Introduction of a Non-canonical Amino Acid into GFP

Introduction of a Non-canonical Amino Acid into GFP Tiffany Chen The University of Texas at Austin 2006 Abstract

Proteins are polymers of amino acids. There are only twenty commonly found natural amino acids encoded by the genetic code. These amino acids are limited in the chemistry they can perform. In order to expand the range of this chemistry, a system has been developed to introduce non-canonical amino acids into proteins at specific positions, in vivo. We report here the methods used to introduce a non-canonical amino acid, O-methoxy-L-tyrosine into the reporter protein, green fluorescent protein (GFP). In order to incorporate this non-canonical amino acid into the protein, multiple components need to be present in the cell. The gene for GFP must be present, with an amber stop codon, TAG, introduced at the position corresponding to the location of the non-canonical amino acid within the protein. To recognize this stop codon, a mutant tRNA must be present. A mutant tRNA synthetase must also be present to charge this mutant tRNA with the non-canonical amino acid. Finally, the non-canonical amino acid itself must be present. With all these components in place, the cell will synthesize the modified GFP. If a full length GFP is produced, the cell will fluoresce green. The modified protein can then be isolated from the cell and tested for successful incorporation of the non-canonical amino acid.

Introduction of a Non-canonical Amino Acid into GFP



Introduction Introduction Proteins are polymers of amino acids. There are only twenty commonly found natural amino acids encoded by the genetic code. These amino acids are limited in the chemistry they can perform1. By inserting a non-canonical amino acid into the protein, it is possible to change the chemistry performed by the protein. Although methods have been developed to introduce a non-canonical amino acid into a cell, the in vitro method yields very little protein2. We want to develop an in vivo method to produce a larger quantity of the modified protein, in this case, Green Fluorescent Protein (GFP), in a mammalian cell.

Proteins are polymers of amino acids. There are only twenty commonly found natural amino acids encoded by the genetic code. These amino acids are limited in the chemistry they can perform

1. By inserting a non-canonical amino acid into the protein, it is possible to change the chemistry performed by the protein. Although methods have been developed to introduce a non-canonical amino acid into a cell, the in vitro method yields very little protein2. We want to develop an in vivo method to produce a larger quantity of the modified protein, in this case, Green Fluorescent Protein (GFP), in a mammalian cell.

Although seemingly simple, expressing a modified protein in a mammalian cell requires more than just the non-canonical amino acid. A cell produces protein in a series of steps (Figure 1): First there is transcription, where the ribonucleic acid (RNA) polymerase produces messenger RNA from a deoxyribonucleic acid (DNA) template within the nucleus; simultaneously, transfer RNA is also being transcribed. Once the tRNA and mRNA are made, they exit through the nuclear membrane into the cytoplasm. In the cytoplasm, an enzyme, tRNA synthetase, will charge the tRNA with the appropriate amino acid. There is a specific synthetase for each tRNA and amino acid pair. Next, a

ribosome scans along the mRNA until it locates a start codon, a specific group of three

Although seemingly simple, expressing a modified protein in a mammalian cell requires more than just the non-canonical amino acid. A cell produces protein in a series of steps (Figure 1): First there is transcription, where the ribonucleic acid (RNA) polymerase produces messenger RNA from a deoxyribonucleic acid (DNA) template within the nucleus; simultaneously, transfer RNA is also being transcribed. Once the tRNA and mRNA are made, they exit through the nuclear membrane into the cytoplasm. In the cytoplasm, an enzyme, tRNA synthetase, will charge the tRNA with the appropriate amino acid. There is a specific synthetase for each tRNA and amino acid pair. Next, a

ribosome scans along the mRNA until it locates a start codon, a specific group of three

Figure 1 Protein Synthesis6

Figure 2 Translation7

nucleic acids, to begin the elongation phase of protein synthesis. During this phase (Figure 2), the ribosome combines the appropriate tRNA with a codon. They combine due to the anticodon on the RNA which complements the bases on the mRNA. The ribosome will then create a peptide bond between each amino acid. Translation is completed once a stop codon is reached because there is normally no tRNA to recognize the stop codon. There are only three stop codons: UGA, UAA, UAG. Most genes terminate with more than one stop codon. This ensures

nucleic acids, to begin the elongation phase of protein synthesis. During this phase (Figure 2), the ribosome combines the appropriate tRNA with a codon. They combine due to the anticodon on the RNA which complements the bases on the mRNA. The ribosome will then create a peptide bond between each amino acid. Translation is completed once a stop codon is reached because there is normally no tRNA to recognize the stop codon. There are only three stop codons: UGA, UAA, UAG. Most genes terminate with more than one stop codon. This ensures

