Proc. Nati. Acad. Sci. USAVol. 86, pp. 8123-8127, October 1989Neurobiology

Isolation and expression of the eclosion hormone gene from thetobacco hornworm, Manduca sexta

(neuropeptide/ecdysis/behavior/insect)

FRANK M. HORODYSKI*, LYNN M. RIDDIFORD, AND JAMES W. TRUMANDepartment of Zoology, NJ-15, University of Washington, Seattle, WA 98195

Communicated by Richard Palmiter, July 13, 1989 (received for review, June 15, 1989)

ABSTRACT Eclosion hormone (EH) is a 62-amino acidneuropeptide that initiates the ecdysis behavior of insects. TheEH-encoding gene of the tobacco hornworm, Manduca sexta,was isolated by using a designed 72-mer oligonucleotide probe.Sequence analysis of this gene and its corresponding cDNAshowed that the EH gene is 7.8 kilobases and consists of threeexons. Exon I is totally nontranslated; exon II contains a26-amino acid signal peptide and amino acids 1-4 of the EHpeptide, and exon III encodes the remainder of the peptide. TheEH gene is present in a single copy per haploid genome andtranscribes an 0.8-kb mRNA that is expressed in larval,diapausing pupal, and developing adult brains but not in theventral nerve cord or in nonneural tissues. In situ hybridizationshowed that the EH gene is expressed in two pairs of ventro-medial neurosecretory cells in brains of both larvae anddeveloping adults.

As in vertebrates, insect neuropeptides are a diverse class ofregulatory molecules that affect a number of physiologicalprocesses relating to growth, metamorphosis, reproduction,and homeostasis (1, 2). Despite their importance, the struc-tures of relatively few of these neuropeptides are known;even less is known about the genes that code for them. Recentadvances have been made in the molecular characterizationand cloning of genes for the insect neuropeptides Phe-Met-Arg-Phe-NH2 (FMRFamide) (3, 4), bombyxin (5), andadipokinetic hormone (6).Growth and metamorphosis in insects is characterized by

a series of molts when a new cuticle is produced. Theshedding ofthe old cuticle at ecdysis is caused by the eclosionhormone (EH), a neuropeptide that triggers this behavior anddirects associated physiological changes (7). The primarytarget of this peptide is the central nervous system, althoughother nonneural targets are known. Purification and sequenc-ing ofEH from two different moths, Manduca sexta (8, 9) andBombyx mori (10), has revealed a 62-amino acid peptide thatshows 80% identity between the two species. This neuropep-tide, however, has no similarity with any other knownneuropeptide from either vertebrates or invertebrates (8).Using an oligonucleotide based on this sequence, we now

report the isolation and characterization of the EH genet.This gene proves to code only for the pre-EH molecule andto be expressed primarily in a set of four ventromedial cellsin the brain of larvae and of developing adults.

EXPERIMENTAL PROCEDURESAnimals. Larvae of the tobacco hornworm, M. sexta, were

reared individually on an artificial diet at 26°C under a 17-hrlight:7-hr dark photoperiod as described (11). At the start ofthe wandering stage, the larvae were transferred to wooden

blocks in which they pupated. Developing adults were trans-ferred to a photoperiod of 12-hr light: 12-hr dark. Staging ofdeveloping adults was by days after pupal ecdysis, except forthe final 5 days, which were determined by reference to adefined set of cuticular markers (12).

Oligonucleotide Probe Construction and Labeling. To con-struct the 72 nucleotide (nt)-long probe, the oligonucleotides5'-ATGGAGATCTGCATTGAGAACTGTGCCC-3' and 5'-ATCTCCATGGGGTCGTAGCCGGTGGC-3' (synthesizedat the Howard Hughes Medical Institute facility at theUniversity of Washington) were labeled at their 5' ends byusing [y-32P]ATP and T4 polynucleotide kinase (New EnglandBiolabs) and annealed to the oligonucleotides 5'-AAC-CCCGCCATCGCCACCGGCTACGA-3' and 5'-CATCT-TCTTGCACTGGGCACAGTTCTCA-3' in 50 mM Tris HCl,pH 8.0/0.1 M NaCl/10mM MgCl2 at 65°C for 30 min followedby room temperature for 15 min. The annealed oligonucleo-tides were filled in by using the Klenow fragment of Esche-richia coli DNA polymerase I (Boehringer Mannheim) in thepresence of40 ,uCi each of[a-32P]dATP and [a-32P]dGTP (3000Ci/mmol; 1 Ci = 37 GBq). The reaction mixture was ligatedusing T4 DNA ligase (New England Biolabs), and the reac-tion products were loaded onto 20% polyacrylamide/6 Murea gel. The 72-mer was eluted from the gel and used toscreen the Manduca genomic library.Genomic Library Screening. Three genome equivalents

