Instructions for use · HYPOXIA ENHANCES THE EXPRESSION OF AUTOCRINE MOTILITY FACTOR AND THE...
Transcript of Instructions for use · HYPOXIA ENHANCES THE EXPRESSION OF AUTOCRINE MOTILITY FACTOR AND THE...
Instructions for use
Title Hypoxia enhances the expression of autocrine motility factor and the motility of human pancreatic cancer cells
Author(s) Niizeki, Hiroto; Kobayashi, Masanobu; Horiuchi, Iori; Akakura, Nobuaki; Chen, Jian; Wang, Jingxin; Hamada, Jun-ichi; Seth, Prem; Katoh, Hiroyuki; Watanabe, Hideomi; Raz, Avraham; Hosokawa, Masuo
Citation British Journal of Cancer, 86(12), 1914-1919https://doi.org/10.1038/sj.bjc.6600331
Issue Date 2002-06-17
Doc URL http://hdl.handle.net/2115/11317
Type article (author version)
File Information bjc.pdf
Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP
HYPOXIA ENHANCES THE EXPRESSION OF AUTOCRINE MOTILITY FACTOR
AND THE MOTILITY OF HUMAN PANCREATIC CANCER CELLS
Hiroto Niizeki 1, 2, Masanobu Kobayashi 1 *, Iori Horiuchi 1, Nobuaki
Akakura 1, 3, Jian Chen 1, 2, Jingxin Wang 1, Jun-ichi Hamada 4, Prem
Seth 5, Hiroyuki Katoh 2, Hideomi Watanabe 6, Avraham Raz 7, and
Masuo Hosokawa 1
1 Division of Cancer Pathobiology, 4 Division of Cancer-Related
Genes, 5 Division of Gene Therapy Development, Institute for
Genetic Medicine, Hokkaido University, Sapporo 060-0815, 2
Department of Surgical Oncology, 3 Department of
Gastroenterology and Hematology, Hokkaido University Graduate
School of Medicine, Department of Orthopedic Surgery, 6 Gunma
University, Maebashi, 7 Division of Basic Research, KARMANOS
Cancer institute, Wane State University school of Medicine,
Detroit, MI.
A running title: AMF expression promoted by hypoxia
* Correspondence to Dr. M Kobayashi, Division of Cancer
Pathobiology, Institute for Genetic Medicine, Hokkaido
University, Kita-15, Nishi-7, Kita-ku, Sapporo, 060-8638 Japan
Fax; 81-11-706-7826, Tel; 81-11-706-5070, e-mail;
1
Summary
The incidence of distant metastases is higher in the tumors
with low oxygen pressure than in those with high oxygen pressure.
It is well known that hypoxia induces the transcription of various
genes involved in angiogenesis and anaerobic metabolism
necessary for the growth of tumor cells in vivo, suggesting that
hypoxia may also induce the transcription of
metastasis-associated genes. We sought to identify the
metastasis-associated genes differentially expressed in tumor
cells under hypoxic conditions with the use of a DNA microarray
system. We found that hypoxia enhanced the expression of
autocrine motility factor (AMF) mRNA in various cancer cells
and also enhanced the random motility of pancreatic cancer cells.
AMF inhibitors abrogated the increase of motility under hypoxic
conditions. In order to explore the roles of hypoxia-inducible
factor-1α (HIF-1α), we established HIF-1α-transfectants and
dominant negative HIF-1α-transfectants. Transfection with
2
HIF-1α and dominant-negative HIF-1α enhanced and suppressed
the expression of AMF/PHI/NL mRNA and the random motility,
respectively. These results suggest that hypoxia may promote
the metastatic potential of cancer cells through the enhanced
AMF/PHI/NL mRNA expression and that the disruption of the HIF-1
pathway may be an effective treatment for metastasis.
