Menin Promotes the Wnt Signaling Pathway in Pancreatic ...Wnt signaling and h-catenin are important...

Menin Promotes the Wnt Signaling Pathway in PancreaticEndocrine Cells

Gao Chen, Jingbo A, Min Wang, Steven Farley, Lung-Yi Lee, Lung-Ching Lee,and Mark P. Sawicki

David Geffen School of Medicine at University of California at Los Angeles and the GreaterLos Angeles VA Medical Center, Los Angeles, California

AbstractMenin is a tumor suppressor protein mutated in

patients with multiple endocrine neoplasia type 1. We

show that menin is essential for canonical Wnt/B-

catenin signaling in cultured rodent islet tumor cells.

In these cells, overexpression of menin significantly

enhances TCF gene assay reporter activity in response

to B-catenin activation. Contrastingly, inhibition of

menin expression with Men1 siRNA decreases TCF

reporter gene activity. Likewise, multiple endocrine

neoplasia type 1 disease associated missense

mutations of menin abrogate the ability to increase TCF

reporter gene activity. We show that menin physically

interacts with proteins involved in the canonical Wnt

signaling pathway, including B-catenin, TCF3 (TCFL1),

and weakly with TCF4 (TCFL2). Menin overexpression

increases expression of the Wnt/B-catenin downstream

target gene Axin2, which is associated with increased

H3K4 trimethylation of the Axin2 gene promoter.

Moreover, inhibition of menin expression by siRNA

abrogates H3K4 trimethylation and Axin2 gene

expression. Based on these studies, we hypothesized

that Wnt signaling could inhibit islet cell proliferation

because loss of menin function is thought to increase

endocrine tumor cell proliferation. TGP61 rodent

islet tumor cells treated with a glycogen synthase

kinase 3B inhibitor that increases Wnt pathway

signaling had decreased cell proliferation compared

with vehicle-treated cells. Collectively, these

data suggest that menin has an essential role in

Wnt/B-catenin signaling through a mechanism that

eventually affects histone trimethylation of the

downstream target gene Axin2, and activation of

Wnt/B-catenin signaling inhibits islet tumor cell

proliferation. (Mol Cancer Res 2008;6(12):1894–907)

IntroductionMultiple endocrine neoplasia type 1 (MEN1) is an

autosomal dominant disease characterized by the development

of parathyroid hyperplasia, pancreatic islet cell tumors, and

anterior pituitary endocrine tumors (1). Besides these classic

tumors, several other endocrine and nonendocrine tumors may

develop, including lipomas, dermatofibromas, collagenomas,

ependymomas, meningiomas, schwannomas, carcinoids, adre-

nal cortical tumors, and thyroid tumors. The MEN1 gene is

highly conserved and encodes for a 67-kDa nuclear protein,

called menin, which has been implicated in DNA metabolism

and transcription regulation (2). MEN1 patients have trunca-

tion mutations and missense mutations that are predicted to

inactivate menin function consistent with a tumor suppressor

protein (3). Homozygous knockout mice (Men1�/�) die

in utero (E11.5-13.5) with multiple developmental defects,

suggesting that menin that has an essential role in early

development (4). Similar to MEN1 patients, heterozygous

knockout mice (Men1�/+) develop normally, but the adult mice

eventually grow endocrine tumors (5).

To determine how the loss of menin promotes endocrine

tumor development, most investigations have focused on the

role of menin in transcription regulation. Menin interacts with

several transcription factors including members of the activator

protein-1 (JunD), transforming growth factor-h/bone morpho-

genetic protein (RUNX2, SMAD1, SMAD3, and SMAD5), and

nuclear factor-nB (p65, p50, and p52) signal transduction

pathways (6-11). More recently, menin was identified in MLL

and MLL2 histone methyltransferase complexes and found

essential for the histone methyltransferase activity (12-16).

Pancreas development, in particular islets, is mediated by

expression of a specific program of growth factors including the

Wnt proteins (17-24). In general, Wnt proteins regulate

development through actions on cell proliferation, differentia-

tion, cell fate decisions, apoptosis, axial polarity, axonal

guidance, and adhesion (25). In the canonical Wnt pathway,

the extracellular Wnt ligand (20 different genes in mammalian

cells) binds the cell surface receptor frizzled (10 FZD genes in

mammalian cells) and the coreceptor LRP5/6 (low density

lipoprotein receptor–related proteins 5 and 6). This initiates a

cascade of intracellular mediators that results in h-catenin

stabilization and subsequent h-catenin nuclear localization to

regulate target gene transcription (26). In the absence of Wnt

ligand, h-catenin is phosphorylated in a cytoplasmic complex

with casein kinase 1, glycogen synthase kinase 3h (GSK3h),

axin 1, and the tumor suppressor adenomatous polyposis coli.

Phosphorylated h-catenin is ubiquitylated and targeted for

degradation by the proteasome. Wnt binds the Fzd receptor and

Received 12/14/07; revised 8/4/08; accepted 8/25/08.Grant support: NIH grant R01CA095148 and VA Merit grants (M.P. Sawicki).The costs of publication of this article were defrayed in part by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).Requests for reprints: Mark P. Sawicki, David Geffen School of Medicine, CHS72-215, Los Angeles, CA 90095-6904. Phone: 310-268-3298; Fax: 310-268-3026. E-mail: [email protected] D 2008 American Association for Cancer Research.doi:10.1158/1541-7786.MCR-07-2206

Mol Cancer Res 2008;6(12). December 20081894on June 2, 2020. © 2008 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

http://mcr.aacrjournals.org/

stops phosphorylation of h-catenin. The hypophosphorylated

h-catenin translocates to the nucleus where it associates with

the T-cell – specific transcription factor/lymphoid enhancer

binding factor 1 (TCF/LEF) family transcription factors and

regulates Wnt responsive genes expression.

Components of the Wnt pathway regulate pancreas deve-

lopment, although the mechanism is not fully understood.

Numerous members of the Wnt pathway are expressed during

the development of the mouse pancreas and in the adult organ

(27). In particular, activated (dephosphorylated) h-catenin and

the parahox protein Pdx-1, which signals pancreas lineage

development, are both expressed in the pancreas epithelium

during development (20). Pdx-1 promoter directing Wnt

misexpression in a transgenic mouse model results in pancreas

agenesis (28). A h-catenin conditional knockout mouse,

however, loses normal pancreatic acinar tissue development,

but islet development is preserved (22). Whereas it is clear that

Wnt signaling and h-catenin are important for pancreas

development, its role in pancreatic endocrine tumor develop-

ment is unknown.

Based on the role of menin in multiple cell signaling

pathways and the broad role of Wnt signaling in tumor

development, we hypothesized that menin may be important for

Wnt/h-catenin signaling in endocrine tumors. In this report, we

investigate the role of menin in Wnt/h-catenin signaling in a

mouse islet cell line. These data suggest menin is important for

regulation of Wnt signaling in the endocrine pancreas through a

mechanism that involves histone H3K4 trimethylation.

ResultsExpression of Endogenous b-Catenin, TCF3, and TCF4 inEndocrine and Nonendocrine Cell Lines and the Effect ofMenin Overexpression

Canonical Wnt pathway protein expression in endocrine

tumor cell lines has not been previously reported. Therefore, we

first determined the expression of activated (dephosphorylated)

h-catenin in selected islet tumor endocrine (TGP-61 and

InR1G9) and nonendocrine cell lines (HEK 293T). Endogenous

h-catenin protein was expressed in all three cell lines (Fig. 1A).

The amount of activated h-catenin protein expression, however,

was variable, with highest expression in the mouse islet tumor

cell line TGP-61 (29), slightly less in human embryonic kidney

cells HEK 293T (30), and barely detectable in the hamster islet

cell line InR1G9 (31). We then examined the expression of two

of the TCF/LEF family members. TCF3 (also called TCF7L1)

and TCF4 (also called TCF7L2) were both highly expressed in

TGP-61 cells, but TCF4 was predominantly expressed in both

HEK 293T and InR1G9 cells. Whereas the expression patterns

of TCF4 and TCF3 differ in these cell lines, these proteins are

functionally similar (25). Overexpression of menin did not

affect the expression of TCF4, TCF3, or activated (dephos-

phorylated) h-catenin in any of the cell lines studied. In cells

expressing fluorescent epitope–tagged h-catenin, TCF3, and

TCF4, menin overexpression did not affect the nuclear

localization of these proteins (Fig. 1B). These data suggest

that proteins important for canonical Wnt signaling are

expressed in these cell lines, in particular the mouse islet

tumor cell line TGP-61, and their expression is not altered by

exogenous menin. Specifically, the amount of activated

(dephosphorylated) h-catenin is not altered by menin over-

expression.

