Lecture II: Genomic Methods
description
Transcript of Lecture II: Genomic Methods
![Page 1: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/1.jpg)
TRiG Curriculum: Lecture 2 1
Lecture II: Genomic Methods
Dennis P. Wall, PhDFrederick G. Barr, MD, PhD
Deborah G.B. Leonard, MD, PhD
March 2012
![Page 2: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/2.jpg)
TRiG Curriculum: Lecture 2 2
Why Pathologists? We have access, we know testing
PersonalizedRisk Prediction,MedicationDosing,Diagnosis/Prognosis
Physician sendssample toPathology (blood/tissue)
Pathologists
Access to patient’s genome
Just another laboratory test
March 2012
![Page 3: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/3.jpg)
The path to genomic medicine
Sample Collection
Testing: Sequencing, Gene chips
Analysis
Pathologists
Access to patient’s genome
Sample Collection
March 2012
![Page 4: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/4.jpg)
What we will cover today:
• Types of genetic alterations• Current and future
molecular testing methods
– Cytogenetics, in situ hybridization, PCR
– Microarrays• Genotyping• Expression profiling• Copy number variation
– Next generation sequencing (NGS)
• Whole genome• Transcriptome
4TRiG Curriculum: Lecture 2March 2012
![Page 5: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/5.jpg)
DNA alterations – the small stuff
Point mutation
Repeat alteration
Deletion/Insertion
CCTGAGGAG CCTGTGGAG
TTCCAG…(CAG)5…CAGCAA
GAATTAAGAGAAGCA GAAGCA
Example: hemoglobin, beta – sickle cell disease
Example: epidermal growth factor receptor – lung cancer
TTCCAG…(CAG)60…CAGCAA
Example: huntingtin – Huntington disease
5TRiG Curriculum: Lecture 2March 2012
![Page 6: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/6.jpg)
DNA alterations – the bigger stuff
Translocation
Amplification
Deletion/Insertion
Example: 22q11.2 region –
DiGeorge syndrome
Example: 17q21.1 (ERBB2) –
Breast cancer
Example: t(11;22)(q24;q12) –
Ewing’s sarcoma
11
22
Der 11
Der 22
6TRiG Curriculum: Lecture 2March 2012
![Page 7: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/7.jpg)
Current strategies to detect DNA alterations
Cytogenetics: Large indels, amplification, translocations
In situ hybridization: large indels, amplification, translocations
http://moon.ouhsc.edu
EGFR amplification in glioblastomat(6;15) in a woman with repeated abortions
http://www.indianmedguru.com
7TRiG Curriculum: Lecture 2March 2012
![Page 8: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/8.jpg)
Current strategies to detect DNA alterations
PCR-based approaches: Mutations, small indels, repeat alterations, large indels, amplification, translocations
Alsmadi OA, et al. BMC Genomics 2003 4:21
Factor V Leiden mutation
8TRiG Curriculum: Lecture 2March 2012
![Page 9: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/9.jpg)
What we will cover today:
• Types of genetic alterations• Current and future
molecular testing methods
– Cytogenetics, in situ hybridization, PCR
– Microarrays• Genotyping• Expression profiling• Copy number variation
– Next generation sequencing (NGS)
• Whole genome• Transcriptome
9TRiG Curriculum: Lecture 2March 2012
![Page 10: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/10.jpg)
DNA microarray - the basics
• Purpose: multiple simultaneous measurements by hybridization of labeled probe
• DNA elements may be: Oligonucleotides cDNA’s Large insert genomic clones
• Microarray is generated by: Printing Synthesis
10TRiG Curriculum: Lecture 2March 2012
![Page 11: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/11.jpg)
TRiG Curriculum: Lecture 2 11
Microarray technologies
March 2012
![Page 12: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/12.jpg)
Organization of a DNA microarray
(adapted from Affymetrix)
1.28 cm
1.28 cm
12TRiG Curriculum: Lecture 2March 2012
![Page 13: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/13.jpg)
