1

Lateral Transfer of Genes for RDX Degradation 1

Running Title: 2

Keywords: 3

4

Peter Andeer1, David A. Stahl

1,2, Neil C. Bruce

3, Stuart E. Strand

1,4* 5

6

1. Department of Civil and Environmental Engineering, University of Washington, 7

201 More Hall, Seattle, WA 98195-2700 8

2. Department of Microbiology, University of Washington, Seattle, WA 98195-7242 9

3. Center for Novel Agricultural Products, Department of Biology, University of 10

York, York YO10 5YW, United Kingdom

11

4. College of Forest Resources, University of Washington, Seattle, WA 98195-2100

12

13

Phone: +1 (206) 543-5350 14

Email: sstrand@u.washington.edu 15

16

17

18

19

20

21

22

23

Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02396-08 AEM Accepts, published online ahead of print on 6 March 2009

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2

Abstract 1

Recent studies demonstrated that degradation of the military explosive hexahydro-1,3,5-2

trinitro-1,3,5-triazine (RDX) by species of Rhodococcus, Gordonia, and Williamsia is 3

mediated by a novel cytochrome P450 with a fused flavodoxin reductase domain (XplA) 4

in conjunction with a flavodoxin reductase (XplB). Pulse field gel analysis was used to 5

localize xplA to extrachromosomal elements in Rhodococcus and a distantly related 6

Microbacterium (strain MA1). Comparison of R. rhodochrous 11Y and Microbacterium 7

plasmids sequences in the vicinity of xplB and xplA showed near identity (6710 of 6721 8

bp). Sequencing of the associated 52.2 kb region of the Microbacterium plasmid (pMA1) 9

revealed flanking IS elements and additional genes implicated in RDX uptake and 10

degradation. 11

12

13

14

15

16

17

18

19

20

21

22

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

3

Introduction 1

Past practices of production, application, and disposal of RDX have resulted in 2

widespread contamination. Environmental contamination is aggravated by its high 3

mobility, contributing to more widespread contamination of groundwater than by other 4

commonly used explosives (27). Ingestion or inhalation of RDX is associated with 5

neurological disorders and organ failure (38), and exposed wildlife show behavioral 6

changes and suffer liver and reproductive damage (38). The U.S. Environmental 7

Protection Agency (EPA) has classified RDX as a possible human carcinogen (37). 8

These adverse effects have provided motivation to better understand the microbiology 9

and biochemistry of RDX degradation. 10

11

As yet there is relatively limited information concerning natural rates or mechanisms of 12

microbial RDX degradation that are needed to predict or control rates of degradation in 13

the environment. Of the three general pathways for RDX degradation or transformation 14

based on metabolite analysis outlined in the review by Crocker and associates (6), aerobic 15

degradation initiated by XplA is among the better-characterized systems. This enzyme, a 16

novel cytochrome P450, with a fused flavodoxin reductive domain (18, 33), was first 17

identified by Seth-Smith et al. in Rhodococcus rhodochrous 11Y to be encoded by xplA 18

(33). This gene has been identified in 24 bacterial isolates of the Corynebacterineae 19

capable of utilizing RDX as a sole nitrogen source (4, 25, 32-34). While mammalian 20

nitric oxide synthase (NOS) family enzymes are known to be P450-like enzymes with 21

fused flavodoxin domains, there are very few identified examples of this type of protein 22

fusion among characterized microbial species (2, 15, 18, 24). Subsequent studies by 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4

Jackson and associates (18) demonstrated that XplA, in association with an electron 1

transferring flavodoxin reductase (XplB), functions to efficiently denitrate RDX 2

aerobically to the aliphatic nitramine 4-nitro-2,4-diazabutanal (NDAB) (18). NDAB has 3

been shown to serve as a viable nitrogen source for Methylobacterium sp. strain JS178 4

(13) and degraded by Phanerochaete chrysosporium (11). Thus, complete mineralization 5

often appears to be mediated by multiple microbial populations. 6

7

The capacity for microbial degradation of recalcitrant organics, many of which are 8

apparently new to the biosphere as a result of chemical manufacture, is often determined 9

by plasmids and associated mobile genetic elements (36, 39). Plasmids serve both as a 10

reservoir of genetic information and to promote metabolic innovation, since their 11

replication is independent of the chromosome and they do not generally encode essential 12

functions. Although it was earlier suggested that genes in Rhodococcus sp. Strain DN22 13

associated with initial steps of RDX degradation are plasmid encoded (5), no direct 14

evidence for an extrachromosomal location was provided. We now show that near-15

identical genes for XplA and XplB are encoded on plasmids in two phylogentically and 16

geographically distinct bacterial isolates - Microbacterium sp. MA1 isolated from North 17

