 1363-1368. Tonjum, T., and Seeberg, E. (2001). Microbial fitness and genome dynamics. Trends in microbiology 9, 356-358. Torrelles, J.B., Azad, A.K., and Schlesinger, L.S. (2006). Fine discrimination in the recognition of individual species of phosphatidyl-myo-inositol mannosides from Mycobacterium tuberculosis by C-type lectin pattern recognition receptors. Journal of immunology 177, 1805-1816. Toungoussova, O.S., Caugant, D.A., Sandven, P., Mariandyshev, A.O., and Bjune, G. (2004). Impact of drug resistance on fitness of Mycobacterium tuberculosis strains of the W-Beijing genotype. FEMS immunology and medical microbiology 42, 281-290. Trunz, B.B., Fine, P., and Dye, C. (2006). Effect of BCG vaccination on childhood tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of cost-effectiveness. Lancet 367, 1173-1180. Tsenova, L., Ellison, E., Harbacheuski, R., Moreira, A.L., Kurepina, N., Reed, M.B., Mathema, B., Barry, C.E., 3rd, and Kaplan, G. (2005). Virulence of selected Mycobacterium tuberculosis clinical isolates in the rabbit model of meningitis is dependent on phenolic glycolipid produced by the bacilli. The Journal of infectious diseases 192, 98-106. Tsolaki, A.G., Gagneux, S., Pym, A.S., Goguet de la Salmoniere, Y.O., Kreiswirth, B.N., Van Soolingen, D., and Small, P.M. (2005). Genomic deletions classify the Beijing/W strains as a distinct genetic lineage of Mycobacterium tuberculosis. Journal of clinical microbiology 43, 3185-3191. Tuberculosis, E.C.A.o.N.G.G.M.a.T.f.t.E.a.C.o. (2006). Beijing/W genotype Mycobacterium tuberculosis and drug resistance. Emerging infectious diseases 12, 736-743. Tullius, M.V., Harmston, C.A., Owens, C.P., Chim, N., Morse, R.P., McMath, L.M., Iniguez, A., Kimmey, J.M., Sawaya, M.R., Whitelegge, J.P., et al. (2011). Discovery and characterization of a unique mycobacterial heme acquisition system. Proceedings of the National Academy of Sciences of the United States of America 108, 5051-5056.
129 References
Ulrichs, T., and Kaufmann, S.H. (2006). New insights into the function of granulomas in human tuberculosis. The Journal of pathology 208, 261-269. Underhill, D.M. (2007). Collaboration between the innate immune receptors dectin-1, TLRs, and Nods. Immunological reviews 219, 75-87. Valway, S.E., Sanchez, M.P., Shinnick, T.F., Orme, I., Agerton, T., Hoy, D., Jones, J.S., Westmoreland, H., and Onorato, I.M. (1998). An outbreak involving extensive transmission of a virulent strain of Mycobacterium tuberculosis. The New England journal of medicine 338, 633-639. van Embden, J.D., Cave, M.D., Crawford, J.T., Dale, J.W., Eisenach, K.D., Gicquel, B., Hermans, P., Martin, C., McAdam, R., Shinnick, T.M., et al. (1993). Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. Journal of clinical microbiology 31, 406-409. Van Soolingen, D. (2001). Molecular epidemiology of tuberculosis and other mycobacterial infections: main methodologies and achievements. Journal of internal medicine 249, 1-26. van Soolingen, D., Hoogenboezem, T., de Haas, P.E., Hermans, P.W., Koedam, M.A., Teppema, K.S., Brennan, P.J., Besra, G.S., Portaels, F., Top, J., et al. (1997). A novel pathogenic taxon of the Mycobacterium tuberculosis complex, Canetti: characterization of an exceptional isolate from Africa. International journal of systematic bacteriology 47, 1236-1245. van Soolingen, D., Qian, L., de Haas, P.E., Douglas, J.T., Traore, H., Portaels, F., Qing, H.Z., Enkhsaikan, D., Nymadawa, P., and van Embden, J.D. (1995). Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia. Journal of clinical microbiology 33, 3234-3238. Vandal, O.H., Pierini, L.M., Schnappinger, D., Nathan, C.F., and Ehrt, S. (2008). A membrane protein preserves intrabacterial pH in intraphagosomal Mycobacterium tuberculosis. Nature medicine 14, 849-854. Vandal, O.H., Roberts, J.A., Odaira, T., Schnappinger, D., Nathan, C.F., and Ehrt, S. (2009). Acid-susceptible mutants of Mycobacterium tuberculosis share hypersusceptibility to cell wall and oxidative stress and to the host environment. Journal of bacteriology 191, 625-631. Vannberg, F.O., Chapman, S.J., Khor, C.C., Tosh, K., Floyd, S., Jackson-Sillah, D., Crampin, A., Sichali, L., Bah, B., Gustafson, P., et al. (2008). CD209 genetic polymorphism and tuberculosis disease. PloS one 3, e1388. Velayati, A.A., Masjedi, M.R., Farnia, P., Tabarsi, P., Ghanavi, J., Ziazarifi, A.H., and Hoffner, S.E. (2009). Emergence of new forms of totally drug-resistant tuberculosis bacilli: super extensively drug-resistant tuberculosis or totally drug-resistant strains in iran. Chest 136, 420-425. Velez, D.R., Wejse, C., Stryjewski, M.E., Abbate, E., Hulme, W.F., Myers, J.L., Estevan, R., Patillo, S.G., Olesen, R., Tacconelli, A., et al. (2010). Variants in toll-like receptors 2 and 9 influence susceptibility to pulmonary tuberculosis in Caucasians, African-Americans, and West Africans. Human genetics 127, 65-73. Venkatesh, R., Ganesh, N., Guhan, N., Reddy, M.S., Chandrasekhar, T., and Muniyappa, K. (2002). RecX protein abrogates ATP hydrolysis and strand exchange promoted by RecA: insights into negative regulation of homologous recombination. Proceedings of the National Academy of Sciences of the United States of America 99, 12091-12096. Ventura, M., Canchaya, C., Tauch, A., Chandra, G., Fitzgerald, G.F., Chater, K.F., and van Sinderen, D. (2007). Genomics of Actinobacteria: tracing the evolutionary history of an ancient phylum. Microbiology and molecular biology reviews : MMBR 71, 495-548. Vergne, I., Chua, J., and Deretic, V. (2003). Tuberculosis toxin blocking phagosome maturation inhibits a novel Ca2+/calmodulin-PI3K hVPS34 cascade. The Journal of experimental medicine 198, 653-659. Vergne, I., Chua, J., Lee, H.H., Lucas, M., Belisle, J., and Deretic, V. (2005). Mechanism of phagolysosome biogenesis block by viable Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 102, 4033-4038. Vilcheze, C., Av-Gay, Y., Attarian, R., Liu, Z., Hazbon, M.H., Colangeli, R., Chen, B., Liu, W., Alland, D., Sacchettini, J.C., et al. (2008). Mycothiol biosynthesis is essential for ethionamide susceptibility in Mycobacterium tuberculosis. Molecular microbiology 69, 1316-1329.
