Sauvage et al., 2011

1

A member of a new Picornaviridae genus is shed in pig feces 2

3

4

Virginie Sauvagea, Meriadeg Ar Gouilha, Justine Chevalb, Erika Muthb, Kevin Parienteb, Ana 5

Burguierea, Valérie Caroc, Jean-Claude Manuguerraa, Marc Eloitb,d,e* 6

7

aInstitut Pasteur, Laboratory for Urgent Responses to Biological Threats, 25 rue du Docteur 8

Roux, F-75724 Paris Cedex 15, France 9 bPathoquest, 28 rue du Docteur Roux, F-75015 Paris, France 10 cInstitut Pasteur, Genotyping of Pathogens and Public Health Platform, 28 rue du Docteur 11

Roux, F-75015 75724 Paris, France 12 dEcole Nationale Vétérinaire d’Alfort, UMR 1161 Virologie ENVA, INRA, ANSES, 7 avenue 13

Général de Gaulle, F-94704 Maisons Alfort, France 14 eInstitut Pasteur, Department of Virology , 28 rue du Docteur Roux, F-75015 Paris, France 15

16

* Corresponding author : Marc Eloit, Department of Virology , 28 rue du Docteur Roux, 17

F-75015 Paris, France 18

tel : 33 1 44 38 92 16 fax : 33 1 40 61 39 40, marc.eloit@pasteur.fr 19

20

KEYWORDS: Picornaviridae, SPaV1, swine, piglet, industrial farm 21

RUNNING TITLE: A new Picornaviridae genus discovered in piglets feces 22

23

24

25

26

27

28

29

30

31

32

33

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.00046-12 JVI Accepts, published online ahead of print on 11 July 2012

Sauvage et al., 2011

ABSTRACT 34

35

During a study of the fecal microbiome from two healthy piglets using high 36

throughput sequencing (HTS), we identified of a viral genome containing an open reading 37

frame encoding a predicted polyprotein of 2133 amino acids. This novel viral genome 38

displayed the typical organization of picornaviruses containing three structural proteins (VP0, 39

VP3 and VP1) followed by seven non-structural proteins (2A, 2B, 2C, 3A, 3B, 3Cpro and 40

3Dpol). Given its particular relationship with Parechovirus, we propose to name it “Pasivirus” 41

for “Parecho sister-clade virus” with the “Swine Pasivirus 1” (SPaV1) as type species. Fecal 42

samples collected in an industrial farm from healthy sows and piglets from the same herd (25 43

and 75, respectively) of ages ranging from 4 to 28 weeks old were analyzed for the presence 44

of SPaV1 by one-step RT-PCR targeting a 3D region of 151 pb. SPaV1 was detected in fecal 45

samples from 51/75 healthy piglets (68% of animals) and in none of the 25 fecal samples 46

from healthy sows, indicating that SPaV1 circulates through enteric infection of healthy 47

piglets. We propose that SPaV1 represents the first member of a novel Picornaviridae genus 48

related to parechoviruses.49

33

INTRODUCTION 50

51

Members of the Picornaviridae family are small, non-enveloped viruses, with a 52

genomic positive single-stranded RNA, responsible for several human and veterinary 53

diseases. As of 2009, the International Committee on Taxonomy of Viruses (ICTV) 54

recognized twelve genera within the Picornaviridae family, namely: Enterovirus, 55

Cardiovirus, Aphtovirus, Hepatovirus, Parechovirus, Erbovirus, Kobuvirus, Teschovirus, 56

Sapelovirus, Senecavirus, Tremovirus and Avihepathovirus (www.picornaviridae.com). 57

However, recent developments of high-throughput sequencing (HTS) identified numerous 58

Picornaviridae species, among which several sequences were proposed as prototype for novel 59

genera. At least eleven novel genera have been proposed to belong to the Picornaviridae 60

family in recent literature: “Cosavirus” (7, 20), “Salivirus” (16, 21, 36, 51) in Human, 61

“Orthoturdivirus” and “Paraturdivirus” in wild birds (58), “Mosavirus” and “Rosavirus” in 62

wild rodents (44), an unnamed genus in ringed seal (SePV-1) (26), an agent responsible for 63

hepatitis in turkey poults (22), two unnamed genera harbored by bats (32) and a virus 64

described in domestic cat (FePV) (33). Very recently, the Picornaviridae study group 65

suggested that the proposed species “seal picornavirus 1” (SePV1) be named “seal 66

aquamavirus A1” and classified in a new proposed genus called “Aquamavirus” and that the 67

proposed species “Turkey hepatitis virus” be classified in the proposed “Megrivirus” genus. 68

Candidate species have also been reported within the genus Kobuvirus in pig (46), dog (27, 69

34) and rodent (44), and within the genus Sapelovirus in California seal lion (35). 70

To date, viruses belonging to five genera from the Picornaviridae family are 71

responsible for several diseases in domestic pigs. They are the Encephalomyocarditis virus 72

44

(genus Cardiovirus), the Porcine enterovirus B (Enterovirus), the “Porcine kobuvirus” 73

(Kobuvirus), the Porcine sapelovirus (Sapelovirus, formerly Porcine enterovirus A) and the 74

Porcine teschovirus (Teschovirus, counting only one species) which is recognized as the 75

etiologic agent of polioencephalomyelitis, the most virulent picornaviral infection of pigs. 76

During a study of the fecal microbiome from two healthy piglets using high 77

throughput sequencing (HTS), we identified a viral genome containing an open reading frame 78

encoding a predicted polyprotein of 2133 amino acids (aa) displaying the typical organization 79

of picornaviruses. According to criteria of ICTV (less than 40%, 40% and 50% aa identities in 80

P1, P2 and P3 regions respectively, for genus demarcation), this virus would represent a novel 81

genus in the family Picornaviridae. Given its particular relationship with Parechovirus, we 82

propose to name it “Pasivirus” for “Parecho sister-clade virus” with the “Swine Pasivirus 1” 83

(SPaV1) as type species. In the present article, we show that SPaV1 causes an acute enteric 84

infection of young pigs and report the putative genomic organization and subsequent 85

phylogenetic analysis of its genome. 86

MATERIALS AND METHODS 87

88

Fecal samples 89

Two fecal samples of healthy piglets (“index cases”) were submitted to HTS analysis. 90

Subsequently, a prevalence survey was performed by one-step RT-PCR based on the data 91

obtained from these index cases (for details see “detection of SPaV1 by one-step RT-PCR of 92

3D gene” section). This prevalence study included fecal samples from 25 healthy sows (2 93

years old) and from 75 healthy piglets ranging from 4 to 28 weeks old (3 to 4 piglets per age 94

category). All the fecal samples (sows and piglets) were collected from an industrial pig farm 95

located in the center of France in 2011. 96

97

Extraction and amplification of nucleic acids 98

Fecal samples were diluted (0.1 g/mL) in phosphate-buffered saline (Gibco), vigorously 99

homogenized and centrifuged at 12,000g for 25 minutes at 4°C. The supernatants were micro- 100

filtered (0.45 µm, Sartorius, Goettingen, Germany) to remove residual eukaryotic and 101

bacterial cell-sized particles. The fecal filtrates were then treated with 0.5U/µL of DNaseI 102