WSSP 2006 UT2-2


that translation will terminate properly in the presence of ‘suppressor tRNAs’. These are tRNAs that have undergone a mutation in their anticodon so that they will recognize one of the three stop codons and allow translation to continue past the normal stop location. These suppressor tRNAs can arise through natural mutation or can be intentionally induced1. To introduce a non-canonical amino acid into a protein at a specific site, the normal process of transcription and translation will be co-opted. Normally, there are only sixty-one codons in the genetic code that codes for the 20 natural amino acids. In order to insert a new amino acid, we need a new, unused codon and a corresponding tRNA and synthetase. Due to the fact that normally, there are no tRNAs which pair with a stop codon, we chose a stop codon (TAG) to code the non-canonical amino acid. To induce recognition of this stop codon, the gene for the tRNA was mutated to allow its anticodon to recognize the TAG stop codon. The gene for the synthetase, normally paired with this tRNA, was also mutated to charge the tRNA with the non-canonical amino acid of our choice- O-methoxy-L-tyrosine (L-Dopa) instead of a normal amino acid. In order to use this system, the gene for the protein of choice is mutated and a TAG codon placed at the position corresponding to the desired location of the non-canonical amino acid. For a cell to produce the co-translationally modified protein, mutated genes for the tRNA, the synthetase, and the protein of interest must be transfected into a cell. If L-Dopa is also added to the cell, the normal cellular processes of transcription and translation should produce the protein as specified. To ensure that the transcription and translation of other genes will not be disrupted by the presence of this system, preventative measures were taken. First, codon choice: this system will be used in a mammalian cell, therefore the TAG stop codon was chosen, rather than one of the other two stop codons. This is due to the fact that TAG is the least commonly used stop codon in mammalian cells. Termination of translation of other normal genes will be less likely and minimally affected; perhaps not affected at all if genes that utilize a TAG stop codon also use a another redundant stop codon, as is common.

Figure 3 Method for incorporating the protein of interest

Another precaution to ensure that normal transcription and translation will not be disrupted is to ensure that the tRNA added to the cell will not be recognized by a normal

WSSP 2006 UT2-3


synthetase found in the cell. Likewise, the synthetase added to the cell will not recognize any normal tRNAs found in the cell. To accomplish this, the tRNA and its corresponding synthetase chosen for this system were not of mammalian origin, they were bacterial. Mammalian tRNAs and synthetases do not recognize bacterial tRNAs and synthetases, and vice versa. Our goal is to generate GFP with the non-canonical amino acid, L-Dopa, at the 37th position. L-dopa is normally synthesized from tyrosine, and it is the precursor of dopamine. L-Dopa has the unusual property of being able to cross-link adjacent proteins. By incorporating L-Dopa into a protein, it allows the protein to ‘grab’ any other protein that comes in close contact. To generate GFP containing the L-Dopa amino acid, several components were introduced into the mammalian cells: the gene for GFP, with the 37th codon mutated to TAG; the gene for a bacterial tyrosine tRNA with its anticodon mutated so that it recognized TAG; the gene for the bacterial tyrosine tRNA synthetase mutated so that it charges its corresponding tRNA with L-Dopa instead of tyrosine; and finally L-Dopa itself. With all these components in place, mammalian cells should produce full-length GFP with L-Dopa at the 37th position through translation and transcription. The GFP protein can then be purified from the cells and tested for proper incorporation of L-Dopa. Herein we describe the methods used to prepare the necessary genes to produce L-Dopa modified GFP. Materials and Methods Electrocompetent cells To generate electrocompetent cells, a 10 mL culture of BL21 cells was added to 700 mL luria bertani broth (LB), and grown until the optical density (OD) to equaled 0.4. Meanwhile, a liter of double de-ionized water (ddH2O) and 500 mL of 10% glycerol were prepared, autoclaved, and chilled to ensure optimum efficiency. Once the OD of the cell culture reached 0.4, the cells were transferred to a centrifuge bottle and centrifuged at 4ºC and 4800 rotations per minute (rpm) for twenty minutes. The supernatant was discarded, and the pellet of cells was resuspended in 500 mL of ddH2O. Resuspension was done by very gentle shaking because these cells are very delicate. The centrifugation and resuspension steps were then repeated. Next, the cells were centrifuged again for twenty minutes, the supernatant was decanted, and the pellet was resuspended in 500 mL of 10% glycerol solution. These centrifugation and resuspension steps were then repeated. After being centrifuged and decanted again, the pellet was resuspended in 1 mL of 10% glycerol. and the cells were aliquotted (50 µL) into microcentrifuge tubes and immediately dipped in acetone with dry ice to chill quickly. The cells were stored at -80ºC. Polymerase Chain Reaction: Site Directed Mutagenesis Site directed mutagenesis was performed using the protocol from the Quick Change II Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). A 50 µL PCR reaction was performed, using 5 µL of 10x PfuUltra™ high-fidelity DNA polymerase, 1 µL of 10mM deoxynucleotide (dNTP), 1 µL Pfu polymerase, 1 µL of the forward and reverse37TAGGFP primers (125 µg/µL)(Forward- 5’prime