(320,000 plaques) of the Manduca genomic library (13) wereplated on the E. coli strain CES200, transferred to nitrocel-lulose (Schleicher & Schuell), and hybridized to the 32p-labeled 72-mer. Hybridizations were done in 4x SSC (lxSSC is 0.15 M sodium chloride/0.015 M sodium citrate), 5xDenhardt's solution (lx Denhardt's solution is 0.02% Ficoll/0.02% polyvinylpyrrolidone/0.02% bovine serum albumin),denatured herring sperm DNA at 100 ug/ml, yeast tRNA at100 ,ug/ml, 0.15% sodium pyrophosphate, 0.1% SDS, and32P-labeled 72-mer at 1.5 x 106 cpm/ml for 2 days at 53°C.Filters were washed for at least 1 hr in three changes of 4xSSC containing 0.1% SDS at 53°C, followed by a 30-min washin 0.5x SSC/0.1% SDS at 440C.

Dissections and RNA Extraction. Brains and other portionsof the nervous system were dissected from staged animalsand frozen in liquid nitrogen. Developing adult brains wereenriched for neurosecretory cells by removing the optic lobesand ventral lateral portions of the brain during dissection.RNA was extracted in 6 M urea/SDS/phenol/chloroform

and purified by CsCl centrifugation as described (14).Poly(A)+ RNA was selected by oligo(dT)-cellulose (Collab-orative Research) chromatography (15).cDNA Library Construction and Screening. The cDNA was

synthesized by the method of Gubler and Hoffman (16) withminor modifications, including the addition of E. coli DNA

Abbreviations: nt, nucleotide(s); EH, eclosion hormone.*To whom reprint requests should be addressed.tThe sequence reported in this paper has been deposited in theGenBank data base (accession no. M26921).

8123

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

8124 Neurobiology: Horodyski et al.

ligase at 45 units/ml (Biolabs) in the second-strand reaction,which was required to obtain full-length cDNA synthesis.Residual hairpin loops were cleaved by mung bean nuclease(Pharmacia) (17). EcoRI linkers were added by ligation withT4 DNA ligase to blunt-ended cDNA. After EcoRI digestion,the cDNA was size-selected by Sepharose CL-4B chroma-tography, ligated into the EcoRI site ofAZAP II (Stratagene),and packaged with Gigapack Gold (Stratagene). About 6.3 x105 plaques were obtained from 1 pug of poly(A)+ RNA, ofwhich 50% were recombinant.The cDNA library was amplified on 10150-mm plates in the

E. coli strain XL-1 blue (Stratagene), and the eluate fromeach plate was kept separate. Phage DNA was prepared fromeach eluate and assayed for the presence of the EH cDNAclone by the polymerase chain reaction (18). One nanogramof phage DNA was amplified by using the primers 5'-CTGTGCGCAATGCAAGAAGATGCTC and 5'-CTTTG-GCATGTCATCGGTTGGATTAG and Thermus aquaticus(Taq) I DNA polymerase (Perkin-Elmer/Cetus) by 35 cyclesof amplification consisting of denaturation for 1 min at 940C,annealing for 2 min at 450C, and polymerization for 2 min at72°C with a thermal cycler (Perkin-Elmer/Cetus) and reac-tion conditions supplied by the manufacturer. AmplifiedDNA was electrophoresed on a 4% NuSieve agarose (FMC)gel, denatured, and transferred to nitrocellulose (19). A517-base-pair (bp) Bgl II-Hpa I fragment derived from thegenomic clone AD39 was labeled to a specific activity of 109cpm/mg with 32P by random hexamer priming (20) and usedfor hybridization at a concentration of 106 cpm/ml at 42°C ina solution containing 40% (vol/vol) formamide, 5 x SSC, 10xDenhardt's solution, herring sperm DNA at 100 ,g/ml, 50mM sodium phosphate (pH 7.0), and 10% (wt/vol) dextransulfate for 2 days. Filters were washed for at least 1 hr in threechanges of 4x SSC/0.1% SDS at 65°C, followed by 20-minwashes in 0.5x SSC/0.1% SDS and 0.1x SSC/0.1% SDS at65°C. The three cDNA library aliquots containing the EHcDNA clone were plated on the E. coli strain XL-1 blue(Stratagene), and clones were isolated by hybridization to the32P-labeled 517-bp Bgl II-Hpa I fragment as described above.DNA and RNA Blot Analysis. Genomic DNA was isolated