(Qiagen) for 2 hours at 37°C in order to digest unprotected nucleic acids. The DnaseI was 103

inactivated by 10 mM EDTA at room temperature. A volume of 100 µL of each fecal filtrate 104

was then extracted using a Nucleospin RNA virus kit (Macherey-Nagel), which allows 105

recovery of both DNA and RNA. The nucleic acids were eluted into 50 µL of RNase-free 106

water and cDNA synthesis step was performed with random hexamer primers (Superscript® 107

III RT, Invitrogen, Inc). The two following steps, ligation of cDNA and nucleic acids 108

amplification by the bacteriophage Phi29 polymerase, were performed as previously 109

described (5). 110

HTS and bioinformatics analysis 111

The HTS and the bioinformatics analysis were performed as previously described (5). Briefly, 112

sequencing was conducted on an Illumina® HiSeq-2000 sequencer (GATC Biotech AG, 113

Konstanz, Germany) with a mean depth per sample of 29 ×106 paired-end reads of 96 nt in 114

length (range 25-37 ×106). The whole porcine genome (SGSC - Sscrofa9.2/susScr2) from 115

http://www.genome.ucsc.edu/ was used as reference sequence for pig sequences mapping 116

conducted by SOAPaligner. 117

118

Viral genome sequencing and analysis 119

Twelve specific primer pairs (Table 1) were designed from contigs obtained by HTS to 120

amplify and determine the nucleotide sequence of SPaV1. All PCR amplifications were 121

performed by using the Taq Core kit (MPBio, Illkrich, France) following the manufacturer's 122

instructions. PCR products were sequenced directly using the Big Dye Terminator v1.1 cycle 123

sequencing kit (Applied Biosystems). Sequence chromatograms from both strands were 124

obtained on automated sequence analyzer ABI3730 XL (Applied Biosystems). Attempts to 125

acquire the end of the 3D polymerase and 3’ UTR were made by three methods: i) a Ligation-126

Anchored PCR (LA-PCR) method (3), ii) a 3’ step-out rapid amplification of cDNA ends (3’ 127

step-out RACE) according to the published protocol of Matz D et al. (39) and iii) a novel 128

method using a combination of single strand DNA circularization and rolling circle 129

amplification (RCA) (55). Briefly, LA-PCR involves the ligation of an oligonucleotide by T4 130

RNA Ligase (Ambion) to the 3’ end of RNA before synthesis of cDNA. This method allows 131

the reverse transcription of nonpolyadenylated RNA virus genome. For the 3’ step-out RACE, 132

the 3’ UTR of the genome was amplified with an oligo-dT primer and a specific forward 133

primer (5’-ATATGACTGTTCTTGAGGAGGAG-3’). The method based on template 134

circularization and RCA, used cDNA as template and a specific extension primer (EP) 5’ end 135

phosphorylated. ssDNA was generated with Phusion High-Fidelity DNA Polymerase (New 136

England Biolabs) and self-ligated by using the CircLigase enzyme (Epicentre 137

Biotechnologies). This step was followed by RCA using Phi29 DNA polymerase, yielding 138

linear concatemeric DNA which served as template for inverse-PCR. This PCR involved two 139

set of primers (P2-P3 and P1-P3) listed in Table 2. The detailed protocol is available upon 140

request. 141

The putative proteolytic cleavage sites were predicted by submitting the polyprotein sequence 142

to the analysis performed by the NetPicoRNA prediction server 143

(http://www.cbs.dtu.dk/services/NetPicoRNA/). The protein sequences were aligned using 144

Jalview 11.0 (56). The whole polyprotein of SPaV1 was used as reference in a sliding window 145

analysis implemented in the RAT software (11) (Figure S1, supplemental data). The complete 146

coding sequence of SPaV1 has been deposited in Genbank database under the accession 147

number JQ316470. 148

149

Phylogenetic analysis 150

All complete available amino acid sequences of the polyproteins of Picornaviridae were 151

aligned in a matrix counting up to 92. Complete reference sequences were used when 152

applicable but the matrix was not restricted to reference sequences and the taxa diversity was 153

optimized by including only reference sequence for well-described genera or lower taxonomic 154

levels. Taxa recently described were also included as they may carry valuable information on 155

the diversity of the corresponding group. A sequence of a picornavirus isolated from fish 156

(bluegill virus Montana lake) (2) was used for alignment and tree rooting (GenBank accession 157

number JX134222). A screening of putative recombination breakpoint was performed using 158

RDP3 package prior to phylogenetic analyzes (38). This aligned matrix was then sliced 159

following each protein’s orf encoded in the genome taxa and redundant gene sequences were 160

excluded from the analysis. Protein matrices were constituted in accordance with conserved 161

amino acid motifs reported to be characteristic of proteins start and end for each reference 162

sequence. Other taxa were aligned to these reference sequences by several iterations of multi-163

alignment performed under the Muscle algorithm implemented in Seaview software version 164

4.2.11 (15). Sea-Al software version 2.0a11 was also used to edit the matrices 165

(http://tree.bio.ed.ac.uk/software/seal/). Reading frame was respected for subsequent analyzes 166

and phylogenetic tests. Matrices were converted back to their nucleotidic sequences before 167

computing likelihood scores and ranking the 88 model tests according to the Akaike 168

Independent (corrected) Criterion (AIcC) calculated with the jModelTest software version 169

0.1.1 (43). The best matrix fitted model was then used as tree prior in following analyzes. 170

Other specified priors included a relaxed uncorrelated lognormal clock and the Yule 171

speciation process. Matrices were submitted to a maximum of 30,000,000 iterations in order 172

to allow the Markov chain to converge whenever possible. These analyzes were conducted 173

using the BEAST software version 1.6.1 (10). Posterior ESS values and other statistics were 174

extracted to the output files using TreeAnnotator 1.6.1 and investigated using Tracer 1.5 from 175

the Beast package. Resulting trees were edited and visualized in FigTree version 1.3.1 176

(BEAST package). 177

178

Detection of SPaV1 by one-step RT-PCR of 3D gene 179

Nucleic acids were extracted as previously described, except that no DNAse treatment was 180

applied to the fecal filtrates. Primers for prevalence study were selected within the 3D RNA 181

dependant-RNA polymerase gene of SPaV1 genome by using Primer Pro 3.4 software 182

(www.changbioscience.com) (SPaV1.3D.151F: 5’- AAACCATGGCCTGGTGTGCGT-3’ and 183

SPaV1.3D.151R: 5’- TGCCAATCGCAGAGTCAACCT-3). Reverse transcription and PCR 184

were performed using the Superscript One-step RT-PCR Platinum Taq Kit (Invitrogen) 185

according to the manufacturer’s instructions. PCR products of 151 nt were sequenced with 186

both primers to confirm the detection and assess sequence variation. 187

188

Cell culture 189

The micro filtrated (0.22 µm, Sartorius, Goettingen, Germany) fecal filtrates resuspended in 190

PBS were incubated on Vero E6 grown to sub-confluence in MEM media supplemented with 191

120 µg/mL of streptomycin, 120 units/mL of penicillin and 10% of Fœtal Calf Serum (FCS). 192

The occurrence of any cytopathic effect (CPE) was checked on a daily basis during 12 days. 193

The supernatants were extracted and tested by PCR following the protocol described in the 194

previous section. 195

196

RESULTS 197

198

Identification of SPaV1 genome by HTS 199

The Illumina sequencing generated a total of 27,146,966 reads with a mean length of 96 pb. 200