WSSP 2006 UT2-4


GGCGAGGGCGAGGGCTAGGCCACCTAACGGCAAG 3’; Reverse- 5’prime CTTGCCGTAGGTGGCCTAGCCCTCGCCCTCGCC 3’), 1 µL of the wild type GFP (25 µg/µL), and 40 µL of ddH2O. This was put into a PCR machine where it was treated to sixteen rounds of: sixty seconds of 95°C, one minute at 55°C, twelve minutes of 68°C. Next, it was kept at 68°C for an additional 12 minutes before being stored in 4°C. (Figure 4) Transformation (Figure5) First, the electrocompetent cells (BL21) and DNA were thawed on ice. They were very gently handled throughout the process because their membranes are easily broken. The pulser was set to 1.8 kV; the cuvette was cooled on ice. Then, 1.5 µL of the prepared plasmid was added for every 50 µL of electrocompetent cells, gently mixed together and incubated on ice for 2 minutes. After the time elapsed, the mixture was gently added to the cuvette. The pulser applied power to the cuvette and LB was immediately poured into the cuvette. The mixture was then transferred to another tube and incubated for one hour at 37ºC. Different volumes of the now-transformed bacteria were spread on agar plates and incubated overnight. Minipreps Minipreps were performed using the QIAprep Miniprep Kit (QIAGEN, Valencia, CA). One culture was picked from the agar plate (incubated overnight.) It was placed in microcentrifuge tube with 2 mL of LB to be shaken at 37°C overnight. The tube was then centrifuged for ten minutes at 13,000 rotations per minute (rpm), and the supernatant, carefully decanted. Then, the bacterial pellets were resuspended in 250 µL of Buffer P1 ((re-suspension buffer-50 mM Tris·Cl, pH 8.0, 10 mM EDTA, 100 µg/mL RNase A.) Next, the homogeneous solution was transferred to a microcentrifuge tube and incubated for fifteen minutes. After that, 250 µL of Buffer P2 (lysis buffer- 200nMnaOH, 1% SDS) was added and gently inverted until the solution became viscous and opaque. Then 350 µL of Buffer N3 (QIAGEN) was quickly mixed into the solution to prevent localized precipitation. The solution was then centrifuged for ten minutes at 3000 rotations per minute (rpm) in the microcentrifuge; once completed; the supernatant was decanted into a QIAprep spin column and incubated room temperature for fifteen minutes. After that, the spin column was centrifuged for sixty seconds, and the flow-through was discarded. The column was then washed with .5 mL of Buffer PB (QIAGEN-binding buffer) and centrifuged for another sixty seconds. Again, the flow-through was discarded. Next, the column was rewashed with .75 mL of Buffer PE (QIAGEN) and the flow-through discarded. Then it was centrifuged for one minute to remove any residual buffer. After that, the DNA was extracted with the addition of 50 µL of Buffer EB (elution buffer-10 mM Tris-Cl, pH 8.5) through the column into a clean microcentrifuge tube; let it flow for ten minutes, then centrifuge for one minute. To find the final concentrations, a nanodrop was used. Figure 6 displays the nanodrop’s results for a known sample of DNA. Restriction Digest of DNA 4

The enzymes used were BamH1 and Bay to cleave G/GATCC and T/CTAGA sites (Figure 7).