Key words: hypoxia, AMF, motility, HIF-1, metastasis
3
INTRODUCTION
As metastasis is the major cause of death in cancer patients,
control of metastasis is most important in the therapies for
cancer patients. In order to control metastasis, we need to
understand the details of metastatic process that is now thought
to take multiple steps. Although a variety of factors have been
documented to play important roles in the metastatic steps (Poste
et al., 1980; Liotta, 1986; Liotta, 1988; Nicolson, 1988), many
factors are yet to be elucidated. Several clinical
investigations demonstrated that patients with hypoxic tumors
had poor prognoses and that the incidence of distant metastases
was higher in the tumors with low oxygen pressure than in those
with high oxygen pressure (Gatenby et al., 1988; Brizel et al.,
1996; Hockel et al., 1998; Rofstad, 2000). These studies suggest
that the tumor cells exposed to hypoxia at the primary tumor
sites acquire aggressive properties including metastatic
4
potential more than the well-oxygenated tumor cells do. In fact,
recent reports have demonstrated that hypoxia enhances the
expression of vascular endothelial growth factor (VEGF) and
interleukin-8 (IL-8) in tumor cells, resulting in an increase
of metastatic potential (Claffey et al., 1996; Shi et al., 1999;
Biroccio et al., 2000). However, it remains poorly understood
how hypoxia promotes tumor cells’ metastatic potential.
When tumor cells are exposed to hypoxia, hypoxia-inducible
factor-1 (HIF-1), which is a transcription factor composed of
HIF-1 α and HIF-1β subunits (Wang et al., 1995; Wang et al.,
1996), is activated and then it promotes the transcription of
several genes such as glucose transporters, glycolytic enzymes,
and angiogenic factors (Dang et al., 1999). A recent report
demonstrates that human common cancer cells over-express
hypoxia-inducible factor-1 α (HIF-1 α) in vivo and that the
expression of HIF-1 α is associated with metastasis (Zhong et
5
al., 1999). Furthermore, infiltration of endothelial cells,
which involves various factors, is enhanced when tumor tissues
are in hypoxia-induced angiogenesis. These reports have
prompted us to hypothesize that hypoxia may also promote the
invasion and metastasis of tumor cells by promoting the
expression of metastasis-associated genes in addition to
angiogenic factors through the activation of HIF-1α. As
hypovasculature is an outstanding characteristic of pancreatic
cancers with high invasiveness and metastatic potential
(Raijiman et al., 1995) and most of pancreatic cancer cells
over-express HIF-1α protein (Akakura et al., 2001), we speculate
that pancreatic cancer cells may be exposed to severe hypoxia
in vivo and that pancreatic cancers express higher levels of
metastasis-associated genes in addition to angiogenic factors
than well-oxygenated tumor cells do. Therefore we examined the
expression of more than 9,000 mRNAs in a pancreatic cancer cell
6
line under hypoxic and non-hypoxic conditions with the use of
a DNA microarray system and compared them to identify the
metastasis-associated genes induced by hypoxia.
We found that autocrine motility factor (AMF) / phosphohexose
isomerase (PHI) /neuroleukin (NL) mRNA was expressed more highly
in the cells under hypoxic conditions than under non-hypoxic
conditions. In this study, we examined the expression of
AMF/PHI/NL mRNA in a variety of cancer cell lines and the random
motility of a pancreatic cancer cell line under hypoxic and
non-hypoxic conditions, because AMF/PHI/NL was reported to
stimulate random motility (Liotta et al., 1986). Furthermore,
we established HIF-1α-transfectants and dominant-negative
HIF-1α-transfectants and examined their expression of
AMF/PHI/NL mRNA and random motility in order to determine the
possible role of HIF-1α in the AMF/PHI/NL mRNA expression and
random motility promoted by hypoxia.
7
MATERIALS AND METHODS
Cell lines:
Pancreatic ductal adenocarcinoma cell lines (PCI-6, PCI-10,
PCI-19, PCI-43 and PCI-66 cells) were established from surgically
resected pancreatic cancer tissues. These cell lines were
kindly supplied from Dr. Hiroshi Ishikura (The First Department
of Pathology, Hokkaido University School of Medicine) and
maintained in DMEM/F12 medium supplemented with 10 % fetal calf
serum (FCS). TAOV (ovarian cancer), TTOV (ovarian cancer),
HepG2 (hepatoma), PC-6 (lung cancer), MiaPaca-2 (pancreatic
cancer), BxPC-3 (pancreatic cancer) and KM-12 (colon cancer)
cells were maintained in DMEM medium supplemented with 10 % FCS.
DNA microarray analysis:
Total RNA was extracted with the use of TRIZOL Reagent (LIFE
TECHNOLOGIES, Tokyo, Japan) from the PCI-10 cells that had been
incubated for 24 h under non-hypoxic and hypoxic conditions.