After the host genome filtration and BLAST analyzes against bacterial, viral and generalist 201

NCBI databases, 725 reads matching with various Picornaviridae genomes were assembled 202

into seven contigs (ranging from 206 pb to 3034 pb). These contigs showed a maximum of 42 203

% of amino acids (aa) identities with the best hits reported within the nr NCBI database: the 204

rodent Parechovirus (Ljungan virus - LV), the human parechoviruses type 1 (HPeV1) and 205

type 5 (HPeV5) and the Duck hepatitis A virus (DHV). Based on the sequence of the contigs 206

distributed along the genome, twelve primers pairs (Table 1) were designed and used to 207

generate overlapping PCR products validated on both WTA and cDNA products. The 208

sequencing by the Sanger method gave a resulting sequence of 6896 nt (after excluding the 209

polyadenylated tract), with a 5’ partial untranslated region (UTR) of 378 nt, an open reading 210

frame of 6402 nt encoding a potential polyprotein precursors of 2133 aa and a 3’ UTR of 116 211

nt (Figure 1). The available SPaV1 genomic sequence showed a G + C content of 43.3%, 212

which was similar to the values obtained for the corresponding region of the parechoviruses 213

(HPeV1: 40% and LV : 42%) and related clades (DHV: 43%, Seal Aquamavirus A1: 44%, 214

Porcine teschovirus 1: 45% and turdivirus 1: 47%). A BLASTx analysis on the complete 215

genome of SPaV1 provided 31% aa identity and 50% aa similarity to the LV strain 145 SL. A 216

sliding window analysis on the polyprotein of SPaV1 showed that the identity with the 217

members of closer genera never exceeded 50% (Figure S1, supplemental data). 218

219

Genome organization and coding region of SPaV1 220

The partial 5’ UTR had no sequence homology to any virus recorded in GenBank. This 221

region precedes two putative initiator methionine codons found at nucleotide positions 199 222

and 379. Only the initiator codon at position 379 was surrounded by an optimal Kozak 223

context (RNNAUGG) (29) and therefore interpreted as the start codon of the polyprotein. In 224

picornaviruses, the polyprotein precursor is cleaved by viral protease(s) to yield the mature 225

viral structural and non-structural proteins. Putative cleavage sites of SPaV1 were determined 226

by aligning the aa sequence with the closest known virus (LV) and submitting it to the 227

NetPicoRNA prediction server (4). The predicted cleavage sites of the SPaV1 polyprotein 228

were consistent with that of LV’s polyprotein (strain 145SL) described by Johansson (24). 229

These cleavage sites showed a typical molecular organization of picornaviruses with three 230

structural proteins (VP0, VP3 and VP1) followed by seven non-structural proteins (2A, 2B, 231

2C, 3A, 3B, 3Cpro and 3Dpol) (Figure 1). As observed for Avihepatovirus, Enterovirus, 232

Hepatovirus, Parechovirus, Tremovirus, “Aquamavirus”, “Cosavirus” and “Megrivirus”, 233

SPaV1 does not contain any identifiable leader protein (L). Two predicted cleavage sites, 234

E787/E and Q1372/A define the P1, P2 and P3 coding regions of SPaV1 (Figure 1), which share 235

respectively 17 to 34%, 17 to 29%, and 21 to 29% of aa identities with representatives of 236

other picornaviruses genera (Table S1, supplemental data). The highest identities of the 237

polyprotein were observed with parechoviruses and particularly with LV (33.6, 28.9, 29.2% - 238

for P1, P2, P3 respectively), and with “seal Aquamavirus A1” (22.4, 24.4, 24.6%) and DHV 239

(25.6, 21.3, 27.6%) (Table3). 240

The P1 coding region of SPaV1 contains the “picornavirus capsid protein domain like” (pfam 241

entry: cd00205) and is predicted to be cleaved after Q253 (VP0/VP3), H497 (VP3/VP1) and 242

E787 (VP1/2A) (Figure 1). As observed for the related groups Avihepatovirus, Parechovirus, 243

“Aquamavirus” and more distant groups such as Porcine kobuvirus and others (46, 58), the 244

“VP0” of SPaV1 is probably not cleaved into VP4 and VP2 based on sequence alignment. 245

Similarly to parechoviruses, VP0 does not display the conserved Gxxx[ST] motif for 246

myristylation (6) (Figure 2A), and VP1 does not contain the characteristic [PS]ALxAxETG 247

motif. In addition, VP1 lacked the integrin binding RGD motif [involved in receptor binding] 248

similarly to HPeV3 and LV but in contrast to HPeV1 (57). Consistently to the LV and by 249

contrast to HPeVs, the VP1 protein of SPaV1 contains 2 N-terminal insertions (11- and 4-aa-250

long) and a unique C-terminal extension of 41 aa (43 aa for LV) (Figure 2C). Interestingly, the 251

N-terminal extremity of the VP3 protein (40% aa identity to parechoviruses – Table 3), 252

contained the highly conserved KxKxxRxK motif at position 263 (Figure 2B), recognized to 253

date as a distinctive feature of parechoviruses (57). 254

The P2 polyprotein of SPaV1 was hypothesized to be cleaved after Q916 (2A/2B), Q1041 255

(2B/2C) and Q1372 (2C/3A). The 2A protein shared 43.6% aa identities with the LV, while this 256

score falls to 13% with DHV and “seal Aquamavirus A1” and to 10% with human 257

parechoviruses (Table 3). Furthermore, this 2A protein possessed the canonical cleavage site 258

DXEXNPG804P (47), which is present in Avihepathovirus and “Aquamavirus” as well as in 259

LV but not in HePV. This enzymatic cleavage releases a small 2A1 protein (17 aa) and a 2A2 260

protein (112 aa) of similar sizes than those of LV (20 and 135 aa, respectively). The conserved 261

H-box and NC-box motifs, which are involved in the control of cell proliferation (23), and a 262

putative transmembrane domain are all present in DHV and parechoviruses and absent from 263

the 2A protein of SPaV1. The conserved GXCG motif [characteristic of a trypsin-like 264

proteolytic activity, (31)] was also absent in the 2A of SPaV1. As for other picornaviruses, the 265

2C protein displayed the NTPase motif G1181XXGXGKS (14) and the D1232DLXQ motif 266

required for helicase activity (13). Similarly to DHV, the leucine (L) of the conserved 267

DDLXQ motif was replaced by phenylalanin (F). 268

The P3 of SPaV1 was predicted to be cleaved after Q1462 (3A/3B), Q1487 (3B/3C) and Q1678 269

(3C/3D). Consequently, the P3 polyprotein encodes the characteristic proteins 3A, 3B (VPg, a 270

small genome-linked protein), 3Cpro (protease) and 3Dpol (RNA- dependant RNA polymerase). 271

A pairwise aa sequence analysis showed that the 3A and 3B proteins of SPaV1 shares the 272

highest identities with HPeV1 (24.2%) and HPeV3 (40%), respectively (Table 3). As observed 273

in all picornaviruses described to date, 3B (25 aa) displayed the conserved tyrosine (Y) at 274

position 3 from the putative N-terminus. This amino acid is necessary to covalently link the 5’ 275

UTR extremity of the viral RNA to VPg that acts as a RNA replication primer (1). Similar to 276

the DHV, the “seal Aquamavirus A1” and parechoviruses, the 3C protein of SPaV1 contained 277

the catalytic triad formed by the amino acids H-D-C (12) found at positions 1525, 1563 and 278