WSSP 2006 UT2-5


A 6 µL solution was made to add to 4 µL of the 37TAGGFP (made during the miniprep.) The solution’s composition consisted of 1 µL of 10x BamH1 buffer, 1 µL of bovine serum albumin, .25 µL of BamH1 enzyme, .25 µL of XbaI enzyme, and 3.5 µL of ddH2O. Once 6 µL of the solution had been added to the 4 µL of 37TAGGFP, it was centrifuged to let the liquid settle. Next, the solution was incubated at 37°C for one hour. Then it was analyzed with agarose electrophoresis. Agarose electrophoresis First, the gel was made by heating 30 mL of 1X TAE buffer, .3g of agarose, and 1.5 µL of anthodium bromide (a dye) and pouring it into a plate to set for approximately fifteen minutes. Ac comb was inserted to create wells in the agarose. Then about 1 µL of each sample of DNA (with glycerol and bromythyl blue) was pipetted into each well. After that, the electrodes were attached and 73 V was applied for approximately an hour. To see the results, the gel was photographed in an ultraviolet light (to excite the ethidium bromide) (Figure 8). Sequencing To verify the sequence of the 37TAGGFP was correct, samples were sent to the CORE lab facility in UT Austin (Molecular Biology Building) and the results were confirmed. Maxipreps Maxipreps were performed using the QIAGEN Maxiprep Kit (QIAGEN, Valencia, CA). First, a colony was picked (top ten cells with Methanococcus jannaschii tRNA) and added to 5 mL of low salt LB. Then it was incubated, with shaking, for approximately eight hours at 37°C. After that, the culture was diluted from 1/500 to 1/1000 in 200 mL of low salt LB; it was then incubated again at 37°C with shaking for approximately fourteen hours. Next, the cells were extracted by centrifuging at 6000rpm for fifteen at 4°C. The supernatant was discarded, and the bacterial pellets were re-suspended in 10 mL of Buffer P1 (re-suspension buffer-50mM Tris·Cl, pH 8.0, 10 mM EDTA, 100 µg/mL RNase A). Then, 10 mL of Buffer P2 (lysis buffer- 200nM NaOH, 1% SDS) was gently mixed in and the mixture was incubated at room temperature for five minutes. Next, 10 mL of chilled Buffer P3 (neutralization buffer-3.0 M KC2H3O2, pH 5.5) was gently mixed into the solution and then incubated on ice for twenty minutes. After that, the mixture was centrifuged at 12,000 rpm for thirty minutes in 4°C; it was decanted immediately and the supernatant was saved (contains the needed plasmid). Again, the mixture was centrifuged for fifteen minutes and the supernatant saved. Then, the QIAGEN-tip 500 was equilibrated by adding 10 mL of Buffer QBT (equilibration buffer-750 mM NaCl, 50 mM 3-[N-morpholino]propanesulfonic acid (MOPS), pH 7.0, 15% isopropanol, .15% Triton X-100) and letting the buffer flow through. Next, the saved supernatant, containing the plasmids, was applied to the QIAGEN-tip. After it has flowed through, 60 mL- done in 30 mL increments- of Buffer QC (wash buffer-1.0M NaCl, 50mM MOPS, pH7.0, 15% isopropanol) was used to wash the QIAGEN-tip. Then the DNA was eluted into a new 30 mL tube with 15 mL of Buffer QF (elution buffer- 1.25M NaCl, 50mM Tris·Cl, pH 8.5, 15% isopropanol); the DNA precipitated with the addition of 10.5 mL of room temperature isopropanol. To isolate the DNA, it was centrifuged at 9,500 rpm for thirty minutes in 4°C. The supernatant was carefully decanted; 5 mL of