America (Milan, Tennessee, USA) and Rhodococcus rhodochrous 11Y isolated from 18

England (United Kingdom) (33). Thus, these genes are more broadly distributed within 19

the Actinomycetales than previously recognized and the near-identity of gene sequence 20

(6710 of 6721 bp) in these divergent genera is indicative of recent plasmid-mediated 21

transfer. Analysis of approximately 52 kbp of sequence near xplA and xplB in strain 22

MA1 revealed closely linked genes for transport and degradation that are flanked by 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

5

transposable elements, suggesting that plasmid encoded xplA/xplB are part of a larger 1

class I transposable element encoding for both transport and degradation of RDX. 2

3

Materials and Methods 4

5

Enrichment and Isolation. Medium described by Binks et al. (1), with RDX 6

(Accustandard, New Haven, CT) as a sole nitrogen source (110 µM - 250 µM of RDX), 7

was inoculated with soil suspensions from RDX contaminated soil from the Milan Army 8

Ammunition Plant. Excavated soil was added to a 0.1% sodium pyrophosphate solution 9

(1:10 w/v) (16), suspended by vortexing briefly, and shaken for at least 1 hour at ≥200 10

rpm (28oC) before adding to the growth medium (1:100 v/v). RDX degradation was 11

monitored using HPLC and RDX-degrading bacteria were recovered by repeated colony 12

isolation on 1.5% agar plates containing either the enrichment medium or the complex 13

media R2A (29). RDX degradation of individual colonies was confirmed by clearing of 14

RDX overlay plates (Seth-Smith et al. (33)) and by monitoring RDX loss from broth 15

cultures. 16

17

HPLC quantification of RDX. RDX concentrations in cultures were analyzed using a 18

modular Waters HPLC system consisting of a Waters 717+ autosampler, two Waters 515 19

HPLC pumps and a Waters 9926 photodiode array detector. A 4.6 x 250 mm, Waters 20

C18 column was used for separation using run conditions similar to those outlined 21

previously (33) with concentration determined based on absorbance at 240 nm. Peak 22

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6

integration and analysis was conducted using the Millennium32

software (Waters, 1

Milford, MA). 2

3

Growth of Microbacterium sp. MA1 using RDX as a sole nitrogen source. Growth 4

studies using RDX (approximately 190 µM ) as a sole nitrogen source were conducted in 5

triplicate along with a control flask that was not inoculated under conditions described 6

previously (33). Cultures were regularly sampled to monitor turbidity (600 nm) and 7

RDX concentration. Samples taken for RDX determination (800 µl) were processed by 8

first removing cells by centrifugation (20,000 x g for 15 minutes in microcentrifuge) and 9

amending 250 µl of supernatant with 10% w/v sodium azide to a final concentration of 10

0.1% w/v and stored at 4oC until analyzed with HPLC. 11

12

DNA Extraction. For genomic DNA extractions, cultures were grown to late 13

exponential phase before harvest. Cells were recovered by centrifugation (10 min at 14

10,000 x g) and resuspended to approximately 20 mg per ml of sucrose lysis solution 15

(400 mM sucrose, 100 mM EDTA, 100 mM Tris pH 8.0, 1 mg/ ml lysozyme, 120 U/ml 16

Mutanolysin). Following an overnight incubation at 37oC with gentle shaking (100 rpm), 17

cells were lysed using an SDS-proteinase K lysis solution following established protocols 18

(14) followed with RNaseA (0.5µg/ml) incubation, phenol chloroform extraction and 19

DNA precipitation using standard protocols (31). DNA was suspended in Tris-EDTA 20

buffer and concentration estimated by measuring A260 using a NanoDrop ND-1000 21

spectrophotometer (ThermoFisher Scientific, Wilmington, DE). 22

23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

7

PCR amplification cloning, and sequencing. Sequences for xplA were amplified using 1

xplAF (5’-CCGACGTAACTGTCCTGTTCGGAA-3’) and xplAR (5’-2

CGGGTCCGTCCGCCGGCTGGAAGG-3’) as PCR primers as previously described 3

(30). A region of sequence for the R. rhodochrous 11Y FAD/NADH binding domain 4

protein was amplified using dapBF (5’-ATGACGAACATCAGAGCTGTCGT-3’) and 5

dapBR (5’-TTACAGTTCTTCGCGCACGATGTA-3’) primers designed for this study. 6

Well-characterized primers for the bacterial 16S rRNA genes (27F and 1492R) were used 7

to recover sequences for phylogenetic analysis (20). Correct sized amplification products 8

were ligated into the pCR4 vector (Invitrogen, Carlsbad, CA) and transformed using the 9