1638, respectively. As for other picornaviruses, the GXCG (G1636MCG) and GXH (G1654LH) 279

motifs required for proteolytic activity were identified in 3C of SPaV1 (12). In addition, 3C 280

did not contain the RNA binding motif K[FY]RDI (17). As for all members of the family 281

Picornaviridae, the 3D protein of SPaV1 displayed the four characteristic conserved motifs 282

K1839DELR, GG[LMN]PSG (G1986GMASG, where P is replaced by A), Y2003GDD and 283

F2047LKR (28). 284

285

Phylogenetic analyzes 286

No putative recombination breakpoint was identified in the genome of SPaV1 using RDP3 287

software. According to several regions of the genome (VP0, VP3, VP1, 2C, 3C and 3D), 288

Picornaviridae clusters in three major clades: i) The group infecting fish, used as outgroup, ii) 289

the cluster composed by the genera Parechovirus, Avihepatovirus and “Aquamavirus”, 290

infecting birds and mammals, iii) and the clade that clustered all other genera (Figures 3A-3C 291

and S2-S4). Phylogenetic analyzes constantly grouped SPaV1 with Parechovirus and at a 292

lesser extent with Avihepatovirus, “Aquamavirus” and Hepatovirus, enlightening the 293

particular relationship between these clades and the basal origin of these groups within the 294

Picornaviridae family. The analysis of the non-structural proteins (2C, 3C and 3D) identified 295

three to four major clades among Picornaviridae. Among these major clades, SPaV1 296

belonged to the most basal one according to the 2C (Figure S2, supplemental data) and the 3C 297

(Figure S3, supplemental data) but diverged itself from this clade and rooted all others 298

Picornaviridae members according to the 3D (Figure 3A). Despite these differences between 299

proteins, SPaV1 always found its origin closely to the ones of Avihepatovirus and 300

“Aquamavirus” (detected in seal), and, according to the 3C, clustered with Aquamavirus in 301

the sister clade of all parechoviruses (Figure S3, supplemental data). By contrast, analyzes of 302

the capsid proteins (VP0, VP3 and VP1) rooted parechoviruses with SPaV1 without clustering 303

it with another taxon, making the group SPaV1/parechoviruses monophyletic (Figures 3B, 3C 304

and Figure S4 in supplemental data). These capsid proteins phylogenies were globally 305

congruent but differences noted between these fairly distinguishable topologies remained 306

statistically well supported. Other proteins such as the 2A and the 3A did not provide 307

significant results despite several adjustments of the priors and 30,000,000 iterations. 308

Likewise, the 2B region remained of no interest for phylogenetic reconstruction considering 309

the poor significance of the alignment and low posterior probabilities obtained from analyzes 310

of these data (data not shown). 311

312

Prevalence study and genetic variation of SPaV1 313

Fecal samples from healthy sows and piglets from the same herd (25 and 75, respectively) of 314

ages ranging from 4 to 28 weeks old were analyzed for the presence of SPaV1 by one-step 315

RT-PCR targeting a 3D region of 151 pb. SPaV1 was detected in fecal samples from 51/75 316

healthy piglets (68% of animals) and in none of the 25 fecal samples from healthy sows. The 317

prevalence in piglets aged four to eight weeks was 45% (9/20), in piglets aged nine to 318

fourteen weeks 89.47% (17/19), in piglets aged fifteen to twenty weeks 88.23% (15/17) and 319

in piglets aged twenty-one to twenty-eight weeks 52.63% (10/19) (Figure 4). This distribution 320

is reminiscent of the enteric viruses transmitted after the disappearance of maternal 321

antibodies, as observed for the Hepatitis E virus (8). Among the 51 positive fecal samples for 322

SPaV1, 22 were sequenced to assess genetic diversity. Nucleotide differences between 323

samples ranged from 0.7% to 9.3%. These results suggested the existence of a wide variety of 324

strains in the tested industrial farm. 325

326

Cell culture 327

Vero E6 cells were inoculated with the fecal supernatants of the two index piglets from which 328

the virus was identified. Cytopathic effect (CPE) was not observed either during the first or 329

the second passages and the PCRs on the supernatants were negative. 330

331

DISCUSSION 332

We report the nucleotide sequence and the predicted polyprotein of a novel swine 333

picornavirus identified in stool samples of healthy piglets by an HTS method. A recent study 334

has shown that RNA viruses and more precisely Picornaviridae represent the majority of the 335

fecal virome in piglets (50). The genome of this novel virus, called SPaV1 presents the typical 336

genome organization of a member of the Picornaviridae family, mixing characteristics of the 337

two Parechovirus sub-clades: the Human Parechovirus (HPeV) and the Rodent Parechovirus 338

Ljungan virus (LV) species. Interpreted in the light of phylogeny of each protein, these 339

characteristics may reflect the common origin of parechoviruses and SPaV1. Considering the 340

P1, P2 and the P3 proteins, SPaV1 shares less than 40% identity with the LV, the closest taxon 341

described to date. The ICTV recommend less than 40% aa identity in the P1 and P2, and less 342

than 50% in the P3 for genus demarcation in Picornaviridae (52). This new taxon fulfills 343

these criteria and can therefore be considered as a new genus in Picornaviridae. 344

The recent discovery of a high ranking taxonomy level represented by the SPaV1 illustrates 345

that our picture of the diversity of this family is still partial. Major viral genera of 346

Picornaviridae are represented in several avian or mammalian species and this host diversity 347

may contribute to viral diversity in addition to other factors such as typical error prone RNA 348

replication system (9). Overall, the diversity of both virus family (12 genera) and hosts (fish, 349

reptiles, mammals and birds) depicts the dynamism of the evolution of Picornaviridae. For 350

the most studied groups such as Enterovirus, recombinations were shown to play a master role 351

in shaping their genome, and this was not restricted to the intra-species level (49). Moreover, 352

the structural and non-structural parts of the genome of enteroviruses were shown to evolve 353

independently, P1 being so far less subjected to recombination (37, 49). Albeit recombination 354

between taxa and even genera might have occurred throughout the genome during the 355

evolution of SPaV1, it seems unlikely that traces of such ancient event would still remain 356

detectable. The SPaV1 and therefore the higher ranked “Pasivirus” genus, originated from one 357

of the earliest differentiated and major clade of the Picornaviridae (Figure 3A, 3B, 3C and S2, 358

S3, S4 in supplemental data). Given the host diversity pattern observed for several most 359

studied clades clustering sometimes several viral genera, it is probable that other pasiviruses 360

may infect birds, rodents primates or other animals (Figure 3A, 3B, 3C and S2, S3, S4 in 361

supplemental data). 362

The clear phylogenetic relationship between the SPaV1 and parechoviruses is consistent with 363

numerous similarities of these taxa. Despite being a potential new genus of Picornaviridae, 364