Hybridization of a labeled probeto the microarray
13
(adapted from Affymetrix)
TRiG Curriculum: Lecture 2March 2012
![Page 14: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/14.jpg)
Detection of hybridization on microarray
Light from laser
14
(adapted from Affymetrix)
TRiG Curriculum: Lecture 2March 2012
![Page 15: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/15.jpg)
Hybridization intensities on DNA microarray following laser scanning
15TRiG Curriculum: Lecture 2March 2012
![Page 16: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/16.jpg)
Overview of SNP array technology
LaFramboise T. Nucleic Acids Res. 2009; 37:4181
16TRiG Curriculum: Lecture 2March 2012
![Page 17: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/17.jpg)
Microarray Applications
• DNA analysis Polymorphism/mutation detection –
e.g. Disease susceptibility testingDrug efficacy/sensitivity testing
Copy number detection (comparative genomic hybridization) – e.g. Constitutional or cancer karyotyping
Bacterial DNA – e.g. Identification and speciation
• RNA analysis Expression profiling – e.g. Breast cancer prognosis
Cancer of unknown primary origin
cv
17TRiG Curriculum: Lecture 2March 2012
![Page 18: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/18.jpg)
Genome-wide association studies of lung cancer microarray with 317,139 SNP’s
Hung RJ, et al. Nature Genetics. 2008; 452:633
Cases/controlsFrom differentpopulations
18TRiG Curriculum: Lecture 2March 2012
![Page 19: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/19.jpg)
Genotype calling
Hybridization intensities translated into genotypesLarge SNP numbers requires automated procedureRecent algorithms – clustering/pooling strategies
• Raw hybridization intensities normalized • Information combined across different samples at
each SNP• Assign genotypes to entire clusters• For each sample, estimate probability of each of
three genotype calls at each SNP• Genotype assigned based on defined threshold of
probability• Missing genotypes dependent on algorithm &
threshold used
Teo YY, Curr Op in Lipidology. 2008; 19:133
19TRiG Curriculum: Lecture 2March 2012
![Page 20: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/20.jpg)
Genotyping - Limitations & quality control
• Accuracy of algorithm– Depends on number of samples in each cluster– Prone to errors for small number of samples or SNP’s with rare alleles
• High rates of missing genotypes:– Array problems – plating/synthesis issue– Poor quality DNA – degradation– Hybridization failure– Differential performance between SNP’s
• Excess heterozygosity - sample contamination?
Just another laboratory test
20TRiG Curriculum: Lecture 2March 2012
![Page 21: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/21.jpg)
• Analyzed 8,101 genes on chip microarrays
• Reference= pooled cell lines
• Breast cancer subgroups
Perou CM, et al. Nature. 2000; 406, 747
21TRiG Curriculum: Lecture 2March 2012
![Page 22: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/22.jpg)
Original two probe strategy for expression profiling on cDNA arrays
Duggan DJ, et al., Nature Genetics. 1999; 21:10
22TRiG Curriculum: Lecture 2March 2012
![Page 23: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/23.jpg)
Expression profiling: challenges and limitations
Biological• Dynamic & complex nature of gene expression• Heterogeneous nature of tissue samples• Variation in RNA quality
Technological• Reproducibility across microarray platforms• Selection of probes – dependence on binding efficiency• Controlling for technical variability
Statistical/bioinformatic• Adequate experimental design• Normalization to remove variability among chips• Multiple testing correction• Validation of results Just another
laboratory test23TRiG Curriculum: Lecture 2March 2012
![Page 24: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/24.jpg)
Copy number variation: Comparative genomic hybridization
CGH