8
The incubation under hypoxic condition (1 % O2) was done in a
hypoxic chamber gassed with 95 % N2 and 5 % CO2 (Wakenyaku Co.
Ltd., Tokyo). mRNA was purified from the total RNA with the
use of a Quickprep mRNA purification kit (Amersham Pharmacia
Biotech, Tokyo, Japan). Differentially expressed genes were
screened with the use of a DNA microarray system, UniGEM human
(KURABO INDUSTRIES LTD, Osaka, Japan). We defined the genes
expressed at more than 2-fold higher levels under hypoxic
conditions than under non-hypoxic conditions as possible
hypoxia-inducible genes in this study.
Establishment of HIF-1α-transfectants and dominant negative
HIF-1α-transfectants:
Establishment of HIF-1α-transfectants was previously
reported (Akakura et al., 2001). A cDNA for dominant negative
HIF-1α (dnHIF-1α) lacking both the DNA binding and
transactivation domains of HIF-1α was amplified from reverse
9
transcription (RT) products of mRNAs purified from the PCI-10
cells and cloned into PCR4-TOPO (Invitrogen, Carlsbad, CA). PCR
primers for dominant negative HIF-1α were selected as previously
described (Halterman et al., 1999) (forward,
ccgctcgagaccatgcgaaggaaagaatctg; reverse,
ggggtacctcatttgtcaaagaggctact). Plasmids were recovered,
purified and sequenced with a DyeDeoxy Terminator kit
(Perkin-Elmer, Urayasu, Japan) on an ABI 377 automated sequencer
(Applied Biosystems, Urayasu, Japan) in the condition described
in the manufacturer’s protocol. Cloned fragments were
recovered from the vectors and ligated into PcDNA3.1+ (Invitrogen,
Carlsbad, CA). PCI-43 cells were transfected with the
expression vector for dnHIF-1α with the use of Lipofectamine
(Life Technologies, Tokyo, Japan). Transfectants were cloned
by a limiting dilution method after the selection with G-418
at 800 µg/ml. The transfectants were maintained in the presence
10
of 400 µg/ml of G-418.
FACS analysis:
Cells were stained with anti-AMFR antibody (rat monoclonal
antibody, IgM) (Niinaka et al., 1998) for 1 h and then stained
with second anti-rat Ig antibody for 1 h. Expression of AMFR
proteins was quantified with the use of FACScaliber (Becton
Dickinson, Mountain View, CA).
Northern blot analysis:
Northern blot analysis was performed by the method described
previously (Choi et al., 2000). Total RNA (20 µg) was separated
by electrophoresis in 1.2 % denaturing formaldehyde-agarose gels.
The RNA was transferred to nylon membrane (Hybond N+, Amersham)
overnight by capillary elution and UV cross-linked. After
prehybridization of the blots for 1-2 hr at 42 ̊ C in hybridization
buffer (5XSSPE, 5Xdenhardt’s solution, 1% SDS, 50% Formamide
and 0.1 mg/ml of denatured salmon sperm DNA), the membrane was
hybridized overnight at 42 ̊ C with the cDNA probes for AMF and
11
AMF receptor (AMFR). The probed membrane was then washed and
exposed to radiographic film. cDNA fragments for AMF and AMF
receptor (AMFR) were amplified by RT-PCR, cloned into a TA cloning
vector, purified from the vector and then used as probes for
Northern blot analysis. PCR primers were as follows: AMF forward,
gcttgaccctcaacaccaac; reverse, gaagtgctggtccatccagt; AMFR
forward, caggaggaagtgagccagtc; reverse, agcttgctgcctaaccactc.
Phagokinetic track assay:
Phagokinetic track assay was performed according to the
method reported by Albrecht-Buehler (Albrecht-Buehler et al.,
1977). Briefly, gold particle suspension was prepared by mixing
18 µl of 14.5 mM AuCl4 solution and 5 ml of 36.5 mM Na2CO3 solution
with 11 ml double-distilled water followed by heating to boiling
point and adding 1.8 ml of 0.1 % formaldehyde. Two ml of gold
particle suspension was laid on the 18 X 18 mm-square glass
coverslips coated with 0.1 % bovine serum albumin. The
12
particle-coated coverslips were placed in 35 mm plastic dishes
containing DMEM/F-12 medium supplemented with 5 % FCS. Cells
were seeded in the dishes and incubated for 24 h. After
incubation, the coverslips were removed and fixed in 10%
formaldehyde solution for 30 min and mounted on microscope slides.