TOPO-TA cloning kit (Invitrogen). Vector priming sites were used to determine 400 - 10

1100 bps of sequence from each end of an insert using two University of Washington 11

sequencing services. Recombinant colonies were either submitted directly to "High-12

Throughput Sequencing Solutions" (www.htseq.org) or, alternatively, the BigDye v3.1 13

kit (Applied Biosystems, Foster City, CA) was first used to generate product from 14

recombinant plasmid DNA for submission to the sequencing facility maintained by the 15

Department of Biochemistry, University of Washington, Seattle, WA. 16

17

Pulse field gel electrophoresis and Southern analysis. The Bio-Rad CHEF DRII 18

system was used for pulse field gel electrophoresis (PFGE). Cultures of Microbacterium 19

sp. MA1 and Rhodococcus rhodochrous 11Y were grown and harvested from late 20

exponential phase growth LB broth. Cell plugs were molded according to 21

manufacturer’s instructions and embedded in 1% SeaKem Gold agarose dissolved in 0.5x 22

TBE and run for 24 hours at 6 V/cm with a 10 to 100 second switch time ramp at a 120o 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

8

angle with buffer recirculating at 14oC. The S. cerevisiae YNN295 and Lambda Ladder 1

markers (Bio-rad, Hercules, CA) were used as size standards. SybrGreen was used to 2

stain the gel for visualization. 3

4

DNA from the pulse-field gel was transferred to a Magnacharge membrane (Micron 5

Separations Inc, Westborough, MA) by overnight capillary transfer using the alkaline 6

transfer method (31). PCR amplified DNA probe hybridization and detection was done 7

using the Gene Images Alkphos Direct Labeling and Detection System kit (GE 8

Healthcare, Piscataway, NJ) using the CDP-Star chemiluminescent detection reagent (GE 9

Healthcare) by exposing it to Hyperfilm ECL (GE Healthcare). 10

11

Fosmid library construction and sequence analysis. A fosmid library of the 12

Microbacterium sp. MA1 DNA was constructed using the pCC1FOS vector from the 13

CopyControl Fosmid Library Production Kit and Phage T1-Resistant EPI300-T1 E. coli 14

Plating Strain (Epicentre Biotechnologies, Madison, WI) following the instructions 15

provided. Approximately 400 fosmid clones were screened for the xplA gene by PCR 16

amplification using the previously described xplAF/xplAR primer set. A subset of the 17

positive clones were selected for shotgun sequence analysis using the TOPO-TA shotgun 18

sequencing kit with pCR4 vector (invitrogen) following manufacturers instructions. 19

20

Vector priming sites were used for initial end-sequencing of the shotgun library (as 21

previously described) and for subsequent sequencing of subclones. The Sequencher 4.6 22

software (Gene Codes Corp., Ann Arbor, MI) was used for initial assembly. Restriction 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

9

mapping (NotI, KpnI, PvuII, MscI, BamHI, SacI, EcoRI, EcoRV, BsmI, MluI, HindIII, 1

AscI and DraI) was then used to order contigs and to direct subcloning (data not shown) 2

into the TOPO-pCR4 Zero Blunt vector (Invtirogen) and subsequent sequencing. The 3

GenBank accession numbers for the MA1 16S rDNA sequence and partial plasmid 4

(pMA1) sequence are FJ357539 and FJ577793 respectively. 5

6

The fosmid sequence was submitted to the JCVI Annotation Service for automated 7

annotation using the JCVI prokaryotic annotation pipeline. This service includes gene 8

finding using Glimmer, Blast-extend-repraze (BER) searches, HMM searches, TMHMM 9

searches, SignalP predictions and AutoAnnotate. All of this information was stored in a 10

MySQL database and associated files which were downloaded for review and manual 11

annotation using the Manatee manual annotation tool downloaded from SourceForge 12

(manatee.sourceforge.net). Gene predictions were verified using GeneMark.hmm for 13

Prokaryotes (v2.4) using Mycobacterium avium paratuberculosis as a model organism 14

(22). Coding sequence start sites were subsequently changed as needed. Inverted repeats 15

were queried using the Palindrome software (Institut Pasteur and Ressource Parisienne 16

en Bioinformatique Structurale) distributed by Mobyle. 17

18

Phylogenetic Analysis. The ARB software package was used for 16S rRNA gene 19

sequence alignment and tree construction (21). 16S rRNA gene sequences for other RDX 20

degrading bacteria were downloaded from the NCBI database and other bacteria used in 21

the alignment and analysis were imported from the Silva database (28). The PHYLIP 22