Menin Is Essential for b-Catenin Activation of a TCFResponsive Reporter

To determine whether menin is involved with Wnt/h-catenin

signaling, we studied mouse TGP-61 islet tumor cells trans-

fected with a TCF responsive luciferase reporter vector

(Super8XTOPflash, M50) containing eight TCF/LEF binding

sites or a control vector (Super8XFOPflash, M51) that has

mutant TCF/LEF binding sites (32). As expected, over-

expression of either wild-type h-catenin or the constitutively

activated phosphorylation mutant h-catenin (S37A; ref. 33)

increased TCF reporter gene assay activity (Fig. 2A). Menin

alone did not activate the reporter gene, but cotransfection of

menin and either h-catenin or activated h-catenin (S37A)

strongly stimulated the reporter gene activity severalfold above

that seen with either h-catenin or h-catenin (S37A) alone. One

possible explanation for the increased reporter activity with

menin overexpression could be altered h-catenin expression,

but Western blot analysis shows similar expression of h-catenin

when menin is co-overexpressed with h-catenin or h-catenin

(S37A; Fig. 2A, right). To determine whether menin was

affecting the reporter promoter through a mechanism not

involving the TCF response elements, similar experiments were

done comparing the response of the control reporter gene,

Super8XFOPflash (plasmid M51 labeled ‘‘F’’ in Fig. 2B),

which has mutant TCF binding sites, with the response from the

nonmutated reporter Super8XTOPflash (plasmid M50 labeled

‘‘T’’ in Fig. 2B). Menin and h-catenin did not activate the

negative control reporter gene Super8XFOPflash that has

mutant TCF binding sites (Fig. 2B). Expression of the

overexpressed proteins is shown in Fig. 2B (right), indicating

that the transfections of multiple plasmids did not significantly

interfere with each other. We then wondered whether Wnt/h-

catenin signaling was dependent on menin function. We tested

this hypothesis by decreasing menin expression with transfec-

tion of mouse specific menin-optimized siRNA (TGP61 is a

mouse derived cell line). Several different menin siRNAs were

tested (see Materials and Methods) with the most effective

siRNA chosen for subsequent experiments. Decreased menin

expression significantly inhibited reporter gene activity in

response to transfected h-catenin (label ‘‘M’’ in Fig. 2C)

compared with control siRNA (label ‘‘C’’ in Fig. 2C). Western

blot analysis confirmed that menin protein expression was

reduced by the siRNA transfection (Fig. 2C, right). Similar

studies in human embryonic kidney (HEK 293T) cells showed

that menin more modestly augmented reporter gene activity in

the presence of h-catenin (data not shown).

We then wondered whether disease-associated menin muta-

tions would lose the ability to augment Wnt/h-catenin–mediated

signaling. All of the disease-associated menin missense and

COOH-terminal deletion mutants studied (mutants illustrated in

Fig. 3A) lost the ability to stimulate h-catenin–mediated reporter

gene activity (Fig. 3B and C) consistent with a role for menin in

canonical Wnt/h-catenin–mediated signaling. The menin trun-

cation mutants (meninDB-E) had lower expression compared

with wild-type menin (Fig. 3C, right). To adjust for this effect,

we transfected more plasmid DNA and increased expression of

Menin Is Essential for Wnt Signaling

Mol Cancer Res 2008;6(12). December 2008

1895

on June 2, 2020. © 2008 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from


the truncated proteins, but this further decreased reporter activity

as if truncated menin was acting in a dominant negative fashion

(data not shown). Overexpression of the missense mutants was

comparable to wild-type menin overexpression (Fig. 3C, right).

Like the menin deletion mutants, there was loss of TCF gene assay

reporter activity augmentation with these menin missense mutants

compared with overexpression of wild-type menin (Fig. 3C, left).

The COOH Terminus of Menin Interacts with b-Catenin,TCF3, and Weakly with TCF4

Because Wnt signaling is mediated by h-catenin binding

members of the TCF/LEF transcription factor family at target

gene promoters (34), we wondered whether menin interacted

with either h-catenin, TCF3, or TCF4. Because exogenously

overexpressed proteins may aggregate and produce artificial

interactions detected by immunoprecipitation, endogenous

menin/h-catenin interactions were investigated (Fig. 4A).

HEK 293T cells were treated with vehicle or a GSK3hinhibitor IX (BIO) to activate the canonical Wnt signaling

cascade, and endogenous menin/h-catenin coimmunoprecipita-

tion was done. Treatment with the GSK3h inhibitor increased

expression of activated h-catenin (see Fig. 4A, bottom).

Immunoprecipitation with anti–activated h-catenin that recog-

nizes h-catenin dephosphorylated on Ser37 or Thr41 confirmed

that endogenous menin coimmunoprecipitated with activated

h-catenin with GSK3h inhibitor treatment. This does not prove

that h-catenin dephosphorylation is necessary for the menin

interaction, but more likely that nuclear localization increases

FIGURE 1. Expression and colocalization of menin, h-catenin, and TCF3/4 in endocrine and nonendocrine cell lines. A. Western blot shows proteinexpression of endogenous h-catenin, activated (dephospho)h-catenin, and TCF3/4 in various cell lines transfected with either empty vector or pCMV-SPORT-menin (designated � and +, respectively). Forty-eight hours after transient transfection with either control vector or a menin-expressing plasmid(pCMV-Sport-menin), plated cells (HEK 293T, TGP-61, and InR1G9) were harvested and the protein lysate was immunoblotted and probed with antibodies toh-catenin, activated h-catenin (recognize h-catenin dephosphorylated on Ser37 or Thr41), and TCF3/4. Anti-menin antibody was used to confirmoverexpression of menin in the pCMV-Sport-menin – transfected cells, and anti –h-tubulin was used to show equal protein loading. For each protein detectedsuch as menin, all images from different cell lines were from the same Western blot and exposure, but the images were separated for publication purposes.B. TGP-61 mouse pancreas islet tumor cells expressing fluorescent epitope– tagged expression constructs show colocalization of menin with h-catenin andTCF3/4. ECFP images are pseudocolored red to distinguish these images from Hoechst dye nuclear staining. ECFP-h-catenin is predominantly nuclear dueto overwhelming the proteasome degradation pathway by high levels of ECFP-h-catenin protein expression, but some cytoplasmic protein is still visualized.All images were obtained with 63� objective.

Chen et al.


1896



FIGURE 2. Menin promotes TCF luciferase reporter gene activity by activation of the Wnt/h-catenin pathway in TGP-61 mouse islet cells. All experimentswere done with triplicate (n = 3) transfections, with the results graphed as the mean F SD. In all of the experiments, the amount of plasmid DNA transfectedwas kept constant by adding empty vector DNA as needed for each sample. All samples were transfected with the control vector pRL-hTK (Renilla luciferase)to adjust the results for transfection efficiency. A. Overexpression of menin promotes TCF luciferase gene reporter activity when cotransfected withh-catenin. The TCF luciferase reporter vector M50 (Super8XTOPflash) was cotransfected with pCMV-SPORT-menin alone, pCMV-SPORT-h-catenin alone,pCMV-SPORT-h-catenin/pCMV-SPORT-menin, or activated h-catenin mutant (S37A)/pCMV-SPORT-menin. The control sample was transfected with thereporter vector M50 with added empty pCMV-SPORT plasmid DNA. TCF reporter gene assay activity was measured by the Dual Luciferase Assay(Promega) and the results of the firefly luciferase/Renilla luciferase (FL/RL ) ratio are graphed for each sample set. Expression of transfected constructs foreach experiment is shown on the right. Protein loading was confirmed by h-tubulin expression. B. The augmentation of TCF luciferase gene reporter activityby menin is abrogated by mutation of the TCF enhancer elements of the gene reporter. To prove that activation of the TCF luciferase gene reporter wasspecifically due to the TCF enhancer, TGP-61 cells were transfected with the TCF reporter vector Super8XTOPflash (M50; label ‘‘T’’ in B) or mutant reportervector Super8XFOPflash (M51; label ‘‘F’’ in B) either alone or cotransfected with h-catenin– or h-catenin/menin–expressing plasmids as above. Expressionof transfected constructs for each experiment is shown on the right. Protein loading was confirmed by h-tubulin expression. C. Menin expression knockdownabrogates the TCF luciferase gene reporter response to overexpressed activated h-catenin. To show that menin knockdown inhibited h-catenin activation ofthe TCF gene reporter (M50), TGP-61 cells were transfected with either siRNA (Dharmacon) specifically optimized for mouse menin ‘‘M’’ or control ‘‘C’’ siRNA24 h prior the transfection with the reporter vector M50 and either empty vector or activated h-catenin mutant (S37A)–expressing plasmid. Control samplehas reporter vector and siRNA. Expression of transfected constructs for each experiment is shown on the right. Protein loading was confirmed by h-tubulinexpression.



1897



the likelihood of interaction because endogenous and overex-

pressed menin is largely located within the nucleus. Similar

interaction between endogenous menin and h-catenin was shown

in TGP61 cells by coimmunoprecipitation (data not shown).