Phagokinetic track areas of more than 20 cells that were randomly
selected were observed with the use of a microscope analyzer
(Cosmo zone R500, Nikon, Japan). The experiments were done under
hypoxic (1% O2/5 % CO2) and non-hypoxic conditions (20 % O2/5 %
CO2). In some experiments, supernatant of the pancreatic cancer
cells PCI-10 cultured in hypoxia was added in the dishes at 0,
12.5, 25, 50, and 100 %. PHI inhibitors described in the previous
report (Watanabe et al., 1996), erythrose 4-phosphate (E4P) and
6-phosphogluconic acid (6PGA) (Sigma) were added into the dishes
at 10, 100, and 1000 µM.
Statistical analysis:
Statistical analysis was done by the Mann-Whitney test.
13
RESULTS
Differentially expressed genes under hypoxic conditions:
We defined the genes expressed at more than 2-fold higher
levels under hypoxic conditions than under non-hypoxic
conditions as possible hypoxia-induced genes, which numbered
38. As expected, mRNAs for glycolytic enzymes and angiogenic
factors were expressed at higher levels under hypoxic conditions
than under non-hypoxic conditions. In the glycolytic enzymes,
we found that phosphohexose isomerase (PHI) mRNA was expressed
at a 2-fold higher level under hypoxic conditions than under
non-hypoxic conditions. A recent report has demonstrated that
AMF, which was originally identified as a molecule stimulating
directional motility (chemotaxis) and random motility
(chemokinesis) of melanoma cells (Liotta et al., 1986), was
identical to PHI/NL (Watanabe et al, 1996). As AMF/PHI/NL
secreted by tumor cells acts as a chemokinetic factor (random
motility-stimulating factor) in an autocrine fashion, we focused
14
on this molecule that could promote the metastatic potential
under hypoxic conditions.
Expressions of AMF/PHI/NL and AMFR in a variety of cancer cells:
We then examined the expression of AMF/PHI/NL mRNA in several
cancer cell lines, including PCI-10 cells used in the DNA
microarray analysis, before and after exposure to hypoxia in
order to define whether the enhanced expression of AMF/PHI/NL
mRNA in hypoxia was common in a variety of cancer cells. Fig.
1A shows the expression of AMF/PHI/NL mRNA in the pancreatic
cancer cell lines (PCI-6, PCI-10, PCI-19, PCI-43, PCI-66,
MiaPaca-2, and BxPC-3), colon cancer cell line (KM-12), lung
cancer cell line (PC-6), hepatoma cell line (HepG2) and ovarian
cancer cell lines (TAOV and TTOV). All the cell lines expressed
AMF/PHI/NL mRNA at higher levels under hypoxic conditions than
under non-hypoxic conditions, indicating that the increased
expression of AMF/PHI/NL mRNA under hypoxic conditions was common
in a variety of cancer cells. Next we examined the expression
15
of AMFR. All the cell lines examined, especially PCI-10 cells
used for the examination of motility, expressed AMFR mRNA and
protein (Fig. 1B and 1C), suggesting that the AMF/PHI/NL could
stimulate the random motility of the cells in an autocrine
fashion.
Expression of AMF/PHI/NL mRNA in HIF-1α-transfectants and
dominant-negative HIF-1α-transfectants:
Fig. 2A shows the expression of AMF/PHI/NL mRNA in the
HIF-1 α-transfectants and the vector-transfectant under
non-hypoxic conditions. The expression of AMF/PHI/NL mRNA was
higher in the HIF-1 α-transfectants than in the
vector-transfectant. Fig. 2B shows the expression of
dominant-negative HIF-1α (dnHIF-1α) mRNA. The
dnHIF-1α-transfectants but not the vector-transfectant
expressed the truncated dnHIF-1α mRNA in addition to the
endogenous HIF-1α mRNA. Expression of AMF/PHI/NL mRNA was
16
enhanced after exposure to hypoxia in the vector-transfectant
and the parent cells but not in the dnHIF-1α-transfectants (Fig.
2C). These results suggested that hypoxia might enhance the
expression of AMF/PHI/NL mRNA through the activation of HIF-1.