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

10

software package was used to determine bootstrap values using the Neighbor-Joining 1

method using the Kimura 2-parameter model (10, 19). 2

3

Results 4

5

Microbacterium sp. MA1 (Figure 1) was isolated from contaminated soil from the Milan 6

Army Ammunitions Plant (Milan, TN) based on its capacity to use RDX as a sole 7

nitrogen source. Growth of MA1 was directly correlated with loss of RDX, with nearly 8

complete degradation (190 - 195 µM initial RDX concentration) after 48 hours 9

(Supplemental Figure S1). PCR analysis of MA1 with primers for xplA produced the 10

predicted 403 bp product. 11

12

Initial characterization of Microbacterium sp. MA1 and R. rhodochrous 11Y DNA by 13

pulse field electrophoresis revealed extrachromosomal elements (putative plasmids) in 14

each, migrating near the 145.5 kb Lambda marker in MA1 (pMA1) and between the 225 15

and 245 kb markers in 11Y (p11Y) (Figure 2A). Both species contained nearly identical 16

xplA sequences that were shown to be localized to the extrachromosomal element by 17

hybridization with a 403 bp xplA-specific gene probe (Figure 2B). This is the first 18

description of xplA outside the Corynebacterineae (Rhodococcus, Gordonia and 19

Williamsia) (4, 33, 34). The near identity of xplA sequences in Microbacterium sp. MA1 20

and Rhodococcus rhodochrous 11Y, despite their very different phylogenetic affiliations 21

(Figure 1), is most consistent with recent lateral transfer of xplA. 22

23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

11

Sequence analysis of approximately 52 kbp of DNA flanking the xplA gene, encoding a 1

cytochrome P450 previously shown to be required for RDX degradation (18, 33), appears 2

to be part of a larger metabolic module (underlined in Figure 3A; pMA1.029 – 3

pMA1.034, Supplemental Figure S2) that shares high similarity with the 7.5 kbp of 4

sequence available for the region near xplA in R. rhodochrous 11Y (Supplemental Figure 5

S3) (33). A coding region (pMA1.057) annotated as a glutathione-independent 6

formaldehyde dehydrogenase (fdhA) (17) found downstream from this region 7

(Supplemental Figure S2) may function in metabolism of formaldehyde, a previously 8

identified product of aerobic RDX metabolism (12, 18, 33, 34). Two closely linked 9

coding regions, Ftsk/SpoIIIE (pMA1.003) and an integrase/ recombinase (pMA1.007), 10

are associated with dimer resolution (9) and a FtsK/SpoIIIE homolog (TcpA) has shown 11

to be essential for transfer of the conjugative plasmid pCW3 in Clostridium perfringens 12

(26), are consistent with localization of xplA to a plasmid. 13

14

The genes associated with RDX degradation also appear to be associated with mobile 15

elements. At least six transposases, encoded by three different types of insertion 16

sequence (IS) elements, are present within the 52 kbp sequence (Figure 3a). Two 17

identical copies (pMA1.028 and pMA1.040) of an ORF encoding a transposase related to 18

TnpA is the only gene encoded by an ISL3 family IS element (designated ISMA1 – 19

Figure 3b) (3, 23). An IS21 family-type IS element (designated ISMA2) carries an ATP 20

binding domain protein (pMA1.037) and an integrase (pMA1.038 - Figure 3c) (23). The 21

remaining three elements (pMA1.015, pMA1.035, and pMA1.042) are related to the 22

IS256 family of transposable elements (Figure 3d) (23), two of which (pMA1.015 and 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

12

pMA1.042) share complete nucleotide identity including 114 bp upstream and 47 bp 1

downstream of each. pMA1.035 is a truncated transposase that is not likely to be active 2

because its DDE sequence motif, a highly conserved acidic amino acid triad found in the 3

catalytic sites of many transposases including pMA1.015 and pMA1.042 (Figure 3d) 4

(23), is incomplete. 5

6

Discussion 7

8

These data have established that genes required for RDX degradation are plasmid 9

encoded and likely part of a class I transposable element as suggested by the presence of 10

several flanking pairs of IS elements. Transposition between plasmids has likely 11

promoted transfer of the capacity for RDX degradation among diverse species, as is now 12

supported by the observation of near identical sequences in two suborders of 13

Actinomycetales. While the flavodoxin domain of XplA has homology (>35% amino 14

acid identity) to several amino acid sequences deposited in GenBank, the P450 domain of 15