Based on these data, menin could either directly complex with

h-catenin or indirectly interact as part of a large complex. We

tested this hypothesis by performing in vitro pull-down assays.

For these interaction experiments, an NH2-terminal deletion

FIGURE 3. Mutant menin loses its ability to promote Wnt/h-catenin signaling. All experiments were done with triplicate (n = 3) transfections, with theresults graphed as the mean F SD. In all of the experiments, the amount of plasmid DNA transfected was kept constant by adding empty vector DNA asneeded for each sample. All samples were transfected with the control vector pRL-hTK (Renilla luciferase) to adjust the results for transfection efficiency. A.Diagram illustrates human MEN1 gene structure, disease-associated missense mutants, COOH-terminal deletion mutants, and NH2-terminal deletionmutants used in this article. Exons are numbered 1 to 10. Exon 10 is shortened for illustration purposes. Disease-associated menin missense mutants aredesignated above the gene structure. The COOH-terminal menin deletion mutants are designated by the amino acid that is mutated to a stop codon within themenin protein. The NH2-terminal deletion menin mutants show the amino acid residues expressed by the expression vector. B. Menin COOH-terminaldeletion mutants lose the ability to promote TCF luciferase gene assay reporter activity in TGP61 cells. TGP-61 cells were transfected with the reporter vectorM50 and cotransfected with pSport-h-catenin with or without pSport-menin in the presence of different menin COOH-terminal deletion mutants (meninDB-E).TCF reporter gene assay activity was measured by the Dual Luciferase Assay (Promega) and the results of the firefly luciferase/Renilla luciferase ratio aregraphed for each sample set. Western blot analysis (B, right ) shows decreased expression of the transfected menin deletion mutants compared withoverexpressed wild-type menin. Increasing the deletion mutant menin plasmid expression by increasing the amount of transfected plasmid (meninDB-E)further decreased reporter activity (data not shown). Protein loading was confirmed by h-tubulin expression. C. Menin missense point mutants lose the abilityto promote TCF gene assay reporter activity in TGP61. TGP-61 cells were transfected with the reporter vector M50 and cotransfected with pSport-h-cateninwith or without pSport-menin or missense menin mutants (P12L, L22R, H139Y, A160P, A176P, and L286P). Right, corresponding Western blot for thetransfected proteins. Protein loading was confirmed by h-tubulin expression.

Chen et al.


1898



mutant, meninD5s (contains amino acids 477-610), was expressed

as a glutathione S-transferase (GST) fusion protein in bacteria,

purified by immobilized glutathione gel, and incubated with

in vitro transcribed-translated (TnT) h-catenin, TCF4, and TCF3

(Fig. 4B). The proteins bound to the NH2-terminal deletion mutant

and analyzed by Western blot analysis revealed specific pull-down

of h-catenin, TCF3, and TCF4 by GST-meninD5s. These proteins

were not seen with the GST control protein. Menin, therefore,

directly interacts with h-catenin, TCF3, and TCF4.

To define the menin interaction region, menin and h-catenin

were coexpressed in HEK 293T cells and coimmunoprecipitated

(Fig. 5A). Full-length menin specifically coimmunoprecipitated

with h-catenin. To determine the region of the menin protein that

binds to h-catenin, HEK 293T cells were cotransfected with

different menin deletion mutants (see diagram Fig. 3A). The

coimmunoprecipitation studied showed that h-catenin binds to

the COOH-terminal region of menin (Fig. 5A). COOH-terminal

menin truncation mutants (meninDB-D), on the other hand,

largely lost the ability to interact with h-catenin (Fig. 5B). The

longest of these COOH-terminal deletion mutants, meninDE,

weakly interacted with h-catenin. The majority of naturally

occurring disease-associated truncation mutations, therefore,

would be predicted to lose the ability to interact with h-catenin.

We then wondered whether menin interacted with other members

of the h-catenin transcription complex and showed that menin

could bind TCF3 or weakly with TCF4 either directly or as part

of a larger complex by coimmunoprecipitation in HEK 293T

cells (Fig. 5C).

Menin Regulates Wnt Downstream Target Axin2 GeneExpression

Because menin significantly increased TCF reporter gene

activity in the presence of activated h-catenin, we wondered

whether endogenous gene expression was likewise affected

in TGP-61 cells. To identify a target gene modulated by

Wnt/h-catenin signaling in TGP-61 cells, we studied the mRNA

expression of several known downstream target genes: c-MYC,

NKX2-2, Taspase, PDX1, LEF, MET, CDX1, HNF3B, HDAC9,

LMX1 , and AXIN2 (35).1 TGP-61 cells transfected with

FIGURE 4. Menin interacts with h-catenin,TCF3, and TCF4. A. Endogenous menin interactswith h-catenin, shown by coimmunoprecipitationanalysis. HEK 293T cells (control) or cells treatedwith GSK3h inhibitor IX (5 Amol/L), to activate Wntsignaling by inhibiting h-catenin phosphorylationand proteasome degradation, were harvested andlysed in radioimmunoprecipitation assay buffer.Bottom, Western blot for the input lysates used inthe coimmunoprecipitation. The GSK3h inhibitorincreased expression of activated (dephosphory-lated) h-catenin. The immunoprecipitation andcoimmunoprecipitation are shown on top. Anti –activated h-catenin antibody (recognize h-catenindephosphorylated on Ser37 or Thr41) was used forimmunoprecipitation (IP ) and samples were West-ern blotted (IB ) with either anti –activated h-catenin or anti-menin antibody (top ). The immu-nopreciptiation of activated (dephosphorylated)h-catenin is clearly shown (top , lower Westernblot). Coimmunoprecipitation for the endogenousmenin and h-catenin proteins (top , upper Westernblot) is maximal when h-catenin is activated withthe GSK3h inhibitor. Control antibody for theimmunoprecipitation was mouse IgG (JacksonImmunoResearch Laboratories). B. The meninCOOH terminus interacts with h-catenin, TCF3,and TCF4 in vitro as shown by GST pull-downassay. GST-tagged meninD5s (contains meninCOOH terminus) was expressed in bacteria andimmobilized on glutathione-coated agarose beads.In vitro transcribed and translated (TnT Systemfrom Promega) and biotin-labeled (Transcend fromPromega) h-catenin, TCF3, and TCF4 were usedfor pull-down assay and analyzed by Westernblotting. Input represents 10% of the TnT productto control for the amount of protein used to showinteraction. Biotinylated TnT products weredetected by the Transcend Non-RadioactiveTranslation Detection System from Promega(labeled TNT in figure).

1 See www.stanford.edu/~rnusse/wntwindow.html.



1899



expression constructs for menin and h-catenin (S37A) showed

increased Axin2 gene expression in response to h-catenin in both

TGP-61 and HEK 293T cells (Fig. 6A). There was no effect on

b-actin gene (loading control) expression. Similarly, Axin2

protein expression was increased in response to increased

h-catenin and menin/h-catenin expression (Fig. 6B). Expression

of other Wnt regulated genes tested was not affected by Wnt

signaling in these particular cell lines. This is not surprising

FIGURE 5. The COOH terminus of menin interacts with h-catenin, TCF3, and TCF4, shown by coimmunoprecipitation analysis. A. The menin COOHterminus interacts with h-catenin. Western blots (IB ; immunoblot antibody) were done on cell lysates or immunoprecipitates (IP ; immnuoprecipitate antibody).HEK 293T cells were cotransfected with plasmids expressing FLAG-h-catenin and either full-length His-menin or NH2-terminal deletion mutants meninD2-D6and coimmunoprecipitated to show interaction between the menin COOH terminus and h-catenin. The lower two Western blots show expression of thetransfected expression constructs. The upper two Western blots show the results from immunoprecipitation. Menin D6 has low levels of expression butimmunoprecipitates well. B. Deletion of the menin COOH terminus abrogates its ability to interact with h-catenin. HEK 293T cells were cotransfected withplasmids expressing FLAG-h-catenin and HA-menin and the COOH-terminal deletion mutants (HA-meninDB-DE). Immunoprecipitation shows interactionbetween full-length menin and h-catenin. There is a weaker interaction between h-catenin and menin DE (which contains one nuclear localization signal). Theother menin deletion mutants do not interact strongly. C. The menin COOH terminus interacts with TCF3/4. HEK 293T cells were cotransfected with plasmidsexpressing HA-menin and HA-meninD5 transfected alone or with FLAG-h-catenin, FLAG-h-catenin (S37A), FLAG-TCF3, and FLAG-TCF4, respectively,showing that the COOH terminus of menin could interact with all of them, albeit weakly with TCF4. Asterisks represent immunoglobin (IgG) proteins from theimmunoprecipitation.

Chen et al.