Random motility:
As shown in Fig. 3A, the random motility of PCI-10 cells
increased under hypoxic conditions by more than 4-fold compared
with that under non-hypoxic conditions. Furthermore, the
random motility of the HIF-1 α-transfectants under non-hypoxic
conditions was higher than that of the vector-transfectant (Fig.
3B). Fig. 3C shows the random motility of the
dnHIF-1α-transfectants under hypoxic and non-hypoxic
conditions. The random motility of the vector-transfectant but
not of the dnHIF-1α-transfectants was enhanced under hypoxic
conditions. These results in combination with the changes in
the AMF/PHI/NL mRNA expression suggested that the random motility
was closely correlated with the levels of AMF/PHI/NL mRNA
17
expression.
Next, as AMF/PHI/NL has been reported to act in an
autocrine fashion, we examined the effects of supernatant of
PCI-10 cells cultured under hypoxic conditions on their motility.
Fig. 3D shows that the supernatant enhanced the random motility
of PCI-10 cells under non-hypoxic conditions in a dose-dependent
manner, indicating that the random motility-stimulating
activity in the supernatant stimulated it in an autocrine fashion.
In order to determine whether the presumed random
motility-stimulating factor in the supernatant was identical
to AMF/PHI/NL, we examined the effects of two carbohydrate
phosphates, 6-phosphogluconic acid (6PGA) and erythrose
4-phosphate (E4P), which have been reported to inhibit the PHI
enzymatic activity and the AMF-induced cell motility (Watanabe
et al., 1996). Fig. 3D shows that 6PGA and E4P almost completely
abrogated the motility-stimulating activity of the supernatant.
18
Figure 3E shows that 6PGA and E4P directly reduced the random
motility of PCI-10 cells enhanced under hypoxic conditions.
19
DISCUSSION
A number of reports have demonstrated that the probability
of distant metastases correlates with oxygen pressure in the
tumor tissues (Gatenby et al., 1988; Brizel et al., 1996; Hockel
et al., 1998; Rofstad, 2000), suggesting that hypoxia may promote
metastatic potential. However, it remains poorly understood
how hypoxia promotes the metastatic potential of tumor cells.
In this study, we clearly demonstrated that hypoxia enhanced
the AMF/PHI/NL mRNA expression in a variety of cancer cells and
it also enhanced the random motility in an autocrine fashion.
In accordance with our results, a recent report demonstrated
that AMF/PHI/NL was identified as a hypoxia-inducible gene by
a representational difference analysis using mRNA extracted from
hypoxic and normoxic Capan-2, a human pancreatic cancer cell
line (Yoon et al., 2001). However, it was not determined whether
the enhanced expression of AMF/PHI/NL resulted in the enhanced
20
motility. As hypoxia is frequently observed in tumor tissues
in vivo (Guillemin et al., 1997; Blancher et al., 1998), we
suspected that AMF/PHI/NL might be expressed in various cancer
cells in vivo. In accordance with this speculation, previous
reports demonstrated that the expression of AMF/PHI/NL was found
in human colorectal, bladder, esophageal, and gastric cancers
and that the expression of AMF/PHI/NL correlated with the disease
progression (Watanabe et al., 1991; Nabi et al., 1992).
Furthermore, we found that AMF/PHI/NL was expressed also in the
tumor cells of human pancreatic cancers in vivo (data not shown).
Recently we have reported that most of pancreatic cancer cells,
which are known to show high invasiveness and high metastatic
potential in vivo, over-expressed HIF-1α proteins
constitutively (Akakura et al., 2001). Those results in
combination with the findings demonstrated in this study suggest
that high expression of AMF/PHI/NL may be attributable to the
21
high invasiveness and high metastatic potential of pancreatic
cancers.
It is well-known that metastasis requires coordinated
activation of various factors involved in proliferation,
motility, cell-to-cell and cell-to-substrate contacts,
degradation of extracellular matrix, inhibition of apoptosis,
and adaptation to an inappropriate tissue environment (Poste
et al., 1980; Liotta et al., 1986). Our DNA microarray study
showed that mRNA expressions of various angiogenic factors and
glycolytic enzymes were enhanced in hypoxia in accordance with
the previous reports (Vaupel et al., 1989; Semenza, 2000).
Increased expression of angiogenic factors under hypoxic
conditions enhances the angiogenesis that supports the survival
and growth of tumor cells in the metastatic sites as well as
in the primary sites (Claffey et al., 1996; Rofstad et al., 1999).