XplA protein has significant relationship with only one other deposited sequence (32). 16

The near identity of sequences for the xplA gene and flanking sequences from plasmids 17

from phylogenetically distant members of the Actinomycetales, R. rhodochrous 11Y and 18

Microbacterium sp. MA1, provide compelling evidence for recent lateral transfer. A 19

contribution of functions encoded by plasmids and associated mobile elements to the 20

degradation of xenobiotics is now well established (35). For example, as for genes (atzA, 21

atzB, and atzC) encoding enzymes that transform the herbicide atrazine, a xenobiotic with 22

a triazine backbone, to cyanuric acid (8). However, the discovery of nearly identical gene 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

13

clusters on plasmids carried by phylogenetically divergent microorganisms, 1

independently isolated from different continents, indicates a remarkably rapid 2

dissemination of this novel catabolic activity – possibly within the 70 year period since 3

first environmental contamination. 4

5

Our analysis of a 52 kbp region of the Microbacterium plasmid sequence also suggests 6

that xplA and xplB may be part of a larger gene cluster (pMA1.029 – pMA1.034) 7

associated with RDX degradation. In addition to xplA and xplB, the gene cluster includes 8

a gene highly similar to an E. coli general aromatic amino acid permease (aroP), an 9

FAD/NAD(P) binding domain protein, an aldehyde dehydrogenase domain protein, and 10

an acetyl-CoA synthetase homolog. The proximity of the aroP gene to xplA, suggests a 11

potential role in the cellular uptake of RDX. The remaining genes in the cluster are less 12

likely to be directly involved in RDX degradation as in vitro experiments have shown 13

XplB and XplA are capable of breaking down RDX (18). However, a formaldehyde 14

dehydrogenase (pMA1.057) located on pMA1 outside the described gene cluster could 15

aid the cell through removal of the toxin formaldehyde, an identified degradation product 16

along with nitrite and NDAB in the xplA-bearing isolates: R. rhodochrous 11Y, 17

Rhodococcus sp. Strain DN22, Williamsia sp. KTR4, Gordonia sp. KTR9, as well as in 18

vitro experiments using XplB and XplA (11, 12, 18, 33, 34). 19

20

The xplA gene has been found in almost every bacterial isolate that aerobically uses RDX 21

as a nitrogen source (18, 25, 32-34) and has been recovered from RDX contaminated 22

soils (Andeer et al., unpublished observations) suggesting that this gene should provide a 23

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

14

useful monitoring tool in applications of bioremediation. Recognition that XlpA is 1

plasmid encoded and likely part of a larger metabolic module carried on a transposable 2

element could provide a foundation for better process control, for example, by promoting 3

environmental conditions that foster its transfer among resident microbial populations. 4

The presence of several IS elements in the vicinity of the xplA gene cluster also suggests 5

that these genes could be readily integrated into different broad range plasmids for 6

selective transfer to disparate microbial species (7). 7

8

Acknowledgements 9

10

This research was funded by the Strategic Environmental Research and Development 11

Program of the Department of Defense project number ER-1504. We would like to thank 12

Jose de la Torre, Sergey Stolyar and Nicolas Pinel for their advice and assistance and 13

Helena Seth-Smith for providing the pHSX1 sequence. Also, we would like to thank 14

JCVI for providing the JCVI Annotation Service which performed the initial automatic 15

annotation and provided the Manatee tool for manual annotation. 16

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

15

References

1. Binks, P. R., S. Nicklin, and N. C. Bruce. 1995. Degradation of hexahydro-

1,3,5-trinitro-1,3,5-triazine (RDX) by Stenotrophomonas maltophilia PB1. Appl.

Environ. Microbiol. 61:1318-1322.

2. Cao, P. R., H. Bulow, B. Dumas, and R. Bernhardt. 2000. Construction and

characterization of a catalytic fusion protein system: P-45011(beta)-adrenodoxin

reductase-adrenodoxin. Biochim. Biophys. Acta 1476:253-264.

3. Cirillo, J. D., R. G. Barletta, B. R. Bloom, and W. R. Jacobs Jr. 1991. A novel

transposon trap for mycobacteria: isolation and characterization of IS1096. J.

Bacteriol. 173:7772-7780.

4. Coleman, N. V., D. R. Nelson, and T. Duxbury. 1998. Aerobic biodegradation

of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) as a nitrogen source by a

Rhodococcus Sp., Strain DN22. Soil Biol. Biochem. 30:1159-1167.