1900



because the Wnt signaling response is likely tissue specific

and the particular target genes for endocrine cell types are

unknown. Based on the reporter gene assay data, we hypothe-

sized that decreased menin expression would block h-catenin–

induced Axin2 transcription. Indeed, h-catenin–induced Axin2

gene transcription was repressed by siRNA knockdown of menin

expression in TGP-61 cells (Fig. 6C and D). To further confirm

the role of menin in Wnt signaling, we performed Western blot

analysis of SW480 colon cancer cells with constitutively active

h-catenin (due to adenomatous polyposis coli mutation) after

siRNA knockdown of menin expression. Compared with control

transfected SW480 cells, menin siRNA–transfected SW480

cells had decreased Axin2 gene expression similar to our findings

in TGP61 cells (Supplementary Fig. S1). These data suggest that

at least one endogenous canonical Wnt/h-catenin signaling target

gene (Axin2) is dependent on menin expression.

Menin Is Essential for Histone H3K4 Trimethylation in theMouse Axin2 Gene Promoter in Response to Wnt/b-Catenin SignalingAxin2 gene expression is regulated by the Wnt/h-catenin

signaling pathway in TGP-61 mouse islet tumor cells and

menin is essential for this signaling (see above), but the exact

molecular role for menin is unknown. Because menin is known

to bind MLL histone methyltransferase complexes (13, 15), we

hypothesized that menin could be involved in histone H3K4

trimethylation at the Axin2 gene promoter in response to Wnt/

h-catenin signaling. Using the chromatin immunoprecipitation

assay with an antibody to trimethylated histone 3 lysine 4 (anti-

H3K4) and DNA amplification by PCR for the proximal Axin2

promoter (genomic regions designated T2 and T3; ref. 36;

Fig. 7A), we showed increased histone H3 K4 trimethylation in

the h-catenin (S37A)–transfected TGP-61 islet tumor cells

compared with empty vector– transfected cells (Fig. 7B).

Histone H3K4 trimethylation was further increased when the

active h-catenin (S37A) was cotransfected with the menin

expression vector (Fig. 7B). To determine if menin was essential

for Axin2 gene promoter H3K4 trimethylation, Men1 siRNA

knockdown was done. Menin protein expression was reduced

and an associated decrease in Axin2 promoter histone H3K4

trimethylation was also seen (Fig. 7C). Hence, menin is directly

or indirectly essential for Axin2 gene promoter histone H3K4

trimethylation in response to Wnt/h-catenin signaling.

Increased Wnt/h-catenin signaling decreases TGP61 islet

tumor cell proliferation in vitro . Based on the above studies, we

hypothesized that increased Wnt signaling could inhibit islet

FIGURE 6. Menin is important for Wnt/h-catenin endogenous Axin2 gene expression. A. Wnt/h-catenin signaling and menin overexpression increaseendogenous Axin2 gene expression. Agarose gels show RT-PCR semiquantitative Axin2 gene expression results after activation of the Wnt/h-cateninsignaling pathway. HEK-293T and TGP-61 cells were transfected with control expression vector, pSPORT-CMV-h-catenin expression vector, or pSPORT-CMV-h-catenin and pSPORT-CMV-menin expression vectors. Forty-eight hours later, total RNA was extracted and analyzed by RT-PCR using Axin2primers. h-Actin primers were used to confirm equal loading of RNA into the RT-PCR reactions. B. Western blot analysis of Axin2 protein expressioncorresponding to the experiment done in A. Western blot with anti –h-tubulin antibody was used as a control for protein gel loading. C. Menin knockdownabrogates the ability of Wnt/h-catenin signaling to increase endogenous Axin2 gene expression. Agarose gels showing semiquantitative RT-PCR geneexpression results after Men1 siRNA transfection and activation of the Wnt/h-catenin signaling pathway. TGP-61 cells were first transfected with eithercontrol or Men1 specific siRNA. Twenty-four hours later, the cells were transfected with control expression vector or pSPORT-CMV-h-catenin expressionvector. RT-PCR was done 48 h later, using Axin2, Men1, b-catenin , or b-actin primers as indicated. D. Western blot analysis of Axin2, menin, and h-cateninprotein expression corresponding to the experiment done in C. Western blot with anti –h-tubulin antibody was used as a control for protein gel loading.



1901



cell proliferation because loss of menin function is thought to

increase endocrine tumor cell proliferation. Indeed, TGP61 islet

tumor cells transfected with menin siRNA show increased cell

proliferation compared with control transfected cells (Supple-

mentary Fig. S2). To determine whether Wnt signaling affects

TGP16 rodent islet tumor cell proliferation, TGP61 cells were

treated with a GSK3h inhibitor (BIO, Calbiochem) that

increases Wnt pathway signaling by decreasing h-catenin

proteasome–mediated degradation (Fig. 8A). Western blot

analysis shows that GSK3h inhibitor treatment increased

activated h-catenin expression compared with vehicle-treated

cells. In addition, cell counting at 0, 24, 48, and 72 hours

showed decreased cell proliferation compared with vehicle-

treated cells (Fig. 8B). Flow cytometry analysis suggests that

this is due to an increase in G2-M phase arrested cells

(Supplementary Fig. S3).

DiscussionIn this study, we show that menin is essential for Wnt/h-

catenin signaling in a mouse islet tumor cell line. The molecular

mechanism involves a direct interaction between h-catenin and

the COOH terminus of menin at the target gene promoter

(Axin2 in this study) and resultant histone H3K4 trimethylation.

Menin COOH-terminal truncation mutants lose their ability to

interact with h-catenin and their ability to increase TCF gene

reporter activity, which is consistent with a requirement for

inactivation of Wnt signaling during islet tumor development.

Although these studies show that histone H3K4 trimethylation

FIGURE 7. Menin is important for histone H3 K4 trimethylation in the mouse Axin2 gene promoter in response to Wnt/h-catenin signaling. A. Diagramillustrating the genomic organization of the mouse Axin2 gene 5¶ upstream region. Locations of TCF/LEF consensus binding elements (T2-T8) are depicted.B. Overexpression of menin increases Wnt/h-catenin signaling–associated Axin2 gene promoter H3K4 trimethylation. Top, agarose gels with PCR productsfrom the chromatin immunoprecipitation assay. TGP-61 cells were transfected with empty expression vector (UV ), active h-catenin (S37A ) expressionvector, or h-catenin (S37A)/menin expression vectors as shown. Forty-eight hours later, the chromatin immunoprecipitation assay was done with a trimethylspecific anti-H3K4 antibody. The T2/T3 promoter region was PCR amplified as depicted in the gene diagram above. Bottom, input DNA loading for the PCR.C. Menin expression knockdown abrogates Axin2 gene promoter H3K4 trimethylation in response to Wnt/h-catenin signaling. Agarose gels with PCRproducts from the chromatin immunoprecipitation assay showing the effect of Men1 siRNA on H3K4 methylation of the Axin2 gene promoter region T2/T3 inresponse to Wnt/h-catenin signaling are shown. TGP61 cells were first transfected with either control or specific Men1 siRNA. Twenty-four hours later, cellswere then transfected with control expression vector (UV ) or a h-catenin (S37A ) expression vector. Chromatin immunoprecipitation assays were done 48h later with either anti – trimethyl H3K4 antibody or anti-menin antibody. The fixed cells were also lysed and analyzed by Western blotting (IB ) with anti-meninantibody and anti –h-tubulin antibody to show reduced expression of menin with Men1 siRNA.

Chen et al.


1902



is affected at the Axin2 promoter, we do not know whether this

is a direct or indirect effect.

Because menin is inactivated in MEN1-associated endo-

crine tumors, we hypothesize that canonical Wnt signaling

could be diminished in these tumors. This contradicts the

typical role of Wnt activation in several malignancies such as

colon cancer (25, 37, 38) and recent data suggesting that

Wnt signaling is important for h-cell proliferation (39, 40).

Most tumors with Wnt signaling abnormalities reported

reveal activation of this pathway, but a few tumors such as

salivary gland tumors have inactivation of the Wnt pathway

(41). Menin inactivation could contribute to tumorigenesis by

disabling the canonical Wnt pathway. Indeed, activation of

Wnt/h-catenin signaling in TGP61 cells resulted in decreased

cell proliferation. This hypothesis is supported by mouse

models showing that Wnt/h-catenin inactivation results in the

loss of pancreas acinar cell development, but promotes or at

least preserves pancreas islet development (22). None of

these transgenic models of Wnt signaling/h-catenin signaling

develop endocrine tumors, suggesting that Wnt signaling may

not be critical for MEN1-associated tumor development. A

Men1 knockout mouse model, however, showed that h-

catenin is predominantly cytoplasmic, rather than nuclear, in

the islet tumors (42).