from a single fifth instar larva (13). DNA was digested withrestriction endonucleases, and the products were size-fractionated on 0.8% agarose gel, denatured, and transferredto a nitrocellulose filter (19). The M13 clone containing the997-bp Sau3A genomic fragment from AD39 was uniformlylabeled with 32p (21) and hybridized to the genomic Southernblot at the identical conditions used for screening the cDNAlibrary.For RNA analysis, total RNA was size-fractionated in

1.5% agarose/formaldehyde gels (19) and transferred tonitrocellulose or nylon (Hybond-N; Amersham). Hybridiza-tion ofNorthern (RNA) blots to the 32P-labeled 997-bp Sau3Agenomic fragment was done under identical conditions usedfor hybridization to the genomic Southern blot. A 32P-labeledantisense RNA probe was labeled to a specific activity of 109cpm/,ug by using the cDNA clone, pF5-3, as a template (22).This probe was hybridized to Northern blots at 1.5 x 107cpm/ml at 60°C in 50% (vol/vol) formamide, 5x SSC, 2.5xDenhardt's solution, 50 mM sodium phosphate (pH 7.0),

0.1% SDS, herring sperm DNA at 200 ,g/ml, yeast tRNA at200 ,g/ml, and poly(A) at 500 ,ug/ml for 16 hr. Filters werewashed for 2 hr in four changes of 0.lx SSC/0.1% SDS at650C.DNA Sequence Analysis. Genomic clone DNA was sub-

cloned into the M13 vectors, MP18 and MP19 (23). Single-stranded cDNA clone DNA was generated using the pBlue-script SK- plasmid cloning vector (Stratagene) containingthe cDNA insert that was excised from the cDNA clone in thevector AZAP II. DNA sequence was analyzed (24), by usingeither the Klenow fragment ofDNA polymerase I or Seque-nase in a commercially available kit (United States Biochem-icals). Nested deletions were prepared by the method ofDaleet al. (25) with the Cyclone kit (International Biotechnolo-gies). The sequences of some regions were determined withsynthetic internal oligonucleotide primers.Computer analysis of sequences used the Pustell DNA

programs (International Biotechnologies) (26).In Situ Hybridizations. Brains were fixed for 6 hr in 4%

(wt/vol) paraformaldehyde, and prepared for in situ hybrid-ization as described (27). The antisense DNA probe used tohybridize to day-10 developing adult brains was uniformlylabeled with 35S from a bacteriophage M13 template contain-ing the 517-bp Bgl II-Hpa I genomic DNA fragment. Theprobe was reduced to a mean size of 50-200 bases by incu-bation in 0.25 M HCO for 15 min at 37°C and then hybridizedfor 16 hr at 450C followed by washes (27). RNA probes usedto hybridize to brains from the remaining stages were labeledwith 35S by means of the cDNA clone pF5-3. The probe wasreduced to a mean size of 150 nt by incubation in 0.1 M sodiumcarbonate buffer (pH 10.2) for 40 min at 600C. Hybridizationswere for 16 hr at 50°C followed by washes (28).

RESULTSIsolation of the ManducaEH Gene and cDNA. To isolate the

gene that encodes Manduca EH, we designed a 72-nt-longprobe based on the sequence of EH from the NH2 terminusto amino acid 24 (8, 9) and codon bias data available forDrosophila genes (29, 30) (Fig. 1). The 72-mer was synthe-sized and labeled as described and was used to screen theManduca genomic library (13). Eight hybridizing clones wereisolated, and restriction analysis of their DNA showed thatthey were derived from three distinct genomic regions. DNAfrom one ofthese clones (AD39) was digested with Sau3A andsubcloned into the BamHI site of the replicative form of thebacteriophage MP18. Clones containing a 997-bp insert inboth orientations were selected by hybridization to the 72-mer, and their nucleotide sequence was determined (Fig. 2).A portion of this sequence, when translated, was identical tothe sequence of EH from amino acid 5-62 (the COOHterminus) and was followed by a termination codon. Apotential 3'-splice site (31) was present at amino acid 5,indicating an intron. Identity of 52 of 59 nt downstream fromthe splice site was sufficient for the specific hybridizationseen.To determine structure of the entire precursor protein and

organization ofthe EH gene, we isolated an EH cDNA clone.Because we detected EH mRNA in developing adult brains