130 References
Vollmer, W., Joris, B., Charlier, P., and Foster, S. (2008). Bacterial peptidoglycan (murein) hydrolases. FEMS microbiology reviews 32, 259-286. Voskuil, M.I., Bartek, I.L., Visconti, K., and Schoolnik, G.K. (2011). The response of mycobacterium tuberculosis to reactive oxygen and nitrogen species. Frontiers in microbiology 2, 105. Voskuil, M.I., Schnappinger, D., Rutherford, R., Liu, Y., and Schoolnik, G.K. (2004). Regulation of the Mycobacterium tuberculosis PE/PPE genes. Tuberculosis 84, 256-262. Voskuil, M.I., Schnappinger, D., Visconti, K.C., Harrell, M.I., Dolganov, G.M., Sherman, D.R., and Schoolnik, G.K. (2003). Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. The Journal of experimental medicine 198, 705-713. Walburger, A., Koul, A., Ferrari, G., Nguyen, L., Prescianotto-Baschong, C., Huygen, K., Klebl, B., Thompson, C., Bacher, G., and Pieters, J. (2004). Protein kinase G from pathogenic mycobacteria promotes survival within macrophages. Science 304, 1800-1804. Walker, L., and Lowrie, D.B. (1981). Killing of Mycobacterium microti by immunologically activated macrophages. Nature 293, 69-71. Walters, S.B., Dubnau, E., Kolesnikova, I., Laval, F., Daffe, M., and Smith, I. (2006). The Mycobacterium tuberculosis PhoPR two-component system regulates genes essential for virulence and complex lipid biosynthesis. Molecular microbiology 60, 312-330. Wang, C., Peyron, P., Mestre, O., Kaplan, G., van Soolingen, D., Gao, Q., Gicquel, B., and Neyrolles, O. (2010). Innate immune response to Mycobacterium tuberculosis Beijing and other genotypes. PloS one 5, e13594. Wang, C.H., Liu, C.Y., Lin, H.C., Yu, C.T., Chung, K.F., and Kuo, H.P. (1998). Increased exhaled nitric oxide in active pulmonary tuberculosis due to inducible NO synthase upregulation in alveolar macrophages. The European respiratory journal : official journal of the European Society for Clinical Respiratory Physiology 11, 809-815. Wanner, R.M., Guthlein, C., Springer, B., Bottger, E.C., and Ackermann, M. (2008). Stabilization of the genome of the mismatch repair deficient Mycobacterium tuberculosis by context-dependent codon choice. BMC genomics 9, 249. Wells, C.D., Cegielski, J.P., Nelson, L.J., Laserson, K.F., Holtz, T.H., Finlay, A., Castro, K.G., and Weyer, K. (2007). HIV infection and multidrug-resistant tuberculosis: the perfect storm. The Journal of infectious diseases 196 Suppl 1, S86-107. Werle, E., Schneider, C., Renner, M., Volker, M., and Fiehn, W. (1994). Convenient single-step, one tube purification of PCR products for direct sequencing. Nucleic Acids Res 22, 4354-4355. Werngren, J., and Hoffner, S.E. (2003). Drug-susceptible Mycobacterium tuberculosis Beijing genotype does not develop mutation-conferred resistance to rifampin at an elevated rate. Journal of clinical microbiology 41, 1520-1524. Whalen, C., Horsburgh, C.R., Hom, D., Lahart, C., Simberkoff, M., and Ellner, J. (1995). Accelerated course of human immunodeficiency virus infection after tuberculosis. American journal of respiratory and critical care medicine 151, 129-135. WHO (2011). Global tuberculosis control report Williams, M.J., Kana, B.D., and Mizrahi, V. (2011). Functional analysis of molybdopterin biosynthesis in mycobacteria identifies a fused molybdopterin synthase in Mycobacterium tuberculosis. Journal of bacteriology 193, 98-106. Witkin, E.M., and Roegner-Maniscalco, V. (1992). Overproduction of DnaE protein (alpha subunit of DNA polymerase III) restores viability in a conditionally inviable Escherichia coli strain deficient in DNA polymerase I. Journal of bacteriology 174, 4166-4168. Wu, C.H., Tsai-Wu, J.J., Huang, Y.T., Lin, C.Y., Lioua, G.G., and Lee, F.J. (1998). Identification and subcellular localization of a novel Cu,Zn superoxide dismutase of Mycobacterium tuberculosis. FEBS letters 439, 192-196. Wu, K., Dong, D., Fang, H., Levillain, F., Jin, W., Mei, J., Gicquel, B., Du, Y., Wang, K., Gao, Q., et al. (2012). An interferon-related signature in the transcriptional core response of human macrophages to Mycobacterium tuberculosis infection. PloS one 7, e38367.