Men1 homozygous knockout mice, however, do have

craniofacial bone development abnormalities, and menin has

been proposed to have a direct role in bone development

(reviewed in ref. 43). Because Wnt/h-catenin has also been

implicated in bone development, it is possible that menin is

critical for proper osteoblast differentiation, in part, through

Wnt signaling and h-catenin/menin transcriptional activation of

RUNX2, the master regulator of bone formation (see review in

ref. 44).

In the absence of Wnt signaling, TCF/LEF transcription

factors form a complex with Groucho/Grg/transducin-like

enhancer-of-split proteins and thereby function as a transcrip-

tion repressor (reviewed in ref. 26). With Wnt signaling, h-

catenin displaces Groucho from the TCF/LEF complex and

thereby activates transcription. The mechanism for transcription

activation is hypothesized to involve interaction with coac-

tivators such as the histone acetylase, cyclic AMP-responsive

element binding protein–binding protein, and brahma-related

gene 1, which is a component of the SWI/SNF family of the

ATP-dependent chromatin remodeling complexes. Histone

methylation is also thought to be involved (45). Because menin

interacts with both h-catenin and the histone methyltransferase

complex, we hypothesize that menin is important for recruit-

ment of MLL histone methyltransferase to the h-catenin/TCF

activator complex at the gene promoter.

Interestingly, parafibromin, which is the tumor suppressor

protein mutated in hyperparathyroidism-jaw tumor syndrome 2,

also binds h-catenin and regulates Wnt target gene transcription

FIGURE 8. Proliferation of TGP61 cells is reduced by GSK3h inhibitor treatment. TGP61 cells were plated in triplicate for each time point and treated witheither vehicle or GSK3h inhibitor IX (BIO from Calbiochem) as described in Materials and Methods. Cell cultures were split for counting and Western blotanalysis. A. Western blot was done to determine the endogenous expression of activated h-catenin, menin, and h-tubulin after treatment with GSK3hinhibitor (5 Amol/L BIO, Calbiochem). Activated (dephosphorylated) h-catenin was detected with an antibody that recognizes h-catenin dephosphorylated onSer37 or Thr41 (Upstate). Western blot with anti –h-tubulin antibody was used as a control for protein gel loading. B. Graph of TGP61 cell proliferation(triplicate cultures) shows cell counting at 0, 24, 48, and 72 h after plating. E, cells treated with GSK3h inhibitor (5 Amol/L BIO); ., vehicle-treated cells.Points, mean cell count for triplicate cultures; bars, SD.



1903



through a mechanism thought to involve the PAF1 complex

(Paf1, Cdc73, Leo1, Ctr9, and Rtf1; ref. 46). Hence, MEN1 and

hyperparathyroidism-jaw tumor syndrome 2 may share a

similar signaling pathway mechanism involving histone

methylation and Wnt signaling.

We found that Axin2 expression is regulated in our mouse

islet tumor cell culture model for studying menin function. This

is not surprising because Axin2 is considered a possible

universal Wnt/h-catenin target, perhaps as part of autoregulation

of this pathway (25). It will be important to identify islet-specific

targets, if they exist, and further to understand the role of Wnt

signaling in islet cell biology as well as tumor development.

Materials and MethodsReagents and Cell Lines

Hamster islet tumor cells InR1G9 (kind gift from Dr. Craig

Smith) and human embryonic kidney cells (HEK 293T from

American Type Culture Collection) were cultivated in DMEM

(Mediatech, Inc.) supplemented with 10% fetal bovine serum

(Omega, Inc.), 2 mmol/L L-glutamine, 100 units/mL penicillin,

and 100 Ag/mL streptomycin (Omega). Mouse islet tumor cells

(TGP-61 from American Type Culture Collection) were

cultivated in 50% DMEM/50% F12K medium (Mediatech)

supplemented with 10% fetal bovine serum and L-glutamine/

penicillin/streptomycin. The rat monoclonal anti-hemagglutinin

antibody (12CA5) was purchased from Roche Applied Science.

The monoclonal anti-FLAG (M2) antibody was purchased from

Sigma-Aldrich. The rabbit polyclonal anti-menin antibody

(BL342) and the goat anti-GST antibody were purchased from

Bethyl Laboratories. The mouse monoclonal anti-His G

antibody was purchased from Invitrogen Corp. The antimouse

Axin2 antibody (ab32197) was purchased from Abcam. The

TCF/LEF reporter plasmid Super8XTOPflash (M50) and its

control mutant plasmid Super8XFOPflash (M51) were kind gifts

from Dr. Randall T. Moon. The human MEN1 full-length wild-

type and missense mutation expression constructs in the vector

pCMV-SPORT were a kind gift from Dr. Sunita Agarwal.

siRNA and TransfectionsiRNAs were purchased from Dharmacon RNA Technol-

ogies. Mouse Men1 siRNA SMARTpools were optimized to

find the best suppressor of menin expression (optimum mouse

Men1 siRNA sequence: GCUAAGACCUACUACCAGGUU)

determined by reverse transcription-PCR (RT-PCR) and

Western blot analysis. Non-Specific Control-V siRNA was

used as a siRNA control. Cells were transfected using

Oligofectamine (Invitrogen) transfection reagent. For experi-

ments requiring inhibition of Wnt signaling, the cells were

mock treated with vehicle or treated by GSK3h inhibitor IX

(Calbiochem) 5 Amol/L for 1 h before harvesting the cells.

Reduction of mouse Men1 mRNA expression was confirmed

by RT-PCR and mouse menin protein expression was

confirmed by Western blot analysis.

Construction of Expression PlasmidsRecombinant expression plasmids were constructed as

described (47). Briefly, a full-length MEN1 cDNA was isolated

by screening a human PBL E phage cDNA library (Clontech

Laboratories, Inc.), probed with a random primed radiolabeled

probe (Boehringer Mannheim), and PCR amplified (PCR

Advantage, Clontech Laboratories) using the 500-bp genomic

fragment from the first exon of human menin. The open reading

frame of this full-length E phage cDNA clone (internal lab

designated clone E$-menin-1.2.3) was high-fidelity PCR

amplified (PCR Advantage) with primers 5 ¶-gaatt-

cATGGGGCTGAAGGCC (small case: EcoRI restriction site)

and 5¶-TCAGAGGCCTTTGCG, and then TA cloned into

vector pCR2.1 (Invitrogen). Fidelity of the PCR DNA

amplification and cloning was confirmed by fully sequencing

the entire pCR2.1-menin (internal lab clone E4.1) insert in both

directions. The pcDNA3.1/HisC-menin construct was created

by subcloning the MEN1 open reading frame fragment from

pCR2.1-menin into the EcoRI site of the pcDNA3.1/HisC

expression vector (Invitrogen). An expression construct for

hemagglutinin epitope– tagged menin (pcDNA3.1-HA-menin)

was created by PCR DNA amplification of full-length

MEN1 open reading frame (pCR2.1-menin) using primers

5¶-gaattcGCCATGTACCCATACGATGTTCCAGATTACGCT-

TACCCATACGATGTTCCAGATTACGCTGGGCT-

GAAGGCCGCC (2xHA epitope underlined; EcoRI site shown

in small case) and 5¶-CCggatccTTCAGAGGCCTTTGCG

(small case: BamHI site not used for this construct). The

2xHA-menin PCR fragment was TA cloned back into pCR2.1

(pCR2.1-HA-menin). The EcoRI-EcoRI fragment from

pCR2.1-HA-menin was subcloned into the EcoRI site of

pcDNA3.1 (Invitrogen).

Hemagglutinin epitope–tagged menin COOH-terminal de-

letion mutants, pcDNA3.1-HA-meninDB (delete amino acids

263-610), meninDC (delete amino acids 341-610), meninDD

(delete amino acids 460-610), and meninDE (delete amino acids

527-610), were generated from pCR2.1-HA-menin (see above)

by site-directed mutagenesis (48) and subcloning into the

expression vector pcDNA3.1.

The menin NH2-terminal deletion mutants pcDNA3.1/HisC-

meninD2 (delete amino acids 1-197), meninD3 (delete amino

acids 1-276), meninD4 (delete amino acids 1-382), and

meninD5 (delete amino acids 1-443) were generated from

pCR2.1-menin (see above) by subcloning respectively the

blunted HincII-BamHI fragment, blunted BstEII-BamHI frag-

ment, blunted KpnI-BamHI fragment, blunted BstXI-BamHI

fragment, and blunted AvrII-BamHI fragment into pcDNA3.1/

HisC. The pcDNA3.1HisB-meninD6 (delete amino acids 1-526)

mutant was created by PCR DNA amplification using the primer

5¶-CgaattcCCGAGGCCCTGAAGG (small case: EcoRI site)

and vector BGH reverse primer 5¶-TAGAAGGCACAGTC-

GAGG, and then the PCR fragment was cloned into the

pcDNA3.1HisB vector (Invitrogen).