WSSP 2006 UT2-6


room temperature 70% ethanol washed the pellet. Next, the solution was centrifuged again for ten minutes and the supernatant immediately decanted. The DNA pellet was then air dried before being dissolved in 500µL of Buffer EB. The concentration was found by using the nanodrop (Figure 6). Results/Discussion We used a mammalian expression vector that contained wild type GFP-normal GFP. We wanted to attach a stop codon through site directed mutagenesis on the 37th position of GFP by using the Quikchange protocol from Invitrogen. A series of steps were taken to incorporate the non-canonical amino acid into the protein which was then grown in a mammalian cell. First, electrocompetent cells had to be made to clone the necessary plasmids for the mutant tRNA, synthetase, and the gene itself. PCR, specifically site-directed mutagenesis, was performed next to modify a wild-type GFP with a TAG codon on the 37th position. In PCR (Figure 4), of DNA is rapidly cloned by annealing primers; site-directed mutagenesis is a form of PCR that clones an entire plasmid. The primers, in this case, had been mutated to incorporate an amber codon (TAG) in the DNA on the 37th position of GFP. The performed PCR was a special circumstance because a high fidelity polymerase, Pfu, was required to clone the entire plasmid.

Figure 4

Shows the process of PCR. However, in this experiment, the entire plasmid was cloned, and not only the fragment shown here.

Next, the tRNA, synthetase, and 37TAGGFP were transformed into the electrocompetent cells. Transformation (Figure 5) is the process of putting the plasmid, made in PCR, into the electrocompetent or chemically competent cells. The cells were shocked, either with

WSSP 2006 UT2-7


sudden heat or electric charge, so that the cellular membrane allows outside particles, such as the plasmids, into the bacteria. LB broth must be immediately added to the bacteria to ensure a high yield. Then the bacteria were incubated while being shaken at 37°C.

PLAS

Figure 5 Transformation

After a period of incubation, the 37TAGGFP was miniprepped to test for the presence of the protein. Minipreps are for cloning on a small scale. Once the Escherichia coli multiplied, the bacterial cells are cracked, bacterial organelles are washed away and only the DNA will remain.

Figure 6 The results from the nanodrop. DNA peaks at around 260nm.

The DNA (for the 37TAGGFP) was then tested with a restriction digest to ensure the modifications had been made. If successful, a Maxi-prep will be used later to clone on a larger scale. Restriction digest occurs when specific restriction enzymes are applied to DNA to cleave at certain patterns of nucleotides. Bacteria use these enzymes to prevent viral infections in nature; scientists use them to cleave certain nucleotides, to study the nucleotides, and, as in this case, insure the presence of nucleotides.

WSSP 2006 UT2-8


5'---G 3'---C

5'---G 3'---CCTAG

GATC C---3'

CTAGGATC C---

3'

5'---G 3'---CCTAG

GATC C---3'

Figure 7 Shows the Restriction of BAMH1

Add BamH1

The results of the restriction digest showed that four out of twenty-four cells contained the GFP sequence of interest. Another procedure used to verify the presence of the

protein’s gene was agarose electrophoreses. Electrophoresis is a method by which DNA, RNA, or pare compared by a specific physical property. Agarose electrophothe charges of individual DNA to compare the different DNA. Similar to paper chromatography in that it comparesdistance traveled by individual samples, the medium it uses is a gel made from seaweed (and found in vegetarian jello!) By comparing the final positions of the DNA samples to positions of known samples- called ladders, th

presence of the modified protein’s gene was confirmed. To further verify the sequencethe 37TAGGFP was correct, samples were sent to the CORE lab facility in UT Austin (Molecular Biology Building) and the results were confirmed.

Figure 8a Maxi-prep tRNA 21 6 06 (1)

roteins

resis uses

e of

Figure 8b Maxi-prep tRNA

Once confirmed for the third time, the 37TAGGFP gene, along with the genes for the tRNA and mutant synthetase were maxiprepped to make a larger quantity of DNA. As mentioned before, the maxi-prep is used to clone large amounts of DNA. The QIAGEN plasmid Maxi Kit was used. Like the Mini-prep, E. coli cells cloned the necessary plasmids; however, due to a longer incubation period as well as the use of more LB, a greater quantity of plasmid can be collected. Also, due to the nature of the protocol, the resulting DNA from the Maxi-prep is of a better quality than that of the Mini-prep. Another benefit is that certain steps in the Maxi-prep can be tested with electrophoresis so mistakes can be easily seen. These two gels show that each step in the Maxi-prep of the tRNA was correct. After the plasmids had been prepared for the protein modification, they were introduced to a mammalian cell for translation. The proteins from both wild type and mutant fluoresced.