SPaV1 exhibits features that were considered to date to be characteristic of Parechovirus and 365

more specifically of the LV. The low G+C percentage is consistent with those of 366

parechoviruses and related clades and contrast with those of other Picornaviridae. SPaV1 367

contains only three capsid proteins (VP0, VP3 and VP1) exhibiting remarkable features 368

resembling with those of parechoviruses and seems to be lacking a leader protein. VP3 369

contains the conserved KxKxxRxK motif, considered to date as a characteristic signature of 370

parechoviruses (Figure 2B). This motif belongs to a basic amino acid rich region described as 371

immunogenic in HPeVs (25). Moreover, the VP3 of SPaV1 shares more than 40% identity 372

with the one of LV (Table 3) and the characteristics of other capsid proteins reinforce the 373

proximity of SPaV1 and LV. Among those propinquities, the N-terminal extremity of VP0 is 374

shorter than those of HPeVs and lacks the myristoylation site (Figure 2A). Therefore, this site 375

described as mandatory for efficient viral infectivity of poliovirus (30), is not required for LV 376

and SPaV1. Another capsid protein, the VP1, exhibits two insertions of unknown function at 377

the N-terminal extremity: i) one counting 11 aa previously described in LV (24), and a second 378

motif of 4 aa identified by multi-alignment of SPaV1, LVs and HPeVs (Figure 2C). The C-379

terminal extremity of VP1 contains a unique 41-aa extension (43 aa for the VP1 of the LV) 380

and no RGD motif but a long C-terminal extremity (Figure 2C). To date, RGD is the unique 381

motif associated with the viral entry mediated by integrin within parechoviruses. Among 382

parechoviruses lacking RGD motif, the well-studied HPeV3 has been associated with 383

neuropathology (18). Nevertheless, no strict association between the RGD presence/absence 384

and the neurovirulence of parechoviruses has been demonstrated. The absence of the RGD 385

motif implies the existence of an alternative cell receptor. By contrast with HPeVs, LV shares 386

with SPaV1 a cleaved 2A resulting in the 2A1 and the 2A2 proteins. The 2A1 of SPaV1 387

exhibits a strong homology with the one of the LV. Due to the absence of the GXCG region, 388

the 2A lacks a proteolytic activity and SPaV1 therefore possess a single 3C protease as 389

described for LV. One of the main differences between the 2A2 protein of SPaV1 and 390

parechoviruses consists in the absence of both the H-box/NC motifs and the putative 391

transmembrane domain. 392

No pathogenicity was noted in infected piglets, that is reminiscent of the high frequency of 393

asymptomatic infections for related parechoviruses infecting human or animals. Nevertheless, 394

HPeVs are pathogens frequently associated to various enteric, nervous or respiratory 395

syndromes in young children (48, 53). Another Parechovirus, the LV, was identified in bank 396

voles (Myodes glareolus) in Europe and the United states (19). Interestingly, LV has been 397

proposed as a potential environmental trigger for human type 1 diabetes on the basis of the 398

presence of LV antibodies while LV RNA detection remained negative, suggesting that the 399

etiologic agent of the disease could be a cross reactive virus (40, 41, 54). The spill-over 400

likelihood of such a virus could be greater from domestic animals than from wild animals, as 401

seen for the Hepatitis E virus genotype 3, which is very prevalent but clinically silent in pigs 402

and which frequently infect humans (42). Therefore, SPaV1 or another “Pasivirus” could be a 403

more relevant trigger than LV. 404

Major neutralizing antigenic sites have been located within exposed BC and EF-loops of the 405

capsid proteins and are therefore suspected to shape the immunogenic specificity of 406

picornaviruses (45). These BC- and EF-loops of SPaV1 (Figures 2A-C), exhibit notable 407

differences with LV and other parechoviruses suggesting that cross reactions are unlikely. 408

Therefore, without experimental data, it is difficult to state that cross reaction between LV and 409

SPaV1 or other yet unknown member(s) of this new genus is impossible. 410

SPaV1 was identified in apparently healthy piglets suggesting that this virus present a silent 411

circulation in the investigated farm. Furthermore, the detection in the same farm of several 412

strains (0.7% - 9.3% divergent from SPaV1) suggested that swine is the natural host of this 413

novel and foreseen diversified genus of Picornaviridae. At the individual level, sequencing 414

revealed several polymorphisms within the 3D, denoting a consistent variability. A better 415

picture of the SPaV1 biology, would be achieved through the study of prevalence, tropism, 416

geographic distribution and genetic variation of this new virus. If the zoonotic potential of 417

SPaV1 is attested and despite the absence of any pathogenicity in piglets, the threat to human 418

health should be evaluated considering its circulation in the vicinity of human populations. 419

420

ACKNOWLEDGMENTS 421

422 This study was mainly supported by Programme Transversal de Recherche (PATHODISC 423

301) from the Institut Pasteur (Paris, France) and by grants from region Ile de France. We 424

would like to acknowledge Francis Delpeyroux (Unité postulante Biologie des virus 425

entériques, Institut Pasteur, Paris, France) for fruitful 426

discussions. We also deeply thanks Mickael Hoffman and Marisa Barbknecht (department of 427

microbiology, University of Wisconsin – La Crosse) for kindly providing us with their 428

sequence of the Bluegill picornavirus.429

REFERENCES 430

431

1. Ambros, V., and D. Baltimore. 1978. Protein is linked to the 5' end of poliovirus RNA by a 432

phosphodiester linkage to tyrosine. J. Biol. Chem. 253:5263-5266. 433

434

2. Barbknecht, M. 2009. Characterization of a unclassified virus and survey for its presence 435

in Wisconsin bluegill populations. MSc Thesis, University of Wisconsin-La Crosse, 89 pp. 436

437

3. Beckett, R., and W.A. Miller. 2007. Rapid full-length cloning of nonpolyadenylated RNA 438

virus genomes. Current Protocoles in Microbiology 16F.3.1-16F.3.18. 439

440

4. Blom, N., J. Hansen, D. Blaas, and S. Brunak. 1996. Cleavage site analysis in picornaviral 441

polyproteins: discovering cellular targets by neural networks. Protein. Science. 5:2203-2216. 442

443

5. Cheval, J., V. Sauvage, L. Frangeul, L. Dacheux, G. Guigon, N. Dumey, K. Pariente, C. 444

Rousseaux, F. Dorange, N. Berthet, S. Brisse, I. Moszer, H. Bourhy, J.C. Manuguerra, M. 445

Lecuit, A. Burguiere, V. Caro, and M. Eloit. 2011. Evaluation of high-throughput sequencing 446

for identifying known and unknown viruses in biological samples. J. Clin. Microbiol. 447

49:3268-3275. 448

449

6. Chow, M., J.F. Newman, D. Filman, J.M. Hogle, D.J. Rowlands, and F. Brown. 1987. 450

Myristylation of picornavirus capsid protein VP4 and its structural significance. Nature. 451

327:482-486. 452

453

7. Dai, X.Q., X.G. Hua, T.L. Shan, E. Delwart, and W. Zhao. 2010. Human cosavirus 454

infections in children in China. J. Clin. Virol. 48:228-229. 455

456

8. de Deus, N., M. Casas, B. Peralta, M. Nofrarías, S. Pina, M. Martín, and J. Segalés. 2008. 457

Hepatitis E virus infection dynamics and organic distribution in naturally infected pigs in a 458

farrow-to-finish farm. Vet. Microbiol. 25:19-28. 459

460

9. Domingo, E., C. Escarmís, N. Sevilla, A. Moya, S.F. Elena, J. Quer, I.S. Novella, and J.J. 461

Holland. 1996. Basic concepts in RNA virus evolution. FASEB. J. 10:859-864. Review. 462