A AsnProAlaIleAlaThrGlyTyrAspProMetGluIleCysIleGluAsnCysAlaGlnCysLysLysMet

5' 3'B AACCCCGCCATCGCCACCGGCTACGACCCCATGGAGATCTGCATTGAGAACTGTGCCCAGTGCAAGAAGATG

5' 3'C AACCCCGCCATCGCCACCGGCTACGA ATGGAGATCTGCATTGAGAACTGTGCCC

CGGTGGCCGATGCTGGGGTACCTCTA ACTCTTGACACGGGTCACGTTCTTCTAC

FIG. 1. Design and construction of the oligonucleotide probe used to screen for the Manduca EH gene. (A) Peptide sequence of theNH2-terminal 24 amino acids of Manduca EH (8, 9). (B) A 72-base oligonucleotide that would encode the peptide sequence; ambiguous baseswere assigned based on codon-usage tables. (C) Oligonucleotides used to construct the 72-mer probe.

Proc. Natl. Acad. Sci. US.A 86 (1989)

Proc. Natl. Acad. Sci. USA 86 (1989) 8125

1GTAAGTATTGAAATGTTTGAGCAATTATTTCAACACATTCTTAATTTATTGCACAAGTTGTTTTGGATTCACCAATGCTTTTG

-------------------------------------------Intron I (3.0 kb) --------------------------------------------------

TTAGGTTTTAGATATATTCTATTAGTATTCGGTGTGGCGCTTTTGATAGCCGTATTTGTAAGATGTTTTATATATTTCA _MetAlaGlyLysValThrValAla

101TGAGTATTCAAAACATTTCAGTTTCTAATAATATGTACCTACCTATA

PhePheMetPheAlaMetIleAlaPheLeuAlaAsnPheGlyTyrValGluCysAsnProAlaIleA

------------------------------------------------Intron II (4.1 kb) -------------------------------------------------

Bgl II, Sau 3A

TAATAAATATTTTTGTATTGAGTTACATTTTCATAAasi&LAACTTTATTTGTAGACATTGTTCTTAAATATTTGTATAGTTCGGATAGGCAGACTTCACACATATTCAAAA

TAAAATTTAATTTAATTTTATATCTCAAAGTAGGGAATCTTAATGCTTATTTTGGGATAGCATCAGCTCACCCATACTATATTGTTACAlaThrGlyTyrAspProMetGluIl

O 201

301

PheAlaSerIleAlaProPheLeuAsnLysLeu---

401 Hpa I 5U1*116"."2.gfe~wU"taP:"**...].]*"DltlUS^e~""*t^@Dgt D*V § ~tB*isX"Z"itl g" _&xZgZZZ~tsW:- s :.a.lmlS

4 601bS~s~sw0Bflv:Bv~zZ":BX~sl~x^.B**es~sPw"1B**"wwx"wj:.Mf**V.^.1Me:tffi"|"sL"*eW's."ZeweX.MwwBfe m~@

_.-INWW __ .,vwvMAAAAGTGTTTTTATTGAAGTATACATATTTAATTGTGTCATTGTGACTGGTCTATCCAGTTTTAATAGAGTATGATAATAGTTGT

Sau 3ACGATGTTCTCAGGAACTAAAACTATACTT TTTAATATAAACATTTACTTAAAAACTATTTCTCACAAATATCCCAC TTATAACTACGAATAACAACCGTTTTTAATAAACgS

FIG. 2. Nucleotide sequence of the Manduca EH gene and cDNA and the deduced amino acid sequence of the peptide precursor. Thenucleotide sequence of AD39 from the 5'-most Sal I site indicated on Fig. 3 was determined as described. Sequence of the cDNA clone pF5-3is displayed as white characters on black and numbered above. Not displayed but determined are the sequence of65% ofintron I and the completesequence of intron II (available upon request). Underlined are the presumptive TATA element and the Bgl II, Sau3A, and Hpa I sites referredto in the text. The sequence similar to the cap site of insect mRNAs is double-underlined. Position of a 60-nt poly(A) sequence in the cDNAis indicated (*). Locations of oligonucleotides used to assay for the EH cDNA clone are shown by arrows.