Likewise increased expression of glycolytic enzymes supports
22
the survival and growth of tumor cells under hypoxic conditions
(Malhotra et al., 1999). Accordingly, these angiogenic factors
and glycolytic enzymes induced by hypoxia could enhance the
metastasis in cooperation with AMF/PHI/NL. Namely, hypoxia
promotes the infiltration of endothelial cells into tumor tissues
in its inducing angiogenesis; the hypoxia may also induce the
activation of various factors other than angiogenic factors and
AMF/PHI/NL in cancer cells. We now search the possible
metastasis-associated genes, which should have
hypoxia-responsive elements (HRE) in the promoter region.
All together, our present results provide a new insight into
the mechanisms and a possible means for control of metastasis.
We now propose that the enhancement of metastatic potential may
be one of hypoxic responses of tumor cells exposed to hypoxia.
The findings of dominant-negative HIF-1α-transfectants suggest
that the disruption of the HIF-1 pathway may be an effective
23
treatment for metastasis, in addition to the treatment of primary
tumors through the inhibition of various genes necessary for
the growth and metastasis of tumor cells in vivo, in accordance
with the previous report (Kung et al., 2000).
24
ACKNOWLEDGEMENTS
We appreciate Dr. Hiroshi Ishikura (The First Department
of Pathology, Hokkaido University School of Medicine) for
providing us with a pancreatic cancer cell line. We thank Ms.
M. Yanome for assistance in preparing the manuscript.
25
REFERENCES
Akakura N, Kobayashi M, Horiuchi I, Suzuki A, Wang J, Chen J,
Niizeki H, Kawamura K, Hosokawa M, and Asaka M (2001)
Constitutive expression of hypoxia-inducible factor-1α
(HIF-1α) renders pancreatic cancer cells resistant to
apoptosis induced by hypoxia and nutrient deprivation. Cancer
Res., 61:6548-6554.
Albrecht-Buehler G (1977) Phagokinetic tracks of 3T3 cells:
parallels between the orientation of track segments and of
cellular structures which contain actin or tubulin. Cell,
11:395-404.
Biroccio A, Candiloro A, Mottolese M, Sapora O, Albini A, Zupi
G, and Del Bufalo D (2000) Bcl-2 overexpression and hypoxia
synergistically act to modulate vascular endothelial growth
factor expression and in vivo angiogenesis in a breast
carcinoma line. FASEB J, 14:652-660.
26
Blancher C and Harris AL (1998) The molecular basis of the hypoxia
response pathway: tumour hypoxia as a therapy target. Cancer
and Metastasis Rev, 17:187-194.
Brizel DM, Scully SP, Harrelson JM, Layfield LJ, Bean JM, Pronitz
LR, Samulski TV, Prosnitz LR, and Dewhirst MW (1996) Tumor
oxygenation predicts for the likelihood of distant metastases
in human soft tissue sarcoma. Cancer Res, 56:941-943.
Choi S, Kobayashi M, Wang J, Habellhah H, Okada F, Hamada J,
Moriuchi T, Totsuka Y, and Hosokawa M (2000) Activated
leukocyte cell adhesion molecule (ALCAM) and annexin II are
involved in the metastatic progression of tumor cells after
chemotherapy with adriamycin. Clin. Exp. Metastasis, 18:
45-50.
Claffey KP, Brown LF, del Aguila LF, Tognazzi K, Yeo KT, Manseau
EJ, Dvorak HF (1996) Expression of vascular permeability
factor/vascular endothelial growth factor by melanoma cells
27
increases tumor growth, angiogenesis, and experimental
metastasis. Cancer Res. 56: 172-181.
Claffey KP and Robinson GS (1996) Regulation of VEGF/VPF
expression in tumor cells: consequences for tumor growth and
metastasis. Cancer Metastasis Rev, 15:165-176.
Dang CV, and Semenza GL (1999) Oncogenic alterations of
metabolism. Trends Biochem Sci, 24:68-72.
Gatenby RA, Kessler HB, Rosenblum J, Coia LR, Moldofsky PJ, Hartz
WH, and Broder GJ (1988) Oxygen distribution in squamous cell
carcinoma metastases and its relationship to outcome of
radiation therapy. Int J Radiat Oncol Biol Phys, 14:831-838.