463

10. Drummond, A.J., and A. Rambaut. 2007. BEAST: Bayesian evolutionary analysis by 464

sampling trees. BMC Evol Biol 7:214-214. 465

466

11. Etherington, G.J., J. Dicks, and I.N. Roberts. 2005. Recombination Analysis Tool (RAT): 467

a program for the high-throughput detection of recombination. Bioinformatics. 21:278-281. 468

469

12. Gorbalenya, A.E., A.P. Donchenko, V.M. Blinov, and E.V. Koonin. 1989. Cysteine 470

proteases of positive strand RNA viruses and chymotrypsin-like serine proteases. A dinstinct 471

protein superfamily with a common structural fold. FEBS. Lett. 243:103-114. 472

473

13. Gorbalenya, A.E., E.V. Koonin, A.P. Donchenko, and V.M. Blinov. 1989. Two related 474

superfamilies of putative helicases involved in replication, recombination, repair and 475

expression of DNA and RNA genomes. Nucleic. Acids. Res. 17:4713-4730. 476

477

14. Gorbalenya, A.E., E.V. Koonin, and Y.I. Wolf. 1990. A new superfamily of putative NTP-478

binding domains encoded by genomes of small DNA and RNA viruses. FEBS. Lett. 479

262:145-148. 480

481

15. Gouy, M., S. Guindon, and O. Gascuel. 2010. SeaView Version 4: A Multiplatform 482

Graphical User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol. 483

Biol. Evol. 27:221-224. 484

485

16. Greninger, A.L., C. Runckel, C.Y. Chiu, T. Haggerty, J. Parsonnet, D. Ganem, and J.L. 486

DeRisi. 2009. The complete genome of klassevirus - a novel picornavirus in pediatric stool. 487

Virol. J. 6:82. 488

489

17. Hammerle, T., A. Molla, and E. Wimmer. 1992. Mutational analysis of the proposed FG 490

loop of poliovirus proteinas 3C identifies amino acids that are necessary for 3CD cleavage 491

and might be determinants of a function distinct from proteolytic activity. J. Virol. 66:6028-492

6034. 493

494

18. Harvala, H., and P. Simmonds. 2009. Human parechoviruses: biology, epidemiology and 495

clinical significance. J. Clin. Virol. 45:1-9. Review. 496

497

19. Hauffe, H.C., B. Niklasson, T. Olsson, A. Bianchi, A. Rizzoli, and W. Klitz. 2010. 498

Ljungan virus detected in bank voles (Myodes glareolus) and yellow-necked mice 499

(Apodemus flavicollis) from Northern Italy. J. Wildl. Dis. 46:262-266. 500

501

20. Holtz, L.R., S.R. Finkbeiner, C.D. Kirkwood, and D. Wang. 2008. Identification of a 502

novel picornavirus related to cosaviruses in a child with acute diarrhea. Virol. J. 5:159. 503

504

21. Holtz, L.R., S.R. Finkbeiner, G. Zhao, C.D. Kirkwood, R. Girones, J.M. Pipas, and D. 505

Wang. 2009. Klassevirus 1, a previously undescribed member of the family Picornaviridae, 506

is globally widespread. Virol. J. 6:86. 507

508

22. Honkavuori, K.S., H.L. Shivaprasad, T. Briese, C. Street, D.L. Hirschberg, S.K. 509

Hutchison, and W.I. Lipkin. 2011. Novel picornavirus in Turkey poults with hepatitis, 510

California, USA. Emerg. Infect. Dis. 17:480-487. 511

512

23. Hughes, P.J., and G. Stanway. 2000. The 2A proteins of three diverse picornaviruses are 513

related to each other and to the H-rev107 family of proteins involved in the control of cell 514

proliferation. J. Gen. Virol. 81:201-207. 515

516

24. Johansson, S., B. Niklasson, J. Maizel, A.E. Gorbalenya, and A.M. Lindberg. 2002. 517

Molecular analysis of three Ljungan virus isolates reveals a new, close-to-root lineage of the 518

Picornaviridae with a cluster of two unrelated 2A proteins. J. Virol. 76:8920-8930. 519

520

25. Joki-Korpela, P., M. Roivainen, H. Lankinen, T. Pöyry, and T. Hyypiä. 2000. Antigenic 521

properties of human parechovirus 1. J. Gen. Virol. 81:1709-1718. 522

523

26. Kapoor, A., J. Victoria, P. Simmonds, C. Wang, R.W. Shafer, R. Nims, O. Nielsen, and E. 524

Delwart. 2008. A highly divergent picornavirus in a marine mammal. J. Virol. 82:311-320. 525

526

27. Kapoor, A., P. Simmonds, E.J. Dubovi, N. Qaisar, J.A. Henriquez, J. Medina, S. Shields, 527

and W.I. Lipkin. 2011. Characterization of a canine homolog of human aichivirus. J. Virol. 528

85:11520-11525. 529

530

28. Koonin, E.V. 1991. The phylogeny of RNA-dependent RNA polymerases of positive-531

strand RNA viruses. J. Gen. Virol. 72:2197-2206. 532

533

29. Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon 534

that modulates translation by eukaryotic ribosomes. Cell. 44:283-292. 535

536

30. Kräusslich, H.G., C. Hölscher, Q. Reuer, J. Harber, and E. Wimmer. 1990. Myristoylation 537

of the poliovirus polyprotein is required for proteolytic processing of the capsid and for viral 538

infectivity. J. Virol. 64:2433-2436. 539

540

31. Lamphear, B.J., R. Yan, F. Yang, D. Waters, H.D. Liebig, H. Klump, E. Kuechler, T. 541

Skern, and R.E. Rhoads. 1993. Mapping the cleavage site in protein synthesis initiation 542

factor eIF-4 gamma of the 2A proteases from human Coxsackievirus and rhinovirus. J. Biol. 543

Chem. 268:19200–19203. 544

545

32. Lau, S.K., P.C. Woo, K.K. Lai, Y. Huang, C.C. Yip, C.T. Shek, P. Lee, C.S. Lam, K.H. 546

Chan, and K.Y. Yuen. 2011. Complete genome analysis of three novel picornaviruses from 547

diverse bat species. J. Virol. 85:8819-8828. 548

549

33. Lau, S.K., P.C. Woo, C.C. Yip, G.K. Choi, Y. Wu, R. Bai, R.Y. Fan, K.K. Lai, K.H. Chan, 550

and K.Y. Yuen. 2011. Identification of a novel feline picornavirus from the domestic cat. J. 551

Virol. 86:395-404. 552

553

554

34. Li, L., P.A. Pesavento, T. Shan, C.M. Leutenegger, C. Wang, and E. Delwart. 2011. 555

Viruses in diarrhetic dogs include novel kobuviruses and sapoviruses. J. Gen. Virol. 92:2534-556

2541. 557

558

559

35. Li, L., T. Shan, C. Wang, C. Côté, J. Kolman, D. Onions, F.M. Gulland, and E. Delwart. 560

2011. The fecal viral flora of California sea lions. J. Virol. 85:9909-9917. 561

562

36. Li, L., J. Victoria, A. Kapoor, O. Blinkova, C. Wang, F. Babrzadeh, C.J. Mason, P. 563

Pandey, H. Triki, O. Bahri, B.S. Oderinde, M.M. Baba, D.N. Bukbuk, J.M. Besser, J.M. 564

Bartkus, and E. Delwart. 2009. A novel picornavirus associated with gastroenteritis. J. Virol. 565