The GST-menin NH2-terminal deletion mutant pGEX4T2-

meninD5s (delete amino acids 1-476) was created by subclon-

ing the SmaI-NotI fragment of pcDNA3.1-menin into the

bacteria expression vector pGEX4T2 (GE Healthcare Bio-

Sciences Corp.) SalI-blunted/NotI restriction sites.

Two menin missense mutant expression constructs, pCMV-

SPORT-Men-P12L and pCMV-SPORT-Men-L22R, were gen-

erated from pCMV-SPORT-menin (kind gift from Dr. Sunita

Agarwal) using the splice overlap extension method (48) with

the primers P12Lf (5¶-GACGCTGTTCCTGCTGCGCTC),

Chen et al.


1904



P12Lr (5¶-GAGCGCAGCAGGAACAGCGTC), L22Rf (5¶-GGTGCGCCGGTTTGCTGCCGA), and L22Rr (5¶-GCAG-

CAAACCGGCGCACCACG; underlined and boldfaced letter

is the mutated nucleotide).

The cDNA coding for wild-type h-catenin was obtained from

IMAGE clone 6151332 (Invitrogen), and the constitutively

active missense mutant pCMV-SPORT-h-catenin (S37A) was a

kind gift from Dr. Eric Vilain. The open reading frames of wild-

type h-catenin and mutant S37A were subcloned into the

mammalian expression vectors p3XF10 (Sigma-Aldrich) and

pECFP-N1 (Clontech Laboratories) by PCR-TA (Invitrogen)

cloning using the following primers: for p3XF10-h-catenin,

HCATf 5¶-ggtaccATGGCTACTCAAGCTGATTTG (small case:

Kpn I site) and HCATr 5¶-tctagaTTACAGGTCAGTAT-

CAAACCA (small case: XbaI site); for pECFP-h-catenin,

CATNOr 5¶-gatatcCCAGGTCAGTATCAAACCAGGC (small

case: EcoRV site). The full-length cDNAs for TCF3 (also called

TCF7L1) and TCF4 (also called TCF7L2) were purchased from

Invitrogen (IMAGE clones 6141641 and 5533185, respectively)

and PCR-TA cloned into plasmids p3XF10, pcDNA3.1/HisB,

pEYFP-C1 (Clontech Laboratories), and pECFP-N1 using the

following PCR primers: TCF3f, 5¶-gaattcCACCATGCCC-

CAGCTCG (small case: EcoRI site); TCF3r, 5¶-gatatcT-

TAGTGGGCAGACTTGGTG (small case: EcoRV site);

TCF3Nr, 5¶-gatatcCGTGGGCAGACTTGGTGACC (small

case: EcoRV site); TCF4f, 5¶-gaattcAAAAATGCCGCAGCT-

GAAC (small EcoRI case site); and TCF4r, 5¶-gatatcTAG-

TAAGCTTCCATCTGAAGA (small case: EcoRV site).

GST Pull-Down AssayPull-down protein interaction studies were done according to

the manufacturer’s recommendations (ProFound Pull-Down

GST Protein:Protein Interaction Kit, Pierce Biotechnology).

Briefly, the competent bacteria (BL21 strain) were transformed

with either pGEX4T2 or pGEX4T2-meninD5s plasmids and

grown under selective conditions to produce the ‘‘bait’’ protein.

One colony from each transformants was scraped and grown in

suspension at 28jC overnight. Bacteria were diluted into fresh

media the next day, and the protein expression was isopropyl-h-

D-1-thiogalactopyranoside induced when the bacterial culture

attained an A600 z0.6. Induced bacteria were isolated by

centrifugation and lysed in the provided buffer. GST-tagged

proteins were immobilized on the glutathione-coated agarose

beads according to the manufacturer’s protocol. Biotinylated

(Transcend Non-Radioactive Translation Detection System

from Promega) full-length h-catenin, TCF3, and TCF4 proteins

were made by in vitro transcription/translation reaction of

pSPORT-h-catenin (construct from Invitrogen), pcDNA3.1/

HisB-TCF3, and pcDNA3.1/HisB-TCF4 following the manu-

facturer’s recommendations (Promega, TnT Quick Coupled

Transcription/Translation Systems) and added as ‘‘prey’’ to the

complex of beads with immobilized GST epitope–tagged

‘‘bait.’’ The bead complexes were washed and the bound

‘‘prey’’ proteins were eluted for SDS-PAGE and further

analysis by Western blot.

Transient TransfectionCulture dishes (100 mm) were seeded with either 2 � 106

HEK 293T cells, 1 � 106 TGP-61 cells, or 2 � 106 InR1G9

cells 24 h before transfection. Cells were transfected with

different plasmids using Effectene Transfection Reagent

(Qiagen, Inc.). For HEK 293T cells, 2 to 4 Ag of plasmid and

15 AL of Effectene/Ag plasmid were used for each transfection.

For TGP-61 and InR1G9 cells, 4 to 6 Ag of plasmid and 25 AL

of Effectene/Ag plasmid were used for each transfection.

Cotransfection with empty vector DNA was done as needed

to keep the amount of transfected DNA consistent between

samples in each experiment.

Total Cell Protein ExtractionPlated cells were washed twice in cold 1� PBS (without

calcium) buffer and then lysed in radioimmunoprecipitation

assay buffer containing 50 mmol/L Tris-HCl (pH 7.4),

200 mmol/L NaCl, 1 mmol/L EDTA, 1% NP40, 0.5% sodium

deoxycholate, 0.5% SDS, 2 mmol/L NaVO4, 2 mmol/L NaF,

and 1 mmol/L phenylmethylsulfonyl fluoride supplemented

with Complete Protease Inhibitor Cocktail as recommended by

the manufacturer (Roche Applied Science). After a 30-min

incubation on ice, the cell lysate was sonicated twice on ice

(8 s), centrifuged (13,000 rpm at 4jC) for 15 min, and the

supernatant was stored at �80jC for Western blotting.

Coimmunoprecipitation and Western Blot AnalysisAfter 48 h posttransfection, the plated cells were harvested

for protein as above. The protein lysates were precleared with

protein G-Sepharose 4B (Sigma-Aldrich) for 30 min and then

incubated for 2 h with rat monoclonal anti-hemagglutinin or

mouse monoclonal anti-HisG. Untransfected cells were treated

similarly but immunoprecipitated with anti–activated h-catenin

antibody (Upstate clone 8E7). Immune complexes were

captured with protein G-Sepharose 4B beads for an additional

hour, centrifuged, washed four times in radioimmunoprecipita-

tion assay buffer, and then solubilized in SDS sample buffer.

Proteins were analyzed on precast 4% to 12% gel (Invitrogen)

and immunoblotted with mouse monoclonal anti-FLAG

antibody. The immune complexes were detected by horserad-

ish-conjugated secondary antibody and developed by enhanced

chemiluminescence (Amersham Pharmacia Biotech). Images

were digitized with Quantity One Software (Bio-Rad) using the

Bio-Rad Versadoc Imaging System Model 3000. The images

were prepared for publication with Adobe Photoshop and

Illustrator software.

Luciferase AssaysAll luciferase assay experiments were done in triplicate, with

data reported as mean F SD. Twenty-four-well plates were

seeded with 3 � 104 TGP-61 cells 24 h before transfection.

Cells were transfected with different plasmids (including M50,

M51, and pRL-hTK) using Effectene Transfection Reagent. An

equal amount of transfected plasmid DNAwas ensured between

different samples in each experimental group by adding empty

control vector plasmid DNA as needed. Twenty-four hours after

transfection, the medium was changed to fresh medium

containing 5% charcoal stripped serum. Twenty-four hours

later, the cells were lysed in 1� PLB, and luciferase assays

were done using the Dual-Luciferase Reporter Assay System as

recommended by the manufacturer (Promega). SDS-PAGE



1905



sample buffer was added to the remaining lysate, and Western

blotting was done to ensure every transfected plasmid was

expressed for each samples.