Guillemin K and Krasnow MA (1997) The hypoxic response: huffing
and HIFing. Cell, 89:9-12.
Halterman MW, Miller CC, and Federoff HJ (1999) Hypoxia-inducible
factor-1alpha mediates hypoxia-induced delayed neuronal
death that involves p53. J Neurosci. 19:6818-6824.
28
Hockel M, Schlenger K, Hockel S, Aral B, Schaffer U, and Vaupel
P (1998) Tumor hypoxia in pelvic recurrences of cervical cancer.
Int J Cancer, 79:365-369.
Kung AL, Wang S, Klco JM, Kaelin WG, and Livingston DM. (2000)
Suppression of tumor growth through disruption of
hypoxia-inducible transcription. Nat Med, 6:1335-1340.
Liotta LA (1986) Tumor invasion and metastases--role of the
extracellular matrix: Rhoads Memorial Award lecture. Cancer
Res, 46:1-7.
Liotta LA, Mandler R, Murano G, Katz DA, Gordon RK, Chiang PK,
and Schiffmann E (1986) Tumor cell autocrine motility factor.
Proc. Natl. Acad. Sc. USA, 83:3302-3306.
Liotta LA (1988) Gene products which play a role in cancer invasion
and metastasis. Breast Cancer Res, 11:113-124.
Malhotra, R. and Brosius, F.C.3rd. (1999) Glucose uptake and
glycolysis reduce hypoxia-induced apoptosis in cultured
29
neonatal rat cardiac myocytes. J Biol Chem, 274:12567-17575.
Nabi IR, Watabnabe H and Raz A (1992) Autocrine motility factor
and its receptor: role in cell locomotion and metastasis.
Cancer Metastasis Rev, 11:5-20.
Nicolson GL (1988) Cancer metastasis: tumor cell and host organ
properties important in metastasis to specific secondary sites.
Biochem Biophys Acta, 948:175-224.
Niinaka Y, Paku S, Haga A, Watanabe H, Raz A (1998) Expression
and secretion of neuroleukin/phosphohexose
isomerase/maturation factor as autocrine motility factor by
tumor cells. Cancer Res, 1998 58:2667-2674
Poste G and Fidler IJ (1980) The pathogenesis of cancer metastasis.
Nature, 283:139-146.
Raijiman I and Levin B (1995) Bockus Gastroenterology 5th edn.
Haubrich WS and Schaffner F (ed). WB Saunders Company: Tokyo,
Pp. 2984-3001.
30
Rofstad EK, Danielsen T. (1999) Hypoxia-induced metastasis of
human melanoma cells: involvement of vascular endothelial
growth factor-mediated angiogenesis. Br J Cancer,
80:1697-707.
Rofstad EK (2000) Microenvironment-induced cancer metastasis.
Int J Radiat Biol, 76:589-605.
Semenza GL (2000) Expression of hypoxia-inducible factor 1:
mechanisms and consequences. Biochem Pharmacol, 59:47-53.
Shi Q, Abbruzzese JL, Huang S, Fidler IJ, Xiong Q and Xie K (1999)
Constitutive and inducible interleukin 8 expression by hypoxia
and acidosis renders human pancreatic cancer cells more
tumorigenic and metastatic. Clin Cancer Res, 5:3711-3721.
Vaupel P, Kallinowski F and Okunieff P (1989) Blood flow, oxygen
and nutrient supply, and metabolic microenvironment of human
tumors: a review. Cancer Res, 49:6449-6465.
Wang GL, Jiang BH, Rue EA, and Semenza GL (1995) Hypoxia-inducible
31
factor 1 is a basic-helix-loop-helix-PAS heterodimer
regulated by cellular O2 tension. Proc. Natl. Acad. Sci. USA,
92:5510-5514.
Wang GL and Semenza GL (1996) Molecular basis of hypoxia-induced
erythropoietin expression. Curr Opin Hematol, 3:156-162.
Watanabe H, Nabi IR and Raz A (1991) The relationship between
motility factor receptor internalization and the lung
colonization capacity of murine melanoma cells. Cancer Res,
51:2699-2705.
Watanabe H, Takehana K, Date M, Shinozaki T and Raz A (1996)
Tumor cell autocrine motility factor is the
neuroleukin/phosphohexose isomerase polypeptide. Cancer Res,
56:2960-2963.