with the 997-bp Sau3A genomic fragment (see below, Fig.4B), we constructed a cDNA library from day-9 to -12developing adult brain mRNA in AZAP II (Stratagene). TheEH mRNA is likely only found in a few neurosecretory cellsin the brain (32) and, therefore, is rare [<0.01% of thepoly(A)+ RNA population], even in the portion of the brainenriched for these cells. To facilitate screening, we amplifiedphage DNA from aliquots of the cDNA library between twooligonucleotides derived from the sequence of the EH ge-nomic clone AD39 (Fig. 2) by the polymerase chain reaction(18). The 372-bp fragment hybridizing to a radiolabeled517-bp Bgl II-Hpa I genomic fragment of AD39 indicated theEH cDNA clone in three of these aliquots (data not shown).A clone from each aliquot was isolated by hybridization to thesame 517-bp genomic fragment.Primary Structure ofManduca EH mRNA and Organization

of the EH Gene. The cDNA clone containing the longestinsert, pF5-3, was completely sequenced (Fig. 2). The insertis 709 bp in length and contains an open reading frame thatpredicts an 88-amino acid precursor protein. The open read-ing frame begins with a methionine that fulfills Kozak'scriteria for an initiator codon (33). Following this initiatormethionine is a hydrophobic 26-amino acid sequence that

ends in a cysteine and a predicted cleavage site for a signalpeptide (34). Immediately thereafter is the NH2 terminus ofthe known sequence of EH. The translated sequence of theremainder of the precursor protein is identical to the com-plete sequence of EH (8, 9). Therefore, the EH precursorconsists of a 26-amino acid signal sequence followed by asingle copy of the 62-amino acid neuropeptide. Following the334 bp of 3'-nontranslated region is a 60-nt-long poly(A) tail,and an AATAAA polyadenylylation sequence (35) is present22 bp upstream from the poly(A) tail.Mapping of the pF5-3 cDNA and the AD39 genomic clones

showed that the EH gene is composed of three exons andextends over a distance of 7.8 kilobases (kb) (Fig. 3). The firstexon contains only 5'-nontranslated sequence and is sepa-rated from the second exon by 3.0 kb. The second exon of 102bp contains the DNA encoding the signal peptide and the firstfour residues at the NH2 terminus of EH. The third exon of514 bp, containing the DNA encoding the remainder of theEH sequence, is 4.1 kb farther downstream. Sequences at thesplice junctions conform to the consensus sequences seen atthese sites (31). Fifty-three nucleotides upstream from the 5'end of the cDNA clone pF5-3 is a TATAAAA sequencegenerally found 25-30 nt upstream from the initiation site of

ACTGTCTTCTTATTGTAGTCTTAAGGTAGTCATATTATAGTCTACAGAAAAGAATGTTTTACATAAAGGAGATAGTACGTAAACTGACGAGAAAATTTGTATTTTACCCTTGAAG

CATCGGAATGTTTGCCGGCAAACATGACCTTATAGGTACCTTATGTACTACATAATAAGGTGACACGCGTAATTCAGATGCTTCAAGGGTCAATGCCGTCATATTACTAGTTTGA

Neurobiology: Horodyski et al.

8126 Neurobiology: Horodyski et al.

D..;

..1.......ft'

.... ...

FIG. 3. Organization of the Manduca EH gene. The top lineshows a restriction map of a portion of the genomic clone AD39showing the location of the three exons of the EH gene. Size of theexons is shown in nucleotides. Size of the first exon is estimated onthe location of the probable cap site (Fig. 2). Location and size of thesignal peptide (stippled) and the mature EH (hatched) are shownbelow. S, Sal I; E, EcoRI; H, HindIII; b, Bgl II.

transcription (36). The heptanucleotide ATCAGCA is found24 nt downstream from the TATA element, which conformsto the consensus sequence found at the 5' end of many insectmRNAs (37).The results of Southern blots of digested Manduca DNA

hybridized to the 997-kb Sau3A genomic DNA fragment ofAD39 indicate that the EH gene is present in a single copy perhaploid genome (Fig. 4A). The sizes of the hybridizing bandsseen are identical to the corresponding restriction fragmentsin the genomic clone.