131 References
Yang, C.S., Shin, D.M., Kim, K.H., Lee, Z.W., Lee, C.H., Park, S.G., Bae, Y.S., and Jo, E.K. (2009). NADPH oxidase 2 interaction with TLR2 is required for efficient innate immune responses to mycobacteria via cathelicidin expression. Journal of immunology 182, 3696-3705. Yang, C.S., Shin, D.M., Lee, H.M., Son, J.W., Lee, S.J., Akira, S., Gougerot-Pocidalo, M.A., El-Benna, J., Ichijo, H., and Jo, E.K. (2008). ASK1-p38 MAPK-p47phox activation is essential for inflammatory responses during tuberculosis via TLR2-ROS signalling. Cellular microbiology 10, 741-754. Yuk, J.M., Shin, D.M., Lee, H.M., Yang, C.S., Jin, H.S., Kim, K.K., Lee, Z.W., Lee, S.H., Kim, J.M., and Jo, E.K. (2009). Vitamin D3 induces autophagy in human monocytes/macrophages via cathelicidin. Cell host & microbe 6, 231-243. Zahrt, T.C., and Deretic, V. (2002). Reactive nitrogen and oxygen intermediates and bacterial defenses: unusual adaptations in Mycobacterium tuberculosis. Antioxidants & redox signaling 4, 141-159. Zhang, Y., Lathigra, R., Garbe, T., Catty, D., and Young, D. (1991). Genetic analysis of superoxide dismutase, the 23 kilodalton antigen of Mycobacterium tuberculosis. Molecular microbiology 5, 381-391. Zhang, Y., and Yew, W.W. (2009). Mechanisms of drug resistance in Mycobacterium tuberculosis. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 13, 1320-1330. Zhang, Z., Hillas, P.J., and Ortiz de Montellano, P.R. (1999). Reduction of peroxides and dinitrobenzenes by Mycobacterium tuberculosis thioredoxin and thioredoxin reductase. Archives of biochemistry and biophysics 363, 19-26. Zuber, B., Chami, M., Houssin, C., Dubochet, J., Griffiths, G., and Daffe, M. (2008). Direct visualization of the outer membrane of mycobacteria and corynebacteria in their native state. Journal of bacteriology 190, 5672-5680. Zumla, A., Abubakar, I., Raviglione, M., Hoelscher, M., Ditiu, L., McHugh, T.D., Squire, S.B., Cox, H., Ford, N., McNerney, R., et al. (2012). Drug-resistant tuberculosis--current dilemmas, unanswered questions, challenges, and priority needs. The Journal of infectious diseases 205 Suppl 2, S228-240.
Annex
134 Annex
Table A1. Description of M. tuberculosis Beijing/W strains belonging to each node found in Figure 1 and
2, and respective country of isolation.
Node Strain Origin of isolation Node Strain Origin of isolation
Bmyc1 NL25 USA Bmyc10 BE5 Singapore
ZA40 South Africa BE8 USA
Bmyc2 NL20 The Netherlands BE10 USA
CN1 China BE12 USA
CN2 China BE14 USA
CN3 China BE17 USA
CN4 China BE19 USA
CN5 China BE20 USA
CN6 China BE23 USA
CN7 China BE27 USA
CN8 China MG3 Madagascar
CN9 China MG10 Madagascar
ZA13 South Africa MG11 Madagascar
ZA42 South Africa MG21 Madagascar
ZA43 South Africa CN60 China
ZA51 South Africa CN61 China
Bmyc3 NL34 USA CN62 China
Bmyc4 NL17 USA CN63 China
BE26 USA CN64 China
CN10 China CN65 China
CN11 China CN66 China
CN12 China CN67 China
CN13 China CN68 China
CN14 China CN69 China
CN15 China CN70 China
CN16 China CN71 China
CN17 China CN72 China
CN18 China CN73 China
ZA45 South Africa CN74 China
ZA52 South Africa CN75 China
Bmyc5 NL33 USA CN76 China
Bmyc6 NL19 South Korea CN77 China
CN20 China CN78 China
CN21 China CN79 China
CN22 China CN80 China
CN23 China CN81 China
CN24 China CN82 China
CN25 China CN83 China
Bmyc7 BE3 South Korea CN84 China
