microarray and qpcr SF - Agilent and... · PDF fileMicroarray and QPCR applications ......

Click here to load reader

  • date post

    15-Dec-2018
  • Category

    Documents

  • view

    219
  • download

    0

Embed Size (px)

Transcript of microarray and qpcr SF - Agilent and... · PDF fileMicroarray and QPCR applications ......

Microarray and QPCR applications Microarray and QPCR applications for for miRNAsmiRNAs

Cathy CutlerField Application Scientist

Stratagene Products Division

Our measure is your success.

l2

Our measure is your success.

Introduction to miRNAWhat are microRNAs

Non-coding small RNAs (19-30 nt)3 different forms:

Pri- and pre-miRNA: hairpin shapedmature miRNA: bound to RISC

complexAct in repression of translation or

direct mRNA degradationImplicated heavily in disease (eg.

cancer), development, apoptosis,proliferation and differentiation

Involved in viral infectionsMore than 700 human miRNAs

identified (Sanger miRBase 10.0)Implicated in regulation of up to

30% of all human genesProjected $100M to be awarded by the NIH for miRNA-related research in 2008*

Cancer Genomics: Small RNAs with big impactsfrom Nature 435: 745-746 (9 June 2005)*Source: NIH CRISP database at http://crisp.cit.nih.gov/

l3

Our measure is your success.

Introduction to miRNAWhy Are miRNAs Important?

Predicted to regulate expression of 30% of human genesAct as key regulators of many cellular processes, such as:

Early developmentCell proliferation and apoptosisFat metabolismCell differentiation

Involved in viral infection processesDifferentially expressed miRNAs are reported in many human cancers> 50% of miRNA genes are located within regions associated with amplification, deletion, and translocation in cancer (Calin, G.A. et al PNAS 2004 101:2999-3004)

l4

Our measure is your success.

Introduction to miRNABiogenesis in mammals

Expression may be regulated bytranscription factors

monocistronic and polycistronic (40%)miRNA genes expressed by pol IIpromoter

Intronic miRNA genes (~50%) regulatedwith mRNA that flanks miRNA

miRNA transcripts can contain more thanone miRNA

l5

Our measure is your success.

Introduction to miRNAMode of Action Repression of Translation

miRNA

miRNA bound by RISC complex

RISC bound miRNA binds targetmRNA

Bound miRNA-RISC blockstranslation of mRNA by ribosome

l6

Our measure is your success.

Introduction to miRNAMode of Action RNA Degradation

Rossi, J J 2005 Nature Cell Biol 7(7):643-644

P-bodycontains RNA that can no longer be translated and enzymes that are required forRNA decay and degradation

mRNA degradation allows fordetecting effects of miRNA using microarrays

l7

Our measure is your success.

Interaction of miRNA with mRNAFamily Grouping by Seed Region

UGAGGUAGUAGUUUGUACAGUhsa-let-7g

UGAGGUAGUAAGUUGUAUUGUUhsa-miR-98

UGAGGUAGUAGGUUGUAUGGUUhsa-let-7c

AGAGGUAGUAGGUUGCAUAGUhsa-let-7d

UGAGGUAGGAGGUUGUAUAGUhsa-let-7e

UGAGGUAGUAGAUUGUAUAGUUhsa-let-7f

UGAGGUAGUAGUUUGUGCUGUhsa-let-7i

UGAGGUAGUAGGUUGUGUGGUUhsa-let-7b

UGAGGUAGUAGGUUGUAUAGUUhsa-let-7a

nucleotide sequence (5-3)miRNA

AAAAAAA 3

Perfect homology, 5

6-8nt of miRNA (seed)

3 55

miRNA

Target mRNA

seed

one miRNA may regulatehundreds of genes

a gene may be regulated by more

than one miRNA

l8

Our measure is your success.

Introduction to miRNAmiRNAmiRNA RegistryRegistry

http://www.sanger.ac.ukSearchable database of all published miRNA sequences and annotationMouse and human are highly conservedHuman is not conserved with plantsData can be downloaded from ftp site:

ftp://ftpsanger.ac.uk/pub/mirbase

l9

Our measure is your success.

miRNA qRT-PCR Methods and Microarray Methods

QRT-PCR miRNA detection methods are more specific than microarray methods.

Microarray methods tend to show higher cross-hybridization which can lead to false positives. Data should be confirmed by QRT-PCR

Microarray methods are ideal for profiling a small number of samples for many miRNAs

QRT-PCR methods are ideal for:Profiling a large number of samples against a small number of miRNAsProfiling a moderate number of samples against a moderate number of

miRNAs

l10

Our measure is your success.