Expression of theEH Gene inManduca Brain. Fig. 4B showsthat the brain of developing adults contains a single transcriptof 0.8 kb, which is similar in size to the cDNA clone pF5-3.The latter does not represent a complete copy of the mRNA(16), although we believe that it contains the entire translatedportion and the 3' sequences. The EH transcript is present inthe brain throughout adult development, from shortly afterpupal ecdysis until just before emergence of the adult (Fig.4B). This distribution of mRNA is consistent with previousstudies showing that EH activity accumulates in the brain-

A B CCM LO 000

.~CDO~'~O.._I .0

* A

8.*2.8_2.5_01

1 .9-_1 .5-_

genomic:)D39

FIG. 4. Characterization and expression of the Manduca EHgene. (A) Genomic DNA and the genomic clone AD39 were digestedwith various restriction enzymes and hybridized to the 32P-labeled997-bp genomic Sau3A fragment of AD39 at high stringency (b, BglII; E, EcoRI; H, HindIl). The sizes of the hybridizing fragments areindicated to the left. (B) Total RNA (5 Mg per lane) isolated from thedeveloping adult brain (in days after pupal ecdysis), diapausing pupae(DP), or the epidermis of fifth instar larvae (E) was hybridized to the32P-labeled 517-bp genomic Bgl II-Hpa I fragment from AD39. (C)Total RNA (5 gg per lane) isolated from the brain 6 days after pupalecdysis (P6), various portions of the larval nervous system of day-1fifth instar larvae (Br, brain; SEG, subesophageal ganglion; ThG,thoracic ganglion; AG, abdominal ganglion; TeG, terminal ganglion),or the entire nerve cord of day-2 fifth instar larvae (NC) washybridized to the 32P-labeled antisense RNA synthesized using thecDNA clone pF5-3. Size ofthe hybridizing RNA forB and C is shownat left of B.

FIG. 5. Cellular localization of expression of the Manduca EHgene in the brain. (A and D) Hybridization of the antisense RNAprobe to sections of larval (A) and day-15 developing adult brain (D).(B) Hybridization of the sense RNA probe to sections of the larvalbrain. (C) Immunocytochemistry using the EH antiserum to larvalbrain (from ref. 39). The ventromedial cells that hybridize to the EHgenomic clone are indicated by arrows. Background in A is due tononspecific binding of the probe to tracheal cuticle. (Bars = 100 um;A, B, and D are at same magnification.)

corpora cardiaca-corpora allata (CC-CA) complex through-out adult development (38). Because the brain shows pro-nounced growth through this period, the decrease in EHmRNA at the end of adult development (Fig. 3B) may onlyreflect an increase in total cellular mRNA. The diapausingpupal brain also contained EH mRNA (Fig. 4B).

In immature stages, release of EH comes from the ventralnervous system rather than from the brain-CC-CA complex(11, 38, 39). Fig. 4C shows that even in the larval stage, EHtranscripts could be found only in the brain and not in thevarious regions of the ventral central nervous system. More-over, transcripts are not present in nonneural tissue, such asthe epidermis (Fig. 4B).

In situ hybridization analysis with the antisense mRNAstrand showed that the EH mRNA was present in largeamounts in the two pairs of large ventromedial cells locatedon the frontal surface of the brain in both larvae (Fig. SA) anddeveloping adults (Fig. SD). No hybridization to these or anyother cells was seen when the sense strand was used (Fig.SB). These cells were labeled in all five larval brains and inall developing adult brains (eight from day 10, four from day15, and four from day 18, one day before eclosion). In theirposition, these cells correspond to the ventromedial neuro-secretory cells, which are the source of EH for larval andpupal ecdysis (39) (Fig. SC). No obvious hybridization wasseen in the lateral neurosecretory cell cluster thought to bethe source of EH for adult eclosion (32).

DISCUSSIONThese studies have shown that EH is produced by a 7.8-kbgene that codes only for this neuropeptide. Hybridization ofeither the cDNA or genomic clones to genomic DNA at highstringency revealed only one band, indicating that EH is asingle-copy gene. An additional weakly hybridizing band wasseen under low-stringency hybridization conditions (40%formamide/4x SSC, 33°C hybridization; 2x SSC, 500Cwash), but the size of this band was not similar to either ofthetwo additional genomic regions hybridizing to the 72-merprobe (data not shown). The presence of a single EH geneindicates that the minor form ofEH lacking the NH2-terminal2 amino acids seen by Marti et al. (8) is not due to multiplecopies of the gene.