Array-CGH
Metaphase Chromosomes
ArrayedDNA’s
Tumor DNA Reference DNA
Hybridization
Deletion
GainDeletion
Gain
24
http://www.advalytix.com/advalytix/hybridization_330.htm
TRiG Curriculum: Lecture 2March 2012
![Page 25: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/25.jpg)
Constitutional genomic imbalances detected by copy number arrays
10.9 Mbdeletionat 7q11
7.2 Mbduplication
on 11q
Miller DT, et al, Amer J Hum Genet. 2010; 86:74925TRiG Curriculum: Lecture 2March 2012
![Page 26: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/26.jpg)
Copy number - Limitations & quality control
Artifacts may be caused by:• GC content
– Wavy patterns correlate with GC content – Algorithms developed to remove waviness
• DNA sample quantity and quality– Can impact on level of signal noise and false positive rate– Whole genome amplification associated with signal noise
• Sample composition– In cancer studies, normal cells dilute cancer aberrations– Tumor heterogeneity will also affect copy number
26
Just another laboratory test
TRiG Curriculum: Lecture 2March 2012
![Page 27: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/27.jpg)
What we will cover today:
• Types of genetic alterations• Current and future genetic
test methods
– Cytogenetics, in situ hybridization, PCR
– Microarrays• Genotyping• Expression profiling• Copy number variation
– Next generation sequencing (NGS)
• Whole genome• Transcriptome
27TRiG Curriculum: Lecture 2March 2012
![Page 28: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/28.jpg)
TRiG Curriculum: Lecture 2 28
Cancer Treatment: NGS in AML
Welch JS, et al. JAMA, 2011;305, 1577
March 2012
![Page 29: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/29.jpg)
TRiG Curriculum: Lecture 2 29
Case History
• 39 year old female with APML by morphology
• Cytogenetics and RT-PCR unable to detect PML-RAR fusion
• Clinical question: Treat with ATRA versus allogeneic stem cell transplant
March 2012
![Page 30: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/30.jpg)
TRiG Curriculum: Lecture 2 30
Methods/Results
• Paired-end NGS sequencing
• Result: Cytogenetically cryptic event: novel fusion protein
• Took 7 weeks
March 2012
![Page 31: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/31.jpg)
77-kilobase segment from Chr. 15 was inserted en bloc into the second intron of the gene RARA on Chr. 17.
March 2012
![Page 32: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/32.jpg)
TRiG Curriculum: Lecture 2 32
Workflow
Image processing and base calling
Raw Data Analysis
Alignment to reference genome
Whole Genome Mapping
Detection of genetic variation(SNPs, Indels, Insertions)
Variant Calling
Linking variants to biological information
Annotation
March 2012
![Page 33: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/33.jpg)
TRiG Curriculum: Lecture 2 33
Overview of Paired End Sequencing
Short Insert
DNA
Random Shearing
Adapters Ligated
Annealed to Surface
Sequenced
Synthesized
Sequencing done with labeled NTPs and massively parallel
March 2012
![Page 34: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/34.jpg)
TRiG Curriculum: Lecture 2 34
Short read output format
Read ID
Sequence
Quality line
March 2012
![Page 35: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/35.jpg)
TRiG Curriculum: Lecture 2 35
Quality control is critical
Just another laboratory test
March 2012
![Page 36: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/36.jpg)
TRiG Curriculum: Lecture 2 36
Measuring Accuracy• Phred is a program that assigns a quality score to
each base in a sequence. These scores can then be used to trim bad data from the ends, and to determine how good an overlap actually is.
• Phred scores are logarithmically related to the probability of an error: a score of 10 means a 10% error probability; 20 means a 1% chance, 30 means a 0.1% chance, etc.
– A score of 20 is generally considered the minimum acceptable score.