Chromatin Immunoprecipitation AssayThe chromatin immunoprecipitation assays were done

following the protocol described with some minor modifica-

tions (49). Briefly, after different transfections and treatments,

37% formaldehyde (Fisher Scientific) was added directly to

culture medium in the plate to a final concentration of 1% to

cross-link the proteins to the DNA. After incubation for 10 min

at 37jC, cells were washed twice using ice-cold PBS

containing protease inhibitor cocktail. Cells were scrapped

from the plate and harvested into 1.5-mL Eppendorf tubes and

then briefly centrifuged. Cell pellets were lysed in 800-AL SDS

lysis buffer containing 1% SDS, 10 mmol/L EDTA, and

50 mmol/L Tris-HCl (pH 8.1) with freshly added protease

inhibitor cocktail. After a 10-min incubation on ice, the lysates

were sonicated thrice for 10 s on ice and centrifuged. Then the

supernatant (200 AL) was diluted with 1,800 AL of chromatin

immunoprecipitation dilution buffer containing 0.01% SDS,

1.1% Triton X-100, 1.2 mmol/L EDTA, 16.7 mmol/L Tris-HCl

(pH 8.1), and 167 mmol/L NaCl, with freshly added protease

inhibitor cocktail. An aliquot of diluted sample (200 AL) was

saved as input control DNA and, after adding 8 AL of 5 mol/L

NaCl, reverse cross-linked at 65jC overnight. The remaining

samples were precleared with 50 AL of salmon sperm DNA/

protein G-Sepharose-50% slurry for at least 30 min at 4jC with

agitation. The supernatant fractions were collected and either

anti – trimethyl-H3K4 (Upstate USA, Inc.) or anti-menin

antibody was added for immunoprecipitation with rotation at

4jC overnight followed by adding 50 AL of salmon sperm

DNA/protein G-Sepharose slurry for 1 h at 4jC with rotation to

collect the immunocomplex. For a negative control, a no-

antibody immunoprecipitation was done by incubating the

supernatant fraction with 50 AL of salmon sperm DNA/protein

G-Sepharose slurry for 1 h at 4jC before washing the beads.

The samples were washed and eluted, and the DNA was

extracted with a commercial DNA extraction kit (Qiagen). The

DNA was eluted in 30 AL Tris (pH 8.5) buffer, PCR amplified

with AccuPrime Taq polymerase (Invitrogen), and analyzed by

electrophoresis on agarose gel. The primers used to amplify the

mouse Axin2 promoter region, designated as T2/3, were mt23F,

5 ¶-GCGGCGGGATCACTGGCT, and mt23R , 5 ¶-TCCTCCGGGCGCTTCCAAC (36).

RT-PCRHEK 293T cells and TGP-61 cells were plated in a six-well

plate 24 h before transfection. Cells were transfected with

different expression plasmids using Effectene Transfection

Reagent. Two days later, the total RNA was extracted with

Trizol (Invitrogen). The first cDNA was synthesized using the

1st cDNA Synthesis Kit (GE Healthcare Lifesciences), and

followed by RT-PCR with Taq DNA polymerase (Invitrogen).

The primers used were 5LEF1, 5¶-GCCGAGATCAGTCATC-

CCGA; 3LEF1, 5¶-CACCACGGGCACTTTATTTGAT; 5TAS-

PASE, 5¶-AACGAGCTTGTCAGAAGGCAATT; 3TASPASE,

5¶-CCACCCTTTCTGCCAGCTCTA; 5NKX2-2, 5¶-CTGAC-

CAACACAAAGACGGGG; 3NKX2-2, 5¶-GCCGCTCCAGC-

TCGTAGG; 5hMET, 5¶-GATCAACTCATTAGCTGTGGC;

5mMET, 5¶-GCAGCAGCAAAGCCAAT; 3MET, 5¶-TGAA-

AAGTCTGAGCATCTAGAGT; 5HDAC9, 5¶-GGAGCC-

CATCTCACCTTTAGACC; 3HDAC9, 5¶-TGCCACTGCC-

CTTTCTCGTC; 5AXIN2, 5¶-GCCGATTGCTGAGAGGA-

ACTG; 3AXIN2, 5¶-AAAGTTTTGGTATCCTTCAGGTT-

CAT; 5CMYC, 5¶-CAGGAACTATGACCTCGACTACGACT;

3CMYC, 5¶-TGTCTTGGCCAGCC; 5PDX1, 5¶-GGAGCAG-

TACTACGCGGCCA; 3PDX1, 5¶-TGGCCTTTCCACG-

CGTGA; 5LMX1A, 5¶-CCAAGTCTGTCTGCGAGGGC;

3LMX1A, 5¶-TGCAGGGCTTGGAGGATACTTC; 5HNF-3B,

5¶-GCCGGCCTGGGGATGAA; 3HNF-3B, 5¶-TGTTGGGG-

CTCTGCTGGATG; 5CDX1, 5¶-CAGGGCCCAGCATGCG;

and 3CDX1, 5¶-TCTTACCGCTGCCACCGC.

Microscopy Analysis

Forty-eight hours after transfection with fluorescent protein

expression constructs, TGP-61 cells grown on coverslips were

washed twice with cold PBS (Sigma) and fixed with 0.5%

paraformaldehyde for 30 min. Fixed cells were washed twice more

with cold PBS and incubated with 1 ng/mL bisbenzimide H 33258

(Sigma). Coverslips were mounted on slides using Vectashield

(Vector Labs) and viewed under a microscope (Leica DMIL) with

appropriate band-pass filters (Chroma) for ECFP, EYFP, and

Hoechst stain using a 63� objective. Images were captured with a

Hamamatsu Orca II cooled charge-coupled device camera and data

were analyzed with Metamorph (Molecular Devices) software to

create merged images. The final images were assembled in Adobe

Photoshop and Illustrator software to create the publication images.

Cell CountingAll cell counting experiments were done in triplicate, with data

reported as mean F SD. TGP61 cells (2.4 � 105) were plated on

six-well plates. The following day, the medium was changed to

fresh medium containing 5% charcoal-stripped serum. One set of

cells were trypsinized and counted on a hemacytometer, and the

remaining cells were treated with vehicle (DMSO) or 5 Amol/L

GSK3h inhibitor for 1, 2, and 3 d. Each day, the medium was

changed with fresh medium containing 5% charcoal-stripped

serum and treatment was continued with GSK3h inhibitor.

Flow CytometryAdherent cells were detached and collected with 0.25%

trypsin (Sigma). Cells were pelleted by centrifugation and

resuspended in propidium iodide staining buffer (sodium citrate

250 mg, 0.75 mL Triton X-100, propidium iodide 25 mg,

RNase A 5 mg, and distilled H2O to final volume of 250 mL)

and stored in the dark at 4jC until flow cytometry (<1 h). Cells

were then passed through a FACScan cytometer (Becton-

Dickinson) controlled with CellQuest software and the data

were analyzed with the ModFit software.

Statistical AnalysisMicrosoft Excel software was used for data management

(calculating mean and SD) and creating graphs. All luciferase

assays were done with triplicate plasmid transfections, with data

presented as mean F SD.

Chen et al.


1906



Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

AcknowledgmentsWe thank Drs. Gregory Brent, Dean Yamaguchi, Steven Pandol, Ilya Gukovsky,and Matthias Stelzner at the West Los Angeles VA and David Geffen School ofMedicine at University of California at Los Angeles for valuable scientificdiscussions. We are grateful for critical reagents provided by Drs. Sunita Agarwal(National Institutes of Diabetes, Digestive and Kidney Diseases, Bethesda, MD),Randall T. Moon (University of Washington, Seattle, WA), Eric Vilain (Universityof California at Los Angeles, Los Angeles, CA), and Craig V. Smith (Universityof California at Los Angeles, Los Angeles, CA).

References1. Schussheim DH, Skarulis MC, Agarwal SK, et al. Multiple endocrineneoplasia type 1: new clinical and basic findings. Trends Endocrinol Metab 2001;12:173 –8.

2. Yang Y, Hua X. In search of tumor suppressing functions of menin. Mol CellEndocrinol 2007;265 –6:34 –41.

3. Guo SS, Sawicki MP. Molecular and genetic mechanisms of tumorigenesis inmultiple endocrine neoplasia type-1. Mol Endocrinol 2001;15:1653–64.

4. Bertolino P, Radovanovic I, Casse H, Aguzzi A, Wang ZQ, Zhang CX.Genetic ablation of the tumor suppressor menin causes lethality at mid-gestationwith defects in multiple organs. Mech Dev 2003;120:549 –60.

5. Crabtree JS, Scacheri PC, Ward JM, et al. A mouse model of multipleendocrine neoplasia, type 1, develops multiple endocrine tumors. Proc Natl AcadSci U S A 2001;98:1118–23.

6. Agarwal SK, Guru SC, Heppner C, et al. Menin interacts with the AP1transcription factor JunD and represses JunD-activated transcription. Cell 1999;96:143 –52.

7. Naito J, Kaji H, Sowa H, Hendy GN, Sugimoto T, Chihara K. Meninsuppresses osteoblast differentiation by antagonizing the AP-1 factor, JunD.J Biol Chem 2005;280:4785– 91. Epub 2004 Nov 4723.

8. Kaji H, Canaff L, Lebrun JJ, Goltzman D, Hendy GN. Inactivation of menin, aSmad3-interacting protein, blocks transforming growth factor type B signaling.Proc Natl Acad Sci U S A 2001;98:3837 –42. Epub 2001 Mar 3813.

9. Sowa H, Kaji H, Canaff L, et al. Inactivation of menin, the product of themultiple endocrine neoplasia type 1 gene, inhibits the commitment ofmultipotential mesenchymal stem cells into the osteoblast lineage. J Biol Chem2003;278:21058– 69. Epub 22003 Mar 21020.