5. Coleman, N. V., J. C. Spain, and T. Duxbury. 2002. Evidence that RDX

biodegradation by Rhodococcus strain DN22 is plasmid-borne and involves a

cytochrome P-450. J. Appl. Microbiol. 93:463-472.

6. Crocker, F. H., K. J. Indest, and H. L. Fredrickson. 2006. Biodegradation of

the cyclic nitramine explosives RDX, HMX, and CL-20. Appl. Microbiol.

Biotechnol. 73:274-290.

7. Davison, J. 1999. Genetic exchange between bacteria in the environment.

Plasmid 42:73-91.

8. de Souza, M. L., J. Seffernick, B. Martinez, M. J. Sadowsky, and L. P.

Wackett. 1998. The atrazine catabolism genes atzABC are widespread and highly

conserved. J. Bacteriol. 180:1951-1954.

9. Errington, J., J. Bath, and L. J. Wu. 2001. DNA transport in bacteria. Nat. Rev.

Mol. Cell Biol. 2:538-544.

10. Felsenstein, J. 1989. PHYLIP - phylogeny inference package (version 3.2).

Cladistics 5:164-166.

11. Fournier, D., A. Halasz, J. Spain, R. J. Spanggord, J. C. Bottaro, and J.

Hawari. 2004. Biodegradation of the hexahydro-1,3,5-triazine ring cleavage

product 4-nitro-2,4-diazabutanal by Phanerochaete chrysosporium. Appl.

Environ. Microbiol. 70:1123-1128.

12. Fournier, D., A. Halasz, J. C. Spain, P. Fiurasek, and J. Hawari. 2002.

Determination of key metabolites during biodegradation of hexahydro-1,3,5-

trinitro-1,3,5-triazine with Rhodoccus sp. Strain DN22. Appl. Environ. Microbiol.

68:166-172.

13. Fournier, D., S. Trott, J. Hawari, and J. Spain. 2005. Metabolism of the

aliphatic nitramine 4-nitro-2,4-diazabutanal by Methylobacterium sp. Strain

JS178. Appl. Environ. Microbiol. 71:4199-4202.

14. Gerhardt, P. 1994. Methods for general and molecular bacteriology. American

Society for Microbiology, Washington, D.C.

15. Hunter, D. J. B., G. A. Roberts, T. W. B. Ost, J. H. White, S. Muller, N. J.

Turner, S. L. Flitsch, and S. K. Chapman. 2005. Analysis of the domain

properties of the novel cytochrome P450RhF. Febs Letters 579:2215-2220.

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16

16. Hurst, C. J., and G. R. Knudsen (ed.). 1997. Manual of environmental

microbiology. ASM Press, Washington, D.C.

17. Ito, K., M. Takahashi, T. Yoshimoto, and D. Tsuru. 1994. Cloning and high-

level expression of the glutathione-independent formaldehyde dehydrogenase

gene from Pseudomonas putida. J. Bacteriol. 176:2483-2491.

18. Jackson, R. G., E. L. Rylott, D. Fournier, J. Hawari, and N. C. Bruce. 2007.

Exploring the biochemical properties and remediation applications of the unusual

explosive-degrading P450 system XplA/B. Proc. Natl. Acad. Sci. U.S.A.

104:16822-16827.

19. Kimura, M. 1980. A simple method for estimating evolutionary rates of base

substitutions through comparative studies of nucleotide-sequences. J. Mol. Evol.

16:111-120.

20. Lane, D. J. 1991. 16S/23S rRNA sequencing. In E. Stackebrandt and M.

Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley

and Sons, New York, N.Y.

21. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A.

Buchner, T. Lai, S. Steppi, G. Jobb, F. Wolfram, I. Brettske, S. Gerber, A.

W. Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. König, T. Liss,

R. Lüßmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis, N.

Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, and K.-H. Schleifer. 2004. ARB: a software environment for sequence data. Nucleic Acids Res.

32:1363-1371.

22. Lukashin, A., and M. Borodovsky. 1998. GeneMark.hmm: new solutions for

gene finding. Nucleic Acids Res. 26:1107-1115.

23. Mahillon, J., and M. Chandler. 1998. Insertion Sequences. Microbiol. Mol.

Biol. Rev. 62:725-774.

24. Munro, A. W., J. G. Lindsay, J. R. Coggins, S. M. Kelly, and N. C. Price.

1996. Analysis of the structural stability of the multidomain enzyme

flavocytochrome P-450 BM3. Biochim. Biophys. Acta 1296:127-137.

25. Nejidat, A., L. Kafka, Y. Tekoah, and Z. Ronen. 2008. Effect of organic and

inorganic nitrogenous compounds on RDX degradation and cytochrome P-450

expression in Rhodococcus strain YH1. Biodegradation 19:313-320.