83:12002-12006. 566

567

37. Lukashev, A.N., V.A. Lashkevich, O.E. Ivanova, G.A. Koroleva, A.E. Hinkkanen, and J. 568

Ilonen. 2005. Recombination in circulating Human enterovirus B: independent evolution of 569

structural and non-structural genome regions. J. Gen. Virol. 86:3281 -3290. 570

571

38. Martin, D.P., P. Lemey, M. Lott, V. Moulton, D. Posada, and P. Lefeuvre. 2010. RDP3: a 572

flexible and fast computer program for analyzing recombination. Bioinformatics 26:2462-573

2463. 574

575

39. Matz, M., D. Shagin, E. Bogdanova, O. Britanova, S. Lukyanov, L. Diatchenko, and A. 576

Chenchik. 1999. Amplification of cDNA ends based on template-switching effect and step-577

out PCR. Nucleic. Acids. Res. 27:1558-1560. 578

579

40. Niklasson, B. 2011. Current views on Ljungan virus and its relationship to human 580

diabetes. J. Med. Virol. 83:1673. doi: 10.1002/jmv.22062. 581

582

41. Niklasson, B., K.E. Heller, B. Schønecker, M. Bildsøe, T. Daniels, C.S. Hampe, P. 583

Widlund, W.T. Simonson, J.B. Schaefer, E. Rutledge, L. Bekris, A.M. Lindberg, S. 584

Johansson, E. Ortqvist, B. Persson, and A. Lernmark. 2003. Development of type 1 diabetes 585

in wild bank voles associated with islet autoantibodies and the novel ljungan virus. Int. J. 586

Exp. Diabesity. Res. 4:35-44. 587

588

42. Pavio, N., and J.M. Mansuy. 2010. Hepatitis E in high-income countries. Curr. Opin. 589

Infect Dis. 23:521-527. Review. 590

591

43. Posada, D. 2008. jModelTest: Phylogenetic Model Averaging. Mol. Biol. Evol. 25:1253 -592

1256. 593

594

44. Phan, T.G., B. Kapusinszky, C. Wang, R.K. Rose, H.L. Lipton, and E. Delwart. 2011. The 595

fecal viral flora of wild rodents. PLoS. Pathog. 7(9):e1002218. Epub 2011 Sep 1. 596

597

45. Racaniello, V.R. 2001. Picornaviridae: the viruses and their replication. In:Knipe DM, 598

Howley PM, Griffin DE, Lamb RA, Matrin MA, Riozman B, Strauss SE. (Eds), Fields 599

Virology. Lippincott Williams &Wilkins, Philadelphia, pp. 658-722. 600

601

46. Reuter, G., A. Boldizsár, and P. Pankovics. 2009. Complete nucleotide and amino acid 602

sequences and genetic organization of porcine kobuvirus, a member of a new species in the 603

genus Kobuvirus, family Picornaviridae. Arch. Virol. 154:101-108. 604

605

47. Ryan, M.D., and M. Flint. 1997. Virus-encoded proteinases of the picornavirus super-606

group. J Gen. Virol. 78:699-723. 607

608

48. Sainato, R., R. Flanagan, S. Mahlen, M. Fairchok, and L. Braun. 2011. Severe human 609

parechovirus sepsis beyond the neonatal period. J. Clin. Virol. 51:73-74. 610

611

49. Santti, J., T. Hyypiä, L. Kinnunen, and M. Salminen. 1999. Evidence of Recombination 612

among Enteroviruses. J. Virol. 73:8741-8749. 613

614

50. Shan, T., L. Li, P. Simmonds, C. Wang, A. Moeser, and E. Delwart. 2011. The fecal 615

virome of pigs on a high-density farm. J. Virol. 85:11697-11708. 616

617

51. Shan, T., C. Wang, L. Cui, Y. Yu, E. Delwart, W. Zhao, C. Zhu, D. Lan, X. Dai, and X. 618

Hua. 2010. Picornavirus salivirus/klassevirus in children with diarrhea, China. Emerg. Infect. 619

Dis. 16:1303-1305. 620

621

52. Stanway, G., F. Brown, P. Christian, T. Hovi, T. Hyypiä, A.M.Q. King, N.J. Knowles, 622

S.M. Lemon, P.D. Minor, M.A. Pallansch, A.C. Palmenberg, and T. Skern. 2005. Family 623

Picornaviridae. In: Virus Taxonomy. Eighth Report of the International Committee on 624

Taxonomy of Viruses. Eds. Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and 625

Ball, L.A. Elsevier/Academic Press, London. p. 757-778. 626

627

53. Stanway, G., P. Joki-Korpela, and T. Hyypiä. 2000. Human parechoviruses-biology and 628

clinical significance. Rev. Med. Virol. 10:57-69. Review. 629

630

54. Tapia, G., O. Cinek, T. Rasmussen, B. Grinde, and K.S. Rønningen. 2010. No Ljungan 631

virus RNA in stool samples from the Norwegian environmental triggers of type 1 diabetes 632

(MIDIA) cohort study. Diabetes. Care. 33:1069-1071. 633

55. Gadkar, V.J., and M. Filion. 2011. A novel method to perform genomic walks using a 634

combination of single strand DNA circularization and rolling circle amplification. J. 635

Microbiol. Methods. 87:38-43. 636

637 56. Waterhouse, A.M., J.B. Procter, D.M.A. Martin, M. Clamp, and G.J. Barton. 2009. 638

Jalview Version 2 - a multiple sequence alignment editor and analysis workbench. 639

Bioinformatics. 25:1189-1191. 640

641

57. Williams, C.H., M. Panayiotou, G.D. Girling, C.I. Peard, S. Oikarinen, H. Hyöty, and G. 642

Stanway. 2009. Evolution and conservation in human parechovirus genomes. J. Gen. Virol. 643

90:1702-1712. 644

645

58. Woo, P.C., S.K. Lau, Y. Huang, C.S. Lam, R.W. Poon, H.W. Tsoi, P. Lee, H. Tse, A.S. 646

Chan, G. Luk, K.H. Chan, and K.Y. Yuen. 2010. Comparative analysis of six genome 647

sequences of three novel picornaviruses, turdiviruses 1, 2 and 3, in dead wild birds, and 648

proposal of two novel genera, Orthoturdivirus and Paraturdivirus, in the family 649

Picornaviridae. J. Gen. Virol. 91:2433-2448. 650

651

FIGURE LEGENDS 652

653

Figure 1 654

Schematic representation of predicted SPaV1 genome organization, including 5' UTR, 3' 655

UTR, P1, P2 and P3 regions. Primer pairs designed from contigs and used to generate 656

overlapping PCR products are distributed along the nucleotidic sequence. Conserved motifs 657

and predicted cleavage sites are indicated along the polyprotein. 658

659

Figure 2 660

Two dimensions structure predictions of the capsid proteins, VP0 (2A), VP3 (2B), VP1 (2C), 661

of the SPaV1 aligned with representatives of parechoviruses [HPeV1 and HPeV3, American 662

(LV64-7855) and Swedish strains (LV87-012, 174F and 145SL) of LV] performed by Jalview 663

11.0. Predicted α-helices and β-strands in SPaVL1 capsid proteins are represented by red and 664

green arrows, respectively. The positions of BC and EF loops are noted above the alignments. 665