Yoon DY, Buchler P, Saarikoski ST, Hines OJ, Reber HA, Hankinson
O. (2001) Identification of genes differentially induced by
hypoxia in pancreatic cancer cells. Biochem Biophys Res Commun
32
288:882-6.
Zhong H, Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D, Buechler
P, Isaacs WB, Semenza GL, and Simons JW (1999) Overexpression
of hypoxia-inducible factor 1alpha in common human cancers
and their metastases. Cancer Res, 59:5830-5835.
33
Figure Legends
Figure 1. Expression of AMF/PHI/NL and AMFR mRNAs.
A: AMF/PHI/NL mRNA expression. RNAs were extracted from the
cells incubated under non-hypoxic (N) and hypoxic (H) conditions
(20 % and 1 %, respectively) for 24 h and then Northern blot
analysis was performed. B: AMFR mRNA expression. RNAs were
extracted from the cells incubated under non-hypoxic (N) for
24 h and then Northern blot analysis was performed. A
representative result of two different experiments is shown.
C: FACS analysis of AMFR expression. Cells were stained with
anti-AMFR antibody (rat monoclonal antibody, IgM) for 1 h and
then stained with second anti-rat Ig antibody for 1 h. A
representative result of two different experiments is shown.
Figure 2. Expression of AMF/PHI/NL mRNA in the transfectants:
A: Northern blot analysis of AMF/PHI/NL mRNA in the
34
HIF-1α-transfectants (PCI-10/H2 and PCI-10/H3) and
vector-transfectant (PCI-10/V2) under non-hypoxic conditions.
AMF/PHI/NL mRNA expression in PCI-10 cells under non-hypoxic
(N) and hypoxic (H) conditions were shown as controls. B:
Northern blot analysis of dominant negative HIF-1α (dnHIF-1α)
mRNA in the transfectants. C: Northern blot analysis of
AMF/PHI/NL mRNA expression in the dnHIF-1α -transfectants
(PCI-43/dnH3 and PCI-43/dnH7) and the vector-transfectant
(PCI-43/vV3) under non-hypoxic (N) and hypoxic (H) conditions.
RNAs were extracted from the cells incubated under non-hypoxic
(N) and hypoxic (H) conditions for 24 h and then Northern blot
analysis was performed.
Figure 3. Random motility:
Data present the mean ± SD of three different experiments. A:
Random motility of the PCI-10 cells under hypoxic and normoxic
35
conditions. *P<0.01; significantly different compared with the
relative motility of the PCI-10 cells under normoxic conditions.
B: Random motility of the HIF-1α-transfectants under non-hypoxic
conditions. *P<0.01; significantly different compared with the
vector control. C: Random motility of the
dnHIF-1α-transfectants and the vector-transfectant under
hypoxic and non-hypoxic conditions. *P<0.05; significantly
different compared with the relative motility of the PCI-43 cells
under normoxic conditions. D: Random motility of PCI-10 cells
under normoxic conditions in the presence or absence of the
supernatant of PCI-10 cells cultured under hypoxic conditions.
*P<0.01, **P<0.05; significantly different compared with the
relative motility of PCI-10 cells under normoxic conditions in
the absence of supernatant. †P<0.05; significantly different
compared with the relative motility of PCI-10 cells in the
presence of 100 % supernatant. E: Random motility of the PCI-10
36
cells under hypoxic conditions in the presence of
AMF/PHI-inhibitors. *P<0.01; significantly different
compared with the relative motility of PCI-10 cells under
normoxic conditions. † P<0.01; significantly different
compared with the relative motility of PCI-10 cells under
normoxic conditions in the absence of inhibitor.
37
N HPC-6
N HPCI-10 KM-12
N H N HTAOVTTOVN HN H
PCI-43N HHepG2
AMF
18S
N HPCI-66 MiaPaCa-2
N HBxPC-3PCI-19
N HN HPCI-6
N HAMF
18S
AMFPCI-10/V2
PCI-10/H2
PCI-10/H3
N HPCI-10
18S
18s
HIF-1αdnHIF-1α
PCI-43/dnH3
PCI-43/dnH7
PCI-43/dnH10
PCI-43/V3
N HPCI-43/V3
N HPCI-43/dnH3
N HPCI-43/dnH7
AMF
18S
TAOVTTOV
KM-12PCI-1
0
PC-6
AMF-RPCI-4
3
HepG2
18S