8a rep tRNA 21.6.06

WSSP 2006 UT2-9


Conclusions After transfection and incubation within the mammalian cell, the

mutated protein (4TAGGFP) fluoresced. We use 4TAGGFP as a result because the 37TAGGFP, as of this day, has not been transfected yet. The 37TAGGFP has not been tested as of yet. An alien invasion prevented immediate transfection of the produced plasmids. Do not

let this cute façade fool you, he is extremely sly and loves to create havoc. Of course, lab gnomes are just as likely to have delayed the process.

Figure 9 4TAGGFP in a mammalian cell

Future Work In the future, we would like to experiment with introducing L-dopa into other proteins. We would also want to try introducing other non-canonical amino acids into GFP at different sites. References 1. Weaver, Robert. Molecular Biology. 2nd ed. Boston: McGraw-Hill Co., 2002. 2. Zhang, Zhiwen, Brian A. C. Smith, Lei Wang, Ansgar Brock, Charles Cho, and Peter

G. Schultz. "A New Strategy for the Site-Specific Modification of Proteins in Vivo." Biochemistry 42(2003): 6735-6746.

3. Zhang, Zhiwen, Jeff Gildersleev, Yu-Ying Yang, Ran Xu, Joseph A. Loo, Sean Uryu,

and Chi-Huey Wong, Peter G. Schultz. "A New Strategy for the Synthesis of Glycoproteins." Science. 303(2004): 371-373.

4. Bloch, Kenneth D. and Barbara Grossmann. "Restriction Endonucleases."Current

Protocols in Molecular Biology. 2005. 5. "Translation (Genetics)." Biocrawler.com. 13 June 2005. 11 Jul 2006

<http://www.biocrawler.com/w/images/thumb/c/cf/300px-Translation-genetics.png>. 6. "Protein Synthesis." Access Excellence Resource Center. 13 June 2005. National

Health Museum. 11 Jul 2006 <http://www.accessexcellence.org/RC/VL/GG/protein_synthesis.html>.

WSSP 2006 UT2-10


Acknowledgements I would like to thank the Robert A. Welch Foundation for giving me this wonderful opportunity to do research as well as Dr. J.J. Lagowski and Reid Long for coordinating the program here the University of Texas in Austin. I would also like to thank Dr. Jonathan Zhang and the entire Zhang lab for allowing me to come in and work with them. Special thanks to Gabrielle Moreno for explaining everything to me over and over and over and over again and to Roshani Cowmeadow for all your help on my presentation and paper as well as for your wonderful drawings and explanations that accompanied them. To my awesome residential advisor, Srimoyee Ghosh, thank you for listening to me, for buying me food at HEB, and for taking care of me. And to the other, just-as-awesome RA, Vipal Durkal, thank you for walking really slow with me after basketball and for letting me watch Full House on your laptop. I would like to thank my family for not going to China without me and for their support. Daddy, thank you for helping me with my application essays; mommy, thank you for bringing me all the Chinese food. Daniel, thank you for relaying my messages to mom and dad. I’m sure you really missed your favorite sister. To Alex, thank you for showing me the turtle pond and for taking me out to eat. To my fellow Welch Scholars, I had such an awesome time with ya’ll. I will really miss this when we leave. To Jane, thank you for the use of your bed, blankets, room, and ramen- not so much for the leg art. To Tiffany, thank you for being there for me, for going to get another key with me, and for hanging out with me when I was bad company- again, not so much for the leg, and possibly face, art. To Elisha, thank you for coming to church with me, for keeping an eye out for me, and for trying to teach me Korean. Sa rang hae! I would also like to take this chance to thank Mrs. Bindlish for her wonderful nomination letter; Mr. Krebsbach, and Mrs. Dalton for their terrific recommendation letters. Thank you for giving me such wonderful recommendations—without them, I would not be here typing page after page after page. ☺ To Christy, Alisha, Karen, Mel, Kat, Nikolai, Rachel, Morgan, Ophelia, Neal, and anyone else I might not have space to add, thank you for taking care of me, for encouraging me, for listening to me, and for comforting me. I do not know what I would have done if I did not have ya’ll to talk to. Last but not least, to Ray, even though you are greatly missed, I know you’re having a much better time dancing with angels.

WSSP 2006 UT2-11

Introduction of a Non-canonical Amino Acid into GFP

Documents

Transcript of Introduction of a Non-canonical Amino Acid into GFP