Double-headed arrow indicates the shorter N-terminal extremity of VP0 in figure 2A. In 666

figure 2B, the conserved KxKxxRxK motif of VP3 is framed. In the VP1 depicted in figure 667

2C, the two N-terminal aa insertions and the C-terminal aa extension are located by 668

respectively a double pin-headed lines and a dotted double-headed arrow. 669

670

Figures 3 (A, B and C) 671

Phylogenetic analysis of complete VP0, VP1 and 3D (B, C and A, respectively) nucleotide 672

sequences under GTR+G model and relaxed uncorrelated clock implemented in BEAST 673

package. The scale bar unit is expressed in number of substitutions per site, posterior 674

probabilities are reported at the nodes and red color highlights most supported nodes. 675

676

Figure 4 677

Prevalence of SPaV1 on fecal samples from 25 healthy sows and from 75 healthy piglets 678

ranging from 4 to 28 weeks old. The hatched pattern represents weakly positive animals. 679

680

681

Nucleotide position

P1 P2 P3

379 1138 1870 2740 3127 3502 44954765 4840

5413

2A1

6780

A(n)5’UTR 3’UTR

3B

VP0 VP3 2A2 2B 2C 3A 3CPro 3DPolVP1

Contigsposition

Amino acid position

253 497 787 916 1041 13721462

16781487

1

2A1

2133position

VP0 VP3 2A2 2B 2C 3A 3CPro 3DPolVP1Q/G H/G E/E Q/G Q/S Q/A

B

Q/R Q/GQ/G

DxExNPGP GxxGxGKS

DDFGQ GxCG KDELRKxKxxRxK

YGDDFLKR

GGMASG

2133 aa

Rhv-like domain Rhv-like domain

Figure 1

VP0

BC-loop

βB βCβB βC

EF-loop

βE α

Figure 2A

BC lBC-loop

αZ βB βC

EF-loop

βE αB βF

Figure 2B

BC loopBC-loop

βB βC αAβB βC αA

Figure 2CFigure 2C

89 88100

53

80

s (%

)

4553

40

60

tive

anim

als

020

40

tage

of p

osit

0

Sows0

4-8 9-14 15-20 21-28

Perc

ent

Age range in weeks of piglets

Figure 4

Primer name Sequence of forward primer (5’-3’)

Primer name Sequence of reverse primer (5’-3’)

PCR product (bp)

SPaV1.1F

5’-gcttttgaccagtggctctgg-3’

SPaV1.1R

5’-agccgtaggagcagcactatg-3’

531

SPaV1.2F 5’-tgatactgctgaatctggcgg-3’ SPaV1.2R 5’-acccgcagtcagaagaatcag-3’ 566

SPaV1.3F 5’-tcaggtcaatgctgctgcagg-3’ SPaV1.3R 5’-agctgtgaacggtagcaaagg-3’ 598

SPaV1.4F 5’-ctagtgttgcaggcacgagag-3’ SPaV1.4R 5’-cttgacagtgtcaccgcatgg-3’ 572

SPaV1.5F 5’-gttgaaacccgattggctcac-3’ SPaV1.5R 5’-ggagcctcaggcactaacttc-3’ 746

SPaV1.6F 5’-tattcctggtcgccattgcgg-3’ SPaV1.6R 5’-catacatcaagacagggccag-3’ 403

SPaV1.7F 5’-cccccattatggggatattcct-3’ SPaV1.7R 5’-atttcaggagggtacgatccc-3’ 807

SPaV1.8F 5’-cttctgctatggagttgctgg-3’ SPaV1.8R 5’-ccccatacgtggtaaaaccct-3’ 630

SPaV1.9F 5’-ttgaaggattgtgccaccacc-3’ SPaV1.9R 5’-gctagcgcaatagtcgaacac-3’ 900

SPaV1.10F 5’-ccttcttggccctgctgttc-3’ SPaV1.10R 5’-gacaccatctccaaggtctcc-3’ 619

SPaV1.11F 5’-gggtgcttgactataatgggtc-3’ SPaV1.11R 5’-tgccaatcacagagtcaacctc-3’ 597

SPaV1.12F 5’-tcaaggactagtcaccgacac-3’

SPaV1.12R 5’- ccggaacagcttgcaaaagac -3’ 598

Table 1: List of primers designed from contigs used to acquire the genome of SPaV1.

Primer name Sequence of forward primer (5’-3’) Primer name Sequence of reverse primer (5’-3’) SpaV1-EP1 PHO-5’-gagaaagagggatctcgtgcc-3’ SPaV1-P2.CircL1 5’-gagaagattgaacaaggccttac-3’ SPaV1-P3.CircL1 5’-taagctcatctttaaggtgacag-3’ SPaV1-P1.CircL1 5’-aagagtcttttgcaagctgttcc-3’ SPaV1-EP2 PHO-5’-ccacgtcagctcatgatagatg-3’ SPaV1-P2.CircL2 5’-tggaatggcttcaggatcacc-3’ SPaV1-P3.CircL2 5’-ggttacctaccacatgctgtg-3’ SPaV1-P1.CircL2 5’-ggaggagggtgttgagtatac-3’ SPaV1-EP3 PHO-5’-gtcaagcttgatggtgattatcc-3’ SPaV1-P2.CircL3 5’-gtcggtcagtgagtgttttcc-3’ SPaV1-P3.CircL3 5’-gccaacttccatcgctccaac-3’ SPaV1-P1.CircL3 5’-caattaaattcagcaagtatag-3’ Table 2 : List of primers used to complete the end of the SPaV1 genome. Primers EP (SPaV1-EP1, SPaV1-EP2 and SPaV1-EP3) are 5’end phosphorylated (PHO).

Protein

SPaV1

(JQ316470)

Pairwise amino acid identities (%) between SPaV1 and the most closely related picornaviruses

Position Length (aa)

LV145 SL (AF327922)

HPeV1 (FM178558)

HPeV3 (AB084913)

SPeV-1 (NC_009891)

Duck hepatitis A virus 1

(NC_008250)

VP0 1Met-Gln253 253 29.3 30.9 32.3 24.5 30.1

VP3 254Gly-497His 244 40.5 41.1 40.8 26.7 27.5

VP1 498Gly-Glu787 290 26.5 25.6 25.3 16.5 18.8

P1 1Met-Glu787 787 33.6 32.4 32.5 22.4 25.6

2A 788Glu- Gln916 119 43.6 9.9 9.6 11.9 13.0

2B 917Gly-Gln1041 125 22.7 25.0 26.4 12.5 22.1

2C 1042Ser-Gln1372 331 35.6 36.2 36.6 30.4 32.4

P2 788Glu-Gln1372 585 28.9 27.6 28.4 24.4 21.3

3A 1373Ala-Gln1462 90 18.0 24.2 22.7 1.0 18.0

3B 1463Arg-Gln1487 25 27.3 26.7 40.0 8.3 21.1

3C 1488Gly-Gln1678 191 26.1 28.6 27.7 23.3 24.4

3D 1679Gly-2133Ser 455 34.3 30.3 32.4 28.7 32.0

P3 1373Ala- 2133Ser 761 29.2 29.0 29.6 24.6 27.6

Table 3: Pairwise amino acids identities between the predicted proteins of SpaV1 and the related picornaviruses. Pairwise amino acid identities were calculated with the complete 2A sequence (2A1 and 2A2). Precursor protein region 1, 2 and 3: P1, P2 and P3.