Bmyc8 NL21 The Netherlands CN85 China
Bmyc9 MG9 Madagascar CN86 China
Bmyc10 NL1 Mongolia CN87 China
NL2 South Africa CN88 China
NL3 Malaysia CN89 China
NL7 Thailand CN90 China
NL18 The Netherlands CN91 China
NL23 The Netherlands CN92 China
NL24 The Netherlands CN93 China
NL31 The Netherlands CN94 China
BE1 USA CN95 China
135 Annex
Node Strain Origin of isolation Node Strain Origin of isolation
Bmyc10 CN96 China Bmyc10 CN150 China
CN97 China CN151 China
CN98 China CN153 China
CN99 China CN154 China
CN100 China CN155 China
CN101 China CN156 China
CN102 China CN157 China
CN103 China CN158 China
CN104 China CN159 China
CN105 China CN160 China
CN106 China CN161 China
CN107 China CN162 China
CN108 China CN163 China
CN109 China CN164 China
CN110 China CN165 China
CN111 China CN166 China
CN112 China CN167 China
CN113 China CN168 China
CN114 China CN169 China
CN115 China CN170 China
CN116 China CN171 China
CN117 China CN172 China
CN118 China CN173 China
CN119 China CN174 China
CN120 China CN175 China
CN121 China CN176 China
CN122 China CN177 China
CN123 China CN178 China
CN124 China CN179 China
CN125 China CN180 China
CN126 China CN181 China
CN127 China CN182 China
CN128 China ZA1 South Africa
CN129 China ZA2 South Africa
CN130 China ZA3 South Africa
CN131 China ZA4 South Africa
CN132 China ZA5 South Africa
CN133 China ZA6 South Africa
CN134 China ZA7 South Africa
CN135 China ZA8 South Africa
CN136 China ZA10 South Africa
CN137 China ZA11 South Africa
CN138 China ZA12 South Africa
CN139 China ZA15 South Africa
CN140 China ZA16 South Africa
CN141 China ZA17 South Africa
CN142 China ZA18 South Africa
CN143 China ZA20 South Africa
CN144 China ZA21 South Africa
CN145 China ZA22 South Africa
CN146 China ZA23 South Africa
CN147 China ZA24 South Africa
CN148 China ZA25 South Africa
CN149 China ZA26 South Africa
136 Annex
Node Strain Origin of isolation Node Strain Origin of isolation
Bmyc10 ZA28 South Africa Bmyc25 GC1237 Spain
ZA29 South Africa ZA9 South Africa
ZA31 South Africa ZA14 South Africa
ZA32 South Africa ZA19 South Africa
ZA33 South Africa ZA35 South Africa
ZA34 South Africa CN26 China
ZA36 South Africa CN27 China
ZA38 South Africa CN28 China
ZA41 South Africa CN29 China
ZA44 South Africa CN30 China
ZA46 South Africa CN31 China
ZA47 South Africa CN32 China
ZA48 South Africa CN33 China
ZA49 South Africa CN34 China
ZA50 South Africa CN35 China
ZA53 South Africa CN36 China
ZA54 South Africa CN37 China
ZA55 South Africa CN38 China
ZA56 South Africa CN39 China
ZA57 South Africa CN40 China
Bmyc11 NL4 China CN41 China
Bmyc12 NL28 South Africa CN42 China
BE6 Russia CN43 China
BE9 China CN44 China
Bmyc13 MG8 Madagascar CN45 China
MG12 Madagascar CN46 China
CN183 China CN47 China
CN184 China CN48 China
CN185 China Bmyc26 CN49 China
CN186 China CN50 China
CN187 China CN51 China
CN188 China CN52 China
CN189 China CN53 China
CN190 China CN54 China
CN191 China CN55 China
CN192 China CN56 China
Bmyc14 MG7 Madagascar CN57 China
Bmyc15 NL6 Malaysia CN58 China
Bmyc16 MG13 Madagascar CN59 China
MG14 Madagascar ZA30 South Africa
MG15 Madagascar ZA58 South Africa
MG16 Madagascar
MG17 Madagascar
MG19 Madagascar
MG20 Madagascar
Bmyc17 MG6 Madagascar
Bmyc18 BE21 USA
Bmyc19 MG4 Madagascar
MG5 Madagascar
Bmyc20 BE13 USA
Bmyc21 BE16 USA
Bmyc22 NL5 Thailand
Bmyc23 BE15 Philippines