March 2012
![Page 37: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/37.jpg)
TRiG Curriculum: Lecture 2 37
Workflow
Image processing and base calling
Raw Data Analysis
Alignment to reference genome
Whole Genome Mapping
Detection of genetic variation(SNPs, Indels, Insertions)
Variant Calling
Linking variants to biological information
Annotation
March 2012
![Page 38: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/38.jpg)
TRiG Curriculum: Lecture 2 38
Alignment/Mapping
…CCATAGGCTATATGCGCCCTATCGGCAATTTGCGGTATAC…GCGCCCTA
GCCCTATCGGCCCTATCG
CCTATCGGACTATCGGAAA
AAATTTGCAAATTTGC
TTTGCGGTTTGCGGTA
GCGGTATA
GTATAC…
TCGGAAATTCGGAAATTT
CGGTATAC
TAGGCTATA
GCCCTATCGGCCCTATCG
CCTATCGGACTATCGGAAA
AAATTTGCAAATTTGC
TTTGCGGT
TCGGAAATTCGGAAATTTCGGAAATTT
AGGCTATATAGGCTATATAGGCTATAT
GGCTATATGCTATATGCG
…CC…CC…CCA…CCA…CCAT
ATAC…C…C…
…CCAT…CCATAG TATGCGCCC
GGTATAC…CGGTATAC
GGAAATTTG
…CCATAGGCTATATGCGCCCTATCGGCAATTTGCGGTATAC…ATAC……CC
GAAATTTGC
Read depth is critical for accurate reconstruction
March 2012
![Page 39: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/39.jpg)
TRiG Curriculum: Lecture 2 39
Alignment approachesAligner DescriptionIllumina platform ELAND Vendor-provided aligner for Illumina data Bowtie Ultrafast, memory-efficient short-read aligner for Illumina data
Novoalign A sensitive aligner for Illumina data that uses the Needleman–Wunsch algorithm
SOAP Short oligo analysis package for alignment of Illumina data MrFAST A mapper that allows alignments to multiple locations for CNV
detectionSOLiD platform Corona-lite Vendor-provided aligner for SOLiD data SHRiMP Efficient Smith–Waterman mapper with colorspace correction
454 Platform Newbler Vendor-provided aligner and assembler for 454 data SSAHA2 SAM-friendly sequence search and alignment by hashing
program BWA-SW SAM-friendly Smith–Waterman implementation of BWA for
long readsMulti-platform
BFAST BLAT-like fast aligner for Illumina and SOLiD data BWA Burrows-Wheeler aligner for Illumina, SOLiD, and 454 data Maq A widely used mapping tool for Illumina and SOLiD; now
deprecated by BWA
Koboldt DC, et al. Brief Bioinform 2010 Sep;11(5):484-98
March 2012
![Page 40: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/40.jpg)
TRiG Curriculum: Lecture 2 40
Short read alignmentGiven a reference and a set of reads, report at
least one “good” local alignment for each read if one existsApproximate answer to question: where in genome did read
originate?
…TGATCATA… GATCAA
…TGATCATA… GAGAAT
better than
• What is “good”? For now, we concentrate on:
…TGATATTA… GATcaT
…TGATCATA… GTACAT
better than
– Fewer mismatches = better
– Failing to align a low-quality base is better than failing to align a high-quality base
March 2012
![Page 41: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/41.jpg)
TRiG Curriculum: Lecture 2 41
Post alignment: what do you get?
Alignment of reads including read pairs
SAM file
Read Pair
CIGAR field
Simplified pileup output
Li H, et al. Bioinformatics. 2009;25:2078
March 2012
![Page 42: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/42.jpg)
TRiG Curriculum: Lecture 2 42
Workflow
Image processing and base calling
Raw Data Analysis
Alignment to reference genome
Whole Genome Mapping
Detection of genetic variation(SNPs, Indels, Insertions)
Variant Calling
Linking variants to biological information
Annotation
March 2012
![Page 43: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/43.jpg)
TRiG Curriculum: Lecture 2 43
Discovering Genetic Variation
SNPs
ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGA CGGTGAACGTTATCGACGATCCGATCGAACTGTCAGC GGTGAACGTTATCGACGTTCCGATCGAACTGTCAGCG
TGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGCTGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGCTGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGC
GTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCTTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT
ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCTGATCGATCGATCGATGCTAGTG TTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT
TCGACGATCCGATCGAACTGTCAGCGGCAAGCTGATATCCGATCGAACTGTCAGCGGCAAGCTGATCG CGATTCCGATCGAACTGTCAGCGGCAAGCTGATCG CGATC TCCGATCGAACTGTCAGCGGCAAGCTGATCGATCGA
GATCGAACTGTCAGCGGCAAGCTGATCG CGATCGA AACTGTCAGCGGCAAGCTGATCG CGATCGATGCTA
TGTCAGCGGCAAGCTGATCGATCGATCGATGCTAG
INDELs
ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGA
TCAGCGGCAAGCTGATCGATCGATCGATGCTAGTG
reference genome
March 2012
![Page 44: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/44.jpg)
TRiG Curriculum: Lecture 2 44March 2012
![Page 45: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/45.jpg)
TRiG Curriculum: Lecture 2 45March 2012
![Page 46: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/46.jpg)
TRiG Curriculum: Lecture 2 46
Workflow
Image processing and base calling
Raw Data Analysis
Alignment to reference genome
Whole Genome Mapping
Detection of genetic variation(SNPs, Indels, Insertions)
Variant Calling
Linking variants to biological information
Annotation
March 2012
![Page 47: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/47.jpg)
TRiG Curriculum: Lecture 2 47
Where to go to annotate genomic data, determine clinical relevance?