10. Sowa H, Kaji H, Hendy GN, et al. Menin is required for bone morphogeneticprotein 2- and transforming growth factor B-regulated osteoblastic differentiationthrough interaction with Smads and Runx2. J Biol Chem 2004;279:40267– 75.Epub 42004 May 40218.

11. Heppner C, Bilimoria KY, Agarwal SK, et al. The tumor suppressor proteinmenin interacts with NF-KB proteins and inhibits NF-KB-mediated trans-activation. Oncogene 2001;20:4917–25.

12. Yokoyama A, Wang Z, Wysocka J, et al. Leukemia proto-oncoprotein MLLforms a SET1-like histone methyltransferase complex with menin to regulate Hoxgene expression. Mol Cell Biol 2004;24:5639–49.

13. Hughes CM, Rozenblatt-Rosen O, Milne TA, et al. Menin associates with atrithorax family histone methyltransferase complex and with the hoxc8 locus. MolCell 2004;13:587– 97.

14. Yokoyama A, Somervaille TC, Smith KS, Rozenblatt-Rosen O, Meyerson M,Cleary ML. The menin tumor suppressor protein is an essential oncogeniccofactor for MLL-associated leukemogenesis. Cell 2005;123:207– 18.

15. Milne TA, Hughes CM, Lloyd R, et al. Menin and MLL cooperativelyregulate expression of cyclin-dependent kinase inhibitors. Proc Natl Acad SciU S A 2005;102:749– 54. Epub 2005 Jan 2007.

16. Scacheri PC, Davis S, Odom DT, et al. Genome-wide analysis of meninbinding provides insights into MEN1 tumorigenesis. PLoS Genet 2006;2:e51.

17. Habener JF, Kemp DM, Thomas MK. Minireview: transcriptional regulationin pancreatic development. Endocrinology 2005;146:1025–34. Epub 2004 Dec1016.

18. Kim SK, MacDonald RJ. Signaling and transcriptional control of pancreaticorganogenesis. Curr Opin Genet Dev 2002;12:540– 7.

19. Kim HJ, Schleiffarth JR, Jessurun J, et al. Wnt5 signaling in vertebratepancreas development. BMC Biol 2005;3:23.

20. Papadopoulou S, Edlund H. Attenuated Wnt signaling perturbs pancreaticgrowth but not pancreatic function. Diabetes 2005;54:2844–51.

21. Dessimoz J, Grapin-Botton A. Pancreas development and cancer: Wnt/B-catenin at issue. Cell Cycle 2006;5:7 –10. Epub 2006 Jan 2004.

22. Murtaugh LC, Law AC, Dor Y, Melton DA. B-catenin is essential forpancreatic acinar but not islet development. Development 2005;132:4663–74.Epub 2005 Sep 4628.

23. Dessimoz J, Bonnard C, Huelsken J, Grapin-Botton A. Pancreas-specificdeletion of B-catenin reveals Wnt-dependent and Wnt-independent functionsduring development. Curr Biol 2005;15:1677 –83.

24. Ireland H, Kemp R, Houghton C, et al. Inducible Cre-mediated control ofgene expression in the murine gastrointestinal tract: effect of loss of B-catenin.Gastroenterology 2004;126:1236–46.

25. Clevers H. Wnt/B-catenin signaling in development and disease. Cell 2006;127:469–80.

26. Stadeli R, Hoffmans R, Basler K. Transcription under the control of nuclearArm/B-catenin. Curr Biol 2006;16:R378– 85.

27. Heller RS, Klein T, Ling Z, et al. Expression of Wnt, Frizzled, sFRP, DKKgenes in adult human pancreas. Gene Expr 2003;11:141– 7.

28. Heller RS, Dichmann DS, Jensen J, et al. Expression patterns of Wnts,Frizzleds, sFRPs, and misexpression in transgenic mice suggesting a role forWnts in pancreas and foregut pattern formation. Dev Dyn 2002;225:260– 70.

29. Pettengill OS, Memoli VA, Brinck-Johnsen T, Longnecker DS. Cell linesderived from pancreatic tumors of Tg(Ela-1-SV40E)Bri18 transgenic miceexpress somatostatin and T antigen. Carcinogenesis 1994;15:61 –5.

30. Pear WS, Nolan GP, Scott ML, Baltimore D. Production of high-titer helper-freeretroviruses by transient transfection. Proc Natl Acad Sci U S A 1993;90:8392–6.

31. Takaki R, Ono J, Nakamura M, et al. Isolation of glucagon-secreting celllines by cloning insulinoma cells. In Vitro Cell Dev Biol 1986;22:120 –6.

32. Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT. Zebrafishprickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulationmovements. Curr Biol 2003;13:680–5.

33. Sadot E, Conacci-Sorrell M, Zhurinsky J, et al. Regulation of S33/S37phosphorylated B-catenin in normal and transformed cells. J Cell Sci 2002;115:2771– 80.

34. Molenaar M, van de Wetering M, Oosterwegel M, et al. XTcf-3 transcriptionfactor mediates B-catenin-induced axis formation in Xenopus embryos. Cell 1996;86:391–9.

35. Hallikas O, Palin K, Sinjushina N, et al. Genome-wide prediction ofmammalian enhancers based on analysis of transcription-factor binding affinity.Cell 2006;124:47–59.

36. Jho EH, Zhang T, Domon C, Joo CK, Freund JN, Costantini F. Wnt/h-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator ofthe signaling pathway. Mol Cell Biol 2002;22:1172– 83.

37. Moon RT, Kohn AD, De Ferrari GV, Kaykas A. WNT and h-cateninsignalling: diseases and therapies. Nat Rev Genet 2004;5:691 –701.

38. Nusse R. Wnt signaling in disease and in development. Cell Res 2005;15:28–32.

39. D’Amour KA, Bang AG, Eliazer S, et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol2006;24:1392–401.

40. Rulifson IC, Karnik SK, Heiser PW, et al. Wnt signaling regulates pancreatich cell proliferation. Proc Natl Acad Sci U S A 2007;104:6247–52.

41. Takeda H, Lyle S, Lazar AJ, Zouboulis CC, Smyth I,Watt FM. Human sebaceoustumors harbor inactivating mutations in LEF1. Nat Med 2006;12:395–7.

42. Bertolino P, Tong WM, Herrera PL, Casse H, Zhang CX, Wang ZQ.Pancreatic h-cell-specific ablation of the multiple endocrine neoplasia type 1(MEN1) gene causes full penetrance of insulinoma development in mice. CancerRes 2003;63:4836 –41.

43. Hendy GN, Kaji H, Sowa H, Lebrun JJ, Canaff L. Menin and TGF-hsuperfamily member signaling via the Smad pathway in pituitary, parathyroid andosteoblast. Horm Metab Res 2005;37:375–9.

44. Li YL, Xiao ZS. Advances in Runx2 regulation and its isoforms. MedHypotheses 2007;68:169–75.

45. Sierra J, Yoshida T, Joazeiro CA, Jones KA. The APC tumor suppressorcounteracts h-catenin activation and H3K4 methylation at Wnt target genes.Genes Dev 2006;20:586 –600.

46. Mosimann C, Hausmann G, Basler K. Parafibromin/Hyrax activates Wnt/Wgtarget gene transcription by direct association with h-catenin/Armadillo. Cell2006;125:327 –41.

47. Chen G, Ray R, Dubik D, et al. The E1B 19K/Bcl-2-binding protein Nip3 isa dimeric mitochondrial protein that activates apoptosis. J Exp Med 1997;186:1975– 83.

48. Dieffenbach CW, Dveksler GS. PCR primer: a laboratory manual. Plainview(NY): Cold Spring Harbor Laboratory Press; 1995. p. xii, 714.

49. Becker PB. Chromatin protocols. Totowa (NJ): Humana Press, 1999.p. xv, 528.



1907



2008;6:1894-1907. Mol Cancer Res Gao Chen, Jingbo A, Min Wang, et al. Endocrine CellsMenin Promotes the Wnt Signaling Pathway in Pancreatic

Updated version

http://mcr.aacrjournals.org/content/6/12/1894

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2009/01/07/6.12.1894.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/6/12/1894.full#ref-list-1

This article cites 47 articles, 16 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/6/12/1894.full#related-urls

This article has been cited by 7 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mcr.aacrjournals.org/content/6/12/1894To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/content/suppl/2009/01/07/6.12.1894.DC1

http://mcr.aacrjournals.org/content/6/12/1894.full#ref-list-1

http://mcr.aacrjournals.org/content/6/12/1894.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]



Menin Promotes the Wnt Signaling Pathway in Pancreatic ...Wnt signaling and h-catenin are important...

Documents

Transcript of Menin Promotes the Wnt Signaling Pathway in Pancreatic ...Wnt signaling and h-catenin are important...