Proc. Natl. Acad. Sci. USA 86 (1989)

Proc. Natl. Acad. Sci. USA 86 (1989) 8127

The use of the polymerase chain reaction to help screen acDNA library represents a different approach. Because mostinsect neuropeptides are usually synthesized in only a fewcells, it is usually not possible to obtain a mRNA populationin which the neuropeptide mRNA represents enough of thetotal population. Therefore, we used the genomic nucleotide-sequence data to design the necessary oligonucleotide prim-ers to assay for the cDNA clone in aliquots ofthe brain cDNAlibrary using the polymerase chain reaction. This approachshould also be applicable to situations in which only part ofthe genomic sequence is known, by using as one of theprimers a sequence derived from the vector.Our nucleotide-sequence data shows that EH is the only

product from the precursor molecule. This contrasts withmany other neuropeptide precursors, such as proopiomel-anocortin, the Aplysia egg-laying hormone, and FMRF-amide, which encode multiple peptides that are processedfrom a larger precursor molecule (for reviews, see refs. 40and 41). The predicted signal peptide of EH is slightly largerin size (26 amino acids) than that of other insect neuropep-tides (3-6). Within the signal peptide region of the EHprecursor are three potential initiator ATGs in frame with theopen reading frame containing the EH sequence. The firstATG most likely serves as the initiator codon because thisATG conforms to Kozak's consensus sequence at the start oftranslation (33).Among the various neural and nonneural tissues assessed,

the EH transcript was present only in brain, although our datacannot exclude a low level of EH gene expression in othertissues. Detection of such low levels of transcription wouldnecessitate more sensitive methods such as RNase protectionanalysis (22) or the polymerase chain reaction (18, 42).

In the larval brain only two pairs of large neurosecretorycells in the ventromedial region contained EH mRNA (Fig.5A). These "ventromedial cells" are also immunopositivewith an antiserum against EH (Fig. SC; ref. 39). They have anunusual projection pattern, extending their axons the lengthof the ventral nervous system to the proctodeal nerve fromwhich they release EH (39). No EH-immunopositive cellbodies are found in the ventral ganglia (39). This finding isconsistent with the apparent lack of EH transcripts in theganglia of the larval nerve cord (Fig. 4C) and suggests that theEH activity in the ventral nervous system (38) is due solelyto transport of the hormone posteriorly in the axons of theventromedial cells.

In the larval stage, the ventromedial cells appear to be theonly brain neurons that contain EH (39), but in day-i adults,a second set of brain neurons, the group Ia lateral neurose-cretory cells, also contain EH (32). The presence of hormonein the lateral cells was established by immunoreactivity,bioassay of the contents of cell bodies, and induced EHrelease through intracellular stimulation. Yet our in situhybridization analysis has not shown significant levels ofEHmRNA in these lateral neurosecretory cells at various timesduring adult development (day 10, 15, or 18). Either the levelof EH mRNA in these cells is very low, or it only occurs ata very restricted time during adult development.

Eclosion hormone acts on the central nervous system totrigger the complex prepatterned behavior of ecdysis (7). Inthis respect, EH is similar to another well-studied behavioralpeptide, the egg-laying hormone of Aplysia, which triggers afixed action pattern of behaviors that leads to egg laying. Inthe latter system, a number of products are processed fromthe pro-egg-laying hormone precursor, and the various com-ponents have their own sets of actions that lead to thecoordinated behavioral response (43). A similar situation isseen in the classic example of the proopiomelanocortins (40).

The ecdysis system uses the alternative strategy in which theproduct of the EH gene is a single peptide, which then exertsits action on diverse tissues, such as the nervous system,muscle, and epidermis (7).We are grateful to Drs. Bonita Biegalke, Patrick O'Hara, and Fred

Hagen for helpful discussions; to Dr. Pam Hines for use of thePerkin-Elmer/Cetus thermal cycler; to Shirley Reiss for preparingthe sections for in situ hybridizations; and to Mark Carter forexcellent technical assistance. This research was supported by grantsfrom the U.S. Department of Agriculture (85-CRCR-1-1756) andNational Science Foundation (BNS8719611).1. O'Shea, M. & Schaffer, M. (1985) Annu. Rev. Neurosci. 8, 171-198.2. Keeley, L. L. & Hayes, T. K. (1987) Insect Biochem. 17, 639-651.3. Nambu, J. R., Murphy-Erdosh, C., Andrews, P. C., Feistner, G. J. &

Scheller, R. H. (1988) Neuron 1, 55-61.4. Schneider, L. E. & Taghert, P. H. (1988) Proc. Nati. Acad. Sci. USA 85,

1993-1997.5. Iwami, M., Kawakami, A., Ishizaki, H., Takahashi, S. Y., Adachi, T.,

Suzuki, Y., Nagasawa, H. & Suzuki, A. (1989) Dev. Growth Differ. 31,31-37.