Choose from a comprehensive set of microarray applications

DNA RNA

Splice VariantsChIP

Elucidate the role that protein-DNA interactions play in transcription, replication, modification and repair

Perform global interrogations of the transcriptome and identify alternative splice forms

GX

Explore gene transcription on a genome-wide basis

mRNA

From one-dimensional

with multiple applications

aCGH

Conduct high-resolution, genome-wide profiling of DNA copy number changes

Copy number

CH3

Discover and monitor epigenetic modifications

Methylation Transcription Factors

mRNA isoforms

miRNA

Study microRNAs and the role they play in gene regulation

miRNA Profiling

to multi-dimensional

l11

Our measure is your success.

Microarray work flow

l12

Our measure is your success.

QC ReportGridShapeTextJPEGMAGE-MLGEML

16-bit Tiff Image(uncompressed)

Feature Extraction Software

GeneSpring

Import

FTP Export

Feature ExtractionResult Files

Grid TemplateGrid File

FE Protocol

Grid and Measure SpotsReject Outlier PixelsSubtract BackgroundCorrect Dye Biases

Data Workflow

Agilent and non-Agilent microarrays scanned on Agilent Scanner

Agilent microarrays scanned on GenePix Scanner

Chip analytics

CGH analytics

l13

Our measure is your success.

QC Metrics

DNA Analytics QC metrics

Feature Extraction QC metrics

l14

Our measure is your success.

Features should be far enough apart to prevent light leakage. Features should be big enough for perfect registration of each layer (no blurry edges), for individual feature statistics and higher confidenceAn ability to increase density while maintaining large enough features without compromising statistical significance

Data quality: feature sizes and density

l15

Our measure is your success.

Image Value in Data qualityImage Value in Data quality

Other array image Agilent 224K image

Agilent scanner at 5 micron resolution

l16

Our measure is your success.

Agilents Microarray Platform

Reliable inkjet printing of phosphoamidite bases

Sensitivity: The chemistry reliability allows synthesis of long oligos that are highly sensitive and specific

Flexibility of microarrays, array is defined by electronic file.

Ease of implementation

Probe Design: Narrow TM, Unique Probes, Self Structure, and GC content, All probes are empirically tested.

Probe Fidelity can synthesize up to 200mer

l17

Our measure is your success.

Santa Clara Manufacturing Facility

IndustrialmanufacturingClass10,000cleanroom

WireddirectlyintoeArray,allowingdirectcustomeraccesstofullycustomizableproducts

Highperformanceinkjetprintingenableslongoligomanufacturing

Manufacturing Process Development Bioinformatics

l18

Our measure is your success.

Small size difficult to label with high efficiency

High sequence homology difficult to design probes with high specificity

Presence of larger RNAs with highly homologous sequences

Expressed with large dynamic range difficult to avoid compression

Growing & changing database

Challenges in miRNA Profiling

Sanger miRBase 12.0

miRNA Sequence #NThsa-let-7a ugagguaguagguuguauaguu 22hsa-let-7b ugagguaguagguugugugguu 22hsa-let-7c ugagguaguagguuguaugguu 22hsa-let-7d agagguaguagguugcauaguu 22hsa-let-7e ugagguaggagguuguauaguu 22hsa-let-7f ugagguaguagauuguauaguu 22hsa-let-7g ugagguaguaguuuguacaguu 22hsa-let-7i ugagguaguaguuugugcuguu 22

l19

Our measure is your success.

miRNA Arrays:

Human miRNA Microarray, v2.0:

799 distinct probe sets (723 human and 76 human viral)

Human miRNA Microarray, v1.0:

450 human distinct probe sets

l20

Our measure is your success.

DirectandSensitivemiRNAProfiling

Back to Applications

PlatformHui Wang, PhD Senior Scientist

Agilent Technologies

l21

Our measure is your success.

miRNA Probe Design Strategy2. Utilize the Cincorporated during labeling for additional G-C base pair on 3end of miRNA to increase stability

3. Sequentially shorten target-probe base pairing from 5end of miRNA during preliminary Tm balancing by calculation.

4. Incorporate hairpin structure on probes to increase size specificity and probe:target stability.

FINAL STEP: Select Tm-balanced probes for each miRNA empirically using microarray data.

1. Start design with full-length miRNA-probe sequence, attached to a stilt sequence.

l22

Our measure is your success.

Work Flow Work Flow

Total RNA(100 ng)

Direct Label with Cy-dye

Hybridize

miRNA Profile

Labeled RNA

8-pack

100ng sample inputDirect probe labeling

High specificity & sensitivity

l23

Our measure is your success.

Specificity to Distinguish Homologous Specificity to Distinguish Homologous miRNAsmiRNAsmiRNAs

hsa-let-7ahsa-let-7bhsa-let-7chsa-let-7dhsa-let-7ehsa-let-7fhsa-let-7ghsa-let-7i

UGAGGUAGUAGGUUGUAUAG