26. Parsons, J. A., T. L. Bannam, R. J. Devenish, and J. I. Rood. 2007. TcpA an

FtsK/SpoIIIE homolog, is essential for transfer of the conjugative plasmid pCW3

in Clostridium perfringens. J. Bacteriol. 189:7782-7790.

27. Pennington, J. C., and J. M. Brannon. 2002. Environmental fate of explosives.

Thermochim. Acta 384:163-172.

28. Pruesse, E., C. Quast, K. Knittel, B. Fuchs, J. Ludwig, J. Peplies, and F. O.

Glöckner. 2007. SILVA: a comprehensive online resource for quality checked

and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids

Res. 35:7188-7196.

29. Reasoner, D. J., and E. E. Geldreich. 1985. A new medium for the enumeration

and subculture of bacteria from potable water. Appl. Environ. Microbiol. 49:1-7.

30. Rylott, E. L., R. G. Jackson, J. Edwards, G. L. Womack, H. M. B. Seth-

Smith, D. A. Rathbone, S. E. Strand, and N. C. Bruce. 2006. An explosive-

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

17

degrading cytochrome P450 activity and its targeted application for the

phytoremediation of RDX. Nat. Biotechnol. 24:216-219.

31. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual,

3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

32. Seth-Smith, H. M. B., J. Edwards, S. J. Rosser, D. A. Rathbone, and N. C.

Bruce. 2008. The explosive degrading cytochrome P450 system is highly

conserved between strains of Rhodococcus. Appl. Environ. Microbiol. 74:4550-

4552.

33. Seth-Smith, H. M. B., S. J. Rosser, A. Basran, E. R. Travis, E. R. Dabbs, S.

Nicklin, and N. C. Bruce. 2002. Cloning, sequencing, and characterization of the

hexahydro-1,3,5-trinitro-1,3,5-triazine degradation gene cluster from

Rhodococcus rhodochrous. Appl. Environ. Microbiol. 68:4764-4771.

34. Thompson, K. T., F. H. Crocker, and H. L. Fredrickson. 2005. Mineralization

of the cyclic nitramine explosive hexahydro-1,3,5-trinitro-1,3,5-triazine by

Gordonia and Williamsia spp. Appl. Environ. Microbiol. 71:8265-8272.

35. Top, E. M., D. Springael, and N. Boon. 2002. Catabolic mobile genetic

elements and their potential use in bioaugmentation of polluted soils and waters.

FEMS Microbiol. Ecol. 42:199-208.

36. Trefault, N., R. de la Iglesia, A. M. Molina, M. Manzano, T. Ledger, D.

Pérez-Pantoja, M. A. Sánchez, M. Stuardo, and B. González. 2004. Genetic

organization of the catabolic plasmid pJP4 from Ralstonia eutropha JMP134

(pJP4) reveals mechanisms of adaptation to chloroaromatic pollutants and

evolution of specialized chloroaromatic degradation pathway. Environ. Microbiol.

6:655-668.

37. U.S. Environmental Protection Agency. 2006. 2006 edition of the drinking

water standards and health advisories EPA, 822-R-06-013. Office of Water,

Washington, D.C.

38. U.S. Environmental Protection Agency. 2005. Handbook on the management of

munitions response actions EPA, 505-B-01-001. Office of Solid Waste and

Emergency Response, Washington D.C.

39. van der Meer, J. R., W. M. de Vos, S. Harayama, and J. B. Zehnder. 1992.

Molecular mechanisms of genetic adaptation to xenobiotic compounds.

Microbiol. Rev. 56:677-694.

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

18

Figure Legends

Figure 1. Phylogenetic tree of selected RDX degrading bacteria inferred from 16S

rRNA sequence relationships. Phylogenetic relationships of characterized RDX

degrading bacteria that carry xplA and close relatives was inferred by the Neighbor-

Joining method using the Kimura 2-parameter model (10, 19). RDX degraders are shown

in bold. GenBank Accession numbers are in parentheses.

Figure 2. Hybridization of xplA gene probe to Microbacterium sp. MA1 and

Rhodococcus rhodochrous 11Y DNA resolved by pulse field gel electrophoresis. (A)

SYBR Green I stained gel: Microbacterium sp. MA1 (lanes 3 – 7), Rhodococcus

rhodochrous 11Y (lanes 9 – 12), S. cerevisiae YNN295 marker (lanes 1, 15), and

Lambda ladder (lanes 2, 14). (B) Hybridization with a 403 bp fragment of the xplA gene.