6. Schulz-Aellen, M.-F., Roulet, E., Fischer-Lougheed, J. & O'Shea, M.(1989) Neuron 2, 1369-1373.

7. Reynolds, S. E. & Truman, J. W. (1983) in Endocrinology of Insects,eds. Downer, R. G. H. & Laufer, H. (Liss, New York), pp. 217-233.

8. Marti, T., Takio, K., Walsh, K. A., Terzi, G. & Truman, J. W. (1987)FEBS Lett. 219, 415-418.

9. Kataoka, H., Troetschler, R. G., Kramer, S. J., Cesarin, B. J. &Schooley, D. A. (1987) Biochem. Biophys. Res. Commun. 146, 746-750.

10. Kono, T., Nagasawa, H., Isogai, A., Fugo, H. & Suzuki, A. (1987) Agric.Biol. Chem. 51, 2307-2308.

11. Truman, J. W., Taghert, P. H. & Reynolds, S. E. (1980) J.Exp. Biol. 88, 327-337.

12. Schwartz, L. M. & Truman, J. W. (1983) Dev. Biol. 99, 103-114.13. Rebers, J., Horodyski, F., Hice, R. & Riddiford, L. M. (1987) in

Molecular Entomology, ed. Law, J. (Liss, New York), pp. 201-210.14. Riddiford, L. M. (1982) Dev. Biol. 92, 330-342.15. Aviv, H. & Leder, P. (1972) Proc. Natl. Acad. Sci. USA 69, 1408-1412.16. Gubler, U. & Hoffman, B. J. (1983) Gene 25, 263-269.17. Gubler, U. (1987) Methods Enzymol. 152, 330-335.18. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K., Horn, G. T., Erlich,

H. A. & Arnheim, N. (1985) Science 230, 1350-1354.19. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning:A

Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY).20. Feinberg, A. P. & Vogelstein, B. (1984) Anal. Biochem. 137, 266-267.21. Anderson, S. & Kingston, I. B. (1983) Proc. Natl. Acad. Sci. USA 80,

6838-6842.22. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K. &

Green, M. R. (1984) Nucleic Acids Res. 12, 7032-7055.23. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33, 103-119.24. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci.

USA 74, 5463-5467.25. Dale, R., McClure, B. & Houchins, J. (1985) Plasmid 13, 31-40.26. Pustell, J. & Kafatos, F. C. (1984) Nucleic Acids Res. 12, 643-655.27. Horodyski, F. M. & Riddiford, L. M. (1989) Dev. Biol. 132, 292-303.28. Angerer, L. M., Stoler, M. H. & Angerer, R. C. (1987) in In Situ

Hybridization: Applications to Neurobiology, eds. Valentino, K. L.,Eberwine, J. H. & Barchas, J. D. (Oxford Univ. Press, New York), pp.42-70.

29. Grantham, R., Gautlier, C., Gouy, M., Jacobzine, M. & Mercier, R.(1981) Nucleic Acids Res. 9, r43-r47.

30. Maruyama, T., Gojobori, T., Aota, S.-I. & Ikamura, T. (1986) NucleicAcids Res. 14, r151-r157.

31. Mount, S. M. (1982) Nucleic Acids Res. 10, 459-472.32. Copenhaver, P. F. & Truman, J. W. (1986) J. Neurosci. 6, 1738-1747.33. Kozak, M. (1986) Cell 44, 283-292.34. Von Heijne, G. (1986) Nucleic Acids Res. 14, 4683-4690.35. Proudfoot, N. J. & Brownlee, G. G. (1976) Nature (London) 263, 211-

214.36. Breathnach, R. & Chambon, P. (1981) Annu. Rev. Biochem. 50, 349-383.37. Hultmark, D., Klemenz, R. & Gehring, W. J. (1986) Cell 44, 429-438.38. Truman, J. W., Taghert, P. H., Copenhaver, P. F., Tublitz, N. J. &

Schwartz, L. M. (1981) Nature (London) 291, 70-71.39. Truman, J. W. & Copenhaver, P. F. (1989) J. Exp. Biol. 147, 1-14.40. Douglass, J., Civelli, 0. & Herbert, E. (1984) Annu. Rev. Biochem. 53,

665-715.41. Sossin, W. S., Fisher, J. M. & Scheller, R. H. (1989) Neuron 2, 1407-

1417.42. Sarkar, G. & Sommer, S. S. (1989) Science 244, 331-334.43. Scheller, R. H., Jackson, J. F., McAllister, L. B., Rothman, B. S.,

Mayeri, E. & Axel, R. (1983) Cell 32, 7-22.

Neurobiology: Horodyski et al.