• Online Mendelian Inheritance in Man (http://www.ncbi.nlm.nih.gov/omim)
• International HapMap project (http://hapmap.ncbi.nlm.nih.gov)
• Human genome mutation database (http://www.hgvs.org/dblist/glsdb.html)
• PharmGKB (http://www.pharmgkb.org)• Scientific literature
March 2012
![Page 48: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/48.jpg)
TRiG Curriculum: Lecture 2 48
Case-control study design = variable results
•Need for Clinical Grade Database•Ease of use•Continually updated•Clinically relevant SNPs/variations
Ng PC, et al. Nature. 2009; 461: 724
March 2012
![Page 49: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/49.jpg)
TRiG Curriculum: Lecture 2 49
Cancer Treatment: NGS of Tumor
Jones SJM, et al. Genome Biol. 2010;11:R82.
March 2012
![Page 50: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/50.jpg)
Case History
• 78 year old male• Poorly differentiated
papillary adenocarcinoma of tongue
• Metastatic to lymph nodes
• Failed chemotherapy• Decision to use next-
generation sequencing methods
50TRiG Curriculum: Lecture 2March 2012
![Page 51: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/51.jpg)
TRiG Curriculum: Lecture 2 51
Workflow
Image processing and base calling
Raw Data Analysis
Alignment to reference genome
Whole Genome Mapping
Detection of genetic variation(SNPs, Indels, Insertions)
Variant Calling
Linking variants to biological information
Annotation
March 2012
![Page 52: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/52.jpg)
Methods and Results
• Analysis– Whole genome– Transcriptome
• Findings– Upregulation of
RET oncogene– Downregulation of
PTEN
52TRiG Curriculum: Lecture 2March 2012
![Page 53: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/53.jpg)
Transcriptome and Whole-exome
• Transcriptome– Convert RNA to cDNA– Perform sequencing– Only expressed genes– Can get expression levels
• Whole-exome– Use selection procedure to
enrich exons– No intron data– Results depends on
selection procedure
53
Martin JA, Wang Z. Nat Rev Genet. 2011; 12:671.
TRiG Curriculum: Lecture 2March 2012
![Page 54: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/54.jpg)
A few words about samples…
• Can use formalin-fixed paraffin-embedded tissue for whole-exome or transcriptome sequencing
• Need frozen tissue for whole-genome sequencing– Better quality DNA
• Small quantity of DNA needed – For whole-exome sequencing,
amount off a few slides
54TRiG Curriculum: Lecture 2March 2012
![Page 55: Lecture II: Genomic Methods](https://reader035.fdocuments.net/reader035/viewer/2022081520/56815b60550346895dc947af/html5/thumbnails/55.jpg)
Summary• Microarrays
– SNPs– Expression profiling– Copy number variation
• Major steps in NGS– Base calling– Alignment– Variant calling– Annotation
• Technology will change but just another test– Accuracy– Precision– Need to validate findings with
traditional methods
Roychowdhury S, et al. Sci Transl Med. 2011; 3: 111ra121
55TRiG Curriculum: Lecture 2March 2012