Figure 3. Distribution of transposases and IS elements in pMA1. (A) The six ORFs

associated with transposition in the 52 kbp sequence of pMA1 are shown in relation to

xplB/xplA. The apparent metabolic module that xplB/xplA belongs to is underlined in

green. (B) Two identical ISL3 family elements (ISMA1), each encoding a single

transposase (ORFs pMA1.028, pMA1.040). Imperfect indirect repeat and direct repeat

sequences characteristic of ISL3 elements are shown (23). (C) IS21 family element

(ISMA2) encoding an ATP binding domain protein (pMA1.037) and an integrase

(pMA1.038). Direct and indirect repeat sequences are displayed below. Repeat

sequences found throughout the indirect repeats highlighted in blue. (D) Three IS256

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19

family elements shown. pMA1.015 and pMA1.042 and 161 bps of sequence flanking

each share 100% identity encoding a transposase. pMA1.035 is a truncated gene with

incomplete DDE motif, but shares 100% nt identity with portions of pMA1.015 and

pMA1.042.

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

100%

57%

94%

89%

100%

100%

84%

97%

44%

100%

100%

100%

100%

100%

58%

92%

80%

85%

85%

99%

100%

100%

98% Rhodococcus rhodochrous DSM 43241 (X79288)

Rhodococcus rhodochrous (X81936)

Rhodococcus rhodochrous DSM 43274T (X80624)

Rhodococcus rhodochrous 11Y (AF439261)

Rhodococcus sp. YH1 (AF103733)

Rhodococcus sp. Strain DN22 (X89240)

Gordonia amarae (AF020329)

Gordonia sp. KTR9 (DQ068383)

Gordonia rhizospera (AB004729)

Williamsia sp. KTR4 (DQ068382)

Williamsia murale (Y17384)

Mycobacterium poniferae (AF480589)

Mycobacterium smegmatis (AJ536041)

Corynebacterium appendicis (AJ314919)

Corynebacterium mucifaciens (AF480589)

Streptomyces coelicolor (Z76678)

Streptomyces indigocolor (AF346474)

Microbacterium trichotecenolyticum (Y17240)

Microbacterium trichotecenolyticum (AB004722)

Microbacterium sp. MA1 (FJ357539)

Microbacterium flavescens (Y17232)

Microbacterium flavescens (AB004716)

Arthrobacter oxidans (AJ243423)

Arthrobacter rhombi (Y15884)

Bifidobacterium animalis (D86197)

0.10

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

97 kb145.5 kb

225 kb285 kb

1 2 3 4 5 6 7 8 9 101112 1314 15 3 4 5 6 7 8 9 10 1112 1321

(A) (B)

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ISMA1: ISL3 Family IS Element

34172 TCTTTTCA GGCTCTTCACAGTTGAGGGTGTAGCGG 34206

35613 CTACTACACCCCGGTCTGTGAAGAGCC TCTTTTCA 35647

19569 CCGCTACACCCTCAACTGTGAAGAGCC GGTTATAC 1960318128 GGTTATAC GGCTCTTCACAGACCGGGGTGTAGTAG 18162

tnpA

istAistB L4 L3 L2 L1 DRDR R1 R2 R3 R4 R5

ISMA2: IS21 Family IS Element

tnp

tnp

tnp

#1

#2

#3

#4

#5

#6

Trasnsposases: IS256 Family

#1 & #6 Transposases, and114 bp

upstream and 47 bp downstream

that share 100% Identity

Truncated gene (incomplete DDE)

with 100% identity to parts of

ORFs pMA1.015 & pMA1.042

(A)

(B)

(C) (D)

#1 #2 #3 #4 #5 #6

xplB/xplA

31504 GATGGT

R1 GTCAAGGGCCAGTAGGAA

R2 CTGCCCAGTGGCGGTCATGAGAC

R3 CTGCCCGCTGACGGTCACGAGAA

R4 CTGCCCGGTGGTGGCCATGGGAT

R5 CTGCCCACGGGGGGCTGCGGCCA

L4 CGGGCAGATCCCATGACCGTCAG

L3 CGGGCAGTTCTCATGTCCGCCAG

L2 CGGGCAGCTTCGTGGCCGTCTC

L1 CGGGCAGTTTCTCGTGGCCGCCGACA

GATGGT 34149

General Transposase Arrangement

tnpA

pMA1.028

pMA1.040

pMA1.037 pMA1.038 pMA1.015

pMA1.042

pMA1.035

on April 3, 2020 by guest

http://aem.asm

.org/